Inhibitory effect of esterified lactoferin and lactoferin against tobacco mosaic virus (TMV) in tobacco seedlings

Pesticide Biochemistry and Physiology 105 (2013) 62–68

Contents lists available at SciVerse ScienceDirect

Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest

Inhibitory effect of esterified lactoferin and lactoferin against tobacco mosaic virus (TMV) in tobacco seedlings Jie Wang a, Hong-Yan Wang b, Xiao-Ming Xia a, Peng-peng Li a, Kai-Yun Wang a,⇑ a b

Department of Plant Protection, Shandong Agricultural University, Tai’an, Shandong 271018, PR China Cotton Research Center, Shandong Academy of Agricultural Sciences, Jinan, Shandong 250100, PR China

a r t i c l e

i n f o

Article history: Received 14 October 2012 Accepted 29 November 2012 Available online 7 December 2012 Keywords: Esterified lactoferrin Elicitor Induced resistance Tobacco mosaic virus Tobacco seedlings

a b s t r a c t The inhibitory effects of esterified lactoferrin (ELF) and lactoferrin (LF) against tobacco mosaic virus (TMV) in tobacco seedlings and the underlying mechanism were investigated. ELF and LF significantly inhibited viral infection and TMV multiplication in tobacco plants. ELF showed a higher inhibition effect against TMV than LF treatment in a dose and time-dependent way. Moreover, ELF induced a higher increase in the levels of transcription of pathogenesis-related (PR) protein genes [acidic PRs (PR-1a, PR-2, PR-3, PR-5) and basic PR-1] and defense-related enzymes [phenylalanine ammonia lyase (PAL, EC 4.3.1.5), and 5-epi-aristolochene synthase (EAS, EC 2.5.1.35)] both locally and systemically, in correlation with the induction of resistance against tobacco mosaic virus. Furthermore, ELF also induced accumulation of salicylic acid, SA 2-O-b-D-glucoside and H2O2. These results suggested that ELF and LF could control TMV incidence and the mechanism might attribute to activate the expression of a number of defense genes. Ó 2012 Elsevier Inc. All rights reserved.

1. Introduction Lactoferrin, an 80 kDa iron binding glycoprotein, binds to the membranes of various bacteria and fungi, causing damage to membranes and loss of cytoplasmic fluids [1]. In addition to antifungal and antibacterial activity, as one of components of milk and whey, lactoferrin can also inhibit viral infections of both naked and enveloped viruses, and the activity is primarily exerted during an early phase of the viral infection [2]. However, research has focused largely on Gram-negative bacteria and other species primarily involved in food spoilage, and on fungi and virus related to human health [1,3]. Although lactoferrin exhibited an inhibition of tomato yellow leaf curl virus [4], investigation on the ability of lactoferrin to control tobacco mosaic virus (TMV) appears limited. In spite of its high biological properties, native lactoferrin is not hydrolyzed easily by means of digestion enzymes as pepsin and trypsin, due to disulfide bonds in the protein molecules. The poor digestibility of whey proteins is considered the reason for their allergenicity [5]. Therefore, modification of lactoferrin to enhance or alter its biological and functional properties may increase its applications, which can be accomplished by chemical, enzymatic, or physical techniques [6].

⇑ Corresponding author. Address: Department of Plant Protection, Shandong Agricultural University, 61 Daizong Street, Tai’an, Shandong 271018, PR China. E-mail addresses: [email protected], [email protected] (K.-Y. Wang). 0048-3575/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.pestbp.2012.11.009

Esterified whey protein fractions (EWPF) have been very common in the study of biological activity of whey protein, where routes of esterification have been very well established [7]. Moreover, many studies reported that increasing the net positive charge on whey proteins through esterification led to enhancement of its antiviral activity against poliovirus type-1, Coxsackie virus B6, human cytomegalovirus, Herpes simplex virus type 1 and human influenza virus A subtype H3N2, H1N1 and subtype H5N1 [7–11]. However, the systemic esterified lactoferrin (ELF) responses and the underlying mechanism of the ELF-mediated disease resistance against TMV have not been elucidated. Therefore, we used biochemical and molecular approaches to investigate the potential of ELF and its possible mechanisms in controlling TMV in tobacco seedlings. 2. Materials and methods 2.1. Preparation of esterified lactoferrin Esterified lactoferrin (ELF) was prepared according to the methods of Sitohy et al. [6] using 99.5% methyl alcohol, at 4 °C for 10 h. The color reaction using hydroxylamine hydrochloride was used according to Bertrand-Harb et al. [5] to quantify the extent of esterification of lactoferrin. The extent of modified lactoferrin was 100%. The observed extent of such esterification is in accordance with the study of Sitohy et al. [8]. Both LF and ELF were dissolved in distilled water at 1 mg/mL, and then diluted to a series of 25, 50, 75 and

J. Wang et al. / Pesticide Biochemistry and Physiology 105 (2013) 62–68

100 lg/mL. Lactoferrin (95% protein, LF) was obtained from commercial sources (Sigma–Aldrich, St. Louis, MO, USA). All other chemicals used in this study were of analytical grade. 2.2. Plant culture and treatments Tobacco plants (Nicotiana tabacum var. sam sun NN) were grown from seeds in a greenhouse and were used at the 6-leaf stage after 2 months in culture. The plants were kept in a growth chamber at 23 ± 1 °C with light/dark period of 16 h/8 h and 70– 80% relative humidity for several days before treatments. Tobacco mosaic virus (TMV) that came from our collection was multiplied in N. tabacum. TMV was extracted from infected leaves of systemically infected plants by homogenization in 0.05 M H3PO4 buffer (0.05 M KH2PO4, 0.05 M Na2HPO4 pH 5.5) with subsequent clarification of the extract by centrifugation at 2000g for 6 min. The supernatant extract was used for mechanical inoculation. The bioactivity assay for protection and inactivation and cure effect was assessed according to the method described by Wang et al. [12]. For the inactivation assay by half-leaf method, leaves of N. tabacum were split into two halves of left and right from the midrib with scissors and kept in wet absorbent paper in porcelaneous dishes before use. ELF and LF (25, 50, 75 and 100 lg/mL), the blank control, and Ningnanmycin (500 lg/mL, reference agent) were mixed with an equal volume of TMV solution (10.19 lg/mL final concentration), and left standing for 30 min and mechanically inoculate the left half leaves of. N. tabacum, whereas the right halves were treated with the blank control and TMV solution containing the same solvent as a control, using 500-mesh carborundum as abrasive. After inoculation, leaves were washed immediately with distilled water. The number of local lesion was recorded 3–4 days after inoculation. The inhibition level of viral infection was recorded and calculated according to the formula:

inhibition rate ð%Þ ¼ ð1  T=CÞ  100 where T is the average mean lesion number of treated half-leaves and C is the average lesion number of the control halves. For the protection assay, leaves of N. tabacum were sprayed with ELF and LF at different concentrations, respectively, and the control plants were sprayed with water and Ningnanmycin (500 lg/mL). At 48 h after ELF and LF application, plants were inoculated mechanically with TMV. The inoculated plants were maintained at 25 ± 2 °C under cool-white fluorescent lamps. The disease index was investigated according to Zhao et al. [13] at 5 d after inoculation. For the detection of effects of ELF or LF on TMV multiplication, the tobacco leaves were sprayed with ELF and LF (100 lg/mL), respectively. At 48 h after LF or ELF treatment, the leaves were inoculated with TMV. One-gram leaves inoculated with TMV were collected at 8, 12 and 24 h after inoculation. The fold changes in TMV coat protein (TMV-CP) gene expression using RTqPCR were determined. For the cure assay by leaf-discolor method, the TMV suspension of 10.19 lg/mL was inoculated on leaves of N. tabacum. Growing leaves of N. tabacum were mechanically inoculated with TMV (10.19 lg/mL). After 6 h, 12-mm diameter leaf disks that were smooth and thin and without major veins were cut from the leaf surface. The leaf disks were floated on the solution of each sample and then incubated at 25 ± 2 °C for 48 h. The disks were treated with solvent only as the positive control, while disks of healthy leaves were used as the negative control. After 48 h, leaf disks were ground in coating buffer, and their viral concentration was assessed by ELISA. Indirect ELISA was mainly performed as described by Zhou et al. [14]. The inhibition rate of viral replication was calculated according to the formula: inhibition rate (%) = (1C/C0)  100

63

where C is the viral concentration in the treated leaf disks and C0 is the viral concentration in the positive control [15]. TMV concentration was calculated by the standard curve with the A405 value of TMV at concentrations of 8, 4, 2, 1, 0.5, 0.25 and 0.125 lg/mL. All assays were performed in triplicate with at least five tobacco seedlings per replicate. To determine the effects of ELF and LF on the amounts of H2O2, SA and SA 2-O-b-D-glucoside (SAG) and the transcript levels of defense related genes in tobacco seedlings, tobacco seedlings were sprayed with 75 lg/mL ELF or LF, until drops began to fall from the leaves. At various times after the treatment, leaf samples were collected, and aliquots normalized by their fresh weight (approximately 1 g) were taken from the treated leaves, and the first upper untreated leaf. The leaves were immediately frozen in liquid nitrogen and stored at 80 °C. 2.3. H2O2 measurements H2O2 was measured according to the method of Mukherjee and Choudhuri [16], with some modifications. One gram of fresh leaf tissue was homogenized with 5 mL ice-cold acetone and centrifuged at 10,000g for 10 min at 4 °C. Then 1 mL of the supernatant was added to 0.1 mL 20% TrisCl4–HCl solution and 0.2 mL ammonia solution and then centrifuged at 10,000g for 10 min. The residue was washed five times with acetone and then dissolved in 3 mL 1 M H2SO4. The absorbance was measured at 410 nm. The same protocol was used to make a standard curve for H2O2 and this was used to calculate the amount of H2O2. Each treatment had three replicates with at least five tobacco seedlings per replicate. 2.4. SA and SAG measurements The amounts of SA and SAG extracted from tobacco leaves were measured by HPLC according to the method described by Verberne et al. [17]. HPLC analysis of SA was performed using an ATvp HPLC (Shimadzu, Japan) with a chromatographic column (Hypersil ODS (C18), 5 mm, 250  4.6 mm). The eluent was 0.2 M sodium acetate buffer pH 5.5 (90%) with methanol (10%) at a flow rate of 0.8 mL/ min. The column temperature was 40 °C. The RF-10Az spectrofluorometric detector operated at an emission wavelength of 407 nm and an excitation wavelength of 305 nm. Each treatment contained three replicates with at least five tobacco seedlings per replicate. 2.5. RNA isolation Total RNA was extracted by Trizol Reagent (Invitrogen, USA) according to manufacturer’s instruction. Isolated RNA was dissolved in 20 lL of RNase free H2O, quantified by spectrophotometry and stored at 80 °C. 2.6. Real-time quantitative PCR (RT-qPCR) For RT experiments 0.5 lg of total RNA was used for reverse transcription. The reaction was performed using an RT-PCR kit (TOYOBO, Japan) according to the manufacturer’s instruction. The relative level of transcripts coding for TMV-CP, PR-1a, Basic PR-1, PR-2, PR-3, PR-5, PAL, and EAS was determined using EF-1a as internal control. The reaction mixture was incubated for 20 min at 42 °C and terminated by 99 °C for 5 min. The specific genes were amplified using gene specific primers designed from coding sequences of each gene using Primer Express 2.0 software (Applied Biosystems, United States) (Table 1). RT-qPCR using the PTC-200 Real-Time PCR system and SYBR Green Master mix (BIO-RAD, United States) was performed using primers at a final concentration of 0.25 mM each and 2 mL of cDNA as template in a 25 mL reaction. PCR-cycling conditions comprised an initial polymerase

64

J. Wang et al. / Pesticide Biochemistry and Physiology 105 (2013) 62–68

Table 1 Groups of real-time quantitative PCR (RT-qPCR) primers used to amplify genespecific regions. Gene name

GeneBank acc. no.

Primer (50 –30 )

PR-1a

X12737

Basic PR-1

X14065

PR-2

M60460

PR-3

X51425

PR-5

AY745249

PAL

D17467

EAS

L04680

TMV-CP

EF183504

EF-1a

D63396

Forward: CCTCGTACATTCTCATGGTCAAT Reverse: CCATTGTTACACTGAACCCTAGC Forward: GTTGCTTGTTTCATTACCTTTGC Reverse: TTCTCATCGACCCACATTTTTAC Forward: CGGAAATAATGGTCAATATGCAC Reverse: CGAAAAATACTATCTTTGGGCGG Forward: TGTTTTGTTGTGTGTTTTTCCTG Reverse: AGCAATACCCTCCTGTAAATGGT Forward: CCGAGGTAATTGTGAGACTGGAG Reverse: CCTGATTGGGTTGATTAAGTGCA Forward: GTTATGCTCTTAGAACGTCGCCC Reverse: CCGTGTAATGCCTTGTTTCTTGA Forward: AGTGCTGCATGAGAGATTATGGT Reverse: TGTAACCTCAACAATACGAGCAA Forward: CCATCACAGTTCGTGTTCTTG Reverse: TAGCGTCTAACGTTTCGGCAG Forward: TGTGATGTTTTTGTTCGGTCTTTAA Reverse: TCAAAAGAAAATGCAGACAGACTCA

activation step at 95 °C for 5 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 50 s. After each run, a dissociation curve was designed to confirm specificity of the product and avoid production of primers-dimers. The gene for EF-1a was used as a control. Calculation of relative amounts of amplification products was completed with the comparative 2DDCn method [18]. All reactions were performed in triplicate and each sample was further amplified without reverse transcription to confirm there was no DNA contamination in the sample. 2.7. Statistical analysis All statistical analyses were performed with SPSS version 13.0 (SPSS Inc., Chicago, IL, USA). Analysis of variance (ANOVA) was carried out to determine the effects of the treatments, and those means were compared by Duncan’s multiple range tests (P < 0.05). Analysis between ELF and LF treatment group was performed with a Student’s t-test, and differences were considered significant at P 6 0.05 or P 6 0.01. Data presented in this paper were pooled across three independent repeated experiments.

The anti-TMV bioassay indicated that the inhibitory effect of ELF or LF on TMV was positively related to the concentration used (Table 2). Inactivation effects of ELF and LF were 85.6% and 81.4% at 100 lg/mL, respectively. Moreover, no obvious differences were obtained between ELF, LF and Ningnanmycin (97.0%, 500 lg/mL) (P < 0.01). In addition, ELF and LF exhibited potential protection bioactivities, with values of 75.2% and 69.6% at 100 lg/mL, respectively. Furthermore, the protection effect of ELF was higher than that of Ningnanmycin (72.0%). Compared with the inactivation and protection activities, ELF and LF possessed relatively lower curative activities, with values of 62.0% and 59.0% at 100 lg/mL, respectively. However, the curative effects were not different significantly between ELF, LF and Ningnanmycin (56.0%, 500 lg/ mL) (P < 0.05). Interestingly, the antiviral activities of ELF and LF were not different significantly at 75 and 100 lg/mL. Hence, we choose the concentration of 75 lg/mL for the following assays. In order to detect whether ELF and LF had systemic protection against TMV, we measured the levels of transcription of the TMVCP gene using RT-qPCR. The results indicated that treated tobacco leaves with ELF and LF 48 h before inoculation with TMV significantly inhibited TMV multiplication (P < 0.05). The level of TMVCP transcripts in DW treated leaves was about 6.9 and 3.85-fold higher than that in the ELF and LF treated leaves 24 h after inoculation respectively (Fig. 1). In addition, about 5 d later, the leaves treated with DW had the typical mosaic pattern, while the leaves treated with ELF did not (data not shown). These results suggested that both ELF and LF treatments improved the level of resistance to TMV. 3.2. Determination of changes in the amounts of H2O2 in tobacco leaves As shown in Fig. 2, rapid generation of H2O2 in ELF treated tobacco leaves was detected, which reached the highest values at the 9 h time point after the initiation of treatment. The amount of H2O2 in ELF treated tobacco leaves was about 2.4-fold higher than that in the LF treated leaves at the 9 h time point. Moreover, significant differences in the production of H2O2 were obtained between the ELF and LF treatment since 3 h time point. Nevertheless, LF did not lead to significant changes of H2O2 in tobacco leaves during the whole experiment. Interestingly, both ELF and LF did not lead to tissue necrosis in tobacco leaves (data not shown). 3.3. ELF locally and systemically caused an increase in SA and SAG in tobacco

3. Results Treatment with ELF locally and systemically induced a rapid accumulation of SA and SAG in tobacco leaves (Fig. 3). In treated

3.1. Preliminary antiviral activity assay To make a judgment of the antiviral potency of ELF and LF, the commercial plant virucide Ningnanmycin was used as the control. Table 2 The protection, inactivation and curative effect of ELF and LF against TMV. Treatment

Concentration (lg/mL)

Protection effect (%)

Curative effect (%)

Inactivation effect (%)

ELF

25 50 75 100

41.0 ± 8 58.8 ± 5* 71.0 ± 8** 75.2 ± 4**

40.4 ± 3 50.0 ± 9 60.0 ± 8* 62.0 ± 8*

55.0 ± 4 68.9 ± 6* 82.9 ± 5** 85.6 ± 4**

LF

25 50 75 100

35.0 ± 6 40.9 ± 5 56.0 ± 7* 69.6 ± 8**

40.2 ± 6 46.4 ± 3 57.8 ± 2* 59.0 ± 8*

55.0 ± 6 65.8 ± 9* 79.9 ± 7** 81.4 ± 4**

Ningnanmycin

500

72.0 ± 5**

56.0 ± 4*

97.0 ± 6**

All results are expressed as means ± SD; n = 3 for all groups. * P < 0.05. ** P < 0.01.

Fig. 1. Time course accumulation of TMV-CP transcripts in tobacco leaves inoculated with TMV. Plants were treated with 75 lg/mL ELF, LF or DW 48 h before inoculation with TMV. Expression of the TMV-CP gene was measured with RT-qPCR following treatment. Error bars represent ± SD (n = 3).

J. Wang et al. / Pesticide Biochemistry and Physiology 105 (2013) 62–68

65

their peaks at 24 h. SA was approximately 2.6-fold higher than that in LF treatment, and SAG was about 3.5-fold higher. The LF treated leaves maintained low levels of SA and SAG throughout the experiment. 3.4. ELF locally and systemically induced expression of PR protein genes in tobacco

Fig. 2. ELF or LF (75 lg/mL) induced changes in the amounts of H2O2 in tobacco leaves. Data presented are averages of pooled data (n = 3). Bars represent standard deviations of the means.

The increased transcript levels of acidic PRs (including PR-1a, PR-2, PR-3 and PR-5) and basic PR-1 were detected in the ELF and LF treated leaves (Fig. 4). In treated leaves, transcripts of the basic PR-1, PR-2 and PR-3 genes reached their maximal levels 48 h after ELF treatment. The level of basic PR-1 was approximately 5.2-fold higher than the LF treated leaves, while PR-2 was 3.1-fold higher and PR-3 was 5.6-fold higher. Meanwhile, the PR-1a and PR5 gene transcripts reached their maximum levels 24 h after ELF treatment. The level of PR-1a was about 4.9-fold higher than the LF treated leaves while PR-5 was 3.2-fold higher. In the untreated upper leaves, transcripts of PR-1a, basic PR-1, PR-2, PR-3 and PR-5 genes all reached their highest values 48 h after ELF treatment. The transcript levels of PR-1a were about 2.9-fold higher than the LF treatment, basic PR-1 levels were 3.3-fold higher, and PR-2 levels were 1.9-fold higher. The transcript levels of PR-3 and PR-5 were 2.8 and 2.1-fold higher, respectively, than the LF treated leaves at the 48 h time point. 3.5. ELF locally and systemically induced expression of defense-related enzyme genes in tobacco In treated leaves, maximum induction of PAL (Fig. 5A) occurred at 24 h after ELF treatment, and the level was about 2.6-fold higher than that in LF treated leaves. Expression of EAS (Fig. 5B) was strongly induced and reached its maximal level at 48 h after treatment with about 5.1-fold increase. In the untreated upper leaves, the expression of PAL (Fig. 5A) and EAS (Fig. 5B) was also enhanced by ELF, and both reached their peaks at 48 h, with a relative increase of about 2.2 and 2.8-fold, respectively. 4. Discussion

Fig. 3. Effect of ELF or LF (75 lg/mL) on the accumulation of SA and SAG both locally (A) and systemically (B) in tobacco leaves. Data presented are averages of pooled data (n = 3). Bars represent standard deviations of the means.

leaves (Fig. 3A), the maximum levels of SA and SAG were obtained at 12 h. The level of SA was about 5.5-fold higher than that in LF treatment at the same time point, while SAG was 6.45-fold higher. In the untreated upper leaves (Fig. 3B), SA and SAG both reached

In the present study, both ELF and LF exhibited a significant inhibition effect on viral infection (Table 2) and TMV multiplication (Fig. 1) in tobacco plants in greenhouse, especially inactivation and protection activity. Moreover, ELF showed a higher inhibitory effect than LF treatment against TMV in a dose-dependent way in the preliminary antiviral activity assay, which were consistent with our previous study that esterified whey proteins showed a stronger protection against TMV than native ones [18] in a dosedependent manner. This phenomenon may be due to esterification increasing the net positive charge and enhancing the production of free radicals, which thought to be related to interference with negatively charged viral particles, or tobacco cell receptors or both [6–8]. Lactoferrin has been reported to interact with microbial, viral and cell surfaces thus inhibiting microbial and viral adhesion and entry into host cells [2]. Therefore, we supposed that both ELF and LF could decrease the incidence of TMV disease by interacting with viral particles and preventing the entry of virus into the host cell. In order to test whether ELF and LF had the ability to influence the formation of normal virus particle, we determined the levels of transcription of the TMV-CP gene using RT-qPCR. TMV CP possessed the ability to protect TMV RNA from digestion by ribonuclease and then help the formation of normal virus particle [2]. The levels of transcription of the TMV-CP gene in ELF and LF treated leaves decreased obviously in our study, which

66

J. Wang et al. / Pesticide Biochemistry and Physiology 105 (2013) 62–68

Fig. 4. Time course accumulation of PR transcripts induced both locally and systemically in tobacco leaves treatment with ELF or LF (75 lg/mL). The expression of PR protein genes corresponding to PR-1a (B), PR-2 (A), Basic PR-1 (C), PR-3 (D), PR-5 and (E) was determined with RT-qPCR following treatment. Bars represent standard deviations of the means (n = 3).

inferred that the antiviral activities of ELF and LF might be associated with affinity towards TMV CP. Moreover, using ultraviolet–vis spectroscopic and fluorescence spectroscopic methods, we found that ELF and LF had affinity to TMV CP 4S and 20S protein by induction to red shift and fluorescence quenching phenomenon, but not

to TMV RNA. These results will be published in Crop Protection (under review). The antiviral activity of ELF and LF in controlling TMV is considered to involve several mechanisms [20]. It may involve a direct fungitoxic property and elicitation effect on hosts. In order to test

J. Wang et al. / Pesticide Biochemistry and Physiology 105 (2013) 62–68

Fig. 5. Time course accumulation of defense-related enzymes transcripts induced both locally and systemically in tobacco leaves treatment with ELF or LF (75 lg/mL). The expression of PAL (A) and EAS (B) genes was determined with RT-qPCR following treatment. Bars represent standard deviations of the means (n = 3).

whether ELF had the ability to induce systemic resistance against TMV, we measured the level of H2O2 in response to various treatments. H2O2 has been described as key roles in resistance responses against pathogens. H2O2 is took account into involvement in phytoalexin production, lipid peroxidation and defense related genes expression, etc. [21]. Previous studies have shown that treatment with laminarin, oligosaccharide and chitosan elicitors, binding to their receptors on the cellular membranes, could induce rapid generation of ROS and increase diseases resistance against plant pathogens in various plant seedlings [21,22,13]. In our research, we got similar results that ELF could also induce rapid generation of H2O2 (Fig. 2) and increase resistance against TMV in tobacco seedlings. Systemic acquired resistance (SAR) is accompanied by an increased level of salicylic acid (SA) both locally and systemically and by the coordinated upregulation of a specific set of genes encoding pathogenesis-related (PR) proteins, which are thought to contribute to disease resistance [23,24]. In the present study, ELF could promote the production of significant amounts of SA and SAG (Fig. 3) in treated leaves and untreated younger leaves. Salicylic acid as an endogenous plant hormone could be induced in pathogen-inoculated leaves, correlated with the induction of PRs and resistance. In addition, SA has also been reported as a signal molecule, necessary for generation of SAR [23,24]. Taken

67

together with our results, ELF might induce SAR, possibly be mediated by the SA pathway in tobacco plants. PRs can be induced by different stress stimuli and play an important role in plant defense against pathogenic constraints, and in general adaptation to stressful environments [23]. Of the PR protein families, PR-1 proteins are the most abundant after pathogen infection and PR-1a may constitute about 1% of the soluble protein in tobacco 7 d after infection. The increased expression of acidic PR-1a is usually used as a marker of SAR, but the precise function of PR-1a is still not clear [25]. The group of PR2 proteins could catalyze endo-type hydrolytic cleavage of the b-1, 3-D-glucosidic linkages in b-1, 3-glucans. The group of PR-3 proteins is endo-chitinases that catalyze the hydrolysis of b-1, 4-N-acetylglucosamine linkages, so they can cleave fungal cell walls in situ and play a major role in disease resistance [20] Transgenic tobacco over-expressing PR-2 and PR-3 had improved resistance to Cercospora nicotianae [26]. PR-5 proteins are a class of thaumatin-like proteins, and have strong antifungal activity [27]. Consistent with previous findings that a number of different elicitors (chitosan oligosaccharide, chitosan, SA, oxalic acid, calcium chloride) significantly induced expression of PR-1a, PR-2 and PR-3 in plants [22,13], we observed that ELF significantly increased the transcript levels of PR-1a, PR-2, PR-3 and PR-5 in treated tobacco leaves. Interestingly, ELF also induced the increase of the above PR protein genes systemically (Fig. 4). These results suggest that the ELF not only could induce a dose and timedependent resistance in treated leaves but also long-term systemic protection against TMV in plant tissues distant from the primary inoculation. Previous studies have reported that SA, which is synthesized by the phenyl-propanoid pathway from trans-cinnamic acid and benzoic acid, regulates the expression of genes for acidic PR proteins and induces defense against biotrophic pathogens that feed and reproduce on live host cells, whereas jasmonic acid (JA) or ethylene (ET) regulates the expression of genes for basic PR proteins and activates defense against necrotrophic pathogens that kill host cells for nutrition and reproduction [28,29]. In our study, besides the increased transcript levels of acidic PRs [PR-1a, PR-2, PR-3, PR-5], ELF also affected the accumulation of basic PR-1 gene expression. The reason that causes this phenomenon probably is a mutually synergistic interaction between the SA and JA pathways. Such cross-talk provides the means by which plants can regulate their responses to maximize defense [28,29]. PAL is a key enzyme of the phenyl-propanoid pathway, contributing to the synthesis of phenolic compounds, phytoalexin and salicylic acid (SA) [30]. Previous studies have shown that some important compounds of milk, such as sodium bicarbonate, oxalate, dibasic or tribasic potassium phosphate, and other salts and amino acids significantly increase the transcript level of PAL [31]. Our results also found that ELF significantly induced expression of the PAL gene systemically and locally in tobacco leaves (Fig. 5A), compared with LF. This result was also consistent with our previous research showing that methylated lactoferrin increased the transcription of PAL in treated tobacco plants [19]. In this research, 5-epi-aristolochene synthase (EAS), an important enzyme in the phytoalexins synthesis pathway was also significantly induced systemically and locally in tobacco leaves (Fig. 5B). Therefore, the ELF induced increases in TMV resistance in tobacco seedlings was probably correlated with increases in PAL and EAS mRNA levels. In conclusion, ELF and LF exhibited a potential antiviral activity against TMV. This inhibitory effect might be made by binding to tobacco cell receptors, or viral particles or both and inhibiting viral adhesion and entry into host cells, but also attribute to activate the expression of a number of defense genes.

68

J. Wang et al. / Pesticide Biochemistry and Physiology 105 (2013) 62–68

Acknowledgment This work was supported by the National Key Technology R&D Program of China (201003004). References [1] H. Jenssen, R.E. Hancock, Antimicrobial properties of lactoferrin, Biochimie 91 (2009) 19–29. [2] F. Berlutti, F. Pantanella, T. Natalizi, A. Frioni, R. Paesano, A. Polimeni, P. Valenti, Antiviral properties of lactoferrin – a natural immunity molecule, Molecules 16 (2011) 6992–7018. [3] M.E. Kuipers, H.G. De Vries, M.C. Eikelboom, D.K.F. Meijer, P.J. Swart, Synergistic fungistatic effects of lactoferrin in combination with antifungal drugs against clinical Candida isolates, Antimicrob. Agents Chemother. 43 (1999) 2635–2641. [4] A.M. Abdelbacki, S.H. Taha, M.Z. Sitohy, A.I. Abou Dawood, M.M. Abd-El Hamid, A.A. Rezk, Inhibition of tomato yellow leaf curl virus (TYLCV) using whey proteins, Virol. J. 3 (2010) 7–26. [5] C. Bertrand-Harb, J.M. Chobert, E. Dufour, T. Haertle, Esterification of food proteins: characterization of the derivatives by a colorimetric method and by electrophoresis, Sci. Aliment. 11 (1991) 641–652. [6] M. Sitohy, J.M. Chobert, T. Haertlé, Simplified short-time method for the esterification of milk proteins, Milchwissenschaft 56 (2001) 127–131. [7] M. Sitohy, S. Billaudel, T. Haertlé, J.M. Chobert, Antiviral activity of esterified aLactalbumin and b-Lactoglobulin against herpes simplex virus type 1. Comparison with the effect of acyclovir and L-Polylysines, J. Agric. Food Chem. 55 (2007) 10214–10220. [8] M. Sitohy, M. Dalgalarrondo, M. Nowoczin, B. Besse, S. Billaudel, T. Haertlé, J.M. Chobert, The effect of bovine whey proteins on the ability of poliovirus and Coxsackie virus to infect vero cell cultures, Int. Dairy J. 18 (2008) 658–668. [9] M. Sitohy, B. Besse, S. Billaudel, T. Haertlé, J.M. Chobert, Anti-viral action of methylated b-lactoglobulin on the human influenza virus A subtype H3N2, Probiot. Antimicrob. Prot. 2 (2010) 104–111. [10] S.H. Taha, M.A. Mehrez, M.Z. Sitohy, A.G. Abou Dawood, M.M. Abd-El Hamid, H. Kilan, Effectiveness of esterified whey proteins fractions against Egyptian Lethal Avian Influenza A (H5N1), Virol. J. 7 (2010) 330–334. [11] M. Sitohy, M. Scanu, B. Besse, C. Mollat, S. Billaudel, T. Haertle, J.M. Chobert, Influenza virus A subtype N1H1 is inhibited by methylated b-lactoglobulin, J. Dairy Res. 77 (2010) 411–418. [12] K.L. Wang, B. Su, Z.W. Wang, M. Wu, Z. Li, Y.N. Hu, Z.J. Fan, N. Mi, Q.M. Wang, Synthesis and antiviral activities of phenanthroindolizidine alkaloids and their derivatives, J. Agric. Food Chem. 58 (2010) 2703–2709. [13] X.M. Zhao, X.P. She, Y.G. Du, X.M. Liang, Induction of antiviral resistance and stimulary effect by oligochitosan in tobacco, Pestic. Biochem. Physiol. 87 (2007) 78–84.

[14] Y.J. Zhou, H.J. Liu, G.Z. Wang, X. Huang, Z.B. Cheng, Z.X. Chen, X.P. Zhou, Immuno-detection of rice stripe virus carried by brown planthopper, Jiangsu Agric. Sci. 1 (2004) 50–51. [15] C.J. French, G.H.N. Towers, Inhibition of infectivity of potato virus X by flavonoids, Phytochemistry 31 (1992) 3017–3020. [16] S.P. Mukherjee, M.A. Choudhuri, Implications of water stress-induced changes in the levels of endogenous ascorbic acid and hydrogen peroxide in Vigna seedlings, Physiol. Plant. 58 (1983) 166–170. [17] M.C. Verberne, N. Brouwer, F. Delbianco, H.J. Linthorst, J.F. Bol, R. Verpoorte, Method for the extraction of the volatile compound salicylic acid from tobacco leaf material, Phytochem. Anal. 13 (2002) 45–50. [18] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real time quantitative PCR and the 2DDCn method, Methods 25 (2001) 402–408. [19] J. Wang, Y.K. Zhu, H.Y. Wang, H. Zhang, K.Y. Wang, Inhibitory effects of esterified whey protein fractions by inducing chemical defense against tobacco mosaic virus (TMV) in tobacco seedlings, Ind. Crops Prod. 37 (2012) 207–212. [20] P. Crisp, E. S. Scott, T. J. Wicks, Evaluation of biological and novel control of grapevine powdery mildew. Proceedings of the 15th Australasian Plant Pathology Society Conference Handbook, Geelong, Australia, 2005, p 85. [21] A. Aziz, B. Poinssot, X. Daire, M. Adrian, A. Bézier, B. Lambert, J.M. Joubert, A. Pugin, Laminarin elicits defense responses in grapevine and induces protection against Botrytis cinerea and Plasmopara viticola, Mol. Plant-Microbe Interact. 16 (2003) 1118–1128. [22] H. Yin, X.M. Zhao, Y.G. Du, Oligochitosan: a plant diseases vaccine – a review, Carbohydr. Polym. 82 (2010) 1–8. [23] A. Edreva, Pathogenesis-related proteins: research progress in the last 15 years, Gen. Appl. Plant Physiol. 31 (2005) 105–124. [24] L.C. Van Loon, M. Rep, C.M.J. Pieterse, Significance of inducible defense-related proteins in infected plants, Annu. Rev. Phytopathol. 44 (2006) 135–162. [25] Z. Liu, L.F. Du, B. Wan, Pathogenesis-related proteins in higher plants, Nat. Prod. Res. Dev. 17 (2005) 229–234. [26] Q. Zhu, E.A. Maher, S. Masoud, R.A. Dixon, C.J. Lamb, Enhanced protection against fungal attack by constitutive co-expression of chitinase and glucanase genes in transgenic tobacco, Nat. Biotechnol. 12 (1994) 807–812. [27] W.S. Pierpoint, A.S. Tatham, D.J.C. Pappin, Identification of the virus-induced protein of tobacco leaves that resembles the sweet-protein thaumatin, Physiol. Mol. Plant Pathol. 31 (1987) 291–298. [28] R.M. Bostock, Signal crosstalk and induced resistance: straddling the line between cost and benefit, Annu. Rev. Phytopathol. 43 (2005) 545–580. [29] J. Glazebrook, Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens, Annu. Rev. Phytopathol. 43 (2005) 205–227. [30] R.A. Dixon, N.L. Paiva, Stress-induced phenylpropanoid metabolism, Plant Cell 7 (1995) 1085–1097. [31] J. Sudisha, A. Kumar, K.N. Amruthesh, S.R. Niranjana, H.S. Shetty, Elicitation of resistance and defense related enzymes by raw cow milk and amino acids in pearl millet against downy mildew disease caused by Sclerospora graminicola, Crop Prot. 30 (2011) 794–801.