- Email: [email protected]
Smad3 signaling
Biomedicine & Pharmacotherapy 119 (2019) 109387
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Inhibitory effects of astragaloside IV on silica-induced pulmonary fibrosis via inactivating TGF-β1/Smad3 signaling Nannan Lia,b, Feifei Fenga, Ke Wuc, Huanan Zhanga, Wei Zhangb, Wei Wanga,
T
⁎
a
Department of Respiratory Medicine, The Second Hospital of Shandong University, Jinan, 250033, Shandong, PR China Department of Respiratory Medicine, Central Hospital of Tai'an of Shandong Province, Tai’an, 271000, Shandong, PR China c Department of Cardiology, Central Hospital of Tai’an of Shandong Province, Tai’an, 271000, Shandong, PR China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Astragaloside ASV Silicosis Pulmonary fibrosis Transforming growth factor-beta 1 Extracellular matrix
Purpose: To observe the effect of astragaloside ASV (ASV) on silicosis fibroblasts, and further investigate its regulatory mechanism on TGF-β1/Smad3 signaling pathway. Methods: Silica-induced rats model was established in this study. RT-qPCR was performed to detect α-SMA, Collagen I, Collagen III, Smad2, Smad3 and Smad7 expression. Immunofluorescence was conducted to detect αSMA, Collagen I, Collagen III and p-Smad3 protein and the nucleoplasmic distribution of p-Smad3.Westernblotting was performed to detect the protein of Smad2, p-Smad2, Smad3, p-Smad3 and Smad7. Results: 20 μg/mL ASV could effectively reduce the expression of α-SMA, Collagen I, Collagen III. TGF-β1 stimulated the proliferation of fibroblasts, promoted phosphorylation of Smad2 and Smad3, and down-regulated Smad7 expression. Among them, continuous phosphorylation of Smad3 is a major factor in causing fibrosis. Besides, ASV can inhibit silica-induced lung fibroblast fibrosis through TGF-β1/Smad3 signaling pathway, thereby inhibiting the formation of silicosis. Conclusion: ASV could inhibit the expression of collagen in fibroblasts and the transformation to myofibroblasts, and has an anti-silicosis fibrosis effect, which may be related to the continuous phosphorylation of Smad3 in the TGF-β1/Smad signaling pathway.
1. Introduction Silicosis is caused by the chronic inhalation of large amounts of dust from the environment which contains silica particles [1]. Though this disease is largely preventable by implementing strict safety and health standards at work, silicosis remains one of the more common occupational disorders in many parts of the world, including China [2]. Pathological changes in silicosis include irreversible and incurable formation of silicotic nodules and excessive deposition of extracellular matrix (ECM), which resulted in lung function insufficiency [3]. The presence of silicosis has been known for centuries; however, the pathological mechanism of silicosis is still unclear. Thus, it is urgent to mechanistically understand the pathogenesis of silicosis to develop new treatments for this fatal disease. Although the etiology of silicosis is still unclear, emerging studies
have shown that some special type of cells and cytokines play vital roles in the process of silicosis [4]. Among the many factors and cytokines that regulate lung fibrosis, transforming growth factor-beta 1 (TGF-β1) is a critical factor. It can stimulate fibroblast proliferation and the production of collagen around the silica particles, resulting in pulmonary fibrosis and the formation of silicotic nodules. In addition, TGF-β1 can also initiate fibroblasts differentiation into myofibroblasts, causing ECM deposition [5]. Thus, suppressing TGF-β1 expression is of potential value for silicosis. Due to there is no effective drugs to improve the survival of patients with silicosis, herbal medicines as well as the extracts have been increasingly become the focus of attention [6]. Astragaloside ASV (ASV) is one of the major and main active substances of traditional Chinese medicinal plant astragalusmembranaceus. Recently, studies have demonstrated that it has a plenty of pharmacologic effects forits potent
Abbreviations: ASV, astragaloside ASV; ECM, extracellular matrix; TGF-β1, transforming growth factor-beta 1; α-SMA, α-Smooth muscle actin; TβRI, TGF-β type I receptor; TβRII, TGF-β type II receptor ⁎ Corresponding author at: Department of Respiratory Medicine, The Second Hospital of Shandong University, No. 247 Beiyuan Street, Jinan, 250033, Shandong, PR China. E-mail addresses: [email protected] (N. Li), [email protected] (F. Feng), [email protected] (K. Wu), [email protected] (H. Zhang), [email protected] (W. Zhang), [email protected] (W. Wang). https://doi.org/10.1016/j.biopha.2019.109387 Received 28 June 2019; Received in revised form 16 August 2019; Accepted 22 August 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
immunoregulatory, anti-inflammatory, anti-asthma, and anti-fibrotic actions [7]. ASV was found to against BLM-induce pulmonary fibrosis by inhibiting the levels of oxidative stress and inflammatory response [8]. Besides, it was found that ASV can alleviate the progression of kidney fibrosis via inhibition of MAPK pathway and TGF-β1/Smad signaling pathway [9]. However, there is a lack of data regarding the effects of ASV on silicosis fibroblast fibrosis. Thus, in this study, we explore the method of inhibiting of TGF-β1 signaling, investigate the effects of ASV on silicosis and its underlying mechanisms, which could provide a novel potential target for the treatment of silicosis.
72 h). To investigate the continuous phosphorylation of Smads3 in the TGF-β1-Smad signaling pathway, the expression of p-Smads3 under different TGF-β1 treatments times (24 h, 48 h and 72 h) were detected. To investigate the effects of 20 mg/L ASV on the silicosis fibrosis through the TGF-β1/Smad3 signaling pathway, the expression of the corresponding downstream genes after treatment with ASV for 24 h were detected.
2. Materials and methods
Tissue sections were deparaffinized in xylene and rehydrated in a series of alcohol solutions. After a brief wash in distilled water, the sections were stained with Harris haematoxylin solution for 5 min, washed in tap water and counterstained in eosin - phloxine solution for 2 min.
2.5. Haematoxylin and eosin staining (HE staning)
2.1. Animals 120 Sprague-Dawley (SD) rats weighing 180–200 g were randomly divided into control group (Control group, n = 40), Silica-induced rats model group (Model group, n = 40), Astragaloside IV group (ASV group, n = 40). The rats were housed under controlled temperature (22 °C ± 2 °C) and exposed to a 12-h light-dark cycle. In Control group, rats were injected with 1 ml of physiological saline and 0.25 ml of air; In Model group, rats were infused with 1 ml of a 50 mg/ml silica dust suspension and 0.25 ml of air; In ASV group, rats were subjected to the same operating procedure as group Model, and intraperitoneally injected 20 mg/kg ASV once a day. All the rats were provided with free access to standard rat feed and tap water. All the animal experimental procedures were approved by the Experimental Animal Ethics Committee of The Second Hospital of Shandong University (NO. 20140195). All experiments were carried out in accordance with the the guidelines of the Chinese Association of Laboratory Animal Care.
2.6. Immunofluorescence analysis After the fixation with 4% paraformaldehyde (80096618, SINOPHARM, China), fibroblast were permeabilized with methanol, and blocked with 5% BSA (BS043, Biosharp, China) in PBS for 20 min. Then fibroblast were immunolabeled with antibodies: α-Smooth muscle actin (α-SMA), Collagen I, Collagen III and p-smads3 (ab52903, Abcam, England). After incubation, the cells were washed with PBS followed by FITC-conjugated secondary antibody. After the nuclei were counterstained with DAPI, the samples were observed under a fluorescence microscope (BX53, Olympus, Japan).
2.7. Real-time PCR analysis
2.2. Silica-induced rats model
Total RNA was extracted using TRIzol kit (RP1001, BioTeke, Beijing, China) according to the manufacturer's protocol. After it was reverse transcribed to cDNA using a Sensiscript RT kit (PR6502, BioTeke, Beijing, China). Subsequently RT-qPCR was performed. The conditions were as follows: 95 °C for 5 min; 30 cycles of 95 °Cfor 30 s, 56 °C for 30 s and extension at 72 °C for 1 min. Relative quantities of mRNA were calculated using the 2−ΔΔCt method [10] and normalized to housekeeping gene β-actin. The experiment was repeated3 times. PCR primer sequences are shown in Table 1.
All the animals were anesthetized with 1% pentobarbital sodium (57-33-0, Dainippon Sumitomo Pharma, Osaka, Japan) and kept on a 60° inclined board with the help of rubber bands. The tongue of mice were pulled and held with the help of blunt forceps. Under the head mirror, the epidural anesthesia catheter with connector connected with 1 mL syringe was inserted into the trachea to the bifurcation of the trachea for endotracheal intubation. The crystalline particles were suspended in normal sterile saline and the suspension (50 mg/mL) was vigorously mixed by avortex shaker (Stuart, UK), before instillation in rat.
2.8. Western-blotting analysis 2.3. Cell culture Cells were lysed with buffer and incubated at 4 °C for 1 h. The lysates were ultrasonicated and centrifuged at 12,000 g for 10 min. Protein concentrations were determined by bicinchoninic acid methods. Protein samples were separated on polyacrylamide-SDS gels (WLA013, wanleibio, China) and electroblotted ontonitrocellulose membranes (Millipore, USA). After blocking with TBS, 5% nonfat dry milk for 2 h, the membrane was incubated overnight at 4 °C with antibodies against Smad2, p-Smad2, Smad3, p-Smad3 and Smad7 followed by incubation with a HRP-conjugated secondary antibody for 45 min at room temperature. After each incubation, the membrane was thoroughly washed with TBST. Then coloring reaction was carried out with DAB and the ratio was then quantified by GelDoc XR System (Bio-RAD, USA).
Lung tissue of normal Wistar rats and silicosis Wistar rats (6–8 weeks) were minced into small pieces (approximately 1 mm3). After being rinsed with PBS, pieces were incubated in DMEM that was supplemented with 1 mg/mL collagenase type I (Worthington, Lakewood, NJ, USA), 0.5 mg/mL dispase (Thermo Fisher Scientific), 2 U/mL DNase (Qiagen, Valencia, CA, USA), 0.1 mg/mL streptomycin, and 100 U/mL penicillin at 37 °C for 15 min with gentle shaking. After washing twice with DMEM, the resulting pieces were transferred to culture flask (Thermo Fisher Scientific) and cultured at 37 °C with 5% CO2. When the flask reached confluence, outgrown cells were harvested as cells at passage 0. Expanded cells at passage 2˜5 were used in experiments. 2.4. Cell treatment
2.9. Statistical analysis To investigate the effects of ASV on silicosis fibrosis, the mRNA expression of α-SMA, Collagen I and Collagen III were detected under different ASV concentrations (7 μg/mL, 20 μg/mL and 60 μg/mL) and treatment times (24 h, 36 h and 48 h). To investigate the effects of TGFβ1 on silicosis fibrosis, cells were maintained in growth media supplemented with 5 ng/mL TGF-β1 for various time (0 h, 24 h, 48 h and
SPSS 19.0 (SPSS Inc, USA) was applied to analyze all data. Results are expressed as mean ± standard deviation (SD). One-way ANOVA analysis of variance was used to determine the significant differences among the groups. Values of p < 0.05 were considered statistically significant. 2
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
Table 1 Primers used for Real Time PCR. Gene
Forward (5’-3’)
Reserve (3’-5’)
Collagen I Collagen III α-SMA Smad2 Smad3 Smad7 β-actin GAPDH
GAGGGCCAAGACGAAGACATC GGAGCTGGCTACTTCTCGC GAGAGGAGCAAAATCTGTCCG GAAGGCAGACGGTAACAA GGAGGAGAAATGGTGCGAGAA CAACCGCAGCAGTTACCC CACTGTGCCCATCTACGAGG GGAGCGAGATCCCTCCAAAAT
CAGATCACGTCATCGCACAAC GGGAACATCCTCCTTCAACAG GGGGGAATTATCTTTCCTGGTCC GCACCGAGCACAGGAAGTTGG GCCACAGGCGGCAGTAGAT GTCGAAAGCCTTGATGGAGA TAATGTCACGCACGATTTCC GGCTGTTGTCATACTTCTCATGG
α-SMA, α-Smooth muscle actin. β-actin, β-non-muscle. GADPH, glyceraldehyde-3-phosphate dehydrogenase.
3. Result
Collagen I and Collagen III were decreased significantly(P < 0.05). On the basis of qRT-PCR results, we conducted immunofluorescence analysis to verify our results. More interestingly, a similar pattern change was observed in immunofluorescence, which was markedly increased in model group at 24 h when compared with control group. After the addition of ASV, weaken fluorescence could be observed (Figs. 3–5).
3.1. The pathological changes detected by HE staning HE staining results showed that the lung tissue structure in the control group was normal and no obvious morphological changes were observed. However, in the silicosis model group, we observed that the lung tissue structure of the rats was damaged, the alveoli collapsed, and the fibrous tissue was obviously proliferated, especially around the small blood vessels and bronchioles. In addition, under the microscopic examination, it was found that there were silicon nodules of different sizes in the lung tissue, mainly composed of III-IV nodules, partially fused into a piece, and a large amount of collagen fibers proliferated in the center of the nodules. Interestingly, when ASV was added, the silicon nodules in the lung tissue were reduced, mainly in grades I to II, with a dispersed distribution and no fusion. The nodules are mainly composed of fibroblasts, macrophages and a small amount of collagen fibers (Fig. 1).
3.3. TGF-β1 promoted Smad2 and Smad3 expression, and inhibited Smad7 expression To explore the effects of TGF-β1 on silicotic fibroblasts, we treated them with 5 ng/mL TGF-β1 for 0, 24, 48 and 72 h, respectively. qRTPCR results showed that there were no significant changes in the mRNA expression of Smad2 and Smad3 in the corresponding time as compared with the Control group. However, the expression of Smad7 decreased significantly with the increase of TGF-β1 treatment times. (Fig. 6A-C). Western-blotting analysis results showed that the ratio of p-Smad2/ Smad2 and p-Smad3/Smad3 significantly increased, while the protein expression Smad7 were significantly decreased. More specifically, quantized histogram showed a up-regulated protein expressions of pSmad2 and p-Smad3 and a down-regulated protein expressions of Smad7 in silicosis fibroblasts when compared Control group (P < 0.05; Fig. 6D-F).
3.2. ASV down-regulated the expressions of α-SMA, collagen I and Collagen III To investigate the effects of ASV on silicosis fibroblast fibrosis, we detected the expression changes of α-SMA, Collagen I and Collagen III at different ASV concentrations and treatment times. As shown in Fig. 2A-C, compared with control group, α-SMA, Collagen I and Collagen III expression were significantly increased (P < 0.05). However, after treatment with 7 μg/mL, 20 μg/mL and 60 μg/ML ASV respectively, all the mRNA expressions were significantly decreased in comparison to model group (P < 0.05). Among them, the changes were particularly significant under 20 μg/mL ASV treatment. Fig. 2D-E showed the expression changes of the above three genes after ASV treatment for 24, 36 and 48 h respectively. It was found that the α-SMA, Collagen I and Collagen III mRNA expression were significantly increased in group Model as compared with group Control. Conversely, when treated by 20 μg/mL ASV, the mRNA expression of α-SMA,
3.4. Continuous phosphorylation of Smad3 leaded to fibrosis of silicosis fibroblasts To further explore the mechanism of fibrosis induced by TGF-β1Smad signaling pathway, silicosis fibroblasts were treated with 5 ng/mL TGF-β1 for 24 h, 48 h and 72 h, respectively, and then incubated with TβR1 inhibitor for 24 h to block the upstream signal of TGF-β1-Smads signaling pathway. As shown in Fig. 6, intense p-Smad3 immunofluorescence were detected at 24 h, 48 h and 72 h in the silicosis fibroblasts when compared with the Control group and the fluorescence intensity increased with the increase of treatment time (Fig. 7).
Fig. 1. Examination of lung histological and morphological alterations. HE staining results showed that the lung tissue structure in the control group was normal and no obvious morphological changes were observed. While in the silicosis model group, the lung tissue structure of the rats was damaged, the alveoli collapsed, and the fibrous tissue was obviously proliferated. In addition, it was found that there were silicon nodules of different sizes in the lung tissue, mainly composed of III-IV nodules, partially fused into a piece, and a large amount of collagen fibers proliferated in the center of the nodules. After treatment with ASV, the silicon nodules in the lung tissue were reduced, with a dispersed distribution and no fusion. 3
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
Fig. 2. The mRNA expression of Collagen I, Collagen III and α-SMA at different concentrations and different treatment times of ASV. (A) After treatment of 20 μg/mL ASV, the down-regulation of Collagen I was more significant; (B) Collagen III mRNA expression was significantly reduced after treatment with 20 μg/mL ASV; (C) The expression of α-SMA were all significant decreased after 20 μg/mL and 60 μg/mL ASV treatment. *indicated Model group compared with Control group; #indicated 7 μg/mL, 20 μg/mL and 60 μg/mL groups compared with Model group. (D) Collagen I mRNA was significantly down-regulated at 24 h, 36 h and 42 h after ASV treatment; (E) Collagen III mRNA was significantly down-regulated at 24 h, 36 h and 42 h after ASV treatment, which was most obvious at 24 h; (F) α-SMA mRNA changed most significantly at 24 h after ASV treatment; *indicated Model group compared with Control group; #indicated 24 h, 36 h and 48 h groups compared with Model group.
Fig. 3. Immunofluorescence staining of Collagen I at 24 h after ASV treatment in each group. Compared with Model group, the fluorescence intensity was significantly decreased in ASV group. Scale bar = 100 μm.
3.5. ASV inhibited fibrosis of silicosis fibroblasts by TGF-β1-Smads signaling pathway
Smad3 signaling pathway in the treatment of silicosis, 20 mg/L ASV were given immediately after TGF-β1 administration. Compared with Control group, a down-regulated mRNA expressions of Smad7 was observed in Model group. However, when ASV was added, their
To further investigate the relationship between ASV and TGF-β14
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
Fig. 4. In Model group, strong immunofluorescence of Collagen III were observed. After the addition of ASV, fluorescence intensity were significantly reduced. Scale bar = 100 μm.
Fig. 5. Intense α-SMA immunofluorescence was detected at 24 h in the Model group when compared with the Control group. 20 μg/mL ASV treatment attenuated αSMA immunofluorescence in comparison to Model group. Scale bar = 100 μm.
immunoreactivity were significantly decreased when compared with the matching Model group (Fig. 9).
expression increased significantly (P < 0.05; Fig. 8C). Smad2 and Smad3 showed no significant changes in the three groups above (Fig. 8A and B). Western-blotting analysis results showed that the pSmad2 and p-Smad3 protein expression were significantly increased in Model group as compared with Control group, while the Smad7 protein expression was decreased significantly (P < 0.05). More interestingly, treatment with ASV markedly decreased the expression of p-Smad2 protein and p-Smad3 protein and increased the expression of Smad7 protein when compared Control group (P < 0.05; Fig. 8D-F) To confirm the role of p-Smad3 in the whole signaling pathway, we conducted immunofluorescence assay. Strong p-Smad3 immunoreactivity was detected in the Model group when compared with Control group. After treatment with ASV, however, p-Smad3
4. Discussion Silicosis is a highly prevalent occupational condition that is caused by chronic inhalation of crystalline silica particulates (aerodynamic diameter < 5 μm) into the distal air spaces of the lung. Although silica dust has been shown to injure many cell types in the lung it is generally believed that activated myofibroblasts play a central role in driving the development of disease [2]. Myofibroblasts, which are characterized by up-regulation of a-smooth muscle actin (a-SMA), fibronectin, and collagens, can result inexcessive ECM (collagen I and collagen III) 5
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
Fig. 6. Smad2, p-Smad2, Smad3, p-Smad3 and Smad7 expression changes at different treatment times of TGF-β1. (A) After treatment with TGF-β1 for 24 h, 48 h and 72 h, there was no significant mRNA expression changes of Smad2 in comparison to Control group; (B) There was no significant changes in Smad3 mRNA expression after treatment with TGF-β1 for 24 h, 48 h and 72 h; (C) With the increase of treatment time of TGF-β1, the mRNA expression of Smad7 was significantly downregulated, which was most obvious at 72 h; *indicated 24 h, 48 h and 72 h groups compared with Control group. (D) p-Smad2 (60 kDa), Smad2 (55 kDa) and β-actin (42 kDa) immunoreactive bands, respectively. The ratio of p-Smad2/Smad2 increased with the time of TGF-β1 treatment; (E) The protein expression of p-Smad3 increased with the treatment time of TGF-β1; (F) Compared with Control group, Smad7 protein was significantly decreased after treatment with TGF-β1; *indicated 24 h, 48 h and 72 h groups compared with Control group.
deposition, contributing to epithelial cell death and fibrotic remodeling due to lung fibroblasts activation and differentiation [11]. Here in our study, RT-qPCR results showed that a suppressed expression of α-SMA,
Collagen I and Collagen III following ASV treatment in SiO2 induced silicosis fibroblast fibrosis in vitro. This are consistent with previous study that a-SMA, Collagen I, Collagen III, FSP-1, fibronetin and
Fig. 7. Fluorescence changes of p-Smad3 after treatment with TGF-β1 for 24, 48 and 72 h, respectively. Intense p-Smad3 immunofluorescence were observed in the silicosis fibroblasts and the fluorescence intensity increased with prolonged treatment time of TGF-β1. Scale bar = 50 μm. 6
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
Fig. 8. The expression changes of Smad2, p-Smad2, Smad3, p-Smad3 and Smad7 after 20 mg/L ASV treatment for 24 h. (A) Compared with the Control group and Model group, there was no mRNA expression changes of Smad2 after treatment with 20 mg/L ASV; (B) After treatment with 20 mg/L ASV, Smad3 mRNA has no significant change in compareision to Control group; (C) After the addition of 20 mg/L ASV, Smad7 mRNA significantly increased; (D) The protein expression changes of Smad2 and p-Smad2. The ratio of p-Smad2/Smad2 reduced after treatment with ASV when compared with Model group. (E) The ratio of p-Smad3/Smad3 reduced after treatment with ASV when compared with Model group. (F) Smad7 protein expression was significantly increased after treatment with ASV. *indicated Model group compared with Control group; #indicated 20 mg/L group compared with Model group.
Fig. 9. Immunofluorescence staining of p-Smad3 after treatment with 20 mg/L ASV for 24 h. Strong p-Smad3 immunoreactivity was detected in the Model group After treatment with ASV, however, p-Smad3 immunoreactivity were significantly decreased and its accumulation in the nucleus is reduced. Scale bar = 50 μm.
7
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
Vimentin ablation attenuates fibrosis in the lung tissue samples from mouse [12]. Based on this finding, we conducted immunofluorescence staining to further confirm our conclusions. As expected, after treatment with ASV, the fluorescence intensity of the three genes above were significantly decreased as compared with model group, suggesting that ASV intervention can reduce the expression of collagen in silicosis fibroblasts and the transformation into myofibroblasts, and has the effect of resisting silicosis fibroblast fibrosis. It has been well documented that the elevation of transforming growth factor TGF-β1 released from macrophages induced by silica promotedfibroblast migration, proliferation and myofibroblast differentiation [13]. Besides, it turned out to be a pleiotropic cytokine that has a crucial role in many aspects of the lung fibrotic response and has long been believed to be a central mediator of this response [14]. Important intracellular mediators of TGFβ signaling are members of the Smad family which have key roles in exerting TGFβ-induced EMT. TGFβ isoforms exert their cellular effects by binding to the TGF-β type II receptor (TβRII), and this binding facilitates activation of TGF-β type I receptor (TβRI) kinase, which leads to the activation of Smad2 and Smad3. Phosphorylated Smads partner with cytosolic Smad4 and form a heteromericsmad complex, which translocates to the nucleus where they cooperate with other transcription factors, co-activators and corepressors to regulate the transcription of specific genes [15,16]. Smad7 as a negative factor can down-regulate TGF-β1/Smads signal transduction [17]. In our study, it was found that after treatment with TGFβ1 in different time periods, the protein expression of p-Smad2 and pSmad3 in silicosis fibroblasts were markedly increased, while the expression of Smad7 was decreased. This indicated that as the TGF-β1 action time increases, the positive feedback of the TGF-β1/Smads signal pathway is strengthened and the negative feedback is suppressed. This study was the first to propose the hypothesis of the regulation mechanism of TGF-β1-Smads signaling pathway: “The inhibition of negative feedback pathway Smad7 and the continued phosphorylation of Smad3 are important reasons for the regulation of TGF-β1-Smads signaling pathway”, which is significantly innovative in research ideas and results. Activation of TGF-β1 pathway in fibrosis and potent up-regulation of Smad2 and Smad3 proteins have been demonstrated both in human and in animal models of chronic kidney disease [18]. Both Smad2 and Smad3 proteins are phosphorylated in response to TGF-β1 receptor activation and insubsequent events become downstream mediators of TGF-β1signaling. Importantly, however, a plenty of data indicates Smad3 pathogenic role in silicosis fibrosis development. Sataranatarajan et al. [19] showed that matrix proteins expression can be directly driven by Smad3 through its binding to specific promoter regions of collagen genes. Besides, Sato et al. [20] showed that Smad3 KO mice had a protective effect on renal tubular interstitial fibrosis. Thus, in order to further confirm the role of Smad3 in TGF-β1/Smad signaling pathway, we added TβR1 inhibitors to detect changes in Samd3 expression. Western-blotting showed that after blocking the upstream signal, Smad3 still continues to hyperphosphorylate. Correspondingly, immunofluorescence staining showed a large amount of p-Smad3 were accumulated in the nucleus. Our study confirmed that continuous phosphorylation of Smad3 leads to silicosis fibrosis and it is the target of TGF-β1induced silicosis fibroblast fibrosis. ASV is one of the most active compounds isolated from Radix Astragali, anedible herb used widely in traditional Chinese medicine for several centuries [21]. ASV has been used to treat several fibrotic disease in vivo including systemic sclerosis, liver fibrosis as well as lung fibrosis [8,22]. Previous study has proved that ASV can alleviate the progression of kidney fibrosis via inhibition of MAPK pathway and TGFβ1/Smad signalling pathway [23]. Besides, ASV could protect against TGF-β1-induced EMT by inhibiting in peritoneal mesothelial cells by promoting Smad 7 expression [24]. In order to verify whether ASV can inhibit silicosis fibroblast fibrosis through TGF-β1/Smad signaling pathway, we detected the expression changes of p-Smad2, p-Smad3 and
Smad7, and observed the nucleoplasm distribution of p-Smad3. Remarkably, after treatment with ASV, the expression of p-Samd2 and pSmad3 proteins were decreased markedly, while the protein expression of Smad7 was increased significantly in comparison to the model group. A similar pattern change was observed inimmunofluorescence staining. The above results indicated that ASV could inhibit the phosphorylation of TβR1-mediated receptor-activated Smads by promoting the expression of Smad7, thus inhibiting the sustained hyperphosphorylation of Smad3. Meanwhile, ASV could inhibit its aggregation in the nucleus, thereby inhibiting excessive deposition of extracellular matrix, inhibiting the formation of silicosis fibroblast fibrosis, and slowing down the pathological process of silicosis. Based on the previous studies, this study for the first time proposed the intervention of the traditional Chinese medicine monomer ASV on the deregulation of TGF-β1-Smads signaling pathway by “reducing the inhibition of negative feedback signaling pathway and blocking the continuous phosphorylation of Smad3”, which provides the theoretical foundation for silicosis treatment of new drug research and development. 5. Conclusion In this study, we demonstrated the anti-silicosis fibroblast fibrosis effects of ASV, which may be due to its regulation on continuous phosphorylation of Smad3, and the mechanism of action may be realized through the TGF-β1/Smad3 pathway. This is an attractive pharmacological tool for the treatment of silicosis. Funding This study was supported by the general project of National natural science foundation of China (No: 81473485； 81973630), Jinan Medical Science and Technology Innovation Program (No: 201704069) and Shandong University Basic Research Business Funding Project, Natural Science Special Project (No: 2017JC028). Tai'an Science and Technology development programme (guidance programme) (2018NS0170). Declaration of Competing Interest The authors declare no conflict of interest. Acknowledgements None. References [1] M.H. Ross, J. Murray, Occupational respiratory disease in mining, J. Occup. Med. Toxicol. 54 (2004) 304–310, https://doi.org/10.1093/occmed/kqh073. [2] M. Na, X. Hong, J. Fuyu, X. Dingjie, D. Sales, Z. Hui, W. Zhongqiu, L. Shifeng, G. Xuemin, C. Wenchen, L. Dan, Z. Guizhen, Z. Bonan, Z. Lijuan, L. Shumin, Z. Ying, W. Jin, R. Mingwang, R. Summer, Y. Fang, Proteomic profile of TGF-beta1 treated lung fibroblasts identifies novel markers of activated fibroblasts in the silica exposed rat lung, Exp. Cell Res. 375 (2019) 1–9, https://doi.org/10.1016/j.yexcr. 2019.01.010. [3] L. Shifeng, X. Hong, Y. Xue, N. Siyu, Z. Qiaodan, X. Dingjie, Z. Lijuan, W. Zhongqiu, G. Xuemin, C. Wenchen, Z. Guizhen, L. Dan, W. Ruimin, Y. Fang, Ac-SDKP increases alpha-TAT 1 and promotes the apoptosis in lung fibroblasts and epithelial cells double-stimulated with TGF-beta1 and silica, Toxicol. Appl. Pharmacol. 369 (2019) 17–29, https://doi.org/10.1016/j.taap.2019.02.015. [4] Y. Zhou, Z. He, Y. Gao, R. Zheng, X. Zhang, L. Zhao, M. Tan, Induced pluripotent stem cells inhibit bleomycin-induced pulmonary fibrosis in mice through suppressing TGF-beta1/Smad-Mediated epithelial to mesenchymal transition, Front. Pharmacol. 7 (2016) 430, https://doi.org/10.3389/fphar.2016.00430. [5] X. Song, W. Liu, S. Xie, M. Wang, G. Cao, C. Mao, C. Lv, All-transretinoic acid ameliorates bleomycin-induced lung fibrosis by downregulating the TGF-beta1/ Smad3 signaling pathway in rats, Lab. Invest. 93 (2013) 1219–1231, https://doi. org/10.1038/labinvest.2013.108. [6] L.C. Li, L.D. Kan, Traditional Chinese medicine for pulmonary fibrosis therapy: progress and future prospects, J. Ethnopharmacol. 198 (2017) 45–63, https://doi. org/10.1016/j.jep.2016.12.042.
8
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
9–33, https://doi.org/10.1002/jcb.21255. [16] H. Carl-Henrik, M. Aristidis, Role of smads in TGFβ signaling, Cell Tissue Res. 347 (2012) 21–36. [17] N. Du, Z. Xu, M. Gao, P. Liu, B. Sun, X. Cao, Combination of Ginsenoside Rg1 and Astragaloside IV reduces oxidative stress and inhibits TGF-beta1/Smads signaling cascade on renal fibrosis in rats with diabetic nephropathy, Drug Des. Devel. Ther. 12 (2018) 3517–3524, https://doi.org/10.2147/dddt.s171286. [18] H.Y. Lan, Diverse roles of TGF-beta/Smads in renal fibrosis and inflammation, Int. J. Biol. Sci. 7 (2011) 1056–1067, https://doi.org/10.7150/ijbs.7.1056. [19] K. Sataranatarajan, D. Feliers, M.M. Mariappan, H.J. Lee, M.J. Lee, R.T. Day, H.B. Yalamanchili, G.G. Choudhury, J.L. Barnes, H. Van Remmen, A. Richardson, B.S. Kasinath, Molecular events in matrix protein metabolism in the aging kidney, Aging Cell 11 (2012) 1065–1073, https://doi.org/10.1111/acel.12008. [20] M. Sato, Y. Muragaki, S. Saika, A.B. Roberts, A. Ooshima, Targeted disruption of TGF-beta1/Smad3 signaling protects against renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction, J. Clin. Invest. 112 (2003) 1486–1494, https://doi.org/10.1172/jci19270. [21] H. Sun, D. Xie, X. Guo, L. Zhang, Z. Li, B. Wu, X. Qin, Study on the relevance between beany flavor and main bioactive components in radix astragali, J. Agric. Food Chem. 58 (2010) 5568–5573, https://doi.org/10.1021/jf9042634. [22] Q. Qi, Y. Mao, J. Yi, D. Li, K. Zhu, X. Cha, Anti-fibrotic effects of Astragaloside IV in systemic sclerosis, Cell. Physiol. Biochem. 34 (2014) 2105–2116, https://doi.org/ 10.1159/000366405. [23] W. Xu, X. Shao, L. Tian, L. Gu, M. Zhang, Q. Wang, B. Wu, L. Wang, J. Yao, X. Xu, S. Mou, Z. Ni, Astragaloside IV ameliorates renal fibrosis via the inhibition of mitogen-activated protein kinases and antiapoptosis in vivo and in vitro, J. Pharmacol. Exp. Ther. 350 (2014) 552–562, https://doi.org/10.1124/jpet.114.214205. [24] L. Zhang, Z. Li, W. He, L. Xu, J. Wang, J. Shi, M. Sheng, Effects of astragaloside IV against the TGF-beta1-induced epithelial-to-Mesenchymal transition in peritoneal mesothelial cells by promoting smad 7 expression, Cell. Physiol. Biochem. 37 (2015) 43–54, https://doi.org/10.1159/000430332.
[7] L.Q. Meng, J.W. Tang, Y. Wang, J.R. Zhao, M.Y. Shang, M. Zhang, S.Y. Liu, L. Qu, S.Q. Cai, X.M. Li, Astragaloside IV synergizes with ferulic acid to inhibit renal tubulointerstitial fibrosis in rats with obstructive nephropathy, Br. J. Pharmacol. 162 (2011) 1805–1818, https://doi.org/10.1111/j.1476-5381.2011.01206.x. [8] W.N. Yu, L.F. Sun, H. Yang, Inhibitory Effects of Astragaloside IV on BleomycinInduced Pulmonary Fibrosis in Rats Via Attenuation of Oxidative Stress and Inflammation, Inflammation 39 (2016) 1835–1841, https://doi.org/10.1007/ s10753-016-0420-5. [9] L. Wang, Y.F. Chi, Z.T. Yuan, W.C. Zhou, P.H. Yin, X.M. Zhang, W. Peng, H. Cai, Astragaloside IV inhibits renal tubulointerstitial fibrosis by blocking TGF-beta/ Smad signaling pathway in vivo and in vitro, Exp. Biol. Med. (Maywood) 239 (2014) 1310–1324, https://doi.org/10.1177/1535370214532597. [10] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods. 25 (2001) 402–408, https://doi.org/10.1006/meth.2001.1262. [11] R.J. Phillips, M.D. Burdick, K. Hong, M.A. Lutz, L.A. Murray, Y.Y. Xue, J.A. Belperio, M.P. Keane, R.M. Strieter, Circulating fibrocytes traffic to the lungs in response to CXCL12 and mediate fibrosis, J. Clin. Invest. 114 (2004) 438–446, https://doi.org/10.1172/jci20997. [12] F. Cheng, Y. Shen, P. Mohanasundaram, M. Lindstrom, J. Ivaska, T. Ny, J.E. Eriksson, Vimentin coordinates fibroblast proliferation and keratinocyte differentiation in wound healing via TGF-beta-Slug signaling, Proc Natl Acad Sci U S A 113 (2016) E4320–E4327, https://doi.org/10.1073/pnas.1519197113. [13] H. Liu, S. Fang, W. Wang, Y. Cheng, Y. Zhang, H. Liao, H. Yao, J. Chao, Macrophage-derived MCPIP1 mediates silica-induced pulmonary fibrosis via autophagy, Part. Fibre Toxicol. 13 (2016) 55, https://doi.org/10.1186/s12989-0160167-z. [14] L. Xiao, Y. Du, Y. Shen, Y. He, H. Zhao, Z. Li, TGF-beta 1 induced fibroblast proliferation is mediated by the FGF-2/ERK pathway, Front. Biosci. (Landmark Ed) 17 (2012) 2667–2674. [15] K.A. Brown, J.A. Pietenpol, H.L. Moses, A tale of two proteins: differential roles and regulation of Smad2 and Smad3 in TGF-beta signaling, J. Cell. Biochem. 101 (2007)
9
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Inhibitory effects of astragaloside IV on silica-induced pulmonary fibrosis via inactivating TGF-β1/Smad3 signaling Nannan Lia,b, Feifei Fenga, Ke Wuc, Huanan Zhanga, Wei Zhangb, Wei Wanga,
T
⁎
a
Department of Respiratory Medicine, The Second Hospital of Shandong University, Jinan, 250033, Shandong, PR China Department of Respiratory Medicine, Central Hospital of Tai'an of Shandong Province, Tai’an, 271000, Shandong, PR China c Department of Cardiology, Central Hospital of Tai’an of Shandong Province, Tai’an, 271000, Shandong, PR China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Astragaloside ASV Silicosis Pulmonary fibrosis Transforming growth factor-beta 1 Extracellular matrix
Purpose: To observe the effect of astragaloside ASV (ASV) on silicosis fibroblasts, and further investigate its regulatory mechanism on TGF-β1/Smad3 signaling pathway. Methods: Silica-induced rats model was established in this study. RT-qPCR was performed to detect α-SMA, Collagen I, Collagen III, Smad2, Smad3 and Smad7 expression. Immunofluorescence was conducted to detect αSMA, Collagen I, Collagen III and p-Smad3 protein and the nucleoplasmic distribution of p-Smad3.Westernblotting was performed to detect the protein of Smad2, p-Smad2, Smad3, p-Smad3 and Smad7. Results: 20 μg/mL ASV could effectively reduce the expression of α-SMA, Collagen I, Collagen III. TGF-β1 stimulated the proliferation of fibroblasts, promoted phosphorylation of Smad2 and Smad3, and down-regulated Smad7 expression. Among them, continuous phosphorylation of Smad3 is a major factor in causing fibrosis. Besides, ASV can inhibit silica-induced lung fibroblast fibrosis through TGF-β1/Smad3 signaling pathway, thereby inhibiting the formation of silicosis. Conclusion: ASV could inhibit the expression of collagen in fibroblasts and the transformation to myofibroblasts, and has an anti-silicosis fibrosis effect, which may be related to the continuous phosphorylation of Smad3 in the TGF-β1/Smad signaling pathway.
1. Introduction Silicosis is caused by the chronic inhalation of large amounts of dust from the environment which contains silica particles [1]. Though this disease is largely preventable by implementing strict safety and health standards at work, silicosis remains one of the more common occupational disorders in many parts of the world, including China [2]. Pathological changes in silicosis include irreversible and incurable formation of silicotic nodules and excessive deposition of extracellular matrix (ECM), which resulted in lung function insufficiency [3]. The presence of silicosis has been known for centuries; however, the pathological mechanism of silicosis is still unclear. Thus, it is urgent to mechanistically understand the pathogenesis of silicosis to develop new treatments for this fatal disease. Although the etiology of silicosis is still unclear, emerging studies
have shown that some special type of cells and cytokines play vital roles in the process of silicosis [4]. Among the many factors and cytokines that regulate lung fibrosis, transforming growth factor-beta 1 (TGF-β1) is a critical factor. It can stimulate fibroblast proliferation and the production of collagen around the silica particles, resulting in pulmonary fibrosis and the formation of silicotic nodules. In addition, TGF-β1 can also initiate fibroblasts differentiation into myofibroblasts, causing ECM deposition [5]. Thus, suppressing TGF-β1 expression is of potential value for silicosis. Due to there is no effective drugs to improve the survival of patients with silicosis, herbal medicines as well as the extracts have been increasingly become the focus of attention [6]. Astragaloside ASV (ASV) is one of the major and main active substances of traditional Chinese medicinal plant astragalusmembranaceus. Recently, studies have demonstrated that it has a plenty of pharmacologic effects forits potent
Abbreviations: ASV, astragaloside ASV; ECM, extracellular matrix; TGF-β1, transforming growth factor-beta 1; α-SMA, α-Smooth muscle actin; TβRI, TGF-β type I receptor; TβRII, TGF-β type II receptor ⁎ Corresponding author at: Department of Respiratory Medicine, The Second Hospital of Shandong University, No. 247 Beiyuan Street, Jinan, 250033, Shandong, PR China. E-mail addresses: [email protected] (N. Li), [email protected] (F. Feng), [email protected] (K. Wu), [email protected] (H. Zhang), [email protected] (W. Zhang), [email protected] (W. Wang). https://doi.org/10.1016/j.biopha.2019.109387 Received 28 June 2019; Received in revised form 16 August 2019; Accepted 22 August 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
immunoregulatory, anti-inflammatory, anti-asthma, and anti-fibrotic actions [7]. ASV was found to against BLM-induce pulmonary fibrosis by inhibiting the levels of oxidative stress and inflammatory response [8]. Besides, it was found that ASV can alleviate the progression of kidney fibrosis via inhibition of MAPK pathway and TGF-β1/Smad signaling pathway [9]. However, there is a lack of data regarding the effects of ASV on silicosis fibroblast fibrosis. Thus, in this study, we explore the method of inhibiting of TGF-β1 signaling, investigate the effects of ASV on silicosis and its underlying mechanisms, which could provide a novel potential target for the treatment of silicosis.
72 h). To investigate the continuous phosphorylation of Smads3 in the TGF-β1-Smad signaling pathway, the expression of p-Smads3 under different TGF-β1 treatments times (24 h, 48 h and 72 h) were detected. To investigate the effects of 20 mg/L ASV on the silicosis fibrosis through the TGF-β1/Smad3 signaling pathway, the expression of the corresponding downstream genes after treatment with ASV for 24 h were detected.
2. Materials and methods
Tissue sections were deparaffinized in xylene and rehydrated in a series of alcohol solutions. After a brief wash in distilled water, the sections were stained with Harris haematoxylin solution for 5 min, washed in tap water and counterstained in eosin - phloxine solution for 2 min.
2.5. Haematoxylin and eosin staining (HE staning)
2.1. Animals 120 Sprague-Dawley (SD) rats weighing 180–200 g were randomly divided into control group (Control group, n = 40), Silica-induced rats model group (Model group, n = 40), Astragaloside IV group (ASV group, n = 40). The rats were housed under controlled temperature (22 °C ± 2 °C) and exposed to a 12-h light-dark cycle. In Control group, rats were injected with 1 ml of physiological saline and 0.25 ml of air; In Model group, rats were infused with 1 ml of a 50 mg/ml silica dust suspension and 0.25 ml of air; In ASV group, rats were subjected to the same operating procedure as group Model, and intraperitoneally injected 20 mg/kg ASV once a day. All the rats were provided with free access to standard rat feed and tap water. All the animal experimental procedures were approved by the Experimental Animal Ethics Committee of The Second Hospital of Shandong University (NO. 20140195). All experiments were carried out in accordance with the the guidelines of the Chinese Association of Laboratory Animal Care.
2.6. Immunofluorescence analysis After the fixation with 4% paraformaldehyde (80096618, SINOPHARM, China), fibroblast were permeabilized with methanol, and blocked with 5% BSA (BS043, Biosharp, China) in PBS for 20 min. Then fibroblast were immunolabeled with antibodies: α-Smooth muscle actin (α-SMA), Collagen I, Collagen III and p-smads3 (ab52903, Abcam, England). After incubation, the cells were washed with PBS followed by FITC-conjugated secondary antibody. After the nuclei were counterstained with DAPI, the samples were observed under a fluorescence microscope (BX53, Olympus, Japan).
2.7. Real-time PCR analysis
2.2. Silica-induced rats model
Total RNA was extracted using TRIzol kit (RP1001, BioTeke, Beijing, China) according to the manufacturer's protocol. After it was reverse transcribed to cDNA using a Sensiscript RT kit (PR6502, BioTeke, Beijing, China). Subsequently RT-qPCR was performed. The conditions were as follows: 95 °C for 5 min; 30 cycles of 95 °Cfor 30 s, 56 °C for 30 s and extension at 72 °C for 1 min. Relative quantities of mRNA were calculated using the 2−ΔΔCt method [10] and normalized to housekeeping gene β-actin. The experiment was repeated3 times. PCR primer sequences are shown in Table 1.
All the animals were anesthetized with 1% pentobarbital sodium (57-33-0, Dainippon Sumitomo Pharma, Osaka, Japan) and kept on a 60° inclined board with the help of rubber bands. The tongue of mice were pulled and held with the help of blunt forceps. Under the head mirror, the epidural anesthesia catheter with connector connected with 1 mL syringe was inserted into the trachea to the bifurcation of the trachea for endotracheal intubation. The crystalline particles were suspended in normal sterile saline and the suspension (50 mg/mL) was vigorously mixed by avortex shaker (Stuart, UK), before instillation in rat.
2.8. Western-blotting analysis 2.3. Cell culture Cells were lysed with buffer and incubated at 4 °C for 1 h. The lysates were ultrasonicated and centrifuged at 12,000 g for 10 min. Protein concentrations were determined by bicinchoninic acid methods. Protein samples were separated on polyacrylamide-SDS gels (WLA013, wanleibio, China) and electroblotted ontonitrocellulose membranes (Millipore, USA). After blocking with TBS, 5% nonfat dry milk for 2 h, the membrane was incubated overnight at 4 °C with antibodies against Smad2, p-Smad2, Smad3, p-Smad3 and Smad7 followed by incubation with a HRP-conjugated secondary antibody for 45 min at room temperature. After each incubation, the membrane was thoroughly washed with TBST. Then coloring reaction was carried out with DAB and the ratio was then quantified by GelDoc XR System (Bio-RAD, USA).
Lung tissue of normal Wistar rats and silicosis Wistar rats (6–8 weeks) were minced into small pieces (approximately 1 mm3). After being rinsed with PBS, pieces were incubated in DMEM that was supplemented with 1 mg/mL collagenase type I (Worthington, Lakewood, NJ, USA), 0.5 mg/mL dispase (Thermo Fisher Scientific), 2 U/mL DNase (Qiagen, Valencia, CA, USA), 0.1 mg/mL streptomycin, and 100 U/mL penicillin at 37 °C for 15 min with gentle shaking. After washing twice with DMEM, the resulting pieces were transferred to culture flask (Thermo Fisher Scientific) and cultured at 37 °C with 5% CO2. When the flask reached confluence, outgrown cells were harvested as cells at passage 0. Expanded cells at passage 2˜5 were used in experiments. 2.4. Cell treatment
2.9. Statistical analysis To investigate the effects of ASV on silicosis fibrosis, the mRNA expression of α-SMA, Collagen I and Collagen III were detected under different ASV concentrations (7 μg/mL, 20 μg/mL and 60 μg/mL) and treatment times (24 h, 36 h and 48 h). To investigate the effects of TGFβ1 on silicosis fibrosis, cells were maintained in growth media supplemented with 5 ng/mL TGF-β1 for various time (0 h, 24 h, 48 h and
SPSS 19.0 (SPSS Inc, USA) was applied to analyze all data. Results are expressed as mean ± standard deviation (SD). One-way ANOVA analysis of variance was used to determine the significant differences among the groups. Values of p < 0.05 were considered statistically significant. 2
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
Table 1 Primers used for Real Time PCR. Gene
Forward (5’-3’)
Reserve (3’-5’)
Collagen I Collagen III α-SMA Smad2 Smad3 Smad7 β-actin GAPDH
GAGGGCCAAGACGAAGACATC GGAGCTGGCTACTTCTCGC GAGAGGAGCAAAATCTGTCCG GAAGGCAGACGGTAACAA GGAGGAGAAATGGTGCGAGAA CAACCGCAGCAGTTACCC CACTGTGCCCATCTACGAGG GGAGCGAGATCCCTCCAAAAT
CAGATCACGTCATCGCACAAC GGGAACATCCTCCTTCAACAG GGGGGAATTATCTTTCCTGGTCC GCACCGAGCACAGGAAGTTGG GCCACAGGCGGCAGTAGAT GTCGAAAGCCTTGATGGAGA TAATGTCACGCACGATTTCC GGCTGTTGTCATACTTCTCATGG
α-SMA, α-Smooth muscle actin. β-actin, β-non-muscle. GADPH, glyceraldehyde-3-phosphate dehydrogenase.
3. Result
Collagen I and Collagen III were decreased significantly(P < 0.05). On the basis of qRT-PCR results, we conducted immunofluorescence analysis to verify our results. More interestingly, a similar pattern change was observed in immunofluorescence, which was markedly increased in model group at 24 h when compared with control group. After the addition of ASV, weaken fluorescence could be observed (Figs. 3–5).
3.1. The pathological changes detected by HE staning HE staining results showed that the lung tissue structure in the control group was normal and no obvious morphological changes were observed. However, in the silicosis model group, we observed that the lung tissue structure of the rats was damaged, the alveoli collapsed, and the fibrous tissue was obviously proliferated, especially around the small blood vessels and bronchioles. In addition, under the microscopic examination, it was found that there were silicon nodules of different sizes in the lung tissue, mainly composed of III-IV nodules, partially fused into a piece, and a large amount of collagen fibers proliferated in the center of the nodules. Interestingly, when ASV was added, the silicon nodules in the lung tissue were reduced, mainly in grades I to II, with a dispersed distribution and no fusion. The nodules are mainly composed of fibroblasts, macrophages and a small amount of collagen fibers (Fig. 1).
3.3. TGF-β1 promoted Smad2 and Smad3 expression, and inhibited Smad7 expression To explore the effects of TGF-β1 on silicotic fibroblasts, we treated them with 5 ng/mL TGF-β1 for 0, 24, 48 and 72 h, respectively. qRTPCR results showed that there were no significant changes in the mRNA expression of Smad2 and Smad3 in the corresponding time as compared with the Control group. However, the expression of Smad7 decreased significantly with the increase of TGF-β1 treatment times. (Fig. 6A-C). Western-blotting analysis results showed that the ratio of p-Smad2/ Smad2 and p-Smad3/Smad3 significantly increased, while the protein expression Smad7 were significantly decreased. More specifically, quantized histogram showed a up-regulated protein expressions of pSmad2 and p-Smad3 and a down-regulated protein expressions of Smad7 in silicosis fibroblasts when compared Control group (P < 0.05; Fig. 6D-F).
3.2. ASV down-regulated the expressions of α-SMA, collagen I and Collagen III To investigate the effects of ASV on silicosis fibroblast fibrosis, we detected the expression changes of α-SMA, Collagen I and Collagen III at different ASV concentrations and treatment times. As shown in Fig. 2A-C, compared with control group, α-SMA, Collagen I and Collagen III expression were significantly increased (P < 0.05). However, after treatment with 7 μg/mL, 20 μg/mL and 60 μg/ML ASV respectively, all the mRNA expressions were significantly decreased in comparison to model group (P < 0.05). Among them, the changes were particularly significant under 20 μg/mL ASV treatment. Fig. 2D-E showed the expression changes of the above three genes after ASV treatment for 24, 36 and 48 h respectively. It was found that the α-SMA, Collagen I and Collagen III mRNA expression were significantly increased in group Model as compared with group Control. Conversely, when treated by 20 μg/mL ASV, the mRNA expression of α-SMA,
3.4. Continuous phosphorylation of Smad3 leaded to fibrosis of silicosis fibroblasts To further explore the mechanism of fibrosis induced by TGF-β1Smad signaling pathway, silicosis fibroblasts were treated with 5 ng/mL TGF-β1 for 24 h, 48 h and 72 h, respectively, and then incubated with TβR1 inhibitor for 24 h to block the upstream signal of TGF-β1-Smads signaling pathway. As shown in Fig. 6, intense p-Smad3 immunofluorescence were detected at 24 h, 48 h and 72 h in the silicosis fibroblasts when compared with the Control group and the fluorescence intensity increased with the increase of treatment time (Fig. 7).
Fig. 1. Examination of lung histological and morphological alterations. HE staining results showed that the lung tissue structure in the control group was normal and no obvious morphological changes were observed. While in the silicosis model group, the lung tissue structure of the rats was damaged, the alveoli collapsed, and the fibrous tissue was obviously proliferated. In addition, it was found that there were silicon nodules of different sizes in the lung tissue, mainly composed of III-IV nodules, partially fused into a piece, and a large amount of collagen fibers proliferated in the center of the nodules. After treatment with ASV, the silicon nodules in the lung tissue were reduced, with a dispersed distribution and no fusion. 3
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
Fig. 2. The mRNA expression of Collagen I, Collagen III and α-SMA at different concentrations and different treatment times of ASV. (A) After treatment of 20 μg/mL ASV, the down-regulation of Collagen I was more significant; (B) Collagen III mRNA expression was significantly reduced after treatment with 20 μg/mL ASV; (C) The expression of α-SMA were all significant decreased after 20 μg/mL and 60 μg/mL ASV treatment. *indicated Model group compared with Control group; #indicated 7 μg/mL, 20 μg/mL and 60 μg/mL groups compared with Model group. (D) Collagen I mRNA was significantly down-regulated at 24 h, 36 h and 42 h after ASV treatment; (E) Collagen III mRNA was significantly down-regulated at 24 h, 36 h and 42 h after ASV treatment, which was most obvious at 24 h; (F) α-SMA mRNA changed most significantly at 24 h after ASV treatment; *indicated Model group compared with Control group; #indicated 24 h, 36 h and 48 h groups compared with Model group.
Fig. 3. Immunofluorescence staining of Collagen I at 24 h after ASV treatment in each group. Compared with Model group, the fluorescence intensity was significantly decreased in ASV group. Scale bar = 100 μm.
3.5. ASV inhibited fibrosis of silicosis fibroblasts by TGF-β1-Smads signaling pathway
Smad3 signaling pathway in the treatment of silicosis, 20 mg/L ASV were given immediately after TGF-β1 administration. Compared with Control group, a down-regulated mRNA expressions of Smad7 was observed in Model group. However, when ASV was added, their
To further investigate the relationship between ASV and TGF-β14
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
Fig. 4. In Model group, strong immunofluorescence of Collagen III were observed. After the addition of ASV, fluorescence intensity were significantly reduced. Scale bar = 100 μm.
Fig. 5. Intense α-SMA immunofluorescence was detected at 24 h in the Model group when compared with the Control group. 20 μg/mL ASV treatment attenuated αSMA immunofluorescence in comparison to Model group. Scale bar = 100 μm.
immunoreactivity were significantly decreased when compared with the matching Model group (Fig. 9).
expression increased significantly (P < 0.05; Fig. 8C). Smad2 and Smad3 showed no significant changes in the three groups above (Fig. 8A and B). Western-blotting analysis results showed that the pSmad2 and p-Smad3 protein expression were significantly increased in Model group as compared with Control group, while the Smad7 protein expression was decreased significantly (P < 0.05). More interestingly, treatment with ASV markedly decreased the expression of p-Smad2 protein and p-Smad3 protein and increased the expression of Smad7 protein when compared Control group (P < 0.05; Fig. 8D-F) To confirm the role of p-Smad3 in the whole signaling pathway, we conducted immunofluorescence assay. Strong p-Smad3 immunoreactivity was detected in the Model group when compared with Control group. After treatment with ASV, however, p-Smad3
4. Discussion Silicosis is a highly prevalent occupational condition that is caused by chronic inhalation of crystalline silica particulates (aerodynamic diameter < 5 μm) into the distal air spaces of the lung. Although silica dust has been shown to injure many cell types in the lung it is generally believed that activated myofibroblasts play a central role in driving the development of disease [2]. Myofibroblasts, which are characterized by up-regulation of a-smooth muscle actin (a-SMA), fibronectin, and collagens, can result inexcessive ECM (collagen I and collagen III) 5
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
Fig. 6. Smad2, p-Smad2, Smad3, p-Smad3 and Smad7 expression changes at different treatment times of TGF-β1. (A) After treatment with TGF-β1 for 24 h, 48 h and 72 h, there was no significant mRNA expression changes of Smad2 in comparison to Control group; (B) There was no significant changes in Smad3 mRNA expression after treatment with TGF-β1 for 24 h, 48 h and 72 h; (C) With the increase of treatment time of TGF-β1, the mRNA expression of Smad7 was significantly downregulated, which was most obvious at 72 h; *indicated 24 h, 48 h and 72 h groups compared with Control group. (D) p-Smad2 (60 kDa), Smad2 (55 kDa) and β-actin (42 kDa) immunoreactive bands, respectively. The ratio of p-Smad2/Smad2 increased with the time of TGF-β1 treatment; (E) The protein expression of p-Smad3 increased with the treatment time of TGF-β1; (F) Compared with Control group, Smad7 protein was significantly decreased after treatment with TGF-β1; *indicated 24 h, 48 h and 72 h groups compared with Control group.
deposition, contributing to epithelial cell death and fibrotic remodeling due to lung fibroblasts activation and differentiation [11]. Here in our study, RT-qPCR results showed that a suppressed expression of α-SMA,
Collagen I and Collagen III following ASV treatment in SiO2 induced silicosis fibroblast fibrosis in vitro. This are consistent with previous study that a-SMA, Collagen I, Collagen III, FSP-1, fibronetin and
Fig. 7. Fluorescence changes of p-Smad3 after treatment with TGF-β1 for 24, 48 and 72 h, respectively. Intense p-Smad3 immunofluorescence were observed in the silicosis fibroblasts and the fluorescence intensity increased with prolonged treatment time of TGF-β1. Scale bar = 50 μm. 6
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
Fig. 8. The expression changes of Smad2, p-Smad2, Smad3, p-Smad3 and Smad7 after 20 mg/L ASV treatment for 24 h. (A) Compared with the Control group and Model group, there was no mRNA expression changes of Smad2 after treatment with 20 mg/L ASV; (B) After treatment with 20 mg/L ASV, Smad3 mRNA has no significant change in compareision to Control group; (C) After the addition of 20 mg/L ASV, Smad7 mRNA significantly increased; (D) The protein expression changes of Smad2 and p-Smad2. The ratio of p-Smad2/Smad2 reduced after treatment with ASV when compared with Model group. (E) The ratio of p-Smad3/Smad3 reduced after treatment with ASV when compared with Model group. (F) Smad7 protein expression was significantly increased after treatment with ASV. *indicated Model group compared with Control group; #indicated 20 mg/L group compared with Model group.
Fig. 9. Immunofluorescence staining of p-Smad3 after treatment with 20 mg/L ASV for 24 h. Strong p-Smad3 immunoreactivity was detected in the Model group After treatment with ASV, however, p-Smad3 immunoreactivity were significantly decreased and its accumulation in the nucleus is reduced. Scale bar = 50 μm.
7
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
Vimentin ablation attenuates fibrosis in the lung tissue samples from mouse [12]. Based on this finding, we conducted immunofluorescence staining to further confirm our conclusions. As expected, after treatment with ASV, the fluorescence intensity of the three genes above were significantly decreased as compared with model group, suggesting that ASV intervention can reduce the expression of collagen in silicosis fibroblasts and the transformation into myofibroblasts, and has the effect of resisting silicosis fibroblast fibrosis. It has been well documented that the elevation of transforming growth factor TGF-β1 released from macrophages induced by silica promotedfibroblast migration, proliferation and myofibroblast differentiation [13]. Besides, it turned out to be a pleiotropic cytokine that has a crucial role in many aspects of the lung fibrotic response and has long been believed to be a central mediator of this response [14]. Important intracellular mediators of TGFβ signaling are members of the Smad family which have key roles in exerting TGFβ-induced EMT. TGFβ isoforms exert their cellular effects by binding to the TGF-β type II receptor (TβRII), and this binding facilitates activation of TGF-β type I receptor (TβRI) kinase, which leads to the activation of Smad2 and Smad3. Phosphorylated Smads partner with cytosolic Smad4 and form a heteromericsmad complex, which translocates to the nucleus where they cooperate with other transcription factors, co-activators and corepressors to regulate the transcription of specific genes [15,16]. Smad7 as a negative factor can down-regulate TGF-β1/Smads signal transduction [17]. In our study, it was found that after treatment with TGFβ1 in different time periods, the protein expression of p-Smad2 and pSmad3 in silicosis fibroblasts were markedly increased, while the expression of Smad7 was decreased. This indicated that as the TGF-β1 action time increases, the positive feedback of the TGF-β1/Smads signal pathway is strengthened and the negative feedback is suppressed. This study was the first to propose the hypothesis of the regulation mechanism of TGF-β1-Smads signaling pathway: “The inhibition of negative feedback pathway Smad7 and the continued phosphorylation of Smad3 are important reasons for the regulation of TGF-β1-Smads signaling pathway”, which is significantly innovative in research ideas and results. Activation of TGF-β1 pathway in fibrosis and potent up-regulation of Smad2 and Smad3 proteins have been demonstrated both in human and in animal models of chronic kidney disease [18]. Both Smad2 and Smad3 proteins are phosphorylated in response to TGF-β1 receptor activation and insubsequent events become downstream mediators of TGF-β1signaling. Importantly, however, a plenty of data indicates Smad3 pathogenic role in silicosis fibrosis development. Sataranatarajan et al. [19] showed that matrix proteins expression can be directly driven by Smad3 through its binding to specific promoter regions of collagen genes. Besides, Sato et al. [20] showed that Smad3 KO mice had a protective effect on renal tubular interstitial fibrosis. Thus, in order to further confirm the role of Smad3 in TGF-β1/Smad signaling pathway, we added TβR1 inhibitors to detect changes in Samd3 expression. Western-blotting showed that after blocking the upstream signal, Smad3 still continues to hyperphosphorylate. Correspondingly, immunofluorescence staining showed a large amount of p-Smad3 were accumulated in the nucleus. Our study confirmed that continuous phosphorylation of Smad3 leads to silicosis fibrosis and it is the target of TGF-β1induced silicosis fibroblast fibrosis. ASV is one of the most active compounds isolated from Radix Astragali, anedible herb used widely in traditional Chinese medicine for several centuries [21]. ASV has been used to treat several fibrotic disease in vivo including systemic sclerosis, liver fibrosis as well as lung fibrosis [8,22]. Previous study has proved that ASV can alleviate the progression of kidney fibrosis via inhibition of MAPK pathway and TGFβ1/Smad signalling pathway [23]. Besides, ASV could protect against TGF-β1-induced EMT by inhibiting in peritoneal mesothelial cells by promoting Smad 7 expression [24]. In order to verify whether ASV can inhibit silicosis fibroblast fibrosis through TGF-β1/Smad signaling pathway, we detected the expression changes of p-Smad2, p-Smad3 and
Smad7, and observed the nucleoplasm distribution of p-Smad3. Remarkably, after treatment with ASV, the expression of p-Samd2 and pSmad3 proteins were decreased markedly, while the protein expression of Smad7 was increased significantly in comparison to the model group. A similar pattern change was observed inimmunofluorescence staining. The above results indicated that ASV could inhibit the phosphorylation of TβR1-mediated receptor-activated Smads by promoting the expression of Smad7, thus inhibiting the sustained hyperphosphorylation of Smad3. Meanwhile, ASV could inhibit its aggregation in the nucleus, thereby inhibiting excessive deposition of extracellular matrix, inhibiting the formation of silicosis fibroblast fibrosis, and slowing down the pathological process of silicosis. Based on the previous studies, this study for the first time proposed the intervention of the traditional Chinese medicine monomer ASV on the deregulation of TGF-β1-Smads signaling pathway by “reducing the inhibition of negative feedback signaling pathway and blocking the continuous phosphorylation of Smad3”, which provides the theoretical foundation for silicosis treatment of new drug research and development. 5. Conclusion In this study, we demonstrated the anti-silicosis fibroblast fibrosis effects of ASV, which may be due to its regulation on continuous phosphorylation of Smad3, and the mechanism of action may be realized through the TGF-β1/Smad3 pathway. This is an attractive pharmacological tool for the treatment of silicosis. Funding This study was supported by the general project of National natural science foundation of China (No: 81473485； 81973630), Jinan Medical Science and Technology Innovation Program (No: 201704069) and Shandong University Basic Research Business Funding Project, Natural Science Special Project (No: 2017JC028). Tai'an Science and Technology development programme (guidance programme) (2018NS0170). Declaration of Competing Interest The authors declare no conflict of interest. Acknowledgements None. References [1] M.H. Ross, J. Murray, Occupational respiratory disease in mining, J. Occup. Med. Toxicol. 54 (2004) 304–310, https://doi.org/10.1093/occmed/kqh073. [2] M. Na, X. Hong, J. Fuyu, X. Dingjie, D. Sales, Z. Hui, W. Zhongqiu, L. Shifeng, G. Xuemin, C. Wenchen, L. Dan, Z. Guizhen, Z. Bonan, Z. Lijuan, L. Shumin, Z. Ying, W. Jin, R. Mingwang, R. Summer, Y. Fang, Proteomic profile of TGF-beta1 treated lung fibroblasts identifies novel markers of activated fibroblasts in the silica exposed rat lung, Exp. Cell Res. 375 (2019) 1–9, https://doi.org/10.1016/j.yexcr. 2019.01.010. [3] L. Shifeng, X. Hong, Y. Xue, N. Siyu, Z. Qiaodan, X. Dingjie, Z. Lijuan, W. Zhongqiu, G. Xuemin, C. Wenchen, Z. Guizhen, L. Dan, W. Ruimin, Y. Fang, Ac-SDKP increases alpha-TAT 1 and promotes the apoptosis in lung fibroblasts and epithelial cells double-stimulated with TGF-beta1 and silica, Toxicol. Appl. Pharmacol. 369 (2019) 17–29, https://doi.org/10.1016/j.taap.2019.02.015. [4] Y. Zhou, Z. He, Y. Gao, R. Zheng, X. Zhang, L. Zhao, M. Tan, Induced pluripotent stem cells inhibit bleomycin-induced pulmonary fibrosis in mice through suppressing TGF-beta1/Smad-Mediated epithelial to mesenchymal transition, Front. Pharmacol. 7 (2016) 430, https://doi.org/10.3389/fphar.2016.00430. [5] X. Song, W. Liu, S. Xie, M. Wang, G. Cao, C. Mao, C. Lv, All-transretinoic acid ameliorates bleomycin-induced lung fibrosis by downregulating the TGF-beta1/ Smad3 signaling pathway in rats, Lab. Invest. 93 (2013) 1219–1231, https://doi. org/10.1038/labinvest.2013.108. [6] L.C. Li, L.D. Kan, Traditional Chinese medicine for pulmonary fibrosis therapy: progress and future prospects, J. Ethnopharmacol. 198 (2017) 45–63, https://doi. org/10.1016/j.jep.2016.12.042.
8
Biomedicine & Pharmacotherapy 119 (2019) 109387
N. Li, et al.
9–33, https://doi.org/10.1002/jcb.21255. [16] H. Carl-Henrik, M. Aristidis, Role of smads in TGFβ signaling, Cell Tissue Res. 347 (2012) 21–36. [17] N. Du, Z. Xu, M. Gao, P. Liu, B. Sun, X. Cao, Combination of Ginsenoside Rg1 and Astragaloside IV reduces oxidative stress and inhibits TGF-beta1/Smads signaling cascade on renal fibrosis in rats with diabetic nephropathy, Drug Des. Devel. Ther. 12 (2018) 3517–3524, https://doi.org/10.2147/dddt.s171286. [18] H.Y. Lan, Diverse roles of TGF-beta/Smads in renal fibrosis and inflammation, Int. J. Biol. Sci. 7 (2011) 1056–1067, https://doi.org/10.7150/ijbs.7.1056. [19] K. Sataranatarajan, D. Feliers, M.M. Mariappan, H.J. Lee, M.J. Lee, R.T. Day, H.B. Yalamanchili, G.G. Choudhury, J.L. Barnes, H. Van Remmen, A. Richardson, B.S. Kasinath, Molecular events in matrix protein metabolism in the aging kidney, Aging Cell 11 (2012) 1065–1073, https://doi.org/10.1111/acel.12008. [20] M. Sato, Y. Muragaki, S. Saika, A.B. Roberts, A. Ooshima, Targeted disruption of TGF-beta1/Smad3 signaling protects against renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction, J. Clin. Invest. 112 (2003) 1486–1494, https://doi.org/10.1172/jci19270. [21] H. Sun, D. Xie, X. Guo, L. Zhang, Z. Li, B. Wu, X. Qin, Study on the relevance between beany flavor and main bioactive components in radix astragali, J. Agric. Food Chem. 58 (2010) 5568–5573, https://doi.org/10.1021/jf9042634. [22] Q. Qi, Y. Mao, J. Yi, D. Li, K. Zhu, X. Cha, Anti-fibrotic effects of Astragaloside IV in systemic sclerosis, Cell. Physiol. Biochem. 34 (2014) 2105–2116, https://doi.org/ 10.1159/000366405. [23] W. Xu, X. Shao, L. Tian, L. Gu, M. Zhang, Q. Wang, B. Wu, L. Wang, J. Yao, X. Xu, S. Mou, Z. Ni, Astragaloside IV ameliorates renal fibrosis via the inhibition of mitogen-activated protein kinases and antiapoptosis in vivo and in vitro, J. Pharmacol. Exp. Ther. 350 (2014) 552–562, https://doi.org/10.1124/jpet.114.214205. [24] L. Zhang, Z. Li, W. He, L. Xu, J. Wang, J. Shi, M. Sheng, Effects of astragaloside IV against the TGF-beta1-induced epithelial-to-Mesenchymal transition in peritoneal mesothelial cells by promoting smad 7 expression, Cell. Physiol. Biochem. 37 (2015) 43–54, https://doi.org/10.1159/000430332.
[7] L.Q. Meng, J.W. Tang, Y. Wang, J.R. Zhao, M.Y. Shang, M. Zhang, S.Y. Liu, L. Qu, S.Q. Cai, X.M. Li, Astragaloside IV synergizes with ferulic acid to inhibit renal tubulointerstitial fibrosis in rats with obstructive nephropathy, Br. J. Pharmacol. 162 (2011) 1805–1818, https://doi.org/10.1111/j.1476-5381.2011.01206.x. [8] W.N. Yu, L.F. Sun, H. Yang, Inhibitory Effects of Astragaloside IV on BleomycinInduced Pulmonary Fibrosis in Rats Via Attenuation of Oxidative Stress and Inflammation, Inflammation 39 (2016) 1835–1841, https://doi.org/10.1007/ s10753-016-0420-5. [9] L. Wang, Y.F. Chi, Z.T. Yuan, W.C. Zhou, P.H. Yin, X.M. Zhang, W. Peng, H. Cai, Astragaloside IV inhibits renal tubulointerstitial fibrosis by blocking TGF-beta/ Smad signaling pathway in vivo and in vitro, Exp. Biol. Med. (Maywood) 239 (2014) 1310–1324, https://doi.org/10.1177/1535370214532597. [10] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods. 25 (2001) 402–408, https://doi.org/10.1006/meth.2001.1262. [11] R.J. Phillips, M.D. Burdick, K. Hong, M.A. Lutz, L.A. Murray, Y.Y. Xue, J.A. Belperio, M.P. Keane, R.M. Strieter, Circulating fibrocytes traffic to the lungs in response to CXCL12 and mediate fibrosis, J. Clin. Invest. 114 (2004) 438–446, https://doi.org/10.1172/jci20997. [12] F. Cheng, Y. Shen, P. Mohanasundaram, M. Lindstrom, J. Ivaska, T. Ny, J.E. Eriksson, Vimentin coordinates fibroblast proliferation and keratinocyte differentiation in wound healing via TGF-beta-Slug signaling, Proc Natl Acad Sci U S A 113 (2016) E4320–E4327, https://doi.org/10.1073/pnas.1519197113. [13] H. Liu, S. Fang, W. Wang, Y. Cheng, Y. Zhang, H. Liao, H. Yao, J. Chao, Macrophage-derived MCPIP1 mediates silica-induced pulmonary fibrosis via autophagy, Part. Fibre Toxicol. 13 (2016) 55, https://doi.org/10.1186/s12989-0160167-z. [14] L. Xiao, Y. Du, Y. Shen, Y. He, H. Zhao, Z. Li, TGF-beta 1 induced fibroblast proliferation is mediated by the FGF-2/ERK pathway, Front. Biosci. (Landmark Ed) 17 (2012) 2667–2674. [15] K.A. Brown, J.A. Pietenpol, H.L. Moses, A tale of two proteins: differential roles and regulation of Smad2 and Smad3 in TGF-beta signaling, J. Cell. Biochem. 101 (2007)
9