Inhibitory effects of α-cyperone on adherence and invasion of avian pathogenic Escherichia coli O78 to chicken type II pneumocytes

Veterinary Immunology and Immunopathology 159 (2014) 50–57

Contents lists available at ScienceDirect

Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm

Research paper

Inhibitory effects of ␣-cyperone on adherence and invasion of avian pathogenic Escherichia coli O78 to chicken type II pneumocytes Li-Yan Zhang, Shuang Lv, Shuai-Cheng Wu, Xun Guo, Fang Xia, Xi-Rou Hu, Zhou Song, Cui Zhang, Qian-Qian Qin, Ben-Dong Fu ∗ , Peng-Fei Yi, Hai-Qing Shen, Xu-Bin Wei Department of Clinical Veterinary Medicine, College of Veterinary Medicine, Jilin University, No. 5333 Xi’an Road, Changchun 130062, Jilin, China

a r t i c l e

i n f o

Article history: Received 25 August 2013 Received in revised form 26 January 2014 Accepted 13 February 2014

Keywords: APEC-O78 Chicken type II pneumocytes Adherence Invasion Actin cytoskeleton polymerization ␣-cyperone

a b s t r a c t Avian pathogenic Escherichia coli (APEC) are extra-intestinal pathogenic E. coli, and usually cause avian septicemia through breaching the blood–gas barrier. Type II pneumocytes play an important role of maintaining the function of the blood–gas barrier. However, the mechanism of APEC injuring type II pneumocytes remains unclear. ␣-cyperone can inhibit lung cell injury induced by Staphylococcus aureus. In order to explore whether ␣-cyperone regulates the adherence and invasion of APEC-O78 to chicken type II pneumocytes, we successfully cultured chicken type II pneumocytes. The results showed that ␣-cyperone significantly decreased the adherence of APEC-O78 to chicken type II pneumocytes. In addition, ␣-cyperone inhibited actin cytoskeleton polymerization induced by APEC-O78 through down regulating the expression of Nck-2, Cdc42 and Rac1. These results provide new evidence for the prevention of colibacillosis in chicken. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Avian colibacillosis, caused by avian pathogenic Escherichia coli (APEC), is a serious infectious disease, characterized as septicemia, air sacculitis and salpingitis (Dho-Moulin and Fairbrother, 1999; Knobl et al., 2012). APEC strains mainly infect chicken and turkeys between 2 and 12 weeks old with high morbidity and mortality, resulting in huge economic losses wide world (Arne et al., 2000; Knobl et al., 2012; Schouler et al., 2012). Among the 171 serogroups of APEC strains, O78 serogroup (19.8%) is most frequently detected in animals (Orskov and Orskov, 1992; Saif and Barnes, 2008). APEC-O78 strain (APEC-O78)

∗ Corresponding author. Tel.: +86 431 87835379. E-mail addresses: [email protected], [email protected] (B.-D. Fu). http://dx.doi.org/10.1016/j.vetimm.2014.02.005 0165-2427/© 2014 Elsevier B.V. All rights reserved.

possesses many virulence factors including Fimbriae, LPS, ISS, ColV, etc. These virulence factors can bind to the corresponding receptors to attack the host (da Silveira et al., 2002). APEC must breach the blood–gas barrier to get access to the bloodstream and induce septicemia. The cell damage of the blood–gas barrier can induce acute lung injury (Meng et al., 2010). The bird blood–gas barrier is composed of airway epithelial cells and endothelial cells (Scheuermann et al., 1997). Type II pneumocytes (granular cells), one kind of airway epithelial cells, play an important role in maintaining the function of the blood–gas barrier (Bernhard et al., 2001; Bjornstad et al., 2014; Maina and King, 1982; Makanya et al., 2006). APEC can cause the expansion of endoplasmic reticulum and swollen mitochondria of chicken type II pneumocytes (Antao et al., 2008; Gibbs et al., 2004; Shi et al., 2002). Enteropathogenic E. coli and

L.-Y. Zhang et al. / Veterinary Immunology and Immunopathology 159 (2014) 50–57

Fig. 1. Chemical structure of ␣-cyperone.

enterohemorrhagic E. coli can attach intimately to the cell surface, and reorganize the underlying actin cytoskeleton into pedestals through regulating the activators of Cdc42, Rac1, Nck (Campellone, 2010; Tomasevic et al., 2007). However, the mechanism of APEC-O78 adherence and invasion to chicken type II pneumocytes is not very clear. Cyperus rotundus L. (Cyperaceae) grows in the tropical and temperate regions of Asia. The rhizomes of C. rotundus (Fig. 1) were used to treat infectious diseases in traditional Chinese medicine. ␣-Cyperone comprises about 20% of the total oil and is a major ingredient in the rhizomes of C. rotundus with antivirulence, antigenotoxic, and antibacterial activities (Jin et al., 2011). It is reported that ␣-cyperone alleviates the lung cell injury caused by Staphylococcus aureus (Luo et al., 2012). Therefore, in this study, we investigate whether ␣-cyperone inhibits the injury of APEC-O78 to chicken type II pneumocytes. 2. Materials and methods 2.1. Bacterial strain culture conditions APEC O78 strain (China General Microbiological Culture Collection Center, Beijing, China) was saved in glycerol stocks at −80 ◦ C. For the experimental procedures, bacteria were seeded on peptone culture media agar plates at 37 ◦ C and 5% CO2 for overnight, and the quantity of bacteria was counted. Bacteria were harvested by centrifugation at 12,000 r/min for 5 min at 4 ◦ C, re-suspended to cell culture medium and used for the next experiments. DH5␣ strain was used as negative control. 2.2. Culturing and identification of chicken type II pneumocytes The lung tissues of 14 day old Hy-Line Brown specific pathogen free chicken embryos were gently washed three times with HBSS, and cut into small blocks. These blocks were gently washed three times with HBSS and once with pre-warmed 0.25% trypsin. One lung tissue was digested with 0.25% trypsin (1 mL) at 37 ◦ C for 10 min, gently agitated every 2 min. When the tissues were dispersed completely, the digestion was stopped by the addition of 1 mL of Dulbecco’s modified Eagle’s medium (DMEM) with 10% sterile fetal bovine serum (FBS). Cell suspension was centrifuged at

51

800 r/min for 10 min, re-suspended in 0.1% collagenase type IV (Invitrogen-Gibco, Grand Island, NY, USA), digested for 15 min at 37 ◦ C, stopped by 10% FBS, centrifuged at 800 r/min for 10 min, re-suspended with 10% FBS, filtrated by 200 mesh sieve in a 100-mm culture plate, incubated for 1 h, and then supernatants with the unattached cells were collected for three times. Supernatant with the unattached cells was centrifuged at 800 r/min for 5 min, re-suspended in fresh DMEM for three times, filtrated by 400 mesh sieve, and then the concentration of cells was adjusted to 1.5 × 106 /mL, and cells were incubated for 18 h at 37 ◦ C. The attaching cells on culture dish were chicken type II pneumocytes. Chicken type II pneumocytes were passaged on the coverslips in 24-well plates and incubated for 18 h at 37 ◦ C. The coverslips were washed four times in 0.0l M TBS for 5 min with air-dried fast, stained by alkaline phosphatase (Beyotime Institute of Biotechnology, Jiangsu, China) without light for 20 min, and observed by the invert microscope. 2.3. Adhesion assay Chicken type II pneumocytes were seeded on coverslips in 24-well plates and incubated in DMEM supplemented with 10% FBS without antibiotics for 18 h. Then the cells were stained with stained by Hoechst 33342 (InvitrogenGibco, Grand Island, NY, USA) for 30 min, washed three times with PBS. APEC-O78 was stained by Hoechst 33342 (Invitrogen-Gibco, Grand Island, NY, USA). After 1 h post infection with APEC-O78 (5 × 108 CFU/mL), cells were washed with PBS three times, then fixed with 40% formaldehyde for 5 min. Fixed cells were washed with PBS three times, mounted on glass slides in glycerol and then examined by a confocal laser microscope. To screen the optimum time and bacteria quantity of adhesion, chicken type II pneumocytes were incubated with APEC-O78 (5 × 108 CFU/mL) for 1, 2 and 3 h, washed three times, ruptured with 1% (v/v) Triton X-100 (Sigma, St. Louis, MO, USA) for 5 min at room temperature, diluted in PBS, and plated on agar for APEC-O78 CFU determination. In the same way, cells were incubated with 107 , 5 × 107 , 108 and 5 × 108 CFU/mL of APEC-O78. The quantity of bacteria that adhered to cells was counted. The experiments were conducted as three trials. To screen the optimum time and concentration for the effect of ␣-cyperone on bacteria adhesion to cells, cells were pretreated with ␣-cyperone (0.1–1 ␮g/mL) for 1–4 h, followed with 5 × 108 CFU/mL of APEC-O78 incubated cells for 3 h, washed for three times, ruptured with 1% (v/v) Triton X-100 (Sigma, St. Louis, MO, USA) for 5 min at room temperature, diluted in PBS, and plated on agar for APECO78 CFU determination. 2.4. MTT assay Cytotoxicity of ␣-cyperone was performed by MTT assay. Chicken type II pneumocytes were seeded at a density of 1.5 × 106 cells/mL onto 96-well plates containing 100 ␮L of DMEM and incubated for 18 h. After 18 h, cells were treated with 100 ␮L of ␣-cyperone (0–2 ␮g/mL) for 18 h. Subsequently, 20 ␮L of MTT (5 mg/mL) in FBS-free

52

L.-Y. Zhang et al. / Veterinary Immunology and Immunopathology 159 (2014) 50–57

Table 1 List primers used for RT-PCR. Name

Accession number

Forward

Reverse

Nck-2 Cdc42 Rac1 RhoA ␤-actin GAPDH

NC 006088.3 NM 205048 NM 205017 AF098513.1 NM 205518 NM 204305

tccgtcacagaagaagagc acaggaaccagttgaggg gacggtgctgtaggtaaa aaagcaggtggagttggc gcaccacactttctacaatgag gtcctctctggcaaagtccaag

ccagcaaatcgtccagta gcttgggaagatggagaa caaacactgtcttgaggc taggcaggttgggacaga acgaccagaggcatacagg ccacaacatactcagcacctgc

medium was added to each well and cells were further incubated for 4 h. The supernatants were removed and cells were resolved with 150 ␮L of DMSO per well, followed by optical density measurement at 570 nm with a Bio-Tek microplate reader (Bio-Tek Instruments Inc., Winooski, VT, USA). 2.5. F-actin cytoskeleton polymerization assay Chicken type II pneumocytes were seeded on coverslips in 24-well plates without antibiotics for 18 h. After 18 h, cells were pretreated with 1 ␮g/mL of ␣-cyperone for 3 h, washed with PBS for three times, and then stained by Hoechst 33342 for 30 min, followed by infecting cells with 5 × 108 CFU/mL of APEC-O78 stained by FITC (1 mg/mL) (Sigma, St. Louis, MO, USA) for 3 h. Untreated cells were used as control group, cells were treated with DH5␣ as negative control group, and cells were only treated with APEC-O78 as positive control group. At 3 h post infection, cells were washed with PBS for three times, fixed for 5 min in 3.7% formaldehyde solution in PBS, washed extensively with PBS, permeabilized with 0.1% Triton X-100 in 0.1 M PBS for 5 min and washed again with PBS. F-actin was stained with a 5 ␮g/mL fluorescent rhodamine (TRITC) phalloidin (Sigma, St. Louis, MO, USA) conjugate solution with PBS (containing 1% DMSO from the original stock solution) for 40 min at room temperature. Cells were washed three times with PBS to remove unbound phalloidin conjugate and then examined by a confocal laser microscope.

After being pretreated with ␣-cyperone (0.1–1 ␮g/mL) for 3 h, cells were washed with PBS for three times and then incubated with 5 × 108 CFU/mL of APEC-O78 for 3 h. After 3 h, cells were washed with PBS for three times and total cellular RNA was isolated according to the instructions of RNA simple Total RNA Kit (TIANGEN Biotech Co, Beijing, China). For each RT-PCR reaction, 2 ␮g of total RNA was used to synthesise cDNA using BioRT cDNA First Strand Synthesis Kit (Bioer Technology, Hangzhou, China). Primers are shown in Table 1. Parameters of PCR reactions were: 94 ◦ C for 3 min for one cycle, then 94 ◦ C for 30 s, 52–59 ◦ C for 30 s, 72 ◦ C for 45 s for 30 cycles, and 72 ◦ C for 5 min for one cycle. The amplified PCR products were analyzed with 2% agarose gel and visualized with ethidium bromide staining and UV irradiation. The GAPDH was acted as an internal calibrator. Relative ratio of target gene/GAPDH = expression (target gene)/expression (GAPDH). 2.7. Statistical analysis Data are shown as mean ± SEM. Differences between mean values of normally distributed data were assessed by the one-way ANOVA (Dunnett’s t-test) and the Student’s t-test. Values were considered significantly different at P < 0.05. 3. Results 3.1. Culturing and identification of chicken type II pneumocytes

2.6. RT-PCR analysis Chicken type II pneumocytes were seeded on 6-well plates in DMEM with 10% FBS without antibiotics for 18 h.

The chicken type II pneumocytes were cycloid and small, grouped together to form islands, and formed monolayers when cultured for 18 h (Fig. 2A). Alkaline

Fig. 2. Morphology of chicken type II pneumocytes cultured for 18 h. (a) Light microscope images of chicken type II pneumocytes (magnification 100×). (b) Light microscope images of chicken type II pneumocytes stained with alkaline phosphatase (magnification 250×).

L.-Y. Zhang et al. / Veterinary Immunology and Immunopathology 159 (2014) 50–57

53

Fig. 3. (A) The adherence of APEC-O78 to chicken type II pneumocytes. Cells were stained by Hoechst 33342 (blue); APEC-O78 strain was stained by Hoechst 33342 (blue) (magnification 2000×). (B) The optimum time of APEC-O78 adhering to cells. The cells were treated with APEC O78 for 1–3 h. (C) The optimum quantity of APEC-O78 adhering to cells. The cells were treated with 107 –5 × 108 CFU/mL of APEC-O78 for 3 h. The values represent mean ± SEM of three independent experiments. ** P < 0.01 vs. other groups. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

3.2. Adherence of APEC-O78 to chicken type II pneumocytes The adherence of bacteria to epithelial cells is the first step for infection, so we tested the adherence of APEC-O78 to chicken type II pneumocytes (Fig. 3A). After 1 h postinfection, we found the adherence of bacteria to epithelial cells in an aggregate pattern. In order to screen the optimum time of adherence, cells were infected for 1, 2 and 3 h, respectively. For 3 h post-infection, the adherence of APEC-O78 to cells had higher level of permanence than that of 1 and 2 h post-infection (P < 0.01) (Fig. 3B). In order to investigate the optimum quantity of APEC-O78 adhesion to cells, cells were infected with 107 , 5 × 107 , 108 and 5 × 108 CFU/mL of APEC-O78. We found that for 5 × 108 CFU/mL of APEC-O78, the quantity of the adherence of APEC-O78 to cells was significantly higher than that of the others (Fig. 3C). 3.3. Toxicity of ˛-cyperone on chicken type II pneumocytes The potential cytotoxicity of ␣-cyperone was evaluated by the MTT assay after incubating cells for 18 h. The results showed that cell viabilities were not affected by ␣-cyperone at indicated concentrations (0.02–1 ␮g/mL). However, ␣-cyperone (2 ␮g/mL) displayed cellular toxicity against chicken type II pneumocytes (Fig. 4).

1.6

Cell viability (OD570 nm)

phosphatase, markers for type II pneumocytes, was used to stain cells. We observed that cell cytoplasm was positively stained purple (Fig. 2B). The purity of cells reached 95%.

1.4 *

1.2 1 0.8 0.6 0.4 0.2 0

0

0.02

0.1

0.5

1

2

α-cyperone (µg/mL) Fig. 4. Effect of ˛-cyperone on the viability of chicken type II pneumocytes. Cells were treated with ␣-cyperone (0–2.0 ␮g/mL) for 18 h. Cell viability was assessed by MTT reduction assays. The values represent mean ± SEM of three independent experiments. * P < 0.05 vs. control group.

3.4. Effect of ˛-cyperone on the adherence of APEC-O78 to chicken type II pneumocytes In order to determine the optimum time and concentration of ␣-cyperone pretreatment, we applied ␣-cyperone (0.1–1 ␮g/mL) to chicken type II pneumocytes for 1–4 h and set bacteria treatment for 3 h. After pretreatment with ␣cyperone (1 ␮g/mL) for 3 h, the quantity of adherence of APEC-O78 to cells was less than that for 1 and 2 h, however, there is no difference in the quantity of APEC-O78 between 3 and 4 h pretreatment (Fig. 5A). The quantity of adherence of APEC-O78 to cells pretreated with ␣-cyperone decreased in a dose-dependent manner (Fig. 5B).

54

L.-Y. Zhang et al. / Veterinary Immunology and Immunopathology 159 (2014) 50–57

A

CFU/106 cell 5x103

350

400

**

300

**

250

**

**

200 150

3

4

α-cyperone (h)

**

150

50 2

**

200

100

1

**

250

50 APEC-O78

##

300

100

0

B

350 CFU/106 cell 5x103

400

0 DH5α

APEC-O78

0.1

0.5

1

α-cyperone (µg/mL)

Fig. 5. (A) Effect of pretreatment with ˛-cyperone for 1–4 h on the adherence of APEC-O78 to chicken type II pneumocytes. The values represent mean ± SEM of three independent experiments. ** P < 0.01 vs. APEC-O78 group. (B) Effects of pretreatment with ˛-cyperone (0.1–1.0 g/mL) on the adherence of APEC-O78 to chicken type II pneumocytes. The cells were pretreated with 0.1–1.0 g/mL of ␣-cyperone for 3 h followed by the addition of APEC-O78 (5 × 108 CFU/mL) for 3 h. The values represent mean ± SEM of three independent experiments. ## P < 0.01 vs. DH5␣ group, ** P < 0.01 vs. APEC-O78 group.

3.5. Effect of ˛-cyperone on F-actin cytoskeleton polymerization and the expression of Nck-2, Cdc42, Rac1, RhoA and ˇ-actin in chicken type II pneumocytes induced by APEC-O78 After pretreatment with ␣-cyperone (1 ␮g/mL) for 3 h, actin cytoskeleton polymerization was less than that of APEC-O78 group (Fig. 6). After pretreatment with ␣cyperone (0.1–1 ␮g/mL) for 3 h, the expression of ␤-actin was increased. In order to comprehensively understand the mechanism by which ␣-cyperone inhibited actin cytoskeleton polymerization, we next investigated the expression of Nck-2, Cdc42, Rac1, and RhoA. The results showed that 0.5–1 ␮g/mL of ␣-cyperone decreased the expression of Nck-2, Cdc42, and Rac1 in accordance with inhibiting actin cytoskeleton polymerization (Fig. 7). 4. Discussion APEC-O78 belongs to the most predominant serogroups that adhere host cells and cause attaching and effacing lesion (A/E). Bacteria depend on their own virulence factors to induce host cells injury. All kinds of virulence factors damage host cells through different mechanisms. Cortes et al. (2008) have shown that BEN2908 mutant IbeA (an invasion associated protein) adhered to human BMEC due to the expression of type 1 fimbriae. APEC strains applied the common type 1 fimbriae to bind to tracheal and pharyngeal cells, and were likely to adhere to cells and colonize in the lungs and air sacs (Edelman et al., 2003). In addition, bacteria use protein secretion systems in bacterial-host associations to make toxins and effector proteins, enter host cells and modify host physiology to promote colonization and induce host injury (Tseng et al., 2009). APEC strains break through the blood–gas barrier to enter the chicken bloodstream through the adhesion and invasion to host cells. Chicken type II pneumocytes exert an important role in maintaining structure and function of blood–gas barrier (Bjornstad et al., 2014; Makanya et al., 2006; Scheuermann et al., 1997). Thus, to investigate the ability of APEC-O78 to adhere and invade to chicken type II pneumocytes, we successfully isolated and cultured chicken type II pneumocytes. It was reported that

avian pathogenic E. coli MT78 invaded chicken fibroblasts after 1 h post-infection (Matter et al., 2011). We found that APEC-O78 could adhere to chicken type II pneumocytes and treatment with 5 × 108 CFU/mL of APEC-O78 for 3 h was the optimum condition for APEC-O78 infecting chicken type II pneumocytes. Therefore, the discrepancy may be due to different strains of APEC and different host cells. In the present study, we also found that pretreatment with ␣-cyperone (0.1–1 ␮g/mL) for 1–4 h could significantly decrease the adherence of APEC-O78 to cells and the optimum condition is pretreating cells with ␣-cyperone (1 ␮g/mL) for 3 h. Actin is divided into G-actin (the monomer form) and Factin (the polymer form). F-actin is a filamentous structure, which is essential for important cellular functions such as the mobility and contraction of cells during cell division and is a constituent of the cell cytoskeleton (Huber et al., 2013). We also found that APEC-O78 induced actin cytoskeleton polymerization, while DH5␣ did not. It is cossistent with the actin polymerization of chicken fibroblast CEC-32 cell induced by APEC-MT78 (Matter et al., 2011). However, the mechanism of APEC induces actin cytoskeleton polymerization remains unclear. After pretreatment with ␣-cyperone (1 ␮g/mL) for 3 h, the actin cytoskeleton polymerization induced by APEC-O78 was significantly inhibited. The actin cytoskeleton polymerization can be induced by bacteria through different virulence factors interacting with host cells. Tir from enteropathogenic E. coli binding Nck to enter host cells induced actin cytoskeleton polymerization (Gruenheid et al., 2001), SopE and SopE2 from Salmonella typhimurium could activate Rho GTPases Cdc42 and Rac1 to induce actin cytoskeleton polymerization (Hardt et al., 1998; Stender et al., 2000). Distinctive effects of Cdc42, Rac1, and RhoA activation on the organization of the actin cytoskeleton have been observed in many cell types, including epithelial cells, endothelial cells, and astrocytes, as well as circulating cells such as lymphocytes, mast cells, and platelets (Hartwig et al., 1995; Ridley et al., 1995; Cross et al., 1996). Therefore, we investigated if ␣-cyperone can influence the expression of Nck-2, Cdc42, Rac1 and RhoA in chicken type II pneumocytes induced by APEC-O78. The results showed that ␣-cyperone could significantly decrease the expression of Nck-2, Cdc42 and

L.-Y. Zhang et al. / Veterinary Immunology and Immunopathology 159 (2014) 50–57

55

Fig. 6. Effect of ˛-cyperone on F-actin cytoskeleton polymerization induced by APEC-O78. F-actin was stained with TRITC-phalloidin (red), nuclei were stained with Hoechst 33342 (blue) and bacteria were stained with FITC (green) (magnification 2000×).(For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Rac1, but had no significant impact on the expression of RhoA. Nck-2 belongs to the family of adaptor proteins and interacts with the epidermal growth factor receptor, one of the tyrosine kinase receptors which are activated to induce actin cytoskeleton polymerization (Chen et al., 1998; Braverman and Quilliam, 1999). Therefore, ␣-cyperone may interact with the epidermal growth factor receptor to decrease the expression of Nck-2. The Rho family of

GTPases is a family of small signaling G proteins. Three members of the family have been studied in detail: Cdc42, Rac1, and RhoA. Cdc42 GTPases regulates filopodia or microspikes and is important for defining the polarity of cellular polymerization, and regulates actin polymerization by directly binding to Neural Wiskott–Aldrich syndrome protein (N-WASP); Rac GTPases regulate actin cytoskeleton polymerization and the organization of lamellipodia causing membrane ruffling and locomotion (Nobes

Fig. 7. Effect of ˛-cyperone on the mRNA expression of Nck-2, Rac1, Cdc42, RhoA and ˇ-actin in chicken type II pneumocytes invaded by APEC-O78. The cells were pretreated with 0–2 ␮g/mL of ␣-cyperone for 3 h followed by the addition of APEC-O78 (5 × 108 CFU/mL) for 3 h. Each ratio of target gene/GAPDH was normalized to control. The fold increase relative to control was shown. Equal loading of template cDNA was confirmed by ensuring GAPDH expression. The data was representative of three independent experiments and expressed as mean ± SEM. ## P < 0.01 vs. control group and DH5␣ group, ** P < 0.01 vs. APEC-O78 group.

56

L.-Y. Zhang et al. / Veterinary Immunology and Immunopathology 159 (2014) 50–57

and Hall, 1995; Baumer et al., 2008). RhoA GTPases regulates the organization of stress fibers (Ridley, 2006). Therefore, ␣-cyperone decreased actin cytoskeleton polymerization through Cdc42 and Rac1 pathway, not RhoA pathway. According to differing isoelectric points, actin is divided into ␣-, ␤- and ␥-actin. ␤-actin exists in non-muscle cells, and participates in the composition of cytoskeleton and cell migration. We found that APEC-O78 decreased the expression of ␤-actin, which was inhibited by ␣-cyperone. However, the mechanism needs to be further investigated. In summary, we successfully cultured chicken type II pneumocytes. ␣-cyperone significantly decreased the quantity of adherence of APEC-O78 to chicken type II pneumocytes and actin cytoskeleton polymerization of chicken type II pneumocytes induced by APEC-O78 through regulating the expression of Nck-2, Cdc42 and Rac1. Future studies will discern the relationship between membrane receptors of chicken type II pneumocytes and virulence factors of APEC-O78. These results will provide a new evidence for development of drugs to prevent chicken colibacillosis. Conflict of interest The authors have declared no conflict of interest to disclose. Acknowledgements We thank Dr. Dennis Feliciano, J. Thomas Brenna’s lab, Division of Nutritional Sciences, Cornell University and Dr. Lalit Rane, Lab of Therapeutic Immunology, Karolinska Institutet for their carefully modifying of the manuscript. This work was supported by the National Natural Science Foundation of China (no. 31372470), and the Jilin University Fundamental Research Funds (to Dr. B. D. Fu), as well as partly by the Open Project Programs from Beijing Key Laboratory of Traditional Chinese Veterinary Medicine at Beijing University of Agriculture (no. TCVM-201104), and from Key Laboratory of Veterinary Pharmaceutics Discovery, Ministry of Agriculture and Key Laboratory of New Animal Drug Project of Gansu Province (no. SYSKF2011KT05). References Antao, E.M., Glodde, S., Li, G., Sharifi, R., Homeier, T., Laturnus, C., Diehl, I., Bethe, A., Philipp, H.C., Preisinger, R., Wieler, L.H., Ewers, C., 2008. The chicken as a natural model for extraintestinal infections caused by avian pathogenic Escherichia coli (APEC). Microbial Pathogenesis 45, 361–369. Arne, P., Marc, D., Bree, A., Schouler, C., Dho-Moulin, M., 2000. Increased tracheal colonization in chickens without impairing pathogenic properties of avian pathogenic Escherichia coli MT78 with a fimH deletion. Avian Diseases 44, 343–355. Baumer, Y., Burger, S., Curry, F.E., Golenhofen, N., Drenckhahn, D., Waschke, J., 2008. Differential role of Rho GTPases in endothelial barrier regulation dependent on endothelial cell origin. Histochemistry and Cell Biology 129, 179–191. Bernhard, W., Gebert, A., Vieten, G., Rau, G.A., Hohlfeld, J.M., Postle, A.D., Freihorst, J., 2001. Pulmonary surfactant in birds: coping with surface tension in a tubular lung. American Journal of Physiology—Regulatory, Integrative and Comparative Physiology 281, R327–R337. Bjornstad, S., Paulsen, R.E., Erichsen, A., Glover, J.C., Roald, B., 2014. Type I and II pneumocyte differentiation in the developing fetal chicken

lung: conservation of pivotal proteins from birds to human in the struggle for life at birth. Neonatology 105, 112–120. Braverman, L.E., Quilliam, L.A., 1999. Identification of Grb4/Nckbeta, a src homology 2 and 3 domain-containing adapter protein having similar binding and biological properties to Nck. The Journal of Biological Chemistry 274, 5542–5549. Campellone, K.G., 2010. Cytoskeleton-modulating effectors of enteropathogenic and enterohaemorrhagic Escherichia coli: Tir, EspFU and actin pedestal assembly. The FEBS Journal 277, 2390– 2402. Chen, M., She, H., Davis, E.M., Spicer, C.M., Kim, L., Ren, R., Le Beau, M.M., Li, W., 1998. Identification of Nck family genes, chromosomal localization, expression, and signaling specificity. The Journal of Biological Chemistry 273, 25171–25178. Cortes, M.A.M., Gibon, J., Chanteloup, N.K., Moulin-Schouleur, M., Gilot, P., Germon, P., 2008. Inactivation of ibeA and ibeT results in decreased expression of type 1 fimbriae in extraintestinal pathogenic Escherichia coli strain BEN2908. Infection and Immunity 76, 4129–4136. Cross, M.J., Roberts, S., Ridley, A.J., Hodgkin, M.N., Stewart, A., ClaessonWelsh, L., Wakelam, M.J., 1996. Stimulation of actin stress fibre formation mediated by activation of phospholipase D. Current Biology 6, 588–597. da Silveira, W.D., Ferreira, A., Brocchi, M., de Hollanda, L.M., de Castro, A.F.P., Yamada, A.T., Lancellotti, M., 2002. Biological characteristics and pathogenicity of avian Escherichia coli strains. Veterinary Microbiology 85, 47–53. Dho-Moulin, M., Fairbrother, J.M., 1999. Avian pathogenic Escherichia coli (APEC). Veterinary Research 30, 299–316. Edelman, S., Leskela, S., Ron, E., Apajalahti, J., Korhonen, T.K., 2003. In vitro adhesion of an avian pathogenic Escherichia coli O78 strain to surfaces of the chicken intestinal tract and to ileal mucus. Veterinary Microbiology 91, 41–56. Gibbs, P.S., Petermann, S.R., Wooley, R.E., 2004. Comparison of several challenge models for studies in avian colibacillosis. Avian Diseases 48, 751–758. Gruenheid, S., DeVinney, R., Bladt, F., Goosney, D., Gelkop, S., Gish, G.D., Pawson, T., Finlay, B.B., 2001. Enteropathogenic E. coli Tir binds Nck to initiate actin pedestal formation in host cells. Nature Cell Biology 3, 856–859. Hardt, W.D., Chen, L.M., Schuebel, K.E., Bustelo, X.R., Galan, J.E., 1998. S. typhimurium encodes an activator of Rho GTPases that induces membrane ruffling and nuclear responses in host cells. Cell 93, 815–826. Hartwig, J.H., Bokoch, G.M., Carpenter, C.L., Janmey, P.A., Taylor, L.A., Toker, A., Stossel, T.P., 1995. Thrombin receptor ligation and activated Rac uncap actin filament barbed ends through phosphoinositide synthesis in permeabilized human platelets. Cell 82, 643–653. Huber, F., Schnauss, J., Ronicke, S., Rauch, P., Muller, K., Futterer, C., Kas, J., 2013. Emergent complexity of the cytoskeleton: from single filaments to tissue. Advances in Physics 62, 1–112. Jin, J.H., Lee, D.U., Kim, Y.S., Kim, H.P., 2011. Anti-allergic activity of sesquiterpenes from the rhizomes of Cyperus rotundus. Archives of Pharmacal Research 34, 223–228. Knobl, T., Moreno, A.M., Paixao, R., Gomes, T.A., Vieira, M.A., da Silva Leite, D., Blanco, J.E., Ferreira, A.J., 2012. Prevalence of avian pathogenic Escherichia coli (APEC) clone harboring sfa gene in Brazil. TheScientificWorldJournal 2012, 437342. Luo, M., Qiu, J., Zhang, Y., Wang, J., Dong, J., Li, H., Leng, B., Zhang, Q., Dai, X., Niu, X., Zhao, S., Deng, X., 2012. Alpha-cyperone alleviates lung cell injury caused by Staphylococcus aureus via attenuation of alphahemolysin expression. Journal of Microbiology and Biotechnology 22, 1170–1176. Maina, J.N., King, A.S., 1982. The thickness of avian blood–gas barrier: qualitative and quantitative observations. Journal of Anatomy 134, 553–562. Makanya, A.N., Hlushchuk, R., Duncker, H.R., Draeger, A., Djonov, V., 2006. Epithelial transformations in the establishment of the blood–gas barrier in the developing chick embryo lung. Developmental Dynamics 235, 68–81. Matter, L.B., Barbieri, N.L., Nordhoff, M., Ewers, C., Horn, F., 2011. Avian pathogenic Escherichia coli MT78 invades chicken fibroblasts. Veterinary Microbiology 148, 51–59. Meng, G., Zhao, J., Wang, H.M., Ding, R.G., Zhang, X.C., Huang, C.Q., Ruan, J.X., 2010. Cell injuries of the blood–air barrier in acute lung injury caused by perfluoroisobutylene exposure. Journal of Occupational Health 52, 48–57. Nobes, C.D., Hall, A., 1995. Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 81, 53–62.

L.-Y. Zhang et al. / Veterinary Immunology and Immunopathology 159 (2014) 50–57 Orskov, F., Orskov, I., 1992. Escherichia coli serotyping and disease in man and animals. Canadian Journal of Microbiology 38, 699–704. Ridley, A.J., 2006. Rho GTPases and actin dynamics in membrane protrusions and vesicle trafficking. Trends in Cell Biology 16, 522–529. Ridley, A.J., Comoglio, P.M., Hall, A., 1995. Regulation of scatter factor/hepatocyte growth factor responses by Ras, Rac, and Rho in MDCK cells. Molecular and Cellular Biology 15, 1110–1122. Saif, Y.M., Barnes, H.J., 2008. Diseases of Poultry, 12th ed. Blackwell Pub. Professional, Ames, IA. Scheuermann, D.W., Klika, E., De Groodt-Lasseel, M.H., Bazantova, I., Switka, A., 1997. An electron microscopic study of the parabronchial epithelium in the mature lung of four bird species. The Anatomical Record 249, 213–225. Schouler, C., Schaeffer, B., Bree, A., Mora, A., Dahbi, G., Biet, F., Oswald, E., Mainil, J., Blanco, J., Moulin-Schouleur, M., 2012. Diagnostic strategy for identifying avian pathogenic Escherichia coli based on four patterns of virulence genes. Journal of Clinical Microbiology 50, 1673–1678.

57

Shi, H.Y., Gao, S., Xu, Y.M., Wanf, B.A., Zhang, R.K., Jiao, X.A., Zhu, K.X., 2002. Ultrastructurally pathologic dynamics of colibacollosis in chickens experimentally inoculated with E. coli and/or mildly pathogenic avian influenza virus. Chinese Journal of Veterinary Science 22, 171–174. Stender, S., Friebel, A., Linder, S., Rohde, M., Mirold, S., Hardt, W.D., 2000. Identification of SopE2 from Salmonella typhimurium, a conserved guanine nucleotide exchange factor for Cdc42 of the host cell. Molecular Microbiology 36, 1206–1221. Tomasevic, N., Jia, Z., Russell, A., Fujii, T., Hartman, J.J., Clancy, S., Wang, M., Beraud, C., Wood, K.W., Sakowicz, R., 2007. Differential regulation of WASP and N-WASP by Cdc42, Rac1, Nck, and PI(4,5)P2. Biochemistry 46, 3494–3502. Tseng, T.T., Tyler, B.M., Setubal, J.C., 2009. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiology 9.