Inhibitory function of nitric oxide on the onset of metamorphosis in competent larvae of Crepidula fornicata: A transcriptional perspective

Marine Genomics 2 (2009) 161–167

Contents lists available at ScienceDirect

Marine Genomics j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / m a r g e n

Inhibitory function of nitric oxide on the onset of metamorphosis in competent larvae of Crepidula fornicata: A transcriptional perspective Nicolas Taris ⁎, Thierry Comtet, Frédérique Viard Université Pierre et Marie Curie-Paris 6, UMR 7144, Equipe Div&Co, Station Biologique, Roscoff 29682, France CNRS, UMR 7144, Adaptation & Diversité en Milieu Marin, Station Biologique, Roscoff 29682, France

a r t i c l e

i n f o

Article history: Received 29 May 2009 Received in revised form 30 July 2009 Accepted 4 August 2009 Keywords: Nitric oxide synthase Crepidula fornicata Mollusc Metamorphosis Real-time quantitative PCR Larval development

a b s t r a c t In diverse invertebrate species characterized by a biphasic life cycle, metamorphosis represents a fundamental biological transition which determines the fate of benthic population dynamics through settlement and recruitment. Within this context, nitric oxide (NO) is thought to act as an endogenous inhibitor of metamorphosis. While attention has been focused on the mechanisms of this inhibitory pathway with pharmacological agents and immunohistochemistry tools, relatively few studies have investigated transcriptional process at the origin of NO synthesis. In this paper, we report the isolation of a 218-bp cDNA fragment of an ortholog of the neuronal nitric oxide synthase (nNOS) gene in the invasive marine species Crepidula fornicata. By the use of quantitative real-time PCR, we examine the transcription of this gene throughout larval development and in response to two inducers [K+ excess (20 mM), dibromomethane (DBM) (1000 ppm)] that are known to potentiate metamorphosis in invertebrate species. The level of transcription increased constantly during the larval development, suggesting an increased repressive effect over metamorphosis as larvae aged. Interestingly, maximum values were reached 6 h post-treatment, before declining within 20 h for all the tested conditions. Overall, our results are in agreement with the involvement, at a molecular level, of the NO signalling pathway in metamorphosis. The decrease in nNOS gene transcription post-induction could support the inhibitory effect of NO upon the onset of metamorphosis in competent larvae, although further studies are needed to fully describe the pathways triggered by K+ ions and DBM induction. Furthermore, results indicate that metamorphosis could occur after termination of endogenous inhibition, bringing support to the hypothesis of spontaneous metamorphosis. © 2009 Elsevier B.V. All rights reserved.

1. Introduction In species with a bentho-pelagic life cycle – the most frequent in marine invertebrates (Thorson, 1950) – larvae are often the major dispersal vector and larval metamorphosis represents a fundamental biological transition which determines benthic population dynamics through settlement and recruitment (Levin, 2006; Cowen and Sponaugle, 2009). Despite their ecological and evolutionary importance, the molecular mechanisms by which the larvae undergo metamorphosis are still largely unknown in most marine invertebrates (Williams et al., 2009). Evidence has accumulated over the last decade that nitric oxide (NO) signalling pathway is crucial in life-history transition in invertebrates, particularly in metamorphosis (Bishop and Brandhorst, 2003). NO is a highly reactive molecule, and its biosynthesis is catalyzed by NO synthase (NOS), involving L-arginine oxidation with generation of L-citrulline. NO elicits a variety of physiological roles in a ⁎ Corresponding author. UMR 7144, Station Biologique, 29682 Roscoff Cedex, France. Tel.: +33 2 98 29 25 44; fax: +33 2 98 29 23 24. E-mail address: [email protected] (N. Taris). 1874-7787/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.margen.2009.08.002

wide spectrum of organisms, from chordates to invertebrates (Palumbo, 2005). Two decades of research have identified this gaseous molecule as a key component of a seemingly limitless range of biological processes including neurotransmission, reproductive biology, immune defence and the regulation of apoptosis (Moncada et al., 1991; Rosselli et al., 1998; Coleman, 2001; Brüne, 2003). In marine invertebrates, NO is thought to exert a repressive effect on metamorphic processes: a growing number of studies support this hypothesis in phylogenetically disparate taxa, including ascidians, echinoids and gastropods (Palumbo, 2005). The evidence in favour of the inhibitory function of the NO signalling is mainly derived from pharmacological treatments (exposure to diverse NOS inhibitors triggering metamorphosis) in association with immunohistochemistry methods to localize putative sites of NO synthesis (Froggett and Leise, 1999; Bishop and Brandhorst, 2001; Pechenik et al., 2002, 2007; Bishop et al., 2008). Three NOS genes (neuronal NOS, endothelial NOS and inducible NOS) have been identified in vertebrates, and one isoform (neuronallike, nNOS) in invertebrate species (Moroz, 2001). Expression studies predict that nNOS will be actively transcribed during larval development and particularly so during the competent period, although only

162

N. Taris et al. / Marine Genomics 2 (2009) 161–167

a limited number of studies have considered the examination of NOS transcription levels in this context. Hens et al. (2006) used gel-based semi-quantitative PCR to explicitly study NOS expression during larval development in the mollusc Ilyanassa obsoleta and following exposure to serotonin (5-HT), which is known to induce metamorphosis in this species. Their results concurred with the hypothesis that the NO signalling pathway maintains the larval state after “competence” (Froggett and Leise, 1999), a developmental state defined as the capacity to undergo metamorphosis upon induction by external settlement cues (Hadfield et al., 2001). The role of NO signalling seems to be central to the integration of information from natural or artificial cues, although the control of the events of metamorphosis pathway, including metamorphic competence, and the signal transduction cascades leading to metamorphosis are poorly understood. To date, neuroactive compounds, pharmacological agents, adult pheromones, microbial films, elevated ion concentrations and heat-shocks comprise the long list of potential metamorphosis inducers (e.g. Pechenik and Gee, 1993; Pechenik and Qian, 1998; Bishop and Brandhorst, 2001 and for a review see Hadfield and Paul, 2001). The multiplicity of potential inducers associated with their disparate effects in various species illustrates the complexity of either combined or independent biological pathways. Knowledge of gene-specific expression provides a valuable framework to comprehensively document the underlying mechanisms that regulate developmental programmes (Zhu and Zhao, 2007). In this study, we used real-time PCR (Heid et al., 1996) to generate a quantitative transcriptional profile of nNOS during larval development of the marine gastropod Crepidula fornicata (Linnaeus, 1758), an invasive species in European coastal areas. Spread and interactions during the larval phase can influence the long-term establishment and future range limits of introduced populations (Kinlan and Hastings, 2005; Dunstan and Bax, 2007); understanding the mechanisms controlling larvae metamorphosis and settlement is thus fundamental in biological invasion studies. As highlighted above, different studies suggested that NO may serve as an endogenous inhibitor of the metamorphosis in larvae of marine invertebrates. Interestingly, in C. fornicata, Pechenik et al. (2007) recently showed the inhibitory role of NO by using common NOS and guanylate cyclase inhibitors [only LNAME failed to induce metamorphosis]. By using immunohistochemical techniques, these authors observed a decline in NOS expression with larval age which might explain spontaneous metamorphosis in old larvae. This prompted us to study the transcription kinetics of nNOS throughout larval development and in response to two inducers: excess of extracellular potassium ions (K+), and dibromomethane (DBM). Excess K+ typically potentiates metamorphosis in competent larvae of C. fornicata at the concentration of 20 mM within about 6 h at 20–23 °C (Pechenik and Gee, 1993). DBM is a volatile compound produced by algae, especially red coralline algae (Itoh and Shinya, 1994), that induces rapid metamorphosis of sea urchin larvae (Strongylocentrotus nudus and Strongylocentrotus intermedius) (Agatsuma et al., 2006). This compound has recently been shown to induce metamorphosis in competent larvae of C. fornicata (Taris et al., in prep.) and was here used as a potential natural inducer. To generate transcriptional profiles of nNOS in C. fornicata, we first isolated and cloned a partial cDNA encoding this gene, using primers that spanned the highly-conserved calmodulin-binding region. 2. Materials and methods 2.1. Experimental set-up We collected C. fornicata larvae after natural release from adults initially maintained at 16.5 ± 2 °C on a diet of Isochrysis galbana (clone T-iso) and Chaetoceros gracilis (Roscoff Culture Collection, Vaulot et al., 2004). Larvae were reared in 2-liter glass jars filled with filtered (0.45 µm) seawater at a temperature of 21 °C. We fed veliger larvae

daily with T-iso at a concentration of 2 × 105 cells ml− 1. As we replaced seawater in larval containers three times per week, we sampled individuals (~50) for length measurement using a dissecting microscope equipped with an ocular micrometer. In addition to measurement, we preserved approximately 500 larvae by flashfreezing them in liquid nitrogen for further RNA isolation (we collected 500 larvae at days 1, 3, 5, 8, 9, 10 and 11 post-release by sieving on adjusted mesh). After 8 days, larvae were large enough to be potentially competent to metamorphosis (Pechenik and Heyman, 1987). We thus conducted a daily test for competence, by elevating the K+ concentration of seawater by 20 mM using a subsample of three replicates of 15 larvae, as described by Pechenik and Heyman (1987) and Pechenik and Gee (1993). On the day the test was positive in the subsamples (70% metamorphosis obtained in 6 h, based upon the loss of the velum; i.e. day 11 post-release), we triggered metamorphosis on the larvae as follows: we placed five pools of 500 larvae in five 50 ml glass beakers, filled each beaker with 50 ml of seawater with K+ (added as KCl 20 mM), and then froze in liquid nitrogen the 500 larvae of each beaker at five time points, respectively 1, 3, 6, 20 and 48 h after metamorphosis induction. In parallel, we performed the same protocol using a one-hour exposure to dibromomethane (DBM) at a concentration of 1000 ppm as metamorphosis inducer (Taris et al., in prep.). In addition, a series with no metamorphosis inducer (0.45 µm filtered seawater) was also executed according to the same sampling kinetics in order to analyze larval development in competent larvae without triggering metamorphosis with any inducers. All conditions taken together, 15 samples (referred as post-treatment samples) were collected for further total RNA extraction (3 conditions × 5 time points). Prior to treatment, we immediately froze in liquid nitrogen 500 additional individuals, which will be further referred as the “time 0” sample. Additionally, we measured the percentage of larvae that metamorphosed in three replicates of 15 larvae using 12-well tissue-culture plates filled with 4 ml of either KCl 20 mM or 0.45 µm filtered seawater. 2.2. RNA isolation and cDNA synthesis We extracted total RNA from the 500 frozen larvae of each of 22 samples; 6 were pre-treatment (i.e. day 1 to 10 post-release), 1 was at the time of treatment (time 0, i.e. day 11) and 15 were post-treatment (i.e. 5 time points and three conditions) with TRI-Reagent (Molecular Research Center, Inc.) and chloroform. The RNA was pelleted using standard isopropanol precipitation, ethanol washing, and dissolving in 50 µl of RNA-free water. We measured RNA concentrations using a NanoDrop® ND-1000 (NanoDrop Technologies, Inc.). The RNA integrity was confirmed by examining the rRNA bands for lack of degradation using the RNA 6000 Nano Assay (Agilent Technologies). For each sample, 1 µg of total RNA was reverse-transcribed using SuperScript™ III reverse transcriptase (Invitrogen, Carlsbad, CA) following the manufacturer's protocol. We stored the resulting cDNA product at −80 °C. 2.3. NOS identification with degenerate primers We designed degenerate primers within the region encompassing the calmodulin-binding site of five molluscan NOS orthologs (Aplysia californica # AF288780; I. obsoleta # AY763405; Limax marginatus # AB115412; Lehmannia valentiana # AB333805; Sepia officinalis # AY582750). Forward and reverse primers were respectively QEMLLYK (5′ ATCAGGARATGYTBCTBTAYAAG 3′) and VKCTIMY (5′ GCRTACADGATKRYRCACTTRAC 3′). A touch-up PCR reaction was set as follows: 94 °C for 5 min, 20 cycles at 94 °C for 45 s, 45 °C up to 55 °C (0.5 °C increments per cycle) for 45 s, 72 °C for 1 min, then 20 cycles at 94 °C for 45 s, 55 °C for 45 s, 72 °C for 1 min, and 72 °C for 7 min. PCR reactions were performed in a total volume of 20 µl including 30 ng

N. Taris et al. / Marine Genomics 2 (2009) 161–167

cDNA, 1 U Taq DNA polymerase (Eurogentec), 1× reaction buffer, 1.25 mM of MgCl2, 200 mM of each dNTP, 1 µM of each primer (final concentration). We visualized PCR products on 2% agarose gels, and bands of the expected size (~220 bp) were excised and purified using the Nucleospin Extract II kit (Macherey-Nagel). An aliquot of purified cDNA was cloned into a pCRII-TOPO vector using the TOPO TA cloning for sequencing kit (Invitrogen, Carlsbad, CA). Plasmid DNA was purified from 7 ml of an overnight culture of Escherichia coli in LB medium using the QIAprep Spin Miniprep Kit (QIAGEN, UK), and sequenced with T7 primers using the Big Dye Terminator v.3.1 Cycle Sequencing kit on an ABI 3130 XL DNA sequencer (Applied Biosystems, Foster City, CA). We used BLASTX (Altschul et al., 1997) to ascertain similarity of the fragment to known NOS orthologs. Subsequently, we deposited the nucleotide sequence information for the partial C. fornicata NOS cDNA in GenBank (FJ842261). 2.4. Phylogenetic tree construction A phylogenetic analysis was conducted using the programs provided at www.phylogeny.fr (“A la carte” mode) (Dereeper et al., 2008). We first compared the partial deduced amino acid sequence of C. fornicata with those of the corresponding regions of known vertebrate and invertebrate NOS isoforms using MUSCLE 3.7 (Edgar, 2004) (Apis mellifera # AB204558, A. californica # AF288780, Danio rerio # AY211528, Discosoma striata # AY036119, Drosophila melanogaster # NM_001032070, Gecarcinus lateralis # AY552549, Homo sapiens # L02881, I. obsoleta # AY763405, L. valentiana # AB333805, L. marginatus # AB115412, Lottia gigantea # jgi|Lotgi1|134735| e_gw1.92.5.1, Luciola cruciata # AB304920, Luciola lateralis # AB304619, Oncorhynchus mykiss # DQ640498, Oryzias latipes # AB163430, S. officinalis # AY582750, Takifugu poecilonotus # AF380137, Xenopus laevis # AF053935). The phylogenetic tree was constructed using a neighbour-joining method implemented in BioNJ (Gascuel, 1997), coupled with Protdist (Felsenstein, 1993). The final tree was customized with the editing interface TreeDyn (Chevenet et al., 2006). A confidence level was assessed using 1000 bootstraps replicates. 2.5. Quantitative real-time PCR To examine the transcriptional profile of the nNOS gene before and after induction or competence, we performed quantitative real-time PCR (RT-qPCR) for each of the 22 cDNA samples (see details above) by combining the Absolute™ QPCR SYBR® Green Mix 2X (Thermo Scientific) with nNOS gene-specific primers on a MJ Research Chromo4 Real Time PCR system. We designed the following primers based on the newly identified sequence using Primer3Plus (Untergasser et al., 2007) (NOS-2 F: CTCTACAAGCTGAAACCCTCGTAT, NOS-2 R: GTTTGTCTCTGTCCTTCTTCCAC). We normalized the level of transcription to elongation factor 2 [F: TAAACGCAAGGGTTTGAAGG, R: ATGTCACGGATGACCAACAA]. Each sample was run in triplicate, and each qPCR plate included both target and reference genes. Each 12.5µl RT-qPCR reaction contained 5 ng cDNA and had a final concentration of 70 nM of each primer. PCR cycling conditions were as follows: 95 °C for 15 min, 45 cycles of 95 °C for 15 s, 60 °C for 30 and 72 °C for 30 s. We included a melting curve program (60 °C–90 °C) with a heating rate of 0.1 °C per second. PCR efficiencies were estimated for each reaction using LinRegPCR software (Ramakers et al., 2003). Options selected to fit the window-of-linearity using LinRegPCR were a number of data points between five and six and the best correlation coefficient. The mean value of all PCR efficiencies for each gene (target and reference) was kept as the value implemented within the calculations. We expressed our data as concentrations relative to the reference gene by normalizing raw CT (threshold cycle) values, where CT was set at 0.01 RFUs (relative fluorescence units) for

163

all the RT-qPCR assays (from the Opticon monitor software, version 3). 2.6. Statistical analysis We analyzed the normalized level of transcription of NOS for significant effects of metamorphosis treatment types and sampling times using Proc GLM (SAS/STAT® Software, SAS Institute Inc., 1999, version 8). All data sets were tested for normality before further analysis using the Shapiro–Wilk test. The statistical model was defined as follows: Z Yijk = μ + α i + βj + γ k +

ij

+ ε ijk

where Yijk is the dependent variable (normalized ratio of transcription), µ is the overall mean, αi is the treatment type effect (KCl, DBM or water; i = 1–3), βj is the time effect (j = 1–5), γk is replicate effect (k = 1–3), intij is the interaction between treatment type and time, and εijk the residual error. Based on this model, a sub-model to further detail the treatment effect throughout time sampling was used. Tukey's Studentized Range (HSD) tests were carried out in completion to the previously described models when necessary as well as for the pre-treatment time samplings. Initially, the consistency of transcription of the reference gene was tested by using the same statistical procedure (the dependent variable was (E reference (CT reference))). The significance level for statistical analyzes was set at p < 0.05. 3. Results 3.1. Partial cloning of nNOS cDNA The use of degenerate primers spanning the nNOS calmodulinbinding region allowed us to identify a 218 base pair fragment in C. fornicata. The deduced amino acid sequence was compared to published nNOS sequences belonging to a large range of animal organisms, including vertebrates, molluscan and arthropod invertebrates. The disc anemone (Discosoma) served as outgroup taxa to root the tree. The molecular phylogenetic tree obtained with Neighbour Joining method clustered the sequence obtained in C. fornicata with I. obsoleta, both belonging to Caenogastropoda suborder (Fig. 1). The partial amino acid sequence of C. fornicata shares 97.2% similarity and 91.7% identity with the I. obsoleta nNOS sequence, indicating that the fragment isolated in C. fornicata is likely to be part of the nNOS.

Fig. 1. BioNJ bootstrap tree of nNOS based on a multiple alignment of amino acid sequences spanning the nNOS calmodulin-binding regions. The numerals on the nodes are the bootstraps scores out of 1000 (branch support values displayed in %). Sequence sources and accession numbers are given in the text.

164

N. Taris et al. / Marine Genomics 2 (2009) 161–167

Furthermore, the sequence shows between 86–94% similarity and 76– 82% identity with other molluscan orthologs (the lowest similarity being observed with Sepia). Smaller values are observed when compared to arthropods and vertebrates. Pairwise levels are nevertheless still relatively high, ranging from 72% to 83% similarity and from 55 to 64% identity. This reflects the conserved nature of the targeted region. More detailed levels of similarity and identity are reported in Table 1. 3.2. Larval growth and competence during the experiment The mean larval size from day 1 to day 11 post-release is illustrated in Fig. 2A. At day 11 post-release, 77±6% (3) [mean±SD (n)] of the larval population was determined to be competent to metamorphosis (based upon the loss of the velum); the mean larval size was 951±78 µm (43) [mean±SD (n)]. In parallel to the induction experiment, we monitored the percentage of larvae that metamorphosed in 3 replicates of 15 larvae using tissue-culture plates (Fig. 2B). No larvae metamorphosed after 1 h of exposure with KCl 20 mM exposure (positive control). The percentage of metamorphosed larvae was 17.8±3.8% (3) after 3 h post-treatment. After 6 h, the percentage reached the threshold of 70% (75.6±3.8% (3)). No metamorphosis was observed in the negative control (filtered seawater), except only few at time 48 h (4.4±3.8% (3)). 3.3. Transcription pattern of nNOS measured by RT-qPCR The normalized level of transcription of nNOS increased gradually from day 1 to day 11 post-release (Fig. 3A). Significant differences from pairwise comparisons emphasize four progressive stages, visualized by the letter code [Tukey's Studentized Range (HSD) test]. Fold change ranges from 1 at day 1 post-release to approximately 3 when the K+ competence test was first defined as positive (i.e. day 11). In the post-treatment stages (Fig. 3B), transcription profiles were stable for the first 3 h, and thereafter transcript concentrations increased significantly and were maximum at 6 h post-treatment for all conditions (Table 2A, time effect p < 0.01). As opposed to the no-inducer and DBM treatments, the transcript concentration with the K+ inducer follows a seemingly different trend since increasing at time 1 h before decreasing at time 3 h. In consequence, KCl shows a statistically significant effect at time 1 h post-treatment (Table 2B, treatment effect p < 0.05, supported by Tukey's Range HSD test). At 20 h and 48 h post-treatment, transcription levels declined to reach values below the initial value of the time control pre-treatment (< 3 fold change) in the three

treatments. The significant effect of the treatment illustrates this distinct pattern of decreased transcription. Indeed, 20 h post-treatment, the no-inducer condition displays a higher level of transcription than the two inducers (Table 2B, treatment effect p < 0.05).

4. Discussion Metamorphosis is an important ecological and evolutionary transition often due to an inductive event, in many invertebrate species characterized by a biphasic life cycle (Bishop and Brandhorst, 2003) and for which little genomics and transcriptional information is available in marine taxa (Davidson and Swalla, 2002; Jacobs et al., 2006; Medina, 2009; Williams et al., 2009). In this study, we examined the NO signalling pathway thought to be predominant in maintaining larval state until metamorphosis. Despite growing interest in this pathway to increase understanding of life-history transitions, relatively few studies have examined the NO synthase, yet involved in NO synthesis (Hens et al., 2006, Comes et al., 2007). Using quantitative real-time PCR analysis, we analyzed regulation of expression of the nNOS gene and determined the extent to which NO might inhibit the onset of metamorphosis in competent larvae of the invasive marine gastropod C. fornicata. First looking at the larval development from day 1 to day 11 postrelease, the observed kinetics of transcription seems to be in accord with the hypothesis of an inhibition of metamorphosis by the NO pathway. Indeed, the levels of transcription rose gradually, supporting an increased repressive effect over metamorphosis as larvae aged and became more likely to get competent to metamorphose in the absence of inductive cues. With different tools and perspective, Lin and Leise (1996) observed a convergent tendency, reporting an increasing pattern of NOS activity during larval development in I. obsoleta, as detected by NADPH diaphorase histochemistry. In addition to being present throughout larval development, NOS activity was reported to be maximal in competent larvae. Opposite results collected over the same development stage in the same gastropod species (I. obsoleta) were nevertheless documented by Hens et al. (2006): nNOS appeared to be transcribed at constant levels throughout larval development. The discrepancy in results can be attributed to the methods used in the two above mentioned studies. The study by Lin and Leise (1996) addressed enzyme activity in targeted larval structures, whereas the study by Hens et al. (2006) focused on gene transcription in whole bodies and relied on band intensity from agarose gels as a proxy for the quantity of PCR products at the final phase of the reaction. The sensitivity of techniques for mRNA detection may eventually explain

Table 1 Comparison of partial nNOS amino acid sequence similarity and identity between Crepidula fornicata and other species.

Mollusc

Arthropod

Vertebrate

Cnidaria

Species (accession numbers)

nNOS amino acid similarity (%)

nNOS amino acid identity (%)

Ilyanassa obsoleta # AY763405 Aplysia californica # AF288780 Lottia gigantea # jgi|Lotgi1|134735|e_gw1.92.5.1 Lehmannia valentiana # AB333805 Limax marginatus # AB115412 Sepia officinalis # AY582750 Gecarcinus lateralis # AY552549 Apis mellifera #AB204558 Drosophila melanogaster # NM_001032070 Luciola cruciata # AB304920 Luciola lateralis # AB304619 Xenopus laevis # AF053935 Oryzias latipes # AB163430 Takifugu poecilonotus # AF380137 Danio rerio # AY211528 Oncorhynchus mykiss # DQ640498 Homo sapiens # L02881 Discosoma striata # AY036119

97.2 94.5 94.4 93.1 93.1 86.3 83.6 80.6 80.6 79.2 79.2 75.0 75.0 73.6 73.6 73.6 72.2 56.9

91.7 82.2 79.2 80.6 80.6 76.7 64.4 58.3 55.6 58.3 58.3 59.7 56.9 59.7 56.9 55.6 56.9 40.3

N. Taris et al. / Marine Genomics 2 (2009) 161–167

Fig. 2. (A) Temporal evolution for mean larval size (µm) (circles) and percentage of competence (bars). Numbers on x-axis indicate days post-release when measurements were carried out. (B) Percentage of larvae that metamorphosed in three replicates of 15 larvae using 12-well tissue-culture plates filled with 4 ml of either KCl 20 mM or filtered seawater (control). Experiment was carried out at day 11 post-release. Data represent the mean ± SD of technical replicates.

the divergence as traditional RT-PCR assay relying on gel-based systems may suffer from subjectivity in interpretation due to limitation in sensitivity. Although focused on a different gastropod species, our data based on quantitative PCR analysis gave support to the hypothesis of variation in nNOS gene transcription through larval development. As these regulation patterns may be species-specific (Williams et al., 2009), additional studies on other marine gastropod species are required to determine the generality of such pathway. To a larger extent, our findings can be compared to the high level of mRNA specifically observed only at the late larval stage in the ascidian Ciona intestinalis (Comes et al., 2007). Yet, unlike our data, the temporal kinetics observed in C. intestinalis displayed a more contrasted profile. Measured by real-time PCR, the NOS expression showed maximum values in the eggs before declining until middle larval stage to finally greatly increase in late larvae. Interestingly, if these results indicate a regulatory role of NO signalling in metamorphosis, it also suggests the involvement of NO in other functions. In C. fornicata, Pechenik et al. (2007) reported NOS-like immunoreactivity only in young pre-competent larvae (4–5 days old) but not in competent larvae. This finding diverges significantly from our results. As discussed before for I. obsoleta, this could be simply due to the method itself as immunoreactivity and quantitative real-time PCR might be difficult to compare. As stated by Pechenik et al. (2007), it is possible that the NOS activity exists in older larvae but is not detectable by the methods using universal anti-NOS polyclonal antibody. Overall, the relative discrepancy in results observed between the studies highlights the difficulty of studying the molecular basis of complex mechanisms such as metamorphosis of larvae through the use of multiple methods in a wide range of species. Turning to post-treatment kinetics, transcription showed a tendency to increase within the first 6 h (except for the KCl condition showing an increase sooner at 1 h post-treatment), before markedly and significantly decreasing past 6 h. Thereafter, mRNA levels

165

Fig. 3. Expression of nNOS mRNA normalized to ef2 mRNA measured by quantitative real-time PCR (A) through larval development from day 1 post-release to day 11 (70% metamorphosis obtained in 6 h with KCl test at day 11), (B) post-treatment with DBM and KCl. The post-treatment kinetics includes a “time 0” sample, referred as “pretreatment”. Data represent the mean ± SE of three replicates. Means with the same letter are not significantly different (Tukey's Studentized Range (HSD) test). A time or treatment effect is reported whenever found significant (p < 0.05) according to the ANOVA model (Proc GLM) for the post-treatment kinetics.

decreased over time, as observed 20 h and 48 h post-treatment, within the same range or beneath pre-treatment values. While the level of nNOS gene expression is expected to decrease following metamorphic induction to support an inhibitory function upon metamorphosis, the drastic nature of the increase 6 h post-treatment surprisingly contrasts with the gradual nature of the kinetics reported during larval development. The magnitude of this increase is difficult to interpret. We cannot exclude a potential effect of the experimental

Table 2 Results of the ANOVA models (Proc GLM) focused on the post-treatment kinetics. A. General model

F value

Pr > F

Treatment Time Treatment * Time Replicate

1.80 10.86 1.74 1.08

0.18 <0.01 0.13 0.35

B. Inducer effect throughout time sampling Time

Effect Treatment

1 3 6 20 48

Replicate

F value

Pr > F

F value

Pr > F

8.12 0.43 0.84 10.96 2.75

< 0.05 0.68 0.49 < 0.05 0.18

1.69 0.41 1.38 1.28 0.77

0.29 0.69 0.35 0.37 0.52

166

N. Taris et al. / Marine Genomics 2 (2009) 161–167

conditioning. Indeed, the ambient temperature (as opposed to the controlled temperature during larval rearing), the high density of larvae on beaker post-treatment (10 larvae per ml versus 2 per ml before treatment) as well as the larvae handling could have influenced or perturbed the transcriptional signal. For example, Gaudette et al. (2001) demonstrated that exposure to elevated temperature for a short period of time (hours) could promote metamorphosis in competent larvae of C. fornicata. In this regard, competence can be seen as an extremely vulnerable period. The timing for nNOS shutdown is scarcely documented. In support of the inhibitory function of NO, Hens et al. (2006) showed that larval nNOS transcript levels are greatly reduced by 12 h after induction. Similarly, Bishop et al. (2008) reported a significant decline in NO level (measured using electron paramagnetic spin resonance) within 12 h of metamorphosis induction with coral-derived inducer in the gastropod Phestilla sibogae. These results echo our observations: the transcriptional kinetics following both KCl and DBM treatment suggest the end of NO inhibition. More surprisingly was the similarity of the transcription profiles with and without inducer. The robustness of the transcriptional results is first supported by the subsamples monitoring the percentage of metamorphosed larvae in KCl 20 mM and without inducer. The percentage of metamorphosis reported in the phenotypic controls (Fig. 2B) excludes the possibility of artefactual signal. Indeed, while more than 70% of larvae were metamorphosed 6 h post-treatment, 100% of the larvae bathing in filtered seawater (i.e. without inducer) were still clearly pelagic. In addition, our study was replicated on a completely different batch of larvae obtained four months later and similar results were observed (similar kinetics and transcription level; data not shown). The seeming parallelism between the three experimental conditions (KCl, DBM, no inducer) thus calls for alternative interpretations. One possible explanation presumes that the transcription shutdown occurred earlier in treated samples. Statistically, the transcription level is significantly higher without inducer after 20 h. This result supports the hypothesis of a more progressive decline in the condition lacking inducer, as opposed to a more drastic decline occurring earlier with the two inducers tested. This scenario verifies the end of inhibition of NO due to the inductive event. It also suggests a more gradual decline of transcription levels for the larvae in filtered seawater that could simply reflect the “natural” decline of endogenous level of nNOS. This latter argument argues in favour of the “spontaneous metamorphosis” hypothesis supported by Pechenik et al. (2002) in C. fornicata. The authors demonstrated that the chloropromazine (NOS inhibitor) induced metamorphosis in greater proportion as competent larvae aged. Compared to this study, we observed a decline in transcription within a relatively short timeframe. We speculate that experimental handling caused an enhancing effect over the metamorphic processes. The percentage of metamorphosis monitored in the control subsamples (4.4 ± 3.8%) at the last time point (48 h) seems to validate the hypothesis proposing that metamorphosis occurs after termination of endogenous inhibition (Pechenik and Qian, 1998; Pechenik et al., 2002). After 20 h, a statistical difference between treatments was observed. Despite this observation, it is possible that K+ and DBM do not suppress the NO inhibitory function at all. Instead, these inducers might skip the NO pathway and/or intervene downstream along the metamorphic pathway (Pechenik et al., 2007). Indeed, the observed decrease might be similar to all conditions between 6 h and 20 h post-treatment, reflecting as speculated before, the gradual decline of endogenous level of nNOS. The inductive effect of excess K+ is known to cause depolarization of membrane potential and thus stimulation of excitatory cells (Hodgkin and Horowicz, 1959; Baloun and Morse, 1984; Yool et al., 1986). Unfortunately, the downstream sequence in the process of induction and the possible influence over NO signalling is still poorly understood; questions of whether excess K+ induces metamorphosis by depolarizing the same excitable chemosensory cells on the surface of larvae

which are normally activated by natural inducers remain unanswered (Hadfield et al., 2000). Similarly, the dopaminergic pathway is suspected to play an important role in the metamorphic pathway in C. fornicata (Pechenik et al., 2002) but needs further documentation. Conflicting results reflect the complexity of the connectivity of the different signal transduction pathways. For instance, Bishop et al. (2006) demonstrated a function for NO signalling downstream from sensory perception activated by K+ in Lytechinus pictus. These differences in the “transversal” signalling pathways may reflect the specificity of cues or simply can be explained by phylogenetic differences between the targeted invertebrates (Bishop et al., 2008). DBM, as opposite to excess K+, is naturally released by red coralline algae and has been suggested as a metamorphosis inducer of larvae of sea urchins (S. nudus and S. intermedius) (Agatsuma et al., 2006). A recent study has shown that larvae can be competent to respond to this volatile chemical (at a concentration of 1000 ppm) without yet being competent to respond to excess K+ (Taris et al., in prep.). This exclusiveness of the induction action has not been distinguished via the observation of nNOS gene transcription profiles. Finally, it is now well-documented that NOS genes can be regulated at post-transcriptional levels. Stasiv et al. (2001) showed that the drosophila NOS locus generates a large number of transcripts encoding for truncated NOS-like proteins by alternative splicing. Interestingly, although none of these truncated proteins is enzymatically active, it appears that some of them can inhibit the enzymatic activity of the full-length neuronal NOS protein. Among these truncated isoforms, some still harbour the calmodulin-binding regions targeted in the present study. Another striking example of post-transcriptional regulation is provided by Korneev et al. (1999). The authors found that the neuronal NOS enzyme activity can be substantially suppressed by an antisense RNA transcribed from an NOS pseudogene. Though translational regulation remains to be demonstrated in C. fornicata, the nNOS gene transcription levels may not reflect the actual NOS activity nor the associated NO production. Overall, this study showed nNOS gene transcription levels in agreement with an increased repressive effect over metamorphosis as larvae aged. Two possible scenarios could be put forward to explain the NO expression kinetics observed in our study: both scenarios suggesting a gradual endogenous decline of transcription level of nNOS as competent larvae aged, supporting the phenomenon of spontaneous metamorphosis. The scenarios differ with regard to the influence of inducers, questioning the signalling pathways triggered by KCl and DBM. To a larger extent, this work calls for further studies to fully understand the seemingly central role of NO signalling to the integration of information from natural or artificial cues. Likewise suggested by an NO inhibitory function upon metamorphosis, the level of expression decreased past metamorphic induction but did so in parallel without inductive event. This finding might be related to the implication of NO signalling pathways in other physiological functions. NO was indeed pointed out as a major component of a large range of biological processes (Moncada et al., 1991; Rosselli et al., 1998; Coleman, 2001; Brüne, 2003). While the transcriptional perspective is a powerful tool to shed light on NO signalling dynamics, we must also acknowledge the limitations of such inferences. The transcriptional analysis at the organism level enables a temporal study of gene expression, but reduces the spatial complexity of biological events (e.g. tissue or cell specificity). This could explain why it is still surprising not to see more studies that emphasize, at a transcriptional level, the NOS implication in metamorphosis. In this regard, this work calls for complementary approaches to fully identify the complexity of processes occurring both in space and time. While broad-scale approach to studying gene expression may provide important insights to a more integrative view of processes occurring during metamorphosis, dedicated tissue specific approaches at the protein level appear to be a necessary complement.

N. Taris et al. / Marine Genomics 2 (2009) 161–167

Acknowledgements The authors are particularly grateful to Régis Lasbleiz and Sébastien Henry from the Service Mer & Observation (FR2424 Station Biologique de Roscoff) for technical assistance during the larval rearing. The authors also thank Arnaud Tanguy for helpful advises regarding the molecular aspects, Paul Lang for improving the English of this article and two anonymous reviewers for insightful discussions and comments. This work was supported by the Agence Nationale de la Recherche (project MIRAGE no. ANR-05-BLAN-0001) and by GIS “Europôle Mer” (project METAL). References Agatsuma, Y., Seki, T., Kurata, K., Taniguchi, K., 2006. Instantaneous effect of dibromomethane on metamorphosis of larvae of the sea urchins Strongylocentrotus nudus and Strongylocentrotus intermedius. Aquaculture 251, 549–557. Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Baloun, A.J., Morse, D.E., 1984. Ionic control of settlement and metamorphosis in larval Haliotis rufescens (Gastropoda). Biol. Bull. 167, 124–138. Bishop, C.D., Brandhorst, B.P., 2001. NO/cGMP signaling and HSP90 activity represses metamorphosis in the sea urchin Lytechinus pictus. Biol. Bull. 201, 394–404. Bishop, C.D., Brandhorst, B.P., 2003. On NO signaling, metamorphosis and the origin of biphasic life cycles. Evol. Dev. 5, 542–550. Bishop, C.D., Huggett, M.J., Heyland, A.H., Hodin, J.H., Brandhorst, B.P., 2006. Interspecific variation in metamorphic competence in marine invertebrates: the significance for comparative investigations of regulatory systems. Integr. Comp. Biol. 662–682. Bishop, C.D., Pires, A., Norby, S-W., Moroz, L.L., Hadfield, M.G., 2008. Analysis of NO-cGMP signalling during metamorphosis of the nudibranch Phestilla sibogae Bergh (Gastropoda: Opisthobranchia). Evol. Dev. 10, 288–299. Brüne, B., 2003. Nitric oxide: NO apoptosis or turning it ON? Cell Death Differ. 10, 864–869. Chevenet, F., Brun, C., Banuls, A.L., Jacq, B., Chisten, R., 2006. TreeDyn: towards dynamic graphics and annotations for analyses of trees. BMC Bioinformatics 7, 439. Coleman, J.W., 2001. Nitric oxide in immunity and inflammation. Int. Immunopharmacol. 1, 1397–1406. Comes, S., Locascio, A., Silvestre, F., d'Ischia, M., Russo, G.L., Tosti, E., Branno, M., Palumbo, A., 2007. Regulatory roles of nitric oxide during larval development and metamorphosis in Ciona intestinalis. Dev. Biol. 306, 772–784. Cowen, R.K., Sponaugle, S., 2009. Larval dispersal and marine population connectivity. Annu. Rev. Mar. Sci. 1, 443–466. Davidson, B., Swalla, B.J., 2002. A molecular analysis of ascidian metamorphosis reveals activation of an innate immune response. Development 129, 4739–4751. Dereeper, A., Guignon, V., Blanc, G., Audic, S., Buffet, S., Chevenet, F., Dufayard, J.F., Guindon, S., Lefort, V., Lescot, M., Claverie, J.M., Gascuel, O., 2008. Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res. 36, 465–469. Dunstan, P.K., Bax, N.J., 2007. How far can marine species go? Influence of population biology and larval movement on future range limits. Mar. Ecol. Prog. Ser. 344, 15–28. Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797. Felsenstein, J., 1993. PHYLIP (PHYLogeny Inference Package) version 3.6a2. Department of Genetics, University of Washington, Seattle. Froggett, S.J., Leise, E.M., 1999. Metamorphosis in the marine snail Ilyanassa obsoleta, Yes or NO? Biol. Bull. 196, 57–62. Gascuel, O., 1997. BIONJ: an improved version of the NJ algorithm based on a simple model of sequence data. Mol. Biol. Evol. 14, 685–695. Gaudette, M.F., Lowther, J., Pechenik, J.A., 2001. Heat shock induces metamorphosis in larvae of the prosobranch gastropod Crepidula fornicata. J. Exp. Mar. Biol. Ecol. 266, 151–164. Hadfield, M.G., Paul, V.J., 2001. Natural chemical cues for settlement and metamorphosis of marine invertebrate larvae. In: McClintock, J.B., Baker, W. (Eds.), Marine Chemical Ecology. CRC Press, pp. 431–461. Hadfield, M.G., Meleshkevitch, E.A., Boudko, D.Y., 2000. The apical sensory organ of a gastropod veliger is a receptor for settlement cues. Biol. Bull. 198, 67–76.

167

Hadfield, M.G., Carpizo-Ituarte, E.J., del Carmen, K., Nedved, B.T., 2001. Metamorphic competence, a major adaptive convergence in marine invertebrate larvae. Am. Zool. 41, 1123–1131. Heid, C.A., Stevens, J., Livak, K.J., Williams, P.M., 1996. Real time quantitative PCR. Genome Res. 6, 986–994. Hens, M.D., Fowler, K.A., Leise, E.M., 2006. Induction of metamorphosis decreases nitric oxide synthase gene expression in larvae of the marine mollusc Ilyanassa obsoleta (Say). Biol. Bull. 211, 208–211. Hodgkin, A.L., Horowicz, P., 1959. The influence of potassium and chloride ions on the membrane potential of single muscle fibres. J. Physiol. 148, 127–160. Itoh, N., Shinya, M., 1994. Seasonal evolution of bromomethanes from coralline algae (Corallinaceae) and its effect on atmospheric zone. Mar. Chem. 45, 95–103. Jacobs, M.W., Degnan, S.M., Woods, R., Williams, E., Roper, K.E., Green, K., Degnan, B.M., 2006. The effect of larval age on morphology and gene expression during ascidian metamorphosis. Integr. Comp. Biol. 46, 760–776. Kinlan, B.P., Hastings, A., 2005. Rates of population spread and geographic range expansion — what exotic species tell us? In: Sax, D.F., Stachowicz, J.J., Gaines, S.D. (Eds.), Species Invasions: Insights into Ecology, Evolution and Biogeography. Sinauer Associates Inc., Sunderland, pp. 381–419. Korneev, S.A., Park, J-H., O 'Shea, M., 1999. Neuronal expression of neural nitric oxide synthase (nNOS) protein is suppressed by an antisense RNA transcribed from an NOS pseudogene. J. Neurosci. 19, 7711–7720. Levin, L.A., 2006. Recent progress in understanding larval dispersal: new directions and digressions. Integr. Comp. Biol. 46, 282–297. Lin, M.F., Leise, E.M., 1996. NADPH-diaphorase activity changes during gangliogenesis and metamorphosis in the gastropod mollusc Ilyanassa obsoleta. J. Comp. Neurol. 374, 194–203. Medina, M., 2009. Functional genomics opens doors to understanding metamorphosis in nonmodel invertebrate organisms. Mol. Ecol. 18, 763–764. Moncada, S., Palmer, R.M.J., Higgs, E.A., 1991. Nitric Oxide: physiology, pathophysiology, and pharmacology. Pharmacol. Rev. 43, 109–141. Moroz, L.L., 2001. Gaseous transmission across time and species. Am. Zool. 41, 304–320. Palumbo, A., 2005. Nitric oxide in marine invertebrates: a comparative perspective. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 142, 241–248. Pechenik, J.A., Heyman, W.D., 1987. The influence of KCl and other chemicals on metamorphosis of the marine gastropod Crepidula fornicata (L.). J. Exp. Mar. Biol. Ecol. 112, 27–38. Pechenik, J.A., Gee, C.C., 1993. Onset of metamorphic competence in larvae of the gastropod Crepidula fornicata, judged by a natural and an artificial cue. J. Exp. Mar. Biol. Ecol. 167, 59–72. Pechenik, J.A., Qian, P.Y., 1998. Onset and maintenance of metamorphic competence in the marine polychaete Hydroides elegans in response to three chemical cues. J. Exp. Mar. Biol. Ecol. 226, 51–74. Pechenik, J.A., Li, W., Cochrane, D.E., 2002. Timing is everything: the effects of putative dopamine antagonists on metamorphosis vary with larval age and experimental duration in the prosobranch gastropod Crepidula fornicata. Biol. Bull. 202, 137–147. Pechenik, J.A., Cochrane, D.E., Li, W., West, E.T., Pires, A., Leppo, M., 2007. Nitric oxide inhibits metamorphosis in larvae of Crepidula fornicata, the slippershell snail. Biol. Bull. 213, 160–171. Ramakers, C., Ruijter, J.M., Lekanne Deprez, R.H., Moorman, A.F.M., 2003. Assumptionfree analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 339, 62–66. Rosselli, M., Keller, P.J., Dubey, R.K., 1998. Role of nitric oxide in the biology, physiology and pathophysiology of reproduction. Hum. Reprod. Updat. 4, 3–24. SAS Institute Inc., 1999. SAS/STAT User's Guide, Version 8. SAS Institute Inc., Cary, NC. Stasiv, Y., Regulski, M., Kuzin, B., Tully, T., Enikolopov, G., 2001. The Drosophila nitric oxide synthase gene (dNOS) encodes a family of proteins that can modulate NOS activity by acting as dominant negative regulators. J. Biol. Chem. 276, 42241–42251. Thorson, G., 1950. Reproductive and larval ecology of marine bottom invertebrates. Biol. Rev. 25, 1–45. Untergasser, A., Nijveen, H., Rao, X., Bisseling, T., Geurts, R., Leunissen, J.A.M., 2007. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 35, 71–74. Vaulot, D., Le Gall, F., Marie, D., Guillou, L., Partensky, F., 2004. The Roscoff Culture Collection (RCC): a collection dedicated to marine picoplankton. Nova Hedwig. 79, 49–70. Williams, E.A., Degnan, B.M., Gunter, H., Jackson, D.J., Woodcroft, B.J., Degnan, S.M., 2009. Widespread transcriptional changes pre-empt the critical pelagic-benthic transition in the vetigastropod Haliotis asinina. Mol. Ecol. 18, 1006–1025. Yool, A.J., Grau, S.M., Hadfield, M.G., Jensen, R.A., Markell, D.A., Morse, D.E., 1986. Excess potassium induces larval metamorphosis in four marine invertebrate species. Biol. Bull. 170, 255–266. Zhu, M., Zhao, S., 2007. Candidate gene identification approach: progress and challenges. Int. J. Biol. Sci. 3, 420–427.