- Email: [email protected]
Initial development of biosimilar immune checkpoint blockers using HEK293 cells
Protein Expression and Purification 170 (2020) 105596
Contents lists available at ScienceDirect
Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep
Initial development of biosimilar immune checkpoint blockers using HEK293 cells
T
Michael Bernardes Ramos, Anna Erika Vieira de Araújo, Cristiane Pinheiro Pestana, Ana Paula Dinis Ano Bom, Renata Chagas Bastos, Aline de Almeida Oliveira, Patrícia Cristina da Costa Neves, Haroldo Cid da Silva Junior∗ Instituto de Tecnologia em Imunobiológicos (Bio-Manguinhos), Fundação Oswaldo Cruz (Fiocruz), Rio de Janeiro, RJ, Brazil
A R T I C LE I N FO
A B S T R A C T
Keywords: Expression Transient HEK Biosimilar Checkpoint Cancer
Antibodies that block interaction of immune checkpoint receptors with its ligands have revolutionized the treatment of several cancers. Despite the success of this approach, the high cost has been restricted the use of this class of drugs. In this context, the development of biosimilar can be an important strategy for reducing prices and expanding access after patent has been dropped. Here, we evaluated the use of HEK293 cells for transient expression of an immune checkpoint-blocking antibody as a first step for biosimilar development. Antibody light and heavy chain genes were cloned into pCI-neo vector and transiently expressed in HEK293 cells. The culture supernatant was then subjected to protein A affinity chromatography, which allowed to obtain the antibody with high homogeneity. For physicochemical comparability, biosimilar antibody and reference drug were analyzed by SDS-PAGE, isoelectric focusing, circular dichroism and fluorescence spectroscopy. The results indicated that the both antibodies have a high degree of structural similarity. Lastly, the biosimilar antibody binding capacity to target receptor was shown to be similar to reference product in ELISA and flow cytometry assays. These data demonstrate that the HEK293 system can be used as an important tool for candidate selection and early development of biosimilar antibodies.
1. Introduction The amplitude and quality of T cells response are regulated by a balance between costimulatory and inhibitory signals. The inhibitory signals are called immune checkpoints and, under normal physiological conditions, are crucial for maintaining self-tolerance and also for protecting tissues from damage generated by activation of the immune system in response to infections. However, checkpoint protein expression may be deregulated by tumors as an important mechanism of immune resistance [1]. Antibodies blocking these molecules can increase the effector activity of tumor-specific T cells. These antibodies, which are known as immune checkpoint blockers (ICBs), have already been approved by the US Food and Drug Administration (FDA)/The European Medicines Agency (EMA) and used in the standard of care for different tumor types [2]. The growing success of therapeutic monoclonal antibodies has been inevitably paralleled by the increasing challenge for patients and
worldwide health care systems to pay for them. Biosimilar have a central role in this scenario, because encourage competition and reduce prices, enhancing patient access to treatments and relieving pressure on healthcare budgets [3]. The EMA defines a biosimilar as “a biological medicinal product that contains a version of the active substance of an already authorized original biological medicinal product in the European Economic Area”. Since biosimilars are made in living organisms, minor differences can exist between the biosimilar and the reference product, however it is required to demonstrate that these differences are not clinically meaningful [4]. Although there is still a long timeframe for ICBs patents to expire [5], this event will trigger a race for the development of biosimilar versions of these drugs. In this scenario, the use of tools that allow these antibodies to be readily obtained for the initial developmental tests and the validation of the analytical methodologies will be of great relevance. Therefore, this study aimed to evaluate the use of HEK293 cells for
∗ Corresponding author. Laboratório de Tecnologia Recombinante, Bio-Manguinhos / Fiocruz, Av. Brasil, 4365, Manguinhos – Pavilhão Rockfeller, 21040-360, Rio de Janeiro – RJ, Brazil. E-mail address: haroldo.cid@bio.fiocruz.br (H.C. da Silva Junior).
https://doi.org/10.1016/j.pep.2020.105596 Received 18 December 2019; Accepted 5 February 2020 Available online 07 February 2020 1046-5928/ © 2020 Elsevier Inc. All rights reserved.
Protein Expression and Purification 170 (2020) 105596
M.B. Ramos, et al.
the wells were revealed by addition of 100 μL of tetramethyl benzedine (TMB, Thermo Fisher Scientific). The reactions were stopped after 10 min with 50 μL of 2 N H2SO4. Next, the optical density (OD) of each well was read on a microplate reader (Sunrise, Tecan) at 450 nm. To perform antibody quantification, a standard curve was constructed by two-fold serial dilutions (50 ng/mL - 1.6 ng/mL) of IgG from human serum (Sigma-Aldrich).
ICB antibody transient expression as a first step for development of a biosimilar. The antibodies names were omitted for strategic reasons. 2. Material and methods 2.1. Construction of expression vector The gene sequences of proposed biosimilar were reverse-engineered from the amino acid sequences of innovator drug. To allow secretion of antibody to the extracellular space, signal sequences were added in the N-terminal portion of each chain (heavy chain signal sequence: ATGG GCTGGAGCCTGATCCTGCTGTTCCTGGTGGCCGTGGCTACAAGAGTGC TGTCT, and light chain signal sequence: ATGGACTTCCAGGTGCAGAT CATCTCTTTTCTGCTGATCAGCGCCTCTGTGATCATGTCCAGGGGC). Additionally, Kozak sequence (GCCACC) was added at the N-terminal regions of both genes. The gene constructs were synthesized by Integrated DNA Technologies (IDT) and subcloned separately into the polylinker of pCI-neo expression vector (Promega), using the restriction enzymes XhoI and XbaI.
2.5. Purification and homogeneity analysis The purification procedure was performed using a 5 mL HiTrap MabSelect SuRe column (GE Healthcare) on an ÄKTA pure chromatography system (GE Healthcare). The culture supernatant was collected 5 days after transfection and filtered through a 0.45 μm membrane filter. Next, the supernatant was mixed with binding buffer (20 mM Na2PO4, 0.15 M NaCl, pH = 7.2) in a 1:1 ratio and loaded onto the column previously equilibrated. To remove impurities and unbound material, the column was washed with 10 column volumes of binding buffer. Elution step was performed using 0.1 M sodium citrate pH 3.0, followed by immediate neutralization with 1 M tris-HCl, pH 9.0. The purified antibody was buffer exchanged into PBS, pH 7.4, using a 5 mL HiTrap Desalting column (GE Healthcare), according to the manufacturer's instructions. The concentration of purified antibody was determined by spectrophotometric measurement at 280 nm (Nanodrop 1000, Thermo Fisher Scientific), using molar extinction coefficient of 1.4. Finally, densitometry (GS-800 Calibrated Densitomer, Bio-Rad) of Coomassie blue-stained SDS–PAGE gels was used to determine the purity of sample.
2.2. Cell culture The human cell line Expi293F, which is adapted to serum-free culture media and suspension growth, was purchased from Thermo Fisher Scientific (catalog no. A14527). Cells were cultured in baffled erlenmeyer flasks with vented caps, using Expi293 expression medium (Thermo Fisher Scientific). The cultures were maintained at 37 °C in a humidified atmosphere with 8% CO2, under regular agitation (120 rpm).
2.6. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE)
2.3. Transient transfection Expi293F cells were co-transfected with plasmids containing light chain (LC) and heavy chain (HC) DNA sequences, using Expi293 expression system kit (Thermo Fisher Scientific). Briefly, each plasmid (15 μg) was diluted in 1.5 mL Opti-MEM and mixed gently. Expifectamine 293 transfection reagent (81 μL) was diluted in 1.5 mL Opti-MEM and incubated for 5 min at room temperature. In order to allow DNA-lipid complex formation, diluted transfection reagent was added to the diluted DNA, mixed gently and incubated for 30 min. The complex was added to the 125 mL erlenmeyer flask containing 7.5 × 107 cells in 30 mL of medium. The cells subjected to transfection were then incubated for 18 h at 37 °C with 8% CO2 and agitation at 120 rpm. After this period, 150 μL of enhancer I and 1.5 mL of enhancer II were added to increase antibody expression. The cells were incubated further 6 days in the same conditions previously described. Aliquots of the transfected cell suspension were collected every 24 h for determination of cell viability and antibody expression levels.
The proposed biosimilar and reference product were analyzed by SDS-PAGE. For reducing condition, antibodies were mixture with 4x loading buffer containing 2-mercaptoethanol, boiled for 5 min at 95 °C and resolved on 12% polyacrylamide gel at 120V in SDS-PAGE for 90 min. For non-reducing condition, antibodies samples were mixture with 4x loading buffer without 2-mercaptoethanol and heated at 95 °C for 5 min before loading on 10% polyacrylamide gel. The gels staining was performed with Gel Code™ Blue Stain Reagent (Thermo Fisher Scientific), according to the manufacturer's recommendations. 2.7. Isoelectric focusing gel electrophoresis (IEF-PAGE) Antibodies isoforms were separated by isoelectric focusing in polyacrylamide gel with pH 3–9 gradient. An IEF standard (High pI pH 5.0–10.5, GE Healthcare) was co-electrophoresed next to the samples. Following the electrophoresis, the gels were stained with Coomassie Brilliant Blue R350 (GE Healthcare) for 18 h. Antibodies were analyzed in duplicate and compared to the 7 bands of known isoelectric point (pI) protein standards.
2.4. Analysis of antibody expression To evaluate the expression of proposed biosimilar antibody, an enzyme-linked immunosorbent assay (ELISA) was carried out. Firstly, a Flat-bottom 96-well polystyrene plate (Thermo Fisher Scientific) was coated with anti-human IgG (Fc specific) antibody (Sigma-Aldrich) diluted 1:500 in sodium carbonate-bicarbonate buffer, pH 9.6, and incubated overnight at 4 °C. The coated plate was washed five times with PBS containing 0.05% Tween 20 (PBS-T) and blocked with blocking solution (5% fetal bovine serum, 0.1% bovine serum albumin and 5% non-fat dry milk in PBS-T) at 37 °C for 2 h. The supernatants of transfected cells were diluted in triplicate with PBS pH 7.4. A 100 μL volume of diluted supernatants were added into each well, incubated at 37 °C for 2 h, and then washed five times. Following this procedure, 100 μL of goat anti-human IgG, IgM, IgA – peroxidase antibody (Sigma-Aldrich) diluted at 1:8000 with PBS pH 7.4 was added to each well, and the mixtures were incubated at 37 °C for 1 h. After five washes with PBS-T,
2.8. Circular dichroism (CD) The secondary structures of antibodies were evaluated on a Jasco J815 spectropolarimeter (Jasco Corp) with a 0.1 cm path-length quartz cuvette. Far-UV spectra were measured from 190 to 260 nm, averaged over three scans at a speed of 50 nm/min, and collected in 1 nm steps. The buffer baselines were subtracted from their respective sample spectra. The experiment was performed at room temperature with a volume of 400 μL and at the final concentration of 0.5 mg/mL. 2.9. Fluorescence spectroscopy The fluorescence spectra were obtained and recorded by setting the excitation wavelength at 280 nm and the emission spectrum was 2
Protein Expression and Purification 170 (2020) 105596
M.B. Ramos, et al.
recorded from 295 to 415 nm, using a JASCO FP-6500 spectrofluorimeter (Jasco Corp.). The assays were performed in triplicate, at room temperature, with a volume of 200 μL of antibodies, which were in the concentration of 0.5 mg/mL. 2.10. Antibody-receptor binding studies 2.10.1. ELISA A Flat-bottom 96-well polystyrene plate (Thermo Fisher Scientific) was coated with extracellular portion of target receptor diluted in sodium carbonate-bicarbonate buffer, pH 9.6, and incubated overnight at 4 °C. The coated plate (100 ng receptor/well) was washed and blocked as described above. A 100 μL volume of diluted antibodies (5 pg/μL) was added into each well, incubated at 37 °C for 2 h, and then washed. Next, 100 μL of goat anti-human IgG, IgM, IgA – peroxidase antibody (Sigma-Aldrich) diluted at 1:5000 with PBS pH 7.4 was added to each well, and the mixtures were incubated at 37 °C for 1 h. The procedures for revelation and absorbance measurements were performed as described above.
Fig. 1. Expression kinetics of proposed biosimilar in Expi293F cells. Right yaxis: levels of antibody expression measured by ELISA; left y-axis: cell viability. X-axis: harvest days post-transfection. The presented values are the mean of four independent experiments and error bars represent standard error of the mean.
2.10.2. Flow cytometry analysis Expi293F cells were transfected with the construct pCI-neo + receptor-GFP, which was produced in our laboratory. The transfected cells were maintained for 3 days in culture to allow receptor expression on the cell surface. After that, the cells were harvested and resuspended in PBS pH 7.4, at concentration of 1 × 107 cells/mL. The cells were then stained with biosimilar and innovator antibodies (10 μg/mL) for 30 min at room temperature, washed three times with PBS and further stained with anti-human IgG (γ-chain specific) R-Phycoerythrin (SigmaAldrich) for another 30 min. Finally, the cells were washed and analyzed by flow cytometry using the BD LSR Fortessa equipment. An unrelated IgG (Abcam) was used as isotype control.
Fig. 2. SDS-polyacrylamide-gel electrophoresis under reducing conditions to analyze samples collected during purification, buffer exchange and concentration steps of proposed biosimilar. Lane 1, BenchMark Protein Ladder; Lane 2, supernatant of transfected Expi293F cells; Lane 3, supernatant mixed with binding buffer; Lane 4, flow-through; Lane 5, washing step; Lane 6, fraction eluted from affinity column; Lane 7, proposed biosimilar into PBS after desalting step; Lane 8, proposed biosimilar in PBS and concentrated by ultrafiltration. The arrows indicate bands of light chain (LC, ~25 kDa) and heavy chain (HC, ~50 kDa) of purified antibody.
2.11. Statistical analysis The analysis were performed with GraphPad Prism software, version 5. Data were reported as mean ± standard error of the mean. Absorbance values for receptor binding assays were compared using one-way analysis of variance (ANOVA) and Tukey's test. The differences were considered to be statistically significant at p < 0.05. 3. Results To analyze expression kinetics of proposed biosimilar, Expi293F cells were co-transfected with the constructs containing the LC and HC genes. The antibody concentration increased during the culture of transfected cells, exhibiting peak expression on the fifth day posttransfection. On the other hand, the cell viability decreased over the days, reaching less than 10% at the end of the experiment (Fig. 1). To perform antibody purification, the cell supernatant was harvested at day 5 post-transfection and subjected to protein A affinity chromatography. The purification was successful, since the sample was enriched in the antibody and most of the contaminants were removed (Fig. 2). After the purification step, the elution buffer was replaced by PBS, pH 7.4, and then the proposed biosimilar was concentrated by ultrafiltration (Fig. 2). The final recovery estimated for the antibody was approximately 65 mg per liter of transfected culture. To determine homogeneity degree of proposed biosimilar, a SDSPAGE assay was performed with increasing amounts of protein mass (Fig. 3). It was observed that from 15 μg (Fig. 3, lane 3) the percentage of antibody remained stable when compared to the others bands visualized on the gel, which allowed to estimate the homogeneity of antibody in approximately 95%. As a result, the comparability assays with the originator product were initiated. The electrophoretic migration profile of proposed biosimilar was
Fig. 3. SDS-polyacrylamide-gel electrophoresis under non-reducing conditions to estimate homogeneity of proposed biosimilar. Lane 1, BenchMark Protein Ladder; Lane 2, 10 μg; Lane 3, 15 μg; Lane 4, 20 μg; Lane 5, 25 μg; Lane 6, 30 μg. The blank numbers represent the percentage of the antibody bands in each lane.
3
Protein Expression and Purification 170 (2020) 105596
M.B. Ramos, et al.
Fig. 4. SDS-polyacrylamide-gel electrophoresis under reducing (A) and nonreducing (B) conditions to compare electrophoretic migration profile of biosimilar proposed to the reference antibody. Lane 1, BenchMark Protein Ladder; Lane 2, reference product; Lane 3, proposed biosimilar. The arrows indicate bands of light chain (LC, ~25 kDa), heavy chain (HC, ~50 kDa) and whole molecule (HC + LC, ~150 kDa) of immune checkpoint inhibitors antibodies. Fig. 6. Tryptophan fluorescence emission spectra of proposed biosimilar and innovator product obtained by excitation at 280 nm, and emission from 295 to 415 nm.
compared to the reference antibody in the presence (Fig. 4A) and absence of reducing agent (Fig. 4B). In both conditions analyzed, it was possible to observe that the biosimilar antibody presented a migration profile similar to innovator product. In addition, it was possible to observe that the bands had molecular weights of approximately 25 kDa, 50 kDa and 150 kDa, which correspond to the expected weights for the light chain, heavy chain and whole antibody, respectively. In order to evaluate charge variants in proposed biosimilar and reference drug, isoelectric focusing gel electrophoresis (IEF-PAGE) was performed. The result showed that pI for the main isoform of both antibodies was 8.61. The others bands were similar and fell within a similar range for both products (data not shown). The far UV circular dichroism (CD) spectra of antibodies showed a maximum negative ellipticity in the wavelenth range of 216–218 nm, which is a signature for the presence of β-sheet in structure. No relevant differences were observed between the antibody spectra, suggesting that both adopt the same secondary structure (Fig. 5). The fluorescence spectrum of proposed biosimilar presented lower intensity when compared to the innovator product. Despite this, a maximum fluorescence peak at approximately 342 nm was observed for
both antibodies, indicating that there was no deviation in the spectrum (Fig. 6). Thus, it can be inferred that both antibodies are properly folded, despite there are small conformational differences between them. The ability of antibodies to bind to the extracellular portion of receptor adsorbed on the solid surface was assessed by ELISA (Fig. 7). The results showed that the proposed biosimilar and reference product were able to similarly recognize the target receptor, since there was no statistically significant difference between the absorbance values. Isotype control (IgG) did not recognize the receptor as expected. The full-length receptor was constructed fused to GFP protein and expressed transiently in Expi293F cells. These cells were used in the flow cytometry assays to evaluate the binding of antibodies to the target receptor anchored on the cell membrane (Fig. 8). The results suggest that the biosimilar antibody recognizes receptor similarly to the reference product. 4. Discussion Mammalian expression systems are the preferred platform for producing therapeutic antibodies, since these systems are able to
Fig. 7. Immunoenzymatic assay to assess the binding ability of antibodies to target receptor immobilized on solid surface. Y-axis: absorbance at 450 nm. Xaxis: antibodies tested. The presented values are the mean of three independent experiments and error bars indicate standard error of the mean. Groups were compared using ANOVA and Tukey's test (α = 0.05; ***p < 0.0001). Biosimilar and innovator absorbance values are not statistically different (p > 0.05).
Fig. 5. Circular dichroism (CD) spectra of proposed biosimilar and innovator product, at 190–260 nm, resulting from three consecutive measurements at the speed of 50 nm/min. 4
Protein Expression and Purification 170 (2020) 105596
M.B. Ramos, et al.
Fig. 8. Flow cytometry to assess the binding of antibodies to receptor expressed on the cell surface of Expi293F cells. Plasmid expressing full-length receptor fused with GFP was used for transfection. Cells expressing Receptor/GFP and exposed only to secondary antibody were used as negative control (NC). A non-related IgG was used as isotype control to estimate the non-specific binding to receptor. Anti-human IgG R-Phycoerythrin was used as secondary antibody (PE). The data presented are a representative of three independent experiments with similar results.
viability was found to be around 50%. Since cell death may contribute to the release of proteases and thereby affect the quality of the protein being expressed [9], it was chosen to purify the antibody from supernatants maintained for 5 days post-transfection. After purification by protein A affinity chromatography, the proposed biosimilar was obtained with a high degree of homogeneity. The purity around 95% allowed comparability assays with the reference antibody to be performed. CD results showed dominance of beta-sheet structures in both antibodies, proposed biosimilar and innovator product, being possible to observe great similarity between the spectra. In addition, the CD data presented here are in compliance with studies of Liu et al. (2016) [10], which an ICB antibody also was analyzed by far-UV CD. In order to evaluate tertiary structure of the proposed biosimilar and the innovator drug, fluorescence spectroscopy was used. The results showed that the biosimilar spectrum was comparable to the reference product. However, a lower biosimilar signal intensity was observed, which may be related to small differences in the exposure of aromatic groups of this molecule. It is noteworthy that the biosimilar antibody was expressed in human embryonic kidney (HEK) 293 cells, whereas the reference drug is produced in Chinese hamster ovary (CHO) cells. Although CHO cells produce glycosylation very similar to that found in human cells, these cells cannot perform all types of human glycosylation [11]. In addition, CHO cells can express the non-human glycans Gala1-3Gal (alpha-Gal) and N-glycolylneuraminic acid (Neu5Gc) [12]. Therefore, these variations in glycosylation pattern may explain the small differences
manufacture proteins with folding and post-translational modifications (PTMs) that are more similar to those processes in humans [6]. Stable expression technologies are used for the production of biologics at gram to kilogram quantities in mammalian cells. However, the establishment of stable clones usually takes 3–12 months with the requirement of either a labor-intensive clonal selection process or complex and expensive laboratory equipment [7]. In contrast, transient gene expression (TGE) makes it possible to obtain grams of protein within 2–4 weeks, from gene cloning to protein. This accomplishment represents a major advantage compared to the time and resource-consuming process of generating stable cell lines [7]. With the growing demand for biologics and the end-of-patent protection for many existing treatments, the focus for biogeneric equivalents will be speed and/or cost. In this context, a significant challenge for industry will be the rapid analysis of potential biosimilar candidates in early stages of development. This can be effectively achieved using high yielding TGE systems in combination with high-throughput screening methods [8]. In this work, we expressed and evaluated a proposed biosimilar antibody to immune checkpoint blocking. The antibody was produced transiently using the Expi293™ Expression System kit, which is based on HEK293 cells. It is noteworthy that this cell line have been commonly applied to TGE because it show numerous advantages including humanoriginating PTMs, high level productivity, straight-forward management and safety [6]. The study of kinetics of biosimilar expression demonstrated that antibody levels peaked at the fifth day of culture, at which time 5
Protein Expression and Purification 170 (2020) 105596
M.B. Ramos, et al.
observed in terms of tertiary structure. Action mechanism of ICBs is based on antibody binding to its target, which prevents the interaction receptor-ligand. This blockade releases receptor pathway-mediated immune responses against tumor cells [13]. Therefore, the binding capacity of biosimilar antibody to recombinant receptor immobilized on solid surface (ELISA) and expressed on eukaryotic cell membrane (FACS) was evaluated. The results showed that the ability of the biosimilar antibody to bind to the receptor remained unchanged when compared to the reference product, which indicates that the small structural differences observed are unlikely to have a relevant effect on molecule activity. In conclusion, the dataset presented here allows us to state that HEK293 cells represent a suitable system to obtain different biomolecules quickly and efficiently for the early stages of development, which can be an important differential in a scenario of patent drop and biosimilar market growth. Additionally, the use of HEK293 cells to obtain stable clones secreting therapeutic molecules may represent a new trend in the biopharmaceutical industry, since these cells produce recombinant proteins like those synthesized naturally in humans, mitigating concerns related to the presence of nonhuman glycans in biopharmaceuticals [6,12].
Nat. Rev. Immunol. 8 (6) (2008) 467–477, https://doi.org/10.1038/nri2326. [2] A. Lopes, K. Vanvarenberg, Š. Kos, S. Lucas, D. Colau, B. Van den Eynde, et al., Combination of immune checkpoint blockade with DNA cancer vaccine induces potent antitumor immunity against P815 mastocytoma, Sci. Rep. 8 (1) (2018) 15732, https://doi.org/10.1038/s41598-018-33933-7. [3] M. McCamish, G. Woollett, Worldwide experience with biosimilar development, mAbs 3 (2) (2011) 209–217, https://doi.org/10.4161/mabs.3.2.15005. [4] L. Barbier, P. Declerck, S. Simoens, P. Neven, A.G. Vulto, I. Huys, The arrival of biosimilar monoclonal antibodies in oncology: clinical studies for trastuzumab biosimilars, Br. J. Canc. 121 (3) (2019) 199–210, https://doi.org/10.1038/s41416019-0480-z. [5] U. Storz, Intellectual property issues of immune checkpoint inhibitors, mAbs 8 (1) (2016) 10–26, https://doi.org/10.1080/19420862.2015.1107688. [6] M. Tabasinezhad, F. Mahboudi, W. Wenzel, H. Rahimi, T.H. Walther, C. Blattner, et al., The transient production of anti-TNF-α antibody Adalimumab and a comparison of its characterization to the biosimilar Cinorra, Protein Expr. Purif. 155 (2019) 59–65, https://doi.org/10.1016/j.pep.2018.11.006. [7] S. Gutiérrez-Granados, L. Cervera, A.A. Kamen, F. Gòdia, Advancements in mammalian cell transient gene expression (TGE) technology for accelerated production of biologics, Crit. Rev. Biotechnol. 38 (6) (2018) 918–940, https://doi.org/10. 1080/07388551.2017.1419459. [8] J.J.C. Hou, J. Codamo, W. Pilbrough, B. Hughes, P.P. Gray, et al., New frontiers in cell line development: challenges for biosimilars, J. Chem. Technol. Biotechnol. 86 (2011) 895–904, https://doi.org/10.1002/jctb.2574. [9] G.P. Subedi, R.W. Johnson, H.A. Moniz, K.W. Moremen, A. Barb, High yield expression of recombinant human proteins with the transient transfection of HEK293 cells in suspension, J. Vis. Exp. 106 (2015) e53568, , https://doi.org/10.3791/ 53568. [10] B. Liu, H. Guo, J. Xu, T. Qin, L. Xu, J. Zhang, et al., Acid-induced aggregation propensity of nivolumab is dependent on the Fc, mAbs 8 (6) (2016) 1107–1117, https://doi.org/10.1080/19420862.2016.1197443. [11] S. Dietmair, M.P. Hodson, L.E. Quek, N.E. Timmins, P. Gray, L.K. Nielsen, A multiomics analysis of recombinant protein production in Hek293 cells, PloS One 7 (8) (2012) e43394, , https://doi.org/10.1371/journal.pone.0043394. [12] D. Ghaderi, M. Zhang, N. Hurtado-Ziola, A. Varki, Production platforms for biotherapeutic glycoproteins. Occurrence, impact, and challenges of non-human sialylation, Biotechnol. Genet. Eng. Rev. 28 (2012) 147–175, https://doi.org/10. 5661/bger-28-147. [13] L.A. Raedler, Opdivo (nivolumab): second PD-1 inhibitor receives FDA approval for unresectable or metastatic melanoma, Am Health Drug Benefits 8 (2015) 180–183 Spec Feature.
Declaration of competing interest The authors declare no financial or commercial conflict of interest. Acknowledgements The authors thank Dr. Martin Hernan Bonamino for providing the reference drug. References [1] W. Zou, L. Chen, Inhibitory B7-family molecules in the tumour microenvironment,
6
Contents lists available at ScienceDirect
Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep
Initial development of biosimilar immune checkpoint blockers using HEK293 cells
T
Michael Bernardes Ramos, Anna Erika Vieira de Araújo, Cristiane Pinheiro Pestana, Ana Paula Dinis Ano Bom, Renata Chagas Bastos, Aline de Almeida Oliveira, Patrícia Cristina da Costa Neves, Haroldo Cid da Silva Junior∗ Instituto de Tecnologia em Imunobiológicos (Bio-Manguinhos), Fundação Oswaldo Cruz (Fiocruz), Rio de Janeiro, RJ, Brazil
A R T I C LE I N FO
A B S T R A C T
Keywords: Expression Transient HEK Biosimilar Checkpoint Cancer
Antibodies that block interaction of immune checkpoint receptors with its ligands have revolutionized the treatment of several cancers. Despite the success of this approach, the high cost has been restricted the use of this class of drugs. In this context, the development of biosimilar can be an important strategy for reducing prices and expanding access after patent has been dropped. Here, we evaluated the use of HEK293 cells for transient expression of an immune checkpoint-blocking antibody as a first step for biosimilar development. Antibody light and heavy chain genes were cloned into pCI-neo vector and transiently expressed in HEK293 cells. The culture supernatant was then subjected to protein A affinity chromatography, which allowed to obtain the antibody with high homogeneity. For physicochemical comparability, biosimilar antibody and reference drug were analyzed by SDS-PAGE, isoelectric focusing, circular dichroism and fluorescence spectroscopy. The results indicated that the both antibodies have a high degree of structural similarity. Lastly, the biosimilar antibody binding capacity to target receptor was shown to be similar to reference product in ELISA and flow cytometry assays. These data demonstrate that the HEK293 system can be used as an important tool for candidate selection and early development of biosimilar antibodies.
1. Introduction The amplitude and quality of T cells response are regulated by a balance between costimulatory and inhibitory signals. The inhibitory signals are called immune checkpoints and, under normal physiological conditions, are crucial for maintaining self-tolerance and also for protecting tissues from damage generated by activation of the immune system in response to infections. However, checkpoint protein expression may be deregulated by tumors as an important mechanism of immune resistance [1]. Antibodies blocking these molecules can increase the effector activity of tumor-specific T cells. These antibodies, which are known as immune checkpoint blockers (ICBs), have already been approved by the US Food and Drug Administration (FDA)/The European Medicines Agency (EMA) and used in the standard of care for different tumor types [2]. The growing success of therapeutic monoclonal antibodies has been inevitably paralleled by the increasing challenge for patients and
worldwide health care systems to pay for them. Biosimilar have a central role in this scenario, because encourage competition and reduce prices, enhancing patient access to treatments and relieving pressure on healthcare budgets [3]. The EMA defines a biosimilar as “a biological medicinal product that contains a version of the active substance of an already authorized original biological medicinal product in the European Economic Area”. Since biosimilars are made in living organisms, minor differences can exist between the biosimilar and the reference product, however it is required to demonstrate that these differences are not clinically meaningful [4]. Although there is still a long timeframe for ICBs patents to expire [5], this event will trigger a race for the development of biosimilar versions of these drugs. In this scenario, the use of tools that allow these antibodies to be readily obtained for the initial developmental tests and the validation of the analytical methodologies will be of great relevance. Therefore, this study aimed to evaluate the use of HEK293 cells for
∗ Corresponding author. Laboratório de Tecnologia Recombinante, Bio-Manguinhos / Fiocruz, Av. Brasil, 4365, Manguinhos – Pavilhão Rockfeller, 21040-360, Rio de Janeiro – RJ, Brazil. E-mail address: haroldo.cid@bio.fiocruz.br (H.C. da Silva Junior).
https://doi.org/10.1016/j.pep.2020.105596 Received 18 December 2019; Accepted 5 February 2020 Available online 07 February 2020 1046-5928/ © 2020 Elsevier Inc. All rights reserved.
Protein Expression and Purification 170 (2020) 105596
M.B. Ramos, et al.
the wells were revealed by addition of 100 μL of tetramethyl benzedine (TMB, Thermo Fisher Scientific). The reactions were stopped after 10 min with 50 μL of 2 N H2SO4. Next, the optical density (OD) of each well was read on a microplate reader (Sunrise, Tecan) at 450 nm. To perform antibody quantification, a standard curve was constructed by two-fold serial dilutions (50 ng/mL - 1.6 ng/mL) of IgG from human serum (Sigma-Aldrich).
ICB antibody transient expression as a first step for development of a biosimilar. The antibodies names were omitted for strategic reasons. 2. Material and methods 2.1. Construction of expression vector The gene sequences of proposed biosimilar were reverse-engineered from the amino acid sequences of innovator drug. To allow secretion of antibody to the extracellular space, signal sequences were added in the N-terminal portion of each chain (heavy chain signal sequence: ATGG GCTGGAGCCTGATCCTGCTGTTCCTGGTGGCCGTGGCTACAAGAGTGC TGTCT, and light chain signal sequence: ATGGACTTCCAGGTGCAGAT CATCTCTTTTCTGCTGATCAGCGCCTCTGTGATCATGTCCAGGGGC). Additionally, Kozak sequence (GCCACC) was added at the N-terminal regions of both genes. The gene constructs were synthesized by Integrated DNA Technologies (IDT) and subcloned separately into the polylinker of pCI-neo expression vector (Promega), using the restriction enzymes XhoI and XbaI.
2.5. Purification and homogeneity analysis The purification procedure was performed using a 5 mL HiTrap MabSelect SuRe column (GE Healthcare) on an ÄKTA pure chromatography system (GE Healthcare). The culture supernatant was collected 5 days after transfection and filtered through a 0.45 μm membrane filter. Next, the supernatant was mixed with binding buffer (20 mM Na2PO4, 0.15 M NaCl, pH = 7.2) in a 1:1 ratio and loaded onto the column previously equilibrated. To remove impurities and unbound material, the column was washed with 10 column volumes of binding buffer. Elution step was performed using 0.1 M sodium citrate pH 3.0, followed by immediate neutralization with 1 M tris-HCl, pH 9.0. The purified antibody was buffer exchanged into PBS, pH 7.4, using a 5 mL HiTrap Desalting column (GE Healthcare), according to the manufacturer's instructions. The concentration of purified antibody was determined by spectrophotometric measurement at 280 nm (Nanodrop 1000, Thermo Fisher Scientific), using molar extinction coefficient of 1.4. Finally, densitometry (GS-800 Calibrated Densitomer, Bio-Rad) of Coomassie blue-stained SDS–PAGE gels was used to determine the purity of sample.
2.2. Cell culture The human cell line Expi293F, which is adapted to serum-free culture media and suspension growth, was purchased from Thermo Fisher Scientific (catalog no. A14527). Cells were cultured in baffled erlenmeyer flasks with vented caps, using Expi293 expression medium (Thermo Fisher Scientific). The cultures were maintained at 37 °C in a humidified atmosphere with 8% CO2, under regular agitation (120 rpm).
2.6. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE)
2.3. Transient transfection Expi293F cells were co-transfected with plasmids containing light chain (LC) and heavy chain (HC) DNA sequences, using Expi293 expression system kit (Thermo Fisher Scientific). Briefly, each plasmid (15 μg) was diluted in 1.5 mL Opti-MEM and mixed gently. Expifectamine 293 transfection reagent (81 μL) was diluted in 1.5 mL Opti-MEM and incubated for 5 min at room temperature. In order to allow DNA-lipid complex formation, diluted transfection reagent was added to the diluted DNA, mixed gently and incubated for 30 min. The complex was added to the 125 mL erlenmeyer flask containing 7.5 × 107 cells in 30 mL of medium. The cells subjected to transfection were then incubated for 18 h at 37 °C with 8% CO2 and agitation at 120 rpm. After this period, 150 μL of enhancer I and 1.5 mL of enhancer II were added to increase antibody expression. The cells were incubated further 6 days in the same conditions previously described. Aliquots of the transfected cell suspension were collected every 24 h for determination of cell viability and antibody expression levels.
The proposed biosimilar and reference product were analyzed by SDS-PAGE. For reducing condition, antibodies were mixture with 4x loading buffer containing 2-mercaptoethanol, boiled for 5 min at 95 °C and resolved on 12% polyacrylamide gel at 120V in SDS-PAGE for 90 min. For non-reducing condition, antibodies samples were mixture with 4x loading buffer without 2-mercaptoethanol and heated at 95 °C for 5 min before loading on 10% polyacrylamide gel. The gels staining was performed with Gel Code™ Blue Stain Reagent (Thermo Fisher Scientific), according to the manufacturer's recommendations. 2.7. Isoelectric focusing gel electrophoresis (IEF-PAGE) Antibodies isoforms were separated by isoelectric focusing in polyacrylamide gel with pH 3–9 gradient. An IEF standard (High pI pH 5.0–10.5, GE Healthcare) was co-electrophoresed next to the samples. Following the electrophoresis, the gels were stained with Coomassie Brilliant Blue R350 (GE Healthcare) for 18 h. Antibodies were analyzed in duplicate and compared to the 7 bands of known isoelectric point (pI) protein standards.
2.4. Analysis of antibody expression To evaluate the expression of proposed biosimilar antibody, an enzyme-linked immunosorbent assay (ELISA) was carried out. Firstly, a Flat-bottom 96-well polystyrene plate (Thermo Fisher Scientific) was coated with anti-human IgG (Fc specific) antibody (Sigma-Aldrich) diluted 1:500 in sodium carbonate-bicarbonate buffer, pH 9.6, and incubated overnight at 4 °C. The coated plate was washed five times with PBS containing 0.05% Tween 20 (PBS-T) and blocked with blocking solution (5% fetal bovine serum, 0.1% bovine serum albumin and 5% non-fat dry milk in PBS-T) at 37 °C for 2 h. The supernatants of transfected cells were diluted in triplicate with PBS pH 7.4. A 100 μL volume of diluted supernatants were added into each well, incubated at 37 °C for 2 h, and then washed five times. Following this procedure, 100 μL of goat anti-human IgG, IgM, IgA – peroxidase antibody (Sigma-Aldrich) diluted at 1:8000 with PBS pH 7.4 was added to each well, and the mixtures were incubated at 37 °C for 1 h. After five washes with PBS-T,
2.8. Circular dichroism (CD) The secondary structures of antibodies were evaluated on a Jasco J815 spectropolarimeter (Jasco Corp) with a 0.1 cm path-length quartz cuvette. Far-UV spectra were measured from 190 to 260 nm, averaged over three scans at a speed of 50 nm/min, and collected in 1 nm steps. The buffer baselines were subtracted from their respective sample spectra. The experiment was performed at room temperature with a volume of 400 μL and at the final concentration of 0.5 mg/mL. 2.9. Fluorescence spectroscopy The fluorescence spectra were obtained and recorded by setting the excitation wavelength at 280 nm and the emission spectrum was 2
Protein Expression and Purification 170 (2020) 105596
M.B. Ramos, et al.
recorded from 295 to 415 nm, using a JASCO FP-6500 spectrofluorimeter (Jasco Corp.). The assays were performed in triplicate, at room temperature, with a volume of 200 μL of antibodies, which were in the concentration of 0.5 mg/mL. 2.10. Antibody-receptor binding studies 2.10.1. ELISA A Flat-bottom 96-well polystyrene plate (Thermo Fisher Scientific) was coated with extracellular portion of target receptor diluted in sodium carbonate-bicarbonate buffer, pH 9.6, and incubated overnight at 4 °C. The coated plate (100 ng receptor/well) was washed and blocked as described above. A 100 μL volume of diluted antibodies (5 pg/μL) was added into each well, incubated at 37 °C for 2 h, and then washed. Next, 100 μL of goat anti-human IgG, IgM, IgA – peroxidase antibody (Sigma-Aldrich) diluted at 1:5000 with PBS pH 7.4 was added to each well, and the mixtures were incubated at 37 °C for 1 h. The procedures for revelation and absorbance measurements were performed as described above.
Fig. 1. Expression kinetics of proposed biosimilar in Expi293F cells. Right yaxis: levels of antibody expression measured by ELISA; left y-axis: cell viability. X-axis: harvest days post-transfection. The presented values are the mean of four independent experiments and error bars represent standard error of the mean.
2.10.2. Flow cytometry analysis Expi293F cells were transfected with the construct pCI-neo + receptor-GFP, which was produced in our laboratory. The transfected cells were maintained for 3 days in culture to allow receptor expression on the cell surface. After that, the cells were harvested and resuspended in PBS pH 7.4, at concentration of 1 × 107 cells/mL. The cells were then stained with biosimilar and innovator antibodies (10 μg/mL) for 30 min at room temperature, washed three times with PBS and further stained with anti-human IgG (γ-chain specific) R-Phycoerythrin (SigmaAldrich) for another 30 min. Finally, the cells were washed and analyzed by flow cytometry using the BD LSR Fortessa equipment. An unrelated IgG (Abcam) was used as isotype control.
Fig. 2. SDS-polyacrylamide-gel electrophoresis under reducing conditions to analyze samples collected during purification, buffer exchange and concentration steps of proposed biosimilar. Lane 1, BenchMark Protein Ladder; Lane 2, supernatant of transfected Expi293F cells; Lane 3, supernatant mixed with binding buffer; Lane 4, flow-through; Lane 5, washing step; Lane 6, fraction eluted from affinity column; Lane 7, proposed biosimilar into PBS after desalting step; Lane 8, proposed biosimilar in PBS and concentrated by ultrafiltration. The arrows indicate bands of light chain (LC, ~25 kDa) and heavy chain (HC, ~50 kDa) of purified antibody.
2.11. Statistical analysis The analysis were performed with GraphPad Prism software, version 5. Data were reported as mean ± standard error of the mean. Absorbance values for receptor binding assays were compared using one-way analysis of variance (ANOVA) and Tukey's test. The differences were considered to be statistically significant at p < 0.05. 3. Results To analyze expression kinetics of proposed biosimilar, Expi293F cells were co-transfected with the constructs containing the LC and HC genes. The antibody concentration increased during the culture of transfected cells, exhibiting peak expression on the fifth day posttransfection. On the other hand, the cell viability decreased over the days, reaching less than 10% at the end of the experiment (Fig. 1). To perform antibody purification, the cell supernatant was harvested at day 5 post-transfection and subjected to protein A affinity chromatography. The purification was successful, since the sample was enriched in the antibody and most of the contaminants were removed (Fig. 2). After the purification step, the elution buffer was replaced by PBS, pH 7.4, and then the proposed biosimilar was concentrated by ultrafiltration (Fig. 2). The final recovery estimated for the antibody was approximately 65 mg per liter of transfected culture. To determine homogeneity degree of proposed biosimilar, a SDSPAGE assay was performed with increasing amounts of protein mass (Fig. 3). It was observed that from 15 μg (Fig. 3, lane 3) the percentage of antibody remained stable when compared to the others bands visualized on the gel, which allowed to estimate the homogeneity of antibody in approximately 95%. As a result, the comparability assays with the originator product were initiated. The electrophoretic migration profile of proposed biosimilar was
Fig. 3. SDS-polyacrylamide-gel electrophoresis under non-reducing conditions to estimate homogeneity of proposed biosimilar. Lane 1, BenchMark Protein Ladder; Lane 2, 10 μg; Lane 3, 15 μg; Lane 4, 20 μg; Lane 5, 25 μg; Lane 6, 30 μg. The blank numbers represent the percentage of the antibody bands in each lane.
3
Protein Expression and Purification 170 (2020) 105596
M.B. Ramos, et al.
Fig. 4. SDS-polyacrylamide-gel electrophoresis under reducing (A) and nonreducing (B) conditions to compare electrophoretic migration profile of biosimilar proposed to the reference antibody. Lane 1, BenchMark Protein Ladder; Lane 2, reference product; Lane 3, proposed biosimilar. The arrows indicate bands of light chain (LC, ~25 kDa), heavy chain (HC, ~50 kDa) and whole molecule (HC + LC, ~150 kDa) of immune checkpoint inhibitors antibodies. Fig. 6. Tryptophan fluorescence emission spectra of proposed biosimilar and innovator product obtained by excitation at 280 nm, and emission from 295 to 415 nm.
compared to the reference antibody in the presence (Fig. 4A) and absence of reducing agent (Fig. 4B). In both conditions analyzed, it was possible to observe that the biosimilar antibody presented a migration profile similar to innovator product. In addition, it was possible to observe that the bands had molecular weights of approximately 25 kDa, 50 kDa and 150 kDa, which correspond to the expected weights for the light chain, heavy chain and whole antibody, respectively. In order to evaluate charge variants in proposed biosimilar and reference drug, isoelectric focusing gel electrophoresis (IEF-PAGE) was performed. The result showed that pI for the main isoform of both antibodies was 8.61. The others bands were similar and fell within a similar range for both products (data not shown). The far UV circular dichroism (CD) spectra of antibodies showed a maximum negative ellipticity in the wavelenth range of 216–218 nm, which is a signature for the presence of β-sheet in structure. No relevant differences were observed between the antibody spectra, suggesting that both adopt the same secondary structure (Fig. 5). The fluorescence spectrum of proposed biosimilar presented lower intensity when compared to the innovator product. Despite this, a maximum fluorescence peak at approximately 342 nm was observed for
both antibodies, indicating that there was no deviation in the spectrum (Fig. 6). Thus, it can be inferred that both antibodies are properly folded, despite there are small conformational differences between them. The ability of antibodies to bind to the extracellular portion of receptor adsorbed on the solid surface was assessed by ELISA (Fig. 7). The results showed that the proposed biosimilar and reference product were able to similarly recognize the target receptor, since there was no statistically significant difference between the absorbance values. Isotype control (IgG) did not recognize the receptor as expected. The full-length receptor was constructed fused to GFP protein and expressed transiently in Expi293F cells. These cells were used in the flow cytometry assays to evaluate the binding of antibodies to the target receptor anchored on the cell membrane (Fig. 8). The results suggest that the biosimilar antibody recognizes receptor similarly to the reference product. 4. Discussion Mammalian expression systems are the preferred platform for producing therapeutic antibodies, since these systems are able to
Fig. 7. Immunoenzymatic assay to assess the binding ability of antibodies to target receptor immobilized on solid surface. Y-axis: absorbance at 450 nm. Xaxis: antibodies tested. The presented values are the mean of three independent experiments and error bars indicate standard error of the mean. Groups were compared using ANOVA and Tukey's test (α = 0.05; ***p < 0.0001). Biosimilar and innovator absorbance values are not statistically different (p > 0.05).
Fig. 5. Circular dichroism (CD) spectra of proposed biosimilar and innovator product, at 190–260 nm, resulting from three consecutive measurements at the speed of 50 nm/min. 4
Protein Expression and Purification 170 (2020) 105596
M.B. Ramos, et al.
Fig. 8. Flow cytometry to assess the binding of antibodies to receptor expressed on the cell surface of Expi293F cells. Plasmid expressing full-length receptor fused with GFP was used for transfection. Cells expressing Receptor/GFP and exposed only to secondary antibody were used as negative control (NC). A non-related IgG was used as isotype control to estimate the non-specific binding to receptor. Anti-human IgG R-Phycoerythrin was used as secondary antibody (PE). The data presented are a representative of three independent experiments with similar results.
viability was found to be around 50%. Since cell death may contribute to the release of proteases and thereby affect the quality of the protein being expressed [9], it was chosen to purify the antibody from supernatants maintained for 5 days post-transfection. After purification by protein A affinity chromatography, the proposed biosimilar was obtained with a high degree of homogeneity. The purity around 95% allowed comparability assays with the reference antibody to be performed. CD results showed dominance of beta-sheet structures in both antibodies, proposed biosimilar and innovator product, being possible to observe great similarity between the spectra. In addition, the CD data presented here are in compliance with studies of Liu et al. (2016) [10], which an ICB antibody also was analyzed by far-UV CD. In order to evaluate tertiary structure of the proposed biosimilar and the innovator drug, fluorescence spectroscopy was used. The results showed that the biosimilar spectrum was comparable to the reference product. However, a lower biosimilar signal intensity was observed, which may be related to small differences in the exposure of aromatic groups of this molecule. It is noteworthy that the biosimilar antibody was expressed in human embryonic kidney (HEK) 293 cells, whereas the reference drug is produced in Chinese hamster ovary (CHO) cells. Although CHO cells produce glycosylation very similar to that found in human cells, these cells cannot perform all types of human glycosylation [11]. In addition, CHO cells can express the non-human glycans Gala1-3Gal (alpha-Gal) and N-glycolylneuraminic acid (Neu5Gc) [12]. Therefore, these variations in glycosylation pattern may explain the small differences
manufacture proteins with folding and post-translational modifications (PTMs) that are more similar to those processes in humans [6]. Stable expression technologies are used for the production of biologics at gram to kilogram quantities in mammalian cells. However, the establishment of stable clones usually takes 3–12 months with the requirement of either a labor-intensive clonal selection process or complex and expensive laboratory equipment [7]. In contrast, transient gene expression (TGE) makes it possible to obtain grams of protein within 2–4 weeks, from gene cloning to protein. This accomplishment represents a major advantage compared to the time and resource-consuming process of generating stable cell lines [7]. With the growing demand for biologics and the end-of-patent protection for many existing treatments, the focus for biogeneric equivalents will be speed and/or cost. In this context, a significant challenge for industry will be the rapid analysis of potential biosimilar candidates in early stages of development. This can be effectively achieved using high yielding TGE systems in combination with high-throughput screening methods [8]. In this work, we expressed and evaluated a proposed biosimilar antibody to immune checkpoint blocking. The antibody was produced transiently using the Expi293™ Expression System kit, which is based on HEK293 cells. It is noteworthy that this cell line have been commonly applied to TGE because it show numerous advantages including humanoriginating PTMs, high level productivity, straight-forward management and safety [6]. The study of kinetics of biosimilar expression demonstrated that antibody levels peaked at the fifth day of culture, at which time 5
Protein Expression and Purification 170 (2020) 105596
M.B. Ramos, et al.
observed in terms of tertiary structure. Action mechanism of ICBs is based on antibody binding to its target, which prevents the interaction receptor-ligand. This blockade releases receptor pathway-mediated immune responses against tumor cells [13]. Therefore, the binding capacity of biosimilar antibody to recombinant receptor immobilized on solid surface (ELISA) and expressed on eukaryotic cell membrane (FACS) was evaluated. The results showed that the ability of the biosimilar antibody to bind to the receptor remained unchanged when compared to the reference product, which indicates that the small structural differences observed are unlikely to have a relevant effect on molecule activity. In conclusion, the dataset presented here allows us to state that HEK293 cells represent a suitable system to obtain different biomolecules quickly and efficiently for the early stages of development, which can be an important differential in a scenario of patent drop and biosimilar market growth. Additionally, the use of HEK293 cells to obtain stable clones secreting therapeutic molecules may represent a new trend in the biopharmaceutical industry, since these cells produce recombinant proteins like those synthesized naturally in humans, mitigating concerns related to the presence of nonhuman glycans in biopharmaceuticals [6,12].
Nat. Rev. Immunol. 8 (6) (2008) 467–477, https://doi.org/10.1038/nri2326. [2] A. Lopes, K. Vanvarenberg, Š. Kos, S. Lucas, D. Colau, B. Van den Eynde, et al., Combination of immune checkpoint blockade with DNA cancer vaccine induces potent antitumor immunity against P815 mastocytoma, Sci. Rep. 8 (1) (2018) 15732, https://doi.org/10.1038/s41598-018-33933-7. [3] M. McCamish, G. Woollett, Worldwide experience with biosimilar development, mAbs 3 (2) (2011) 209–217, https://doi.org/10.4161/mabs.3.2.15005. [4] L. Barbier, P. Declerck, S. Simoens, P. Neven, A.G. Vulto, I. Huys, The arrival of biosimilar monoclonal antibodies in oncology: clinical studies for trastuzumab biosimilars, Br. J. Canc. 121 (3) (2019) 199–210, https://doi.org/10.1038/s41416019-0480-z. [5] U. Storz, Intellectual property issues of immune checkpoint inhibitors, mAbs 8 (1) (2016) 10–26, https://doi.org/10.1080/19420862.2015.1107688. [6] M. Tabasinezhad, F. Mahboudi, W. Wenzel, H. Rahimi, T.H. Walther, C. Blattner, et al., The transient production of anti-TNF-α antibody Adalimumab and a comparison of its characterization to the biosimilar Cinorra, Protein Expr. Purif. 155 (2019) 59–65, https://doi.org/10.1016/j.pep.2018.11.006. [7] S. Gutiérrez-Granados, L. Cervera, A.A. Kamen, F. Gòdia, Advancements in mammalian cell transient gene expression (TGE) technology for accelerated production of biologics, Crit. Rev. Biotechnol. 38 (6) (2018) 918–940, https://doi.org/10. 1080/07388551.2017.1419459. [8] J.J.C. Hou, J. Codamo, W. Pilbrough, B. Hughes, P.P. Gray, et al., New frontiers in cell line development: challenges for biosimilars, J. Chem. Technol. Biotechnol. 86 (2011) 895–904, https://doi.org/10.1002/jctb.2574. [9] G.P. Subedi, R.W. Johnson, H.A. Moniz, K.W. Moremen, A. Barb, High yield expression of recombinant human proteins with the transient transfection of HEK293 cells in suspension, J. Vis. Exp. 106 (2015) e53568, , https://doi.org/10.3791/ 53568. [10] B. Liu, H. Guo, J. Xu, T. Qin, L. Xu, J. Zhang, et al., Acid-induced aggregation propensity of nivolumab is dependent on the Fc, mAbs 8 (6) (2016) 1107–1117, https://doi.org/10.1080/19420862.2016.1197443. [11] S. Dietmair, M.P. Hodson, L.E. Quek, N.E. Timmins, P. Gray, L.K. Nielsen, A multiomics analysis of recombinant protein production in Hek293 cells, PloS One 7 (8) (2012) e43394, , https://doi.org/10.1371/journal.pone.0043394. [12] D. Ghaderi, M. Zhang, N. Hurtado-Ziola, A. Varki, Production platforms for biotherapeutic glycoproteins. Occurrence, impact, and challenges of non-human sialylation, Biotechnol. Genet. Eng. Rev. 28 (2012) 147–175, https://doi.org/10. 5661/bger-28-147. [13] L.A. Raedler, Opdivo (nivolumab): second PD-1 inhibitor receives FDA approval for unresectable or metastatic melanoma, Am Health Drug Benefits 8 (2015) 180–183 Spec Feature.
Declaration of competing interest The authors declare no financial or commercial conflict of interest. Acknowledgements The authors thank Dr. Martin Hernan Bonamino for providing the reference drug. References [1] W. Zou, L. Chen, Inhibitory B7-family molecules in the tumour microenvironment,
6