Initial Results on the Molecular Phylogeny of the Nudibranchia (Gastropoda, Opisthobranchia) Based on 18S rDNA Data

Molecular Phylogenetics and Evolution Vol. 13, No. 2, November, pp. 215–226, 1999 Article ID mpev.1999.0664, available online at http://www.idealibrary.com on

Initial Results on the Molecular Phylogeny of the Nudibranchia (Gastropoda, Opisthobranchia) Based on 18S rDNA Data Evi Wollscheid* and Heike Wa¨gele† *Department of Cell & Developmental Biology, University of Pennsylvania School of Medicine, 1157 Biomedical Research Building II/III, 421 Curie Blvd., Philadelphia, Pennsylvania 19104-6058; and †Lehrstuhl fu¨r Spezielle Zoologie, Ruhr-Universita¨t Bochum, 44780 Bochum, Germany Received March 3, 1998; revised October 14, 1998

This study investigated nudibranch phylogeny on the basis of 18S rDNA sequence data. 18S rDNA sequence data of 19 taxa representing the major living orders and families of the Nudibranchia were analyzed. Representatives of the Cephalaspidea, Anaspidea, Gymnomorpha, Prosobranchia, and Pulmonata were also sequenced and used as outgroups. An additional 28 gastropod sequences taken from GenBank were also included in our analyses. Phylogenetic analyses of these more than 50 gastropod taxa provide strong evidence for support of the monophyly of the Nudibranchia. The monophyly of the Doridoidea, Cladobranchia, and Aeolidoidea within the Nudibranchia are also strongly supported. Phylogenetic utility and information content of the 18S rDNA sequences for Nudibranchia, and Opisthobranchia in general, are examined using the program SplitsTree as well as phylogenetic reconstructions using distance and parsimony approaches. Results based on these molecular data are compared with hypotheses about nudibranch phylogeny inferred from morphological data. r 1999 Academic Press

Key Words: Nudibranchia; Opisthobranchia; Gastropoda; 18S rDNA; molecular systematics; computer analyses; phylogeny

INTRODUCTION The Nudibranchia, often considered to be the crown group of the Opisthobranchia (Schmekel, 1985) with probably 3000 species (Willan and Coleman, 1984), is a taxon which is distributed worldwide in all oceans from the intertidal down to the deep sea. Nudibranchs have attracted the attention of scientists since early times, not just because of their attractive colors and bizarre appearance but also because of their very interesting biology. Therefore, it is astonishing that despite these biological peculiarities (e.g., different developmental patterns, such as direct development or development including a veliger larval stage; loss of the hard protective shell therefore developing a wide range of occasion-

ally sophisticated defensive mechanisms), the phylogeny of the Nudibranchia and constituent higher taxa has not yet been resolved. The question as to whether the Nudibranchia is a monophyletic group which has evolved by radiation from a common ancestor (Schmekel, 1985; Ghiselin, 1966; Tardy, 1970) or whether their diverse morphology and life styles have converged as a result of ecology (Minichev, 1970; Baranetz and Michinev, 1995; Thompson, 1976) was tested using an independent molecular data set. Since Odhner (1934), the order Nudibranchia has been divided into four main taxa: Doridoidea, Dendronotoidea, Arminoidea, and Aeolidoidea. This classification has remained in general use to the present day. Several malacologists have tried to elucidate the phylogeny of the Nudibranchia (Pelseneer, 1894; Boettger, 1954; Ghiselin, 1966; Tardy, 1970; Schmekel, 1985). These classifications were usually based on only a few organ systems. Since Hennig (1966) presented his theories on phylogenetic systematics, only a few malacologists have attempted to analyze phylogenetic relationships based on apomorphic character states within the Opisthobranchia or Nudibranchia (Willan, 1987; Gosliner and Kuzirian, 1990; Gosliner and Willan, 1991; Jensen, 1996; Mikkelsen, 1996; Wa¨gele, 1997). Although much work has been done on invertebrate phylogeny using DNA sequencing (e.g., Carmean et al., 1992; Halanych, 1996; Kim et al., 1996; Spears et al., 1994; von Dohlen and Moran, 1995), only a few scientists have applied it to molluscs in general (Ghiselin, 1988; Winnepenninckxs et al., 1992, 1994, 1998; Kenchington et al., 1994; Rosenberg et al., 1997) and even fewer on gastropods in particular (Tillier et al., 1994, 1996). For the first time, a phylogenetic analysis of the Nudibranchia is presented here based on 18S rDNA sequences alone. The sequences have been subjected to phylogenetic analyses based on distance and maximum parsimony approaches, as well as split decomposition. The results inferred from the 18S rDNA data were compared with results obtained by morphological assessments using histology and classical morphological

215

1055-7903/99 $30.00 Copyright r 1999 by Academic Press All rights of reproduction in any form reserved.

¨ GELE WOLLSCHEID AND WA

216 TABLE 1

TABLE 1—Continued

Information on Analyzed Species, Including Size (bp) of Sequence and Collection Site and/or Accession No. Species

18S rDNA (bp)

Collection site

1896

Helgoland AJ224770 Antarctica, Weddel Sea AJ224771 USA, North Atlantic AJ224772 Egypt, Red Sea AJ224773 Spain, Atlantic AJ224774 Spain, Atlantic AJ224775 Helgoland AJ224776 Kattegat, North Sea AJ224777 Spain, Atlantic AJ224778 Spain, Atlantic AJ224779 Spain, Atlantic AJ224780 Dom. Republic AJ224781 USA, North Atlantic AJ224782 Spain AJ224783

Species

18S rDNA (bp)

Collection site

1846

Bielefeld, Germany AJ224921

1826

X94268

1833 1844

X94270 X70211

1837 1839 1824 1819 1849 1849 1850 1852 1851 1843 1860 1847 1845

X91976 X66374 X94278 X94276 Z73982 Z73984 Z73980 Z73981 Z73983 Z73985 Z83831 U65225 U65223

1801 1802 1804 1807 1831 1822 1829 1803 1804 1831

X94275 X94273 X94272 X94269 X98827 X91979 X98826 X94277 X94274 X91970

1820

X91971

1832

X94271

Pulmonata: 25 Cepaea nemoralis Linne´, 1758

Nudibranchia: Doridoidea 1 Acanthodoris pilosa (Mu¨ller, 1776) 2 Austrodoris kerguelenensis (Bergh, 1884)

1902

3 Cadlina luteomarginata (MacFarland, 1966)

1902

4 Chromodoris quadricolor (Ru¨ppell and Leuckart, 1828) 5 Chromodoris krohni (Verany, 1846) 6 Diaphorodoris luteocincta (Sars, 1870) 7 Onchidoris bilamellata (Linne´, 1767) 8 Polycera quadrilineata (Mu¨ller, 1776) 9 Limacia clavigera (Mu¨ller, 1776) 10 Hypselodoris elegans (Cantraine, 1834) 11 Hypselodoris villafranca (Risso, 1818) 12 Discodoris concinna (Alder and Hancock, 1864) 13 Triopha catalinae (Cooper, 1863)

1900

14 Goniodoris nodosa (Montagu, 1808)

1887 1903 1896 1926 1893 1917 1893 1902 1896

1892

Nudibranchia: Dendronotoidea 16 Melibe leonina (Gould, 1852)

2087

17 Tritonia plebeia Johnston, 1828

1902

USA, North Atlantic AJ224784 Helgoland AJ224785

18 Eubranchus sp.

1941

19 Eubranchus exiguus (Alder and Hancock, 1848) 20 Flabellina pedata (Montagu, 1814)

1938 1933

Spain, Atlantic AJ224786 Helgoland AJ224787 Helgoland AJ224788

Cephalaspidea: 1846

Egypt, Red Sea AJ224789

Anaspidea: 22 Aplysia depilans Bohatsch, 1761 23 Aplysia punctata Cuvier, 1803

1846 1855

Helgoland AJ224918 Helgoland AJ224919

Sacoglossa: 24 Limapontia nigra (Mu¨ller, 1733)

Anaspidea: 26 Aplysia sp. Gymnomorpha: 27 Laevicaulis alte 28 Onchidella celtica Pulmonata: 29 30 31 32 33 34 35 36 37 38 39 40 41

Helix aspersa Limicolaria kambeul Balea biplicata Oxyloma sp. Lymnaea glabra Lymnaea stagnalis Lymnaea auricularia Radix peregra Stagnicola palustris Fossaria truncatula Bakerilymnaea cubensis Biomphalaria alexandrina Biomphalaria glabrata Caenogastropoda:

42 43 44 45 46 47 48 49 50 51

Fasciolaria lignaria Nassarius singuinjorensis Pisania striata Bursa rana Reishia bronni Thais clavigera Rapana venosa Crepidula adunca Littorina obtusata Littorina littorea Neritopsina:

52 Nerita albicilla Vetigastropoda:

Nudibranchia: Aeolidoidea

21 Samaragdinella sp.

GenBank:

1847

North Sea AJ224920

53 Monodonta labio

assumptions (Wa¨gele, 1997; Wa¨gele and Willan, in press). MATERIALS AND METHODS Biological Material Nineteen species of nudibranchs and 5 outgroup species (Cephalaspidea, Anaspidea, Sacoglossa, and Pulmonata) were collected from various sites around the world (see Table 1) and the complete 18S rDNA of each was sequenced. For further outgroup comparison, complete 18S rDNA sequences of 28 gastropod taxa were taken from GenBank (see Table 1).

217

MOLECULAR PHYLOGENY OF THE NUDIBRANCHIA

DNA Extraction, Amplification, Cloning, and Sequencing Genomic DNA was extracted from fresh or alcoholpreserved animals following an altered DTAB DNA extraction method (Gustincich et al., 1991). A small part of the foot or the whole animal, if small, was homogenized in preheated (60°C) 6% DTAB buffer (6% w/v). After incubation at 60°C for 24 h, DNA was extracted twice with chloroform/isoamyl alcohol (24:1) and precipitated with 2/3 vol prechilled isopropanol. The DNA pellet was redissolved in sterile water. PCR amplification of the target region of the gene for the small subunit of ribosomal DNA (18S rDNA, SSU) was performed with primers developed by the first author: forward (18A1), 58-CCTAYCTGGTTGATCCTGCCAGT and reverse (1800), 58-TAATGATCCTTCCGCAGGTT. PCR amplifications were performed using a Techne thermal cycler and a reaction mix of 50 µl of 1.25U Taq polymerase (Qiagen), 0.8 mM each dNTP, 0.4 µM primer (18A1, 1800), 10 µl of Q-Solution (Qiagen), and 5 µl of 10⫻ PCR buffer (Qiagen). The thermal cycling conditions were: 95°C for 5 min, followed by 38 cycles of 30 s at 94°C, 30 s at 53.5°C, 2.5 min at 72°C, and a final extension for 10 min at 72°C. The double-stranded PCR products were ligated into either pGEM-T Vector (Promega) or pCR2.1-/TOPOVector (Invitrogen) under the conditions recommended by the manufacturer and transformed in Escherichia coli cells using electroporation. Plasmid DNA sequencing was performed using the chain-termination method (Sanger et al., 1977) with a fluorescent-labeled primer cycle sequencing kit (Thermosequenase, Amersham). Products were run on an automated sequencer (Li-Cor) following the manufacturer’s protocol. Both strands of the 18S rDNA were sequenced with the Universal and Reverse primer set annealing to the poly-linker vector sites and with a range of internal primers designed by the first author (see Table 2). The PCR products had a length of 1846 to 2087 bp. Sequence Alignment The confirmed consensus sequences were aligned using CLUSTAL X (Thompson et al., 1997), followed by manual editing by eye using Genedoc (Nicholas and Nicholas, 1997). No expansion parts or hypervariable regions were detected in the sequences. Phylogenetic Analyses The standard error rate of the Taq polymerase is between 2 ⫻ 10⫺4 and 1 ⫻ 10⫺5 (Eckert and Kunkel, 1991); thus, it has no major influence on the results of phylogenetic analyses and can be neglected (Hillis et al., 1996). Phylogenetic tree reconstruction was conducted using MEGA (Kumar et al., 1993) (Kimura two-parameter distance transformation, tree selection criterion: neigh-

TABLE 2 Internal Primers Used for Sequencing 18S rDNA Name

Sequence (58 = 38)

100F seq 400F seq 600F seq 800F seq 1155F seq 1250F seq 1600F seq 1600R seq 1250R seq 1155R seq 800R seq 600R seq 400R seq 100R seq

CCGCGAATGGCTCATTAAATCAG ACGGGTAACGGGGAATCAGGG CGTATATTAAAGTTG(CT)TGC GCATGGAAT(AG)ATGGAA(CT)AGGAC CTGAAACTTAAAGGAATTGACGG CCGTTCTTAGTTGGTGGAGCG CGTCCCTGCCCTTTGTACACACC GGTGTGTACAAAGGGCAGGGACG CGCTCCACCAACTAAGAACGGCC CCGTCAATTCCTTTAAGTTTCAG GTCCT(AG)TTCCAT(CT)ATTCCATGC GCA(AG)CAACTTTAATATACG CCCTGATTCCCCGTTACCCGT CTGATTTAATGAGCCATTCGCGG

Note. The ‘‘name’’ includes information about the position and the strand; e.g., the primer ‘100F’ is complement to the position around base 100 in the coding strand of the 18S rDNA. All primers having a ‘‘R’’ in their name are to sequence the noncoding strand.

bor-joining algorithm, bootstrap analyses) and PAUP 3.2.1 (Swofford, 1993) (settings: heuristic search, nearest neighbour interchange; stepwise addition: closest; 1000 bootstrap replicates; the 50% majority rule consensus). The tree reconstruction by MEGA allows only an a posteriori rooting of the calculated trees, whereas the opportunity of an a priori rooting in PAUP was taken. In a first analysis, all available gastropod taxa (53) were considered using Nerita albicilla as the outgroup to root the trees. A second analysis was performed using only euthyneuran taxa with Littorina as the outgroup. The choice of these taxa as outgroups is based on recent results on the phylogeny of the paraphyletic ‘‘Prosobranchia’’ (Haszprunar, 1988; Ponder and Lindbergh, 1997). SplitsTree 2.2.1f (Huson, 1997), an implementation of the split decomposition method (Bandelt and Dress, 1992), was also applied. In SplitsTree we used the following settings: logdet distance transformation (Steel, 1994); inclusion of all sites; group distances: common constant, split decomposition. Sequences were transformed to obtain distances with which a graph of evolutionary relationships among taxa was generated. The transformation of the data into a sum of weakly compatible splits indicates the extent to which the data are tree-like. This program visualizes conflict in data in the form of a network. The advantage is to exhibit phylogenetic relationships even when they are overridden by parallel events. Furthermore, groupings can be detected which are a result of convergence or systematic error (Huson, 1997). RESULTS A total of 53 gastropod taxa were analyzed in this study, including 19 species of nudibranchs. All base

218

¨ GELE WOLLSCHEID AND WA

pairs were sequenced on both strands of the DNA and we can confirm that there were no detectable differences between the two strands. The final alignment of the 53 taxa consisted of 2556 aligned nucleotide positions. Of these, 1062 were variable and 631 were phylogenetically informative under parsimony. A neighbor-joining tree was generated using the Kimura two-parameter model, as implemented in MEGA (Kumar et al., 1993), with Nerita albicilla chosen as the outgroup to root the tree. In this tree (Fig. 1A) the Nudibranchia, as well as the Doridoidea, the Cladobranchia, and the Aeolidoidea, are assembled in monophyletic clades. The Phanerobranchia and Cryptobranchia are not resolved as monophyletic groups within the Doridoidea. The taxa Melibe leonina and Tritonia plebeia, usually assigned to the Dendronotoidea, are not resolved as a monophyletic taxon. The three aeolidoidean species appear as a monophyletic clade. The Nudibranchia are arranged as the sister taxon to all other opisthobranch, pulmonate, and gymnomorph taxa. The Euthyneura appear monophyletic and its sister taxon is the monophyletic Caenogastropoda. The vetigastropod Monodonta labio appears as the most basal group. There is no solution concerning the two different euthyneuran groups (Opisthobranchia and Pulmonata). This algorithm renders the Opisthobranchia paraphyletic and the Pulmonata polyphyletic. There is no difference at all in the branching order when using the second, reduced, data set (Fig. 1B). The support of the nodes is shown by the bootstrap values (numbers on the branches in Figs. 1A and 1B) for both trees. The nodes without a bootstrap value were not found by bootstrapping and the branching order of these taxa was polyphyletic. The two bootstrap analyses performed with PAUP, one for all gastropod taxa and one for euthyneuran taxa only, produced consensus trees with 2375 and 1875 steps, respectively. Both trees are shown in Fig. 2. The arrangement of the higher taxa is similar to that in the analyses performed with MEGA. When using all gastropod taxa (Fig. 2A), the Euthyneura are clustered as a monophyletic group. The sister taxa to the Euthyneura are again the Caenogastropoda. The taxa Nudibranchia, Doridoidea, Cladobranchia, and Aeolidoidea are confirmed by bootstrap values of 100, 97, 100, and 100, respectively. Within the Doridoidea, the nodes for the genera Hypselodoris (H. elegans and H. villafranca) and Chromodoris (C. quadricolor and C. krohni) and within the Onchidorididae, the species Acanthodoris pilosa and Onchidoris bilamellata are well supported by high bootstrap values (94, 79, and 88, respectively). The bootstrap value for the Triophidae (Limacia clavigera and Triopha catalina) is moderate. Nevertheless, this result confirms the monophyly of the Triophidae, which has been demonstrated also by morphological characters. For the remaining doridoid taxa (i.e., Diaphorodoris luteocincta, Polycera quadrilineata, Cadlina

luteomarginata, and Austrodoris kerguelenensis), no resolution was detected. The clades Anaspidea, Basommatophora, and Helicidae are also supported by high bootstrap values (99, 88, and 86, respectively). The PAUP evaluation shows a polytome branching of the Pulmonata with both a basommatophoran and a stylommatophoran branch. Similar to the results of the MEGA analysis, the Opisthobranchia do not appear monophyletic. Using the same algorithms for euthyneuran taxa only (Fig. 2B), the clades Nudibranchia, Doridoidea, Cladobranchia, and Aeolidoidea again appear monophyletic. In this maximum parsimony analysis, the sister taxon of the Nudibranchia is represented by the remaining gastropod taxa, including the single cephalaspid and sacoglossan species, the monophyletic Anaspidea, and the polyphyletic Pulmonata. Melibe leonina and Tritonia plebeia are not arranged as a monophyletic group. The resolution within the Doridoidea is the same as in the tree using all gastropod taxa (Fig. 2A). Another phylogenetic analysis employed here was SplitsTree 2.2.1f (Huson, 1997). Figure 3 presents an analysis performed with the logdet distance transformation. The tree shows a clear split consisting of a single branch which separates the Nudibranchia from all other taxa. The Doridoidea and Aeolidoidea are presented as monophyletic. Within the Doridoidea all taxa appear unresolved in a bush-like presentation. There is no clear split between the Cladobranchia and the Doridoidea, which is expressed by a net. The relationships of the other Opisthobranchia, the Pulmonata, and the Caenogastropoda are unresolved. The occurrence of some bush-like configurations indicate at least some homoplasy in the data (Bandelt and Dress, 1992). Nevertheless, most of the taxa belonging to putative monophyla, as considered by morphological data, are grouped together and are significantly separated from each other (Fig. 3, circles in the Venn diagram). The results of the distance and parsimony analyses support the following taxa: Nudibranchia, Doridoidea, Cladobranchia, and Aeolidoidea. The opisthobranch lineage does not emerge as a monophyletic unit. Melibe leonina was always presented as the sister taxon of the Aeolidoidea, rendering the Dendronotoidea (M. leonina and Tritonia plebeia) as paraphyletic. DISCUSSION The phylogeny inferred from the complete 18S rDNA sequences using various analytical methods (MEGA, PAUP, SplitsTree) strongly supports the monophyly of the Nudibranchia, Cladobranchia, Doridoidea, and Aeolidoidea, irrespective of the method used. These conclusions from rDNA data are consistent in general with phylogenies based on morphological characters (Schmekel, 1985; Haszprunar, 1988; Salvini-Plawen, 1990; Salvini-

MOLECULAR PHYLOGENY OF THE NUDIBRANCHIA

Plawen and Steiner, 1996; Wa¨gele, 1997; Wa¨gele and Willan, in press). Wa¨gele (1997) and Wa¨gele and Willan (in press) enumerate at least four autapomorphies for the Nudibranchia, evaluated from morphological and histological characters. According to these authors, the reduction of the shell, the presence of a visceral ganglion on the right side of the visceral loop, the presence of a particular type of vacuolated cells, and the pericardial complex orientated in a longitudinal direction with respect to the body axis renders the Nudibranchia monophyletic. These results are supported by our analyses obtained with the different phylogenetic reconstruction methods, in which the Nudibranchia always appeared as monophyletic. To elucidate the position of the Nudibranchia within the Opisthobranchia, more opisthobranch taxa need to be included in future analyses. The Doridoidea are characterized by several morphological autapomorphies (esophagus without cuticle, triaulic genital system, blood gland shifted to head region, gill glands present; see Wa¨gele, 1997; Wa¨gele and Willan, in press). In all analytical methods used here, the Doridoidea were monophyletic, supporting the morphological hypothesis of the Doridoidea as a monophyletic clade. Usually the Doridoidea are separated into two groups: the Phanerobranchia with nonretractile gills and the Cryptobranchia with retractile gills. Wa¨gele and Willan (in press) consider the Cryptobranchia as monophyletic, having evolved a pocket into which the gills can be retracted by newly elaborated gill retractor muscles. Although the number of doridoidean taxa was rather high in this analysis (15 taxa), no separation into these two major groups was apparent. No information was discernable in our alignment in favor of a division of the Doridoidea. The distance analyses clustered Limacia and Triopha (two phanerobranchs) with the cryptobranch family Chromodorididae (Chromodoris, Hypselodoris). The Cryptobranchia were rendered paraphyletic in all analyses. The speciation of the doridoidean Nudibranchia seems to be too recent to have allowed accumulation of substitutions in the 18S gene, thus indicating a lack of signal in 18S rDNA for branching events within the Doridoidea. Although the Cladobranchia are rendered monophyletic merely by loss of morphological characters (i.e., loss of the true gills, the blood gland, and the bursa copulatrix; acquisition of aliform jaws; see Wa¨gele, 1997; Wa¨gele and Willan, in press), this assemblage was always present as a monophyletic unit in our distance and parsimony analyses. According to Wa¨gele (1997) and Wa¨gele and Willan (in press), the Aeolidoidea are rendered monophyletic by the presence of cnidosacs, structures at the apices of papillae which allow the animals to store cnidocysts from their prey (members of the Cnidaria) and to use them against potential enemies. The monophyly is

219

supported by all the analyses presented here but it has to be emphasized that up to now the 18S rDNA sequences of only three species have been investigated. According to the literature (Odhner, 1936), Melibe leonina shares several apomorphies with other members of the Dendronotoidea (i.e., presence of rhinophoral sheath, stomach with cuticle). In our analyses its position next to the Aeolidoidea and not as the sister taxon to the other dendronotoid Tritonia plebeia might be due to the long branch effect. Melibe is a highly derived nudibranch, having evolved a very specialized method of feeding. Its head is broadened and flattened into a hood with which the animal captures mobile animals, like crustaceans. The fact that no support for the Dendronotoidea as a monophyletic clade was ever produced in any of our phylogenetic reconstructions based on molecular data probably indicates flaws due to the selection of taxa or the low number of taxa used. In all the analyses performed with MEGA and PAUP, the gymnomorphs Onchidella celtica and Laevicaulis alte showed a sister taxon relationship. In the Venn diagram, these two species did not come up as sister taxa. The bootstrap analyses for the neighbor-joining trees (MEGA) indicated that there is no support for a monophyletic clade Gymnomorpha; the two species branched polyphyletically. The position of the Gymnomorpha within the gastropod system has been debated for a long time. Boettger (1955) assigned it to the Opisthobranchia but recently Salvini-Plawen (1990) positioned it as the sister group to the Pulmonata (see also Salvini-Plawen and Steiner, 1996; Ruthensteiner, 1997). The SSU rDNA data contain no distinct information with which to further resolve this question. If DNA sequences contain too few phylogenetically informative sites, bootstrap values at the nodes of the consensus tree are consistently low and replicate bootstrap analyses give different consensus topologies (Hillis et al., 1996). This never happened for the major monophyletic clades discussed here when replicating bootstrap analyses. On a higher level, the length of the sequences used here are sufficiently long to avoid effects due to sampling size and selection of taxa. However, low bootstrap values and polytomous nodes occurred within the lower level taxa of the Nudibranchia (mainly the Doridoidea). The chosen DNA sequence may contain too few informative sites for resolving internal nodes of these main groupings. The trees inferred from different methods branch as presented because of a lack of a distinct phylogenetic signal in favor of other groups. The effect of typology, using the DNA sequence from just one individual to represent a whole species, genus, or family can be problematic for the inference of the ‘‘real’’ phylogenetic tree (e.g., Tillier et al., 1996; Littlewood et al., 1998). To overcome this problem, additional species have to be sequenced to resolve nodes of the trees which at the moment appear as unresolved.

220

¨ GELE WOLLSCHEID AND WA

FIG. 1. Phylogenetic trees reconstructed using the neighbor-joining algorithm (Kimura two-parameter) as implemented in MEGA. (A) All gastropod taxa are included. Nerita albicilla was chosen to root the tree. (B) Only euthyneuran taxa are included with Littorina littorea as the outgroup to root the tree.

MOLECULAR PHYLOGENY OF THE NUDIBRANCHIA

221

FIG. 1—Continued

The exclusion of ‘‘prosobranch’’ outgroup taxa in the analyses does not affect the monophyletic position of the Nudibranchia and two of its subordinate taxa (Doridoidea, Aeolidoidea). The usefulness of the 18S rDNA gene for extrapolating speciation events back to the Paleozoic and Mesozoic is based on its high degree of conservatism. For

some nudibranch taxa, speciation seems to be too recent for accumulating substitutions (apomorphies) in the 18S rDNA gene, which makes a reliable inference of their position in the phylogenetic tree uncertain. Thus, resolved nodes in the trees may not be affected by just the actual number of taxa used in the analysis. Possibly, further assessment of the phylogenetic relation-

222

¨ GELE WOLLSCHEID AND WA

FIG. 2. Bootstrap consensus trees based on maximum parsimony using PAUP: heuristic search with branch swapping, nearest-neighbor interchanges, 1000 bootstrap replicates, 50% majority-rule consensus tree. (A) Bootstrap consensus tree for all gastropod taxa. For this analysis Nerita albicilla was selected a priori as outgroup. (B) Bootstrap consensus tree for euthyneuran taxa only, with Littorina littorea as outgroup.

MOLECULAR PHYLOGENY OF THE NUDIBRANCHIA

223

FIG. 2—Continued

ships within the Nudibranchia requires sequence data from more variable regions in nuclear or mitochondrial DNA, as the Nudibranchia is probably a relatively young clade compared to the shelled opisthobranchs, which can be dated back to the Carboniferous (i.e., Acteon; see Jensen, 1997). Therefore, the 18S rDNA may be too conservative for analyses within the Nudi-

branchia. A lack of putative apomorphies (phylogenetic signal) in DNA sequences may be caused by different events; either the speciation of taxa is too recent (as already discussed) or the taxa under consideration are too old or the DNA sequence has been subjected to a rapid evolutionary rate. In this case, the weak resolution of the nodes within the nudibranch suborder

FIG. 3. Venn diagram of SplitsTree 2.2.1f: topology based on logdet distances. SplitsTree expresses conflicts inherent in sequence data as net-like topologies. Taxa are connected in a bush or net when shared sequence similarities are due to convergence (‘‘noise’’) and symplesiomorphy. A tree with binary ramifications is calculated if the data are phylogenetically informative. Putative monophyletic groups are encircled. 1, Doridoidea; 2, Dendronotoidea; 3, Aeolidoidea; 2 ⫹ 3, Cladobranchia; and 1 ⫹ 2 ⫹ 3, Nudibranchia.

224 ¨ GELE WOLLSCHEID AND WA

MOLECULAR PHYLOGENY OF THE NUDIBRANCHIA

Doridoidea is not because of great age of the clade, as could be clearly shown by good resolution for the position of the suborder itself and of the Nudibranchia within the Opisthobranchia. The third possibility of a rapid evolutionary rate cannot be ruled out. The combination of analyzing more taxa and additional gene regions will certainly help to elucidate the relationship of the Nudibranchia within the Opisthobranchia and the phylogeny of lower level nudibranch taxa. ACKNOWLEDGMENTS We gratefully thank J. Wolfgang Wa¨gele (Bochum) for help and support in experimental and theoretical questions. We are indebted to the following people for providing the specimens used in this study: Ulrike Englisch (Bochum), Jose´ Gonzalez (Santiago de Compostela), Christoph Held (Bielefeld), Wulf Kobusch (Bochum), Annette Klussmann-Kolb (Bochum), Katharina Noak (New York), Patricia Reboreda (Santiago de Compostela), Christoph Schubart (formerly Bielefeld), Jesus Troncoso (Vigo), and Victoriano Urgorri (Santiago de Compostela). Paula Mikkelsen (New York) kindly indentified the probably new species of Smaragdinella. We are grateful to Hinrich Graf von der Schulenburg (Cambridge), Gerhard Steiner (Vienna), J. Wolfgang Wa¨gele (Bochum), and Richard Willan (Darwin) for their comments on the first draft of the manuscript. The research was supported by the Deutsche Forschungsgemeinschaft (Wa 618/4).

REFERENCES Bandelt, H-J., and Dress, A. W. M. (1992). Split decomposition: A new and useful approach to phylogenetic analysis of distance data. Mol. Phylogenet. Evol. 1: 242–252. Baranetz, O. N., and Minichev, Y. S. (1995). Evolution of the mantle complex in nudibranchs (Gastropoda, Nudibranchia). Hydrobiol. J. 31: 51–58. Boettger, C. (1955). Die Taxonomie der euthyneuren Schnecken. Zool. Anz. 18: 253–280. Carmean, D., Kimsey, L., and Berbee, L. M. (1992). 18S rDNA sequences and the holometabolous insects. Mol. Phylogenet. Evol. 1: 270–278. Dohlen, C., and Moran, N. A. (1995). Molecular phylogeny of the Homoptera: A paraphyletic taxon. J. Mol. Evol. 41: 211–223. Eckert, K. A., and Kunkel, T. A. (1991). DNA polymerase fidelity and the polymerase chain reaction. PCR Methods Appl. 1: 17–24. Ghiselin, M. T. (1966). Reproductive function and the phylogeny of opisthobranch gastropods. Malacologia 3: 327–378. Ghiselin, M. T. (1988). The origin of molluscs in the light of molecular evolution. In ‘‘Oxford Surveys in Evolutionary Biology’’ (P. H. Harvey and C. Partridge, Eds.), pp. 66–95. Oxford Univ. Press, Oxford. Gosliner, T. M., and Kuzirian, A. M. (1990). Two new species of Flabellinidae (Opisthobranchia: Aeolidacea) from Baja California. Proc. Calif. Acad. Sci. 47: 1–15. Gosliner, T. M., and Willan, R. C. (1991). Review of the Flabellinidae (Nudibranchia: Aeolidacea) from the tropical Indo-Pacific, with the descriptions of five new species. Veliger 34: 97–133. Gustincich, S., Manfioletti, G., Del Sal, G., and Schneider, C. (1991). A fast method for high-quality genomic DNA extraction from whole human blood. Biotechniques 11: 298–302.

225

Halanych, K. M. (1996). Testing hypotheses of chaetognath origins: Long branches revealed by 18S ribosomal DNA. Syst. Biol. 45: 223–246. Haszprunar, G. (1988). On the origin and evolution of major gastropod groups, with special reference to the Streptoneura. J. Moll. Stud. 54: 367–441. Hennig, W. (1966). ‘‘Phylogenetic Systematics,’’ Univ. of Illinois Press, Urbana. Hillis, D. M., Craig, M., and Mable, B. K. (1996). ‘‘Molecular Systematics,’’ Sinauer, Sunderland, MA. Huson, D. (1997). SplitsTree: A program for analyzing and visualizing evolutionary data. Math. Classif. 92-04, 92A10. Jensen, K. R. (1996). Phylogenetic systematics and classification of the Sacoglossa (Mollusca, Gastropoda, Opisthobranchia). Philos. Trans. R. Soc. Lond. B351: 91–122. Jensen, K. R. (1997). Evolution of the Sacoglossa (Mollusca, Opisthobranchia) and the ecological associations with their food plants. Evol. Ecol. 11: 301–335. Kenchington, E. L., Roddick, D. L., Singh, R. K., and Bird, C. J. (1994). Analysis of small subunit rRNA gene sequences from six families of molluscs. J. Mar. Biotechnol. 1: 212–215. Kim, C. B., Moon, S. Y., Gelder, S. R., and Kim, W. (1996). Phylogenetic relationships of the annelids, molluscs, and arthropods: Evidence from molecules and morphology. J. Mol. Evol. 43: 207– 215. Kumar, S., Tamura, K., and Nei, M. (1993). MEGA: Molecular evolutionary genetics analysis. Pennsylvania State Univ., University Park, PA. Littlewood, D. T., Telford, M. J., Clough, K. A., and Rohde, K. (1998). Gnathostomulida—An enigmatic metazoan phylum from both morphological and molecular persectives. Mol. Phylogenet. Evol. 9: 72–79. Michinev, Y. S. (1970). On the origin and system of nudibranchiate molluscs (Gastropoda, Opisthobranchia). Mon. Zool. Italiano 4: 169–182. Mikkelsen, P. M. (1996). The evolutionary relationships of Cephalaspidea s.l. (Gastropoda; Opisthobranchia): A phylogenetic analysis. Malacologia 37: 375–442. Odhner, N. H. J. (1934). The Nudibranchiata. Nat. Hist. Rep. Br. Terra Nova Exped. Zool. 7: 229–310. Pelseneer, P. (1893–1894). Recherches sur divers opisthobranches. Me´m. Cour. Acad. R. Sci. Belgique 53: 1–157. Ponder, W. F., and Lindbergh, D. R. (1997). Towards a phylogeny of gastropod molluscs: An analysis using morphological characters. Zool. J. Linn. Soc. 119: 83–265. Rosenberg, G., Tillier, S., Tillier, A., Gerald, S. K., Hanlon, R. T., Masselot, M., and Williams, C. J. (1997). Ribosomal RNA phylogeny of selected major clades in the Mollusca. J. Moll. Stud. 63: 301–309. Ruthensteiner, B. (1997). Homology of the pallial and pulmonary cavity of gastropods. J. Moll. Stud. 63: 353–367. Salvini-Plawen, L. v. (1990). Origin, phylogeny and classification of the phylum Mollusca. Iberus 9: 1–33. Salvini-Plawen, L. v., and Steiner, G. (1996). Synapomorphies and plesiomorphies in higher classification of Mollusca. In ‘‘Origin and Evolutionary Radiation of the Mollusca’’ (J. Taylor, Ed.), pp. 29–51. Oxford Univ. Press, London. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463–5467. Schmekel, L. (1985). Aspects of evolution within the opisthobranchs. In ‘‘The Mollusca’’ (K. M. Wilbur, Ed.), pp. 221–267. Academic Press, London.

226

¨ GELE WOLLSCHEID AND WA

Spears, T., Abele, L. G., and Apellegate, M. A. (1994). Phylogenetic study of cirripedes and selected relatives (Thecostraca) based on 18S rDNA sequence analysis. J. Crust. Biol. 14: 641–656. Steel, M. A. (1994). Recovering a tree from the leaf colorations it generates under a Markov model. Appl. Math. Lett. 7: 19–24. Steiner, G., and Mu¨ller, M. (1996). What can 18S rDNA do for bivalve phylogeny? J. Mol. Evol. 43: 58–70. Swofford, D. L. (1993). PAUP: phylogenetic analysis using parsimony. Version 3.2.1. Computer program distributed by the Illinois Natural History Survey, Champaign, IL. Tardy, J. (1970). Contribution a` l’e´tude des me´tamorphoses chez les nudibranches. Ann. Sci. Nat. Zool. Biol. 12: 299–370. Thompson, T. E. (1976). ‘‘Biology of Opisthobranch Molluscs,’’ Vol. I, The Ray Society, London. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. (1997). The CLUSTAL X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 24: 4876–4882. Tillier, S., Masselot, M., Guerdoux, J., and Tillier, J. (1994). Monophyly of major gastropod taxa tested from partive 28S rRNA sequences with emphasis on Euthyneura and hot-vent limpets Peltospiroidea. Nautilus 108: 122–140. Tillier, S., Masselot, M., and Tillier, A. (1996). Phylogenetic relationship of the pulmonate gastropods from rRNA sequences and tempo and age of the stylommatophoran radiation. In ‘‘Origin and Evolu-

tionary Radiation of the Mollusca’’ (J. Taylor, Ed.), pp. 267–284. Oxford Univ. Press, London. Wa¨gele, H. (1997). On the phylogeny of the Nudibranchia. Verh. D. Zool. Ges. 90.1: 184. [Abstract]. Wa¨gele, H., and Willan, R. C. (1999). On the phylogeny of the Nudibranchia. Zool. J. Linn. Soc., in press. Willan, R. C. (1987). Phylogenetic systematics of the Notaspidea (Opisthobranchia) with reappraisal of families and genera. Am. Malac. Bull. 5: 215–241. Willan, R. C., and Coleman, N. (1984). ‘‘Nudibranchs of Australasia.’’ Sydney Australasian Marine Photographic Index. Winnepenninckx, B., Backeljau, T., and Van de Peer, Y. (1992). Structure of the small ribosomal subunit RNA of the pulmonate snail, Limicolaria kambeul, and phylogenetic analysis of the Metazoa. FEBS Lett. 309: 123–126. Winnepenninckx, B., Backeljau, T., and De Wachter, R. (1994). Small ribosomal subunit RNA and the phylogeny of Mollusca. Nautilus 2: 98–110. Winnepenninckx, B., Backeljau, T., and De Wachter, R. (1996). Investigation of the molluscan phylogeny on the basis of 18S rRNA sequences. Mol. Biol. Evol. 13: 1306–1317. Winnepenninckx, B., Steiner, G., Backeljau, T., and De Wachter, R. (1998). Details of gastropod phylogeny inferred from 18S rRNA sequences. Mol. Phylogenet. Evol. 9: 55–63.