Initiation of spontaneous tumors in radish (Raphanus sativus): Cellular, molecular and physiological events

Journal of Plant Physiology 173 (2015) 97–104

Contents lists available at ScienceDirect

Journal of Plant Physiology journal homepage: www.elsevier.com/locate/jplph

Physiology

Initiation of spontaneous tumors in radish (Raphanus sativus): Cellular, molecular and physiological events Maria A. Lebedeva (Osipova) a,∗ , Varvara E. Tvorogova a , Alena P. Vinogradova a , Maria S. Gancheva a , Mahboobeh Azarakhsh a , Elena L. Ilina b , Kirill N. Demchenko b , Irina E. Dodueva a , Lyudmila A. Lutova a a b

Department of Genetics and Biotechnology, Saint-Petersburg State University, Universitetskaya emb. 7/9, 199034 Saint-Petersburg, Russia Komarov Botanical Institute, Russian Academy of Sciences, Laboratory of Anatomy and Morphology, Prof. Popov Street 2, 197376 Saint-Petersburg, Russia

a r t i c l e

i n f o

Article history: Received 26 April 2014 Received in revised form 24 July 2014 Accepted 28 July 2014 Available online 18 September 2014 Keywords: Plant tumors Cambium WOX5 Auxin Radish

a b s t r a c t In plant meristems, the balance of cell proliferation and differentiation is maintained by phytohormones, specifically auxin and cytokinin, as well as transcription factors. Changing of the cytokinin/auxin balance in plants may lead to developmental abnormalities, and in particular, to the formation of tumors. The examples of spontaneous tumor formation in plants include tumors formed on the roots of radish (Raphanus sativus) inbred lines. Previously, it was found that the cytokinin/auxin ratio is altered in radish tumors. In this study, a detailed histological analysis of spontaneous radish tumors was performed, revealing a possible mechanism of tumor formation, namely abnormal cambial activity. The analysis of cell proliferation patterns revealed meristematic foci in radish tumors. By using a fusion of an auxinresponsive promoter (DR5) and a reporter gene, the involvement of auxin in developmental processes in tumors was shown. In addition, the expression of the root meristem-specific WUSCHEL-related homeobox 5 (WOX5) gene was observed in cells adjacent to meristematic foci. Taken together, the results of the present study show that tumor tissues share some characteristics with root apical meristems, including the presence of auxin-response maxima in meristematic foci with adjacent cells expressing WOX5. © 2014 Elsevier GmbH. All rights reserved.

Introduction In higher plants, cell proliferation is restricted mostly to meristems, where the formation of new organs and tissues is initiated. Cell proliferation in plants is regulated by hormones, specifically auxin and cytokinin, as well as by transcription factors that regulate sets of genes, including genes involved in plant hormone metabolism and signaling (reviewed in Su et al., 2011; Tvorogova et al., 2013). Examples of such transcription factors include WUSCHEL and WUSCHEL-RELATED HOMEOBOX 5 (WOX5) proteins that regulate shoot and root apical meristems, respectively. Cytokinins, known to stimulate shoot development, induce

∗ Corresponding author at: Department of Genetics and Biotechnology, St.Petersburg State University, Universitetskaya emb. 7/9, 199034 St.-Petersburg, Russia. Tel.: +7 812 3280541; fax: +7 812 3281590. E-mail addresses: mary [email protected] (M.A. Lebedeva (Osipova)), [email protected] (V.E. Tvorogova), alena 08 [email protected] (A.P. Vinogradova), [email protected] (M.S. Gancheva), [email protected] (M. Azarakhsh), [email protected] (E.L. Ilina), [email protected] (K.N. Demchenko), [email protected] (I.E. Dodueva), [email protected] (L.A. Lutova). http://dx.doi.org/10.1016/j.jplph.2014.07.030 0176-1617/© 2014 Elsevier GmbH. All rights reserved.

the expression of WUSCHEL (Bao et al., 2009; Chen et al., 2009). Treatment of root explants of Arabidopsis by exogenous cytokinin causes ectopic expression of WUSCHEL and the conversion of lateral root primordia to shoot apical meristems (Atta et al., 2009; Chatfield et al., 2013). Conversely, treatment of Medicago truncatula leaf explants with auxin causes ectopic expression of WOX5 and ectopic root meristem formation (Imin et al., 2007). Therefore, the cytokinin/auxin balance determines the repertoire of transcription factors expressed, and the type of meristem to be developed. Altered cytokinin/auxin balance in the plant body can lead to developmental abnormalities, and in particular, tumor formation. The best studied example of tumor formation in plants is crown gall induction by the plant pathogen Agrobacterium tumefaciens. Crown galls develop as a result of the expression genes from the bacterial T-DNA integrated in the plant genome, encoding enzymes involved in the biosynthesis of auxin and cytokinin (Garfinkel et al., 1981). Examples of spontaneous tumor formation in plants as a result of altered endogenous hormone levels are known as well (reviewed in Dodueva et al., 2007). Among them are spontaneous genetically controlled tumors formed on roots of several radish lines at the flowering stage. Radish spontaneous tumors are formed

98

M.A. Lebedeva (Osipova) et al. / Journal of Plant Physiology 173 (2015) 97–104

on the upper part of the root near the collet and closely resemble A. tumefaciens-induced crown galls (Buzovkina and Lutova, 2007). Tumorous radish lines were shown to have an increased amount of free cytokinins in their roots compared with non-tumorous lines, and it is therefore assumed that cytokinin accumulation plays a crucial role in tumor induction (Matveeva et al., 2004; Ilina et al., 2006). However, the detailed histological structure of spontaneous tumors in radish and the mechanisms of tumor induction have never been examined. In this study, we analyzed the pattern of cell proliferation in these tumors and the involvement of two key regulators of root meristem development, auxin and the root meristem-related transcription factor WOX5, in radish tumor formation using reporter gene fusions of the auxin-responsive element DR5 and of the WOX5 promoter, respectively. Materials and methods Plant material Radish (Raphanus sativus var. radicula Pers.) inbred line 19 derived from cultivar “Saxa” from the genetic collection of the Department of Genetics and Biotechnology of St. Petersburg State University (Buzovkina and Lutova, 2007) was used in this study. The genetic collection includes more than 40 inbred lines, maintained over 45 generations of inbreeding under the field conditions. RsWOX5 cloning The radish RsWOX5 gene fragment was amplified using degenerate primers WOX5 FOR: 5 -RGWGGHMCGGGGACGAAGT3 and WOX5 REV: 5 -RVTCHVATGGCGGTGGATGTT-3 , cloned in the pAL-TA vector (Evrogen, Russia) and sequenced. For whole cDNA sequencing the Mint RACE cDNA amplification kit (Evrogen, Russia) was used according to the manufacturer’s protocol. Specific primers used for 5 region amplification were: WOX5 RACE-1 5 -GGCGGTGGATGTTCCATCT-3 , WOX5 RACE-2 5 -CCCTCTCCTCCTCGTCTTCGT-3 and WOX5 RACE-3 5 -CGGCGTTTTTGCCTCTCTCT-3 . Specific primers used for 3 -region amplification were: WOX5 RACE-4 5 CGACGGTGGAGCAGTTGAAG-3 , WOX5 RACE-5 5 -GTTCCAAAACCATAAGGCTAGAGAGA-3 and WOX5 RACE-6 5 -TTTCCGGTGAATTCTTTCCAA-3 . As a result, a 579-bp coding sequence of the RsWOX5 gene was identified (GenBank accession no. KF601769). qRT-PCR analysis Total RNA was isolated from radish roots with the RNeasy Plant Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions. After a DNase (Thermo Scientific, USA) treatment, the samples were extracted with equal volume of chloroform, and RNA was precipitated from the aqueous phase with 3 M sodium acetate and ethanol and subsequently quantified with a NanoDrop 2000c UV–vis Spectrophotometer (Thermo Scientific, USA). RNA (1 ␮g) was used for cDNA synthesis with the RevertAid Reverse Transcriptase (Thermo Scientific, USA). The qRT-PCR experiments were done on a CFX-96 real-time PCR detection system with C1000 thermal cycler (Bio-Rad, USA), and Eva Green intercalating dye was used for detection (Syntol, Russia). All reactions were performed in triplicate and averaged. Cycle threshold values were obtained with the accompanying software, and data were analyzed with the 2−Ct method (Livak and Schmittgen, 2001). Relative expression was normalized against the constitutively expressed ubiquitin gene (Dodueva et al., 2013). The following primers were used for qRT-PCR analysis:

RsWOX5 forward, 5 -CGACGGTGGAGCAGTTGAAG-3 ; RsWOX5 reverse, 5 -CGGCGTTTTTGCCTCTCTCT-3 . Ubi forward,5 -ACTTGGTCCTCAGGCTTCGTGGT-3 ; Ubi reverse 5 -AAAGATCAACCTCTGCTGGTCCG-3 Each experiment was repeated at least three times with independent biological samples. Construction of binary vectors The WOX5 promoter (2487 bp) of Arabidopsis thaliana was amplified with primers pAtWOX5-for caccACTTTCTCAAACTAATGTGTCG and pAtWOX5-rev GTTCAGATGTAAAGTCCTCAA, and cloned in the pENTR-D/TOPO vector (Invitrogen, USA) and transferred to pBGFWS7.0 (Ghent, Belgium) using the LR Clonase enzyme (Invitrogen, USA). DR5 is an artificial auxin-sensitive promoter, so the distribution of the reporter proteins reflects the distribution of responses to auxin (Ulmasov et al., 1997). To analyze the auxin response in radish tumor tissues the DR5::gfp-gusA cassette in the pKGW243-GGRR vector was used containing a pAtUBQ10::DsRED1 as a selectable marker (Limpens et al., 2004; Ilina et al., 2012). pAtWOX5::GUS and DR5::GUS constructs were introduced in the Agrobacterium rhizogenes MSU440 strain through electroporation by Eppendorf Eporator® (Eppendorf, Germany). A. rhizogenes-mediated plant transformation R. sativus plants were transformed with A. rhizogenes. Seeds were surface sterilized with 30% hydrogen peroxide for 10 min, rinsed in sterile water, and germinated on Petri dishes with 1% water agar in the dark. 4–5 days after germination, the radicle was cut off with a sterile scalpel. Sectioned seedlings were infected by coating the freshly cut surface with the vector-containing A. rhizogenes MSU440 strain which had been grown at 28 ◦ C for 2 days on solid LB medium with the appropriate antibiotics. The infected seedlings were placed on Petri dishes with Fahraeus medium (Fahraeus, 1957) with 9% agar for 5 days at 21 ◦ C with a 16-h photoperiod. Subsequently, plants were placed on Fahraeus medium with 300 mg l−1 Cefotaxime on filter paper at 21 ◦ C and under identical light conditions. During the next 2 weeks roots were cut off again every week, and 3 weeks later plants were set out in pots with vermiculite wetted with liquid Fahraeus medium and cultivated at 21 ◦ C with a 16-h photoperiod. After about one month, plants were transferred to pots with soil, and after a full rosette was formed plants were transferred to the field. At the flowering stage, roots were harvested and analyzed. Histochemical localization of GUS activity GUS activity in transformed roots was analyzed with 2 mM 5bromo-4-chloro-3-indolyl-␤-d-glucuronic acid as substrate in NT buffer (100 mm Tris HCl/50 mm NaCl solution, pH 7.5) supplemented with 2 mM ferricyanide (Van den Eede et al., 1992). Roots were vacuum infiltrated for 20 min and subsequently incubated in GUS buffer at 37 ◦ C until sufficient blue staining had been developed (about 1 h). After staining, roots were infiltrated with fixative (3% paraformaldehyde, 0.25% glutaraldehyde, 0.1% Tween-20, 0.1% Triton X-100 in 1/3 MTSB) under vacuum (−1 atm), fixed overnight at 4 ◦ C and rinsed with 1/3× MTSB buffer (50 mm PIPES, 5 mm MgSO4, 5 mm EGTA). The root segments were subsequently embedded in agarose (3%), and 50 ␮m sections were prepared with a microtome with a vibrating blade (Leica VT-1200S). Photographs were taken with a fluorescent microscope AxioImager.Z1 (Carl Zeiss, Germany) equipped with a MRc5 digital camera (Carl Zeiss, Germany) and ZEN 2011 microscope software (Carl Zeiss, Germany).

M.A. Lebedeva (Osipova) et al. / Journal of Plant Physiology 173 (2015) 97–104

99

cambium cells. In addition to proliferation, these cells demonstrate some morphological characteristics of meristem cells, e.g. small size, dense cytoplasm and thin cell walls. In mature tumors, such proliferating cells are clustered into “meristematic foci,” which are usually located in the periphery of tumor, close to the ends of vessels (Fig. 2e–h). Supplementary Fig. S1 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jplph.2014.07.030. Auxin response in tumor tissues

Fig. 1. Spontaneous tumors formed on the lower part of radish storage root. Scale bar, 1 cm.

Cell proliferation assay Radish plants at the flowering stage were transferred from field conditions into hydroponic system, containing liquid Fahraeus medium for 24 h. Then modified nucleoside 10 ␮M 5-ethynyl-2 deoxyuridine (EdU) was added to the medium and plants were incubated with Edu for 48 h. After that, root segments were infiltrated with fixative as described above, embedded in agarose (3%), and 50 ␮m sections were prepared with a microtome with a vibrating blade (Leica VT-1200S). EdU incorporation was detected with Alexa Fluor488® dye using the Click-iT® EdU Alexa Fluor® 488 Imaging Kit (Life Technologies, USA) (Salic and Mitchison, 2008; Ilina et al., 2012).

To analyze the auxin response in tumor tissues, radish seedlings were transformed with a DR5::GUS construct via Agrobacterium rhizogenes-mediated transformation. Transformed plants were grown in the field, and at the flowering stage tumors appeared on their roots. The transgenic nature of radish roots was confirmed via analysis for DsRED1 fluorescence (Fig. S2). Activity of DR5::GUS was observed in the apices of radish hairy roots (data not shown), resembling distribution of auxin responses in root tissues described for Arabidopsis thaliana and other species (Sabatini et al., 1999; Ilina et al., 2012). In radish tumors, the activity of DR5::GUS was observed in the tumor periphery and is associated with apices of meristematic foci (Fig. 3 a and b). The pattern of DR5::GUS activity in radish tumors resembles the one observed in root apical meristems. The maximum of auxin concentration in the root apex is known to determine the position of the organizing center of the apical meristem, where WOX5 is expressed maintaining root meristem activity (Sarkar et al., 2007). To test the possible involvement of WOX5 transcription factors in the maintenance of meristematic foci of tumors, the expression of the WOX5 gene was analyzed in transgenic hairy roots of radish. Supplementary Fig. S2 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jplph.2014.07.030.

Microscopy Examination and imaging of composite plants were performed using a SteREO Lumar V12 (Carl Zeiss, Germany) fluorescent stereomicroscope equipped with an MRc5 digital camera (Carl Zeiss, Germany). For observation of DsRED1 fluorescence, the filter set 43 HE (EX BP 550/25, EM BP 605/70) was used. Total tumors and GUSstained sections were examined with the same microscope using bright field optics. Indirect fluorescence localization was taken with a fluorescent microscope AxioImager.Z1 using the filter set 09 (EX 450–490 nm, EM LP 515 nm) (Carl Zeiss, Germany). Images were processed using AxioVision 4.8.2 or ZEN2012 software (Carl Zeiss) and Adobe Photoshop CS5. Results Histological structure and distribution of proliferating cells in radish tumors Normally, radish roots undergo secondary growth due to activity of the cambium, which forms secondary xylem and phloem elements (Lewis-Jones et al., 1982) (Fig. 1). Analysis of proliferating cells using the modified thymidine analog EdU revealed the proliferation of cambial cells and, to a lesser extent, of xylem parenchyma cells in radish roots (Fig. 2a). At early stages of tumor development, large groups of proliferating cells are found in xylem rays (opposite the protoxylem pole) (Fig. 2c and d). At later stages, tumors differentiate irregularly distributed vessels connected with the root vasculature, some of xylem vessels forming globular structures in tumors (Fig. 2g and h, Fig. S1(a and b). As a result, mature radish tumors consist of parenchyma cells and numerous randomly distributed wavy xylem vessels with adjacent proliferating cells (Fig. S1). These proliferating cells are proposed to be the descendants of

The expression of root meristem-related gene WOX5 in radish tumors The nucleotide sequence of WOX5 mRNA in Raphanus sativus var. Radicola Pers. was determined and was designated as RsWOX5 (GenBank accession no. KF601769). The nucleotide sequence of the RsWOX5 gene coding region demonstrates 78.1% sequence similarity with the AtWOX5 gene of A. thaliana (including 88.2% similarity within the homeodomain nucleotide sequence). Fig. 4 shows the alignment of the deduced amino acid sequences of transcription factors RsWOX5 and AtWOX5. In general, the amino acid sequence of RsWOX5 is 10 amino acids longer. In particular, RsWOX5 contains 12 additional amino acids between the homeodomain (underlined) and the acidic amino acid domain (marked with a box) compared with the AtWOX5 sequence. Moreover, RsWOX5 and AtWOX5 differ in the length and amino acid composition within the acidic amino acid domain for which a trans-activation function has been proposed. The differences in the trans-activation domains of RsWOX5 and AtWOX5 may indicate differences in the regulatory activity of these two orthologous transcription factors of related species. Based on the identified RsWOX5 mRNA sequence, specific primers were designed to be used in RsWOX5 expression analysis using quantitative RT-PCR. The relative levels of RsWOX5 expression were determined in tumor tissues, as well as in the root tips and in the upper part of storage roots (Fig. 5). As expected, quantitative RT-PCR analysis revealed RsWOX5 expression in root tips, where the WOX5 gene is known to be expressed in root apical meristems. Surprisingly, comparable levels of RsWOX5 expression were found in upper parts of storage roots and also in tumors. To analyze how WOX5 is expressed in radish tumors locally, the 2487-bp AtWOX5 promoter region was amplified and used to

100

M.A. Lebedeva (Osipova) et al. / Journal of Plant Physiology 173 (2015) 97–104

Fig. 2. The distribution of proliferating cells in storage roots and tumors of radish. Proliferating cells were detected by incorporating 5-ethynyl-2 -deoxyuridine (EdU; 48 h) detected with Alexa Fluor 488. (a and b) Cross-section (50 ␮m) of storage root. (c–f) Cross-sections (50 ␮m) of radish storage root initiating a tumor opposite a xylem pole (asterisk). (g and h) Cross-sections (50 ␮m) of a tumor at a later stage. Meristematic foci are indicated with white arrows. (a, c, e and g) Fluorescent images showing EdU incorporation in proliferating cells (green fluorescence). (b, d, f and h) DIC images. Ca, cambium; Xv, xylem vessels, Xp, xylem parenchyma. Scale bar, 100 ␮m.

Fig. 3. Activity of the auxin-regulated promoter DR5 in radish tumors. (a) Stereoscopic image of a DR::GUS-expressing radish tumor. (b) Light micrographs of sections (50 ␮m) of a DR::GUS-expressing radish tumor. Scale bar, (a) 1 mm, (b) 100 ␮m.

M.A. Lebedeva (Osipova) et al. / Journal of Plant Physiology 173 (2015) 97–104

101

Fig. 4. Alignment of amino acid sequences of WOX5 transcription factors from Raphanus sativus (RsWOX5) and Arabidopsis thaliana (AtWOX5). Conserved domains are marked: homeodomain (underlined), trans-activation acidic domain (boxed), WUS-box (dotted line) and EAR repressor domain (asterisks).

prepare a pAtWOX5::GUS construct (see Methods). Since R. sativus is closely related to the model object A. thaliana, the promoter region of AtWOX5 was expected to work adequately in radish. The pAtWOX5::GUS construct was introduced in radish roots via A. rhizogenes-mediated transformation. Expression of pAtWOX5::GUS in apices of radish hairy roots was observed in groups of cells within root apical meristems corresponding to the quiescent center (QC) (Fig. 6b). This result is consistent with previous data on WOX5 expression in Arabidopsis (Sarkar et al., 2007) and this result proves that pAtWOX5::GUS construct works adequately in radish roots. In spontaneous tumors on radish hairy roots, pAtWOX5::GUS expression was observed in groups of cells adjacent to meristematic foci, but not in the proliferating cells themselves (Fig. 6c–f). Discussion The body of tumors on radish roots consists of parenchymatic cells and randomly distributed xylem vessels, proliferating cells in tumors being clustered into meristematic foci, usually located close to xylem vessels. A similar structure was found in crown galls caused by A. tumefaciens (Sylwester and Countryman, 1933; Kupila, 1963; Aloni et al., 1995; Chalupowicz et al., 2006). Moreover, for a number of plants it was shown that Agrobacterium-mediated tumors are initiated due to an alteration in cambium activity (Kupila, 1963). The spontaneous tumors in radish could develop

Fig. 5. qRT-PCR analysis of the RsWOX5 gene expression in root tips, storage roots and tumors of radish. Expression levels are shown relative to the expression found in root tips. Error bars indicate standard deviation. r.u., relative units.

in a similar way: abnormal cell proliferation of the cambium alters the radial structure of the root, leading to the formation of a large mass of parenchyma and abnormally distributed vascular elements (Fig. S1). Moreover, in mature radish tumors, we observed wavy xylem vessels, resembling globular bundles previously described for A. tumefaciens-induced tumors (Aloni et al., 1995). The analysis of early stages of tumor development in radish shows that tumors are initiated in xylem rays opposite a xylem pole. Interestingly, in most plant species, other root lateral organs, such as lateral roots and symbiotic nodules in legumes, are initiated in pericycle cells that are located opposite to xylem pole (Dubrovsky et al., 2000; Heidstra et al., 1997). It is assumed that the pericycle cells opposite to xylem poles that are involved in lateral root formation resume proliferation after leaving the root meristem (Parizot et al., 2008). The root cambium is known to have a complex origin: cambial cells opposite to xylem poles are formed from the pericycle, whereas cambium between primary phloem and xylem is formed from the stelar parenchyma (Baum et al., 2002; Miyashima et al., 2013). It is especially interesting that the initiation of tumor formation is observed in the ray area opposite to xylem poles, where the cambium has pericyclic origin. This fact supports the idea that the pericycle cells opposite to xylem poles, as well as their derivatives, may retain specific meristematic activity that can be resumed under certain conditions, particularly when the concentrations of auxin and cytokinins are altered. Previously, it has been shown that the ratio of auxin and cytokinins is changed upon the formation of tumors in radish (Lutova et al., 1997; Matveeva et al., 2004; Ilina et al., 2006). These hormones have a profound influence on cambium activity. In particular, it is known that auxin is transported polarly from leaves via xylem parenchyma cells into cambium, where high auxin concentration is observed (Uggla et al., 1996; Spicer et al., 2013). Moreover, auxin stimulates the differentiation of xylem vessels (Aloni et al., 2006; Aloni, 2013). It was also shown that auxin positively regulates cambium activity in shoots (Suer et al., 2011). Cytokinin increases the sensitivity of cambial cells to auxin and stimulates cell division in the cambium (Aloni et al., 2006). So, changing the ratio of these two key hormones can lead to abnormal proliferation of cambial cells. It is known that the development of A. tumefaciens-induced tumors results from altered balance of plant hormones due to the expression of agrobacterial oncogenes, including genes involved in auxin and cytokinin biosynthesis, introduced into plant genome as a part of T-DNA (Chilton et al., 1977). Accordingly, in A. tumefaciensinduced tumors the concentration of free auxin and cytokinin is increased (Veselov et al., 2003). In previous studies, increased amounts of free cytokinins were observed in radish tumor tissues compared with normal roots

102

M.A. Lebedeva (Osipova) et al. / Journal of Plant Physiology 173 (2015) 97–104

Fig. 6. Expression pAtWOX5::GUS in the roots and spontaneous tumors of radish. (a and b) Longitudinal section (50 ␮m) of a pAtWOX5::GUS-expressing root tip. pAtWOX5::GUS expression is observed in the quiescent center. (c and f) Cross-sections of pAtWOX5::GUS-expressing tumors. (a, c, d and e) Light micrographs of sections. (a) WOX5 expression in a root tip; (c) WOX5 expression in a tumor observed in a group of cells adjacent to “meristematic foci” (asterisk); (d) Close-up shows enlargement of (c). (b and f) Fluorescent images showing 5-ethynyl-2 -deoxyuridine EdU (green fluorescence) incorporated in proliferating cells. QC, quiescent center. Scale bar, 100 ␮m.

(Matveeva et al., 2004). The present study is focused on the distribution of auxin responses in tumor tissues. In this study, the method of A. rhizogenes-mediated transformation was successfully used for the first time to obtain composite radish plants with transgenic roots. This approach was used for many plant species to study different aspects of root biology, including symbiotic nodule formation (Limpens et al., 2004; Osipova et al., 2012; Ilina et al., 2012). This study shows that A. rhizogenes-mediated transformation can be used to express different construct in radish roots, in particular in spontaneous tumors formed on roots undergoing secondary growth. Here, the activity of the auxin-responsive construct DR5::GUS was observed in the meristematic foci of tumors. Interestingly, in A. tumefaciens-induced tumors in Trifolium repens and A. thaliana the activity of auxin-responsive constructs GH3::GUS and DR5::GUS, respectively, was also observed in proliferating periphery of metabolically active tumors (Schwalm et al., 2003). Apparently, such pattern of auxin-responsive GUS activity in tumors reflects

the pathway of auxin transport toward proliferating cells, where its concentration maximum is observed. The pattern of DR5::GUS activity in tumor meristematic foci resembles the pattern of auxin distribution in root apical meristems. To test the hypothesis that meristematic foci in tumors have characteristics of root apical meristems, the expression levels of the WOX5 gene encoding one of the key regulators of the root apical meristem were analyzed in tumors. Quantitative PCR analysis revealed RsWOX5 gene expression not only in the root tips, but also in the upper parts of storage roots and in tumors. The fact of RsWOX5 expression in the upper parts of storage roots, where no root apical meristems are found, needs further investigations. It can be speculated that WOX5 expression in radish storage roots may be connected with secondary growth and increased cambium activity required for storage roots formation in radish, however local analysis of RsWOX5 gene expression is required to prove this speculation. Since qPCR analysis does not provide information about the cellular localization of WOX5 gene expression in tumors, WOX5 promoter

M.A. Lebedeva (Osipova) et al. / Journal of Plant Physiology 173 (2015) 97–104

activity was analyzed using a pAtWOX5::GUS reporter construct. As expected, pAtWOX5::GUS expression was detected in root tips in the small area corresponding to the quiescent center of the root apical meristem. In radish tumors, WOX5 promoter activity was observed in groups of cells adjacent to meristematic foci, where local maxima of auxin response were observed, but not in the proliferating cells of the meristematic foci themselves. From several studies it is known that WOX5 gene expression is auxin-inducible (Imin and Rolfe, 2007; Imin et al., 2007; Chen et al., 2009; Osipova et al., 2012). Moreover, a number of studies showed that the activation of WOX5 gene expression is observed in calluses formed from different plant organs on auxin-containing callus-inducing medium (Sugimoto et al., 2010; He et al., 2012). It can be proposed that WOX5 gene expression in developing tumors is also induced by auxin. Together, the findings of this study shed light on the possible mechanisms of tumor formation on radish roots, involving abnormal cambial activity due to altered cytokinin-auxin balance. Moreover, meristematic foci of radish tumors found in the areas with auxin response maximum share some characteristic of root apical meristem, including the expression of meristem-related gene WOX5. Recently, we found that Agrobacterium-induced tumors on pea (Pisum sativium) hypocotyls also include meristematic foci and, moreover, demonstrate increased WOX5 gene expression (Vinogradova et al., 2015). Taking all this into account, we can suggest that the presence of meristematic foci and WOX5 gene expression also can represent common features of spontaneous and Agrobacterium-induced tumors in plants. Acknowledgements This work was supported by grants from the Russian Foundation for Basic Research (RFBR 11-04-01687, 12-04-32021 mol a, 13-04-02140), the President of Russia (HIII-5345.2012.4), the Ministry of Education and Science of the Russian Federation (8045) and grant from Saint-Petersburg State University 1.38.676.2013. Authors acknowledge the Research Resource Center for Molecular and Cell Technologies of Saint-Petersburg State University for DNA sequencing and the equipment used in this study. D.K.N. acknowledges additional support by the Russian Foundation for Basic Research (12-04-32002, 14-0401413) the Focus Program of Presidium of the Russian Academy of Sciences 3/156. References Aloni R. Role of hormones in controlling vascular differentiation and the mechanisms of lateral root initiation. Planta 2013;238:819–30. Aloni R, Aloni E, Langhans M, Ullrich C. Role of cytokinin and auxin in shaping root architecture: regulating vascular differentiation, lateral root initiation, root apical dominance and root gravitropism. Ann Bot 2006;97:883–93. Aloni R, Pradel KS, Ullrich CI. The three-dimensional structure of vascular tissues in Agrobacterium tumefaciens-induced crown galls and in the host stems of Ricinus communis. Planta 1995;196:597–605. Atta R, Laurens L, Boucheron-Dubuisson E, Guivarc’h A, Carnero E, Giraudat-Pautot V, et al. Pluripotency of Arabidopsis xylem pericycle underlies shoot regeneration from root and hypocotyl explants grown in vitro. Plant J 2009;57:626–44. Bao Y, Dharmawardhana P, Arias R, Allen MB, Ma C, Strauss SH. WUS and STMbased reporter genes for studying meristem development in poplar. Plant Cell Rep 2009;28:947–62. Baum SF, Dubrovsky JG, Rost TL. Apical organization and maturation of the cortex and vascular cylinder in Arabidopsis thaliana (Brassicaceae; roots). Am J Bot 2002;89:908–20. Buzovkina IS, Lutova LA. The genetic collection of radish inbred lines: history and prospects. Russ J Genet 2007;43:1411–23. Chalupowicz L, Barash I, Schwartz M, Aloni R, Manulis S. Comparative anatomy of gall development on Gypsophila paniculata induced by bacteria with different mechanisms of pathogenicity. Planta 2006;224(2):429–37. Chatfield SP, Capron R, Severino A, Penttila PA, Alfred S, Nahal H, et al. Incipient stem cell niche conversion in tissue culture: using a systems approach to probe early events in WUSCHEL-dependent conversion of lateral root primordia into shoot meristems. Plant J 2013;73:798–813.

103

Chen SK, Kurdyukov S, Kereszt A, Wang XD, Gresshoff PM, Rose RJ. The association of homeobox gene expression with stem cells formation and morphogenesis in cultured Medicago truncatula. Planta 2009;230:827–40. Chilton MD, Drummond MH, Merio DJ, Sciaky D, Montoya AL, Gordon MP, et al. Stable incorporation of plasmid DNA into higher plant cells: the molecular basis of crown gall tumorigenesis. Cell 1977;11:263–71. Dodueva IE, Frolova NV, Lutova LA. Plant tumorigenesis: different ways for shifting systemic control of plant cell division and differentiation. Transgenic Plant J 2007;1:3–24. Dodueva IE, Kiryushkin AS, Yurlova EV, Osipova MA, Lutova LA. Effect of cytokinins on expression of radish CLE genes. Russ J Plant Physiol 2013;60:388–95. Dubrovsky JG, Doerner PW, Colón-Carmona A, Rost TL. Pericycle cell proliferation and lateral root initiation in Arabidopsis. Plant Physiol 2000;124:1648–57. Fahraeus G. The infection of clover root hairs by nodule bacteria studied by a simple glass slide technique. J Gen Microbiol 1957;16:374–81. Garfinkel DJ, Simpson RB, Ream LW, White FF, Gordon MP, Nester EW. Genetic analysis of crown gall: fine structure map of the T-DNA by site-directed mutagenesis. Cell 1981;27:143–53. He C, Chen X, Huang H, Xu L. Reprogramming of H3K27me3 is critical for acquisition of pluripotency from cultured Arabidopsis tissues. PLoS Genet 2012;8:e1002911. Heidstra R, Yang WC, Yalcin Y, Peck S, Emons AM, van Kammen A, et al. Ethylene provides positional information on cortical cell division but is not involved in nod factor-induced root hair tip growth in Rhizobium–legume interaction. Development 1997;124:1781–7. Ilina EL, Logachov AA, Laplaze L, Demchenko NP, Pawlowski K, Demchenko KN. Composite Cucurbita pepo plants with transgenic roots as a tool to study root development. Ann Bot 2012;110:479–89. Ilina EL, Dodueva IE, Ivanova NM, Lutova LA. Effect of cytokinins on in vitro cultivated inbred radish lines of Raphanus sativus var. radicula Pers. with genetically determined tumorigenesis. Russ J Plant Physiol 2006;53:575–84. Imin N, Nizamidin M, Wu T, Rolfe BG. Factors involved in root formation in Medicago truncatula. J Exp Bot 2007;58:439–51. Imin N, Rolfe BG. Factors that mediate root initiation in plants. Plant Signal Behav 2007;2:249–50. Kupila S. Crown gall as an anatomical and cytological problem: a review. Cancer Res J 1963;23:497–509. Lewis-Jones LJ, Thorpe JP, Wallis GP. Genetic divergence in four species of the genus Raphanus: implications for the ancestry of the domestic radish Raphanus sativus. Biol J Linn Soc 1982;18:35–48. Limpens E, Ramos J, Franken C, Raz V, Compaan B, Franssen H, et al. RNA interference in Agrobacterium rhizogenes-transformed roots of Arabidopsis and Medicago truncatula. J Exp Bot 2004;55:983–92. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25:402–8. Lutova LA, Buzovkina IS, Smirnova OA, Tikhodeev ON, Shishkova SO, Trifonova IM. Genetic control of in vitro regeneration processes in radish. In Vitro Cell Dev Biol – Plant 1997;33:269–74. Matveeva TV, Frolova NV, Smets R, Dodueva IE, Buzovkina IS, Van Onckelen H, et al. Hormonal control of tumor formation in radish. J Plant Growth Regul 2004;23:37–43. Miyashima S, Sebastian J, Lee JY, Helariutta Y. Stem cell function during plant vascular development. EMBO J 2013;32:178–93. Osipova MA, Mortier V, Demchenko KN, Tsyganov VE, Tikhonovich IA, Lutova LA, et al. WUSCHEL-RELATED HOMEOBOX5 gene expression and interaction of CLE peptides with components of the systemic control add two pieces to the puzzle of autoregulation of nodulation. Plant Physiol 2012;158:1329–41. Parizot B, Laplaze L, Ricaud L, Boucheron-Dubuisson E, Bayle V, Bonke M, et al. Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation. Plant Physiol 2008;146:140–8. Sabatini S, Beis D, Wolkenfelt H, Murfett J, Guilfoyle T, Malamy J, et al. An auxindependent distal organizer of pattern and polarity in the Arabidopsis root. Cell 1999;99:463–72. Salic A, Mitchison TJ. A chemical method for fast and sensitive detection of DNA synthesis in vivo. Proc Natl Acad Sci USA 2008;105:2415–20. Sarkar AK, Luijten M, Miyashima S, Lenhard M, Hashimoto T, Nakajima K, et al. Conserved factors regulate signalling in Arabidopsis thaliana shoot and root stem cell organizers. Nature 2007;446:811–4. Schwalm K, Aloni R, Langhans M, Heller W, Stich S, Ullrich CI. Flavonoid-related regulation of auxin accumulation in Agrobacterium tumefaciens-induced plant tumors. Planta 2003;218:163–78. Spicer R, Tisdale-Orr T, Talavera C. Auxin-responsive DR5 promoter coupled with transport assays suggest separate but linked routes of auxin transport during woody stem development in Populus. PLOS ONE 2013;15:e72499. Su Y-H, Liu Y-B, Zhang X-S. Auxin–cytokinin interaction regulates meristem development. Mol Plant 2011;4:616–25. Suer S, Agusti J, Sanchez P, Schwarz M, Greb T. WOX4 imparts auxin responsiveness to cambium cells in Arabidopsis. Plant Cell 2011;23:3247–59. Sugimoto K, Jiao Y, Meyerowitz EM. Arabidopsis regeneration from multiple tissues occurs via a root developmental pathway. Dev Cell 2010;18:463–71. Sylwester EP, Countryman MC. A comparative histological study of crown gall and wound call us on apple. Am J Bot 1933;20:328–40. Tvorogova VY, Osipova MA, Doduyeva IY, Lutova LA. Interactions between transcription factors and phytohormones in the regulation of plant meristem activity. Russ J Genet Appl Res 2013;3:325–37. Uggla C, Moritz T, Sandberg G, Sundberg B. Auxin as a positional signal in pattern formation in plants. Proc Natl Acad Sci USA 1996;93:9282–6.

104

M.A. Lebedeva (Osipova) et al. / Journal of Plant Physiology 173 (2015) 97–104

Ulmasov T, Murfett J, Hagen G, Guilfoyle TJ. Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 1997;9:1963–71. Van den Eede G, Deblaere R, Goethals K, Van Montagu M, Holsters M. Broad host range and promoter selection vectors for bacteria that interact with plants. Mol Plant–Microbe Interact 1992;5:228–34.

Veselov D, Langhans M, Hartung W, Aloni R, Feussner I, Götz C, et al. Development of Agrobacterium tumefaciens C58-induced plant tumors and impact on host shoots are controlled by a cascade of jasmonic acid, auxin, cytokinin, ethylene and abscisic acid. Planta 2003;216:512–22. Vinogradova AP, Lebedeva MA, Lutova LA. Meristem-like characteristics of tumor induced by Agrobacterium tumefaciens in pea. Russ J Genet 2015;1 (in press).