Initiation of the UvrABC nuclease cleavage reaction

J. Mol. Biol. (1991) 220, 19-33

Initiation

of the UvrABC

Nuclease Cleavage Reaction

Efficiency of Incision is not Correlated with UvrA Binding Affinity Amanda Snowden and Ben Van Houten132T31. ‘Department of Pathology, ‘Department of Biochemistry and 3Department of Microbiology and Molecular Genetics University of Vermont Burlington VT 05405, U.S.A. (Received 26 October 1990; accepted 18 March

1991)

The incision steps of Escherichia coli nucleotide excision repair are mediated by the UvrABC nuclease complex. We have previously shown that the UvrABC nuclease specifically incises apyrimidinic (AP) sites less efficiently than o-benzylhydroxylamine-modified apyrimidinic (BA) sites. To investigate these differences, quantitative DNase I footprinting titration studies were performed. The UvrA binding isotherms were similar for both the AP site (Kd = 6 x 10m9 M) and the bulkier BA lesion (Kd = 14 x 10e9 M), despite the fact that the extent of incision differs for these two lesions. It was also found that the relative binding affinity of the preincision UvrA,B complex to the AP and BA substrates differs significantly with estimated apparent equilibrium dissociation constants (Kd) of 4 x 10m9 M and 80 x lOA9 to 120 x 1O-9 M, respectively. These results indicate that incision efficiency does not correlate to UvrA binding afinity, but is a direct result of interactions between the UvrA,B complex and the site of the DNA damage. It is also shown that high UvrA concentrations are inhibitory to the UvrABC nuclease reaction.

Keywords: damage recognition;

DNA

repair;

1. Introduction The nucleotide excision repair pathway in Escherichia coli is mediated by the UvrABC nuclease complex through a series of ordered reactions (for reviews, see Grossman & Yeung, 1990; Sancar & Sancar, 1988; Van Houten, 1990). The UvrA subunit forms a dimer in solution (Oh et al., 1989) and associates with UvrB to form an UvrA,B complex in an ATP-dependent reaction (Orren & Sancar, 1989a). The UvrA,B complex can transiently melt the helix through the action of a limited UvrA,B helicase activity (Oh & Grossman, 1987, 1989). Upon encountering a damaged site the helicase activity is inhibited and a stable preincision complex is formed (Oh & Grossman, 1989). Once the stable preincision complex is formed the UvrC protein binds, resulting in the cleavage of the eighth phosphodiester bond 5’ and the fifth phosphodiester bond 3’ to the lesion. Excision of the oligonucleotide containing the lesion and release of the post-incision Uvr subunits requires the action of both helicase II (UvrD) and DNA polymerase I (Caron et al., 1985; Husain et al., 1985). t Author to whom all correspondence should be addressed.

_^

E. coli; abasic sites; UvrABC

nuclease.

A remarkable feature of the UvrABC nuclease is its broad substrate specificity (Van Houten, 1990). Due to the nature of the diverse substrates, it has been suggested that the nuclease complex recognizes a general alteration in the DNA helix rather than a specific modified nucleotide (Van Houten et al., 1986; Walter et al., 1988). Recent studies have suggested that the general features of DNA damage necessary for recognition by the UvrABC nuclease include localized bends or kinks, DNA unwinding and alterations in either the charge distributions or structural dynamics of the helix (Van Houten, 1990). Among the substrates recognized by this such as pyrimidine dimers and enzyme, many, cisplatin G-G intrastrand diadducts, create significant helical distortion within DNA (Sherman & Lippard, 1987; Husain et al., 1988). However, it has been reported that the UvrABC nuclease complex can also recognize relatively non-distorting DNA damage such as 06-methylguanine nucleotides (Van Houten & Sancar, 1987; Voigt et al., 1989) and thymine glycols (Kow et al., 1990). Hence, the extent and type of helical distortion that is either necessary or sufficient for recognition is not well understood. In order to systematically study the damage recognition process of the UvrABC complex, our

IY

0022~2836/91/130019-15

$03.00/0

0 1991 Academic Press Limited

20

14. Snowden

and B. Van Houten

laboratory has constructed a series of DNA lesions within a defined sequence (Snowden et al., lggo), which presumably induce increasingly greater helical distortion to the DNA helix. We have previously shown that a 49 base-pair (bpt) duplex, containing an apyrimidinic (AP) sit,e, a reduced AP site, an o-methylhydroxylamine-modified apyrimidinic (MA) site or an o-benzylhydroxylaminemodified apyrimidinic (BA) site, is specifically incised by the UvrABC nuclease complex (Snowden et al., 1990). The base-damage analogs (MA and BA lesions) were incised most efficiently, followed by the reduced AP site and the AP site that was incised least efficiently. It was important to determine whether the incision eficiency for these lesions could be correlated to the binding affinity of the UvrA subunit. Using the method of quantitative DNase I footprinting, we demonstrate here that the binding afi?nity of the UvrA subunit is similar for both AP and BA lesions despite the differences seen in incision efficiency. We also show that high UvrA concentrations inhibit incision by UvrABC at the BA lesions, but not at AP sites. More importantly, the relative binding afinity of the UvrA,B complex to these substrates is different, suggesting that the formation of the stable preincision complex may be a limiting factor in the eficiency of incision by the UvrABC nuclease complex. It is also shown that the dual incision process is inhibited when the UvrA,B-DNA preincision complex is formed first at low UvrA concentrations and then challenged with high UvrA concentrations.

methylene from BRL; Aldrich.

bisacrylamide and o-benzyl hydrosylamine

(b) Enzymes Ail modification enzymes restriction and were purchased from BRL unless otherwise noted. The UvrA, UvrB and UvrC subunit,s were purified from E. coli overproducer strain CH296 containing plasmids pUNC4.5. pUNC211 and pDR3274, respectively (obtained from A. Sancar; University of North Carolina). The purification procedure was as described (Sancar et al., 1987). The molar extinction coefficients for the UvrA, UvrB and UvrC subunits are 46,680, 27,699 and 36,200, respectively (Van Houten, 1990). Uracil glycosylase was prepared by the method of Lindahl et al. (1977) using E. coli strain M72 carrying plasmid pBD15, which overproduces uracil N-glycosylase 200.fold (Duncan & Chambers, 1984) and was generously provided by W. Kow, University of Vermont. (c) Oligonucleotides

and Methods

(a) Chemicals Tris base, boric acid and EDTA Sigma; acrylamide, ammonium

were obtained persulfate,

from

and preparation

of substrates

A 49 bp oligonucieotide containing uracil at position 26 and the complementary 50mer were synthesized on a DuPont automatic DNA synthesizer (GE?U‘ERATOR DNA Synthesizer). The oligonucleotides containing either an AP site or a BA site were prepared as described (Snowden et al., 1990). The concent,rations of the DSA duplexes were determined by ethidium bromide fluorescence using sonicated calf thymus DNA as a reference standard (Sambrook et al., 1989). The sequence of the DNA duplex is given in Fig. 1. (d) DNA

2. Materials

Sequencing

Sequencing of the 5’ or 3’-terminally duplex was performed using standard procedures (Maxam & Gilbert, 1980).

reactions

The UvrA or the UvrA and UvrB subunits (concentra-. tions as indicated) were incubated with 2 ng of 49 bi: duplex (1.24 nM) containing either an AP or BA lesion in 50 ~1 of standard reaction mixture (50 miv-Tris * RCI

5’ - GACTACTTGGTACACTGACGCGAGCXCGCGGAAGCTCATTCCAGTGCGC CTGATGAACCATGTGACTGCGCTCGAGCGCCTTCGAGTAAGGTCACGC

A residue

labeled 49 hp Maxam-Gilbert

N,N’(e) D?ja-se I jootprinting

t Abbreviations used: bp, base-pair(s); BP site, apyrimidinic site; BA site, o-benzylhydroxylaminemodified apyrimidinic site; MA site, o-methylhydroxylamine-modified apyridinic site; DTT, dithiothreitol.

urea were obtained was purchased from

purinie

- 3’

site

Figure 1. Nucleotide sequence of the 49 bp oligonucleotide duplex and structures of DNA lesions. A i9 hp oligonucleotide was synthesized: modified and annealed as previously described. An X at, position 26 denotes the site modified to an AP or a BA site; structures shown below sequence. The modified strand is numbered in the 5’ to 3’ direction.

Initiation

qf UvrABC

N&ease

50 rn~-KCl, 10 miv-MgCl,, 5 miv-DTT, (PH 7.5) 2 mM-ATP and 100 pg bovine serum albumin/ml) for 30 min at 37 “C. UvrA concentrations ranged from 2 nM to 200 UM. UvrB (120 nM) was added to the appropriate reactions. Following a 30 min incubation to allow the subunits to equilibrate, the reactions were cooled to room temperature and 25 mM-CaCl, was added. DNase I (0.26 ng) was then added to the reactions for 5 min at room temperature. The reactions were stopped by the addition of EDTA (15 mM) and rapid freezing in a solid COJethanol bath. Reactions were then lyophilized to dryness and resuspended in 40 ~1 of formamide plus tracking dyes. The samples were heated to 90°C quickcooled on ice, and portions (5 to 8 ~1) run on a 10% (w/v) polyacrylamide sequencing gel under denaturing conditions (8.0 M urea) in a Tris-borate (pH 8.0) buffer. The gel was dried and analyzed as described below.

(f) Quantification of DlVase I footprinting and data analysis

Quantification of the individual bands produced by DNase I digestion was performed using a Betascope 603 Blot Analyzer (Betagen, Waltham; MA). Autoradiography was conducted by placing the dried gel onto Kodak XAR5 X-ray film for 20 to 200 h in the presence of intensifying screens at -70°C. To control for unequal loading these values were normalized using a band whose intensity did not change over the concentrations of UvrA used in this experiment. A curve was best-fit to the band intensities at each UvrA concentration using non-linear least-squares analysis (Bevington, 1969). A total of 6 fitted data sets were obtained for each of 3 bands analyzed in 2 separate experiments. These fitted values were normalized to give a fractional binding curve of 0 to 100% for UvrA concentrations of 0 to 200 nM. The binding isotherms were obtained by taking the mean (N = 6) of these normalized fitted data sets. The apparent equilibrium dissociation constant, Kd, was taken as the concentration of UvrA that produced 50% binding. (g) UvrABC

incision reactions

UvrABC incision reactions were performed in parallel with the DNase I footprinting reactions. Unless otherwise noted UvrABC digestions were performed by incubating varying concentrations of UvrA, 120 niw-UvrB; 110 UM-UVrC and 2 ng of 49 bp duplex (1.24 nM) in 50+1 reactions containing 50 mivr-Tris . HCI (pH 7.5); 50 mMKCl; 10 miv-MgCl,, Smiv-DTT, 2 miv-ATP, 100 pg bovine serum albumin/ml for 30 min at 37°C. The reactions were stopped by freezing in a solid COJethanol bath, lyophilized to dryness and resuspended in formamide plus tracking dyes. The samples were heated to 90°C: quickcooled on ice and a portion run on a 10% polyacrylamide sequencing gel under denaturing conditions (80 M-Urea) in a Tris-borate buffer (pH 8.0). The gel was dried and analyzed as described below. (h) Analysis

of incision

products

The amount of radioactivity in the bands corresponding to the full-length substrate and the incision products was quantified using a Betascope 603 Blot Bnalyzer (Betagen, Waltham, MA). The fraction of DNA incised by UvrABC was calculated as the fraction of radioactivity that migrated in the bands corresponding to the incision products as compared with the total radioactivity in both the full-length and the digestion

21

Cleavage Reaction

products. Autoradiography was conducted by placing the dried gel onto Kodak XAR5 X-ray film for 15 to 24 h in the presence of intensifying screens at - 70 “C.

3. Results DNA duplexes containing an AP site or a BA site at a defined location were constructed as described (Snowden et al., 1990). Briefly, a 49mer oligonucleotide containing uracil at position 26 was prepared. Subsequent treatment with uracil glycosylase resulted in the quantitative conversion of the uracil nucleotide to an AP site. Treatment with o-benzyl hydroxylamine results in a BA site. The sequence of the 49mer and the structures are shown in Figure 1. These modified oligonucleotides were labeled 5’ by standard methods and annealed to a complementary 50mer oligonucleotide. Fully duplexed substrates were purified by electrophoresis through native polyacrylamide gels. (a) DNase

I footprint

titrations

of UvrA

The UvrABC nuclease complex has been shown to incise the 49 bp duplex containing a BA site more efficiently than the 49 bp duplex containing an AP site (Snowden et al., 1990). In order to determine if this difference is due to the relative UvrA binding affinities for these lesions, quantitative DNase I footprinting studies were performed (Brenowitz et al., 1986; Van Houten et al., 1987). Footprinting reactions were carried out at varying UvrA concentrations ranging from 0 to 200 nM. Surprisingly, the concentration of UvrA at which a footprint first emerged for either AP or BA-containing DNA was quite similar (Fig. 2). For both substrates, UvrA contacts the DNA at multiple sites covering an area of 28 bp. UvrA also has similar binding affinities for the AP and BA lesions, despite the fact that incision by the UvrABC complex is quite different for the two lesions (Snowden et al., 1990 and see below). A small amount of AP-containing duplex is seen in the BA-containing control (Fig. 2, lane l), which results from a less than complete modification with BA. It should be pointed out that AP sites are unstable, resulting in strand breaks from a p-elimination reaction during heat denaturation of the samples for electrophoresis. The p-elimination product runs two to three nucleotides slower than the Maxam-Gilbert cleavage reaction for the thymidine nucleotide at position 26. The arrow, a, is the hypersensitive site indicative of UvrA binding. The bands indicated by arrows labeled b to d were those used for quantification to determine the binding isotherm shown in Figure 2(b). The apparent equilibrium dissociation constant, Kd, was determined as the amount of protein that resulted in 50% protein bound to the DNA (see Materials and Methods). This approach is valid only if the DNA concentration is lower than the apparent Kd. Reducing the DNA to half the concentration did not change the apparent Kd (data not shown). The apparent equilibrium dissociation

IUvrAJ

-

2

3

0

2

4 5

10 20 6

40

80 120 160 200 7 9 8 10AG T

C

0

11 12

13

2 14

10 15

16

20 40 17

80 18

19 20

120 160 200 nM

Initiation

of UvrABC

Nuclease

Cleavage Reaction

0

20 AvrA

4u concentration

23

50

w

(no)

80 UvrA

concentration

(nM)

( b)

Figure 2. DBase I footprint of the UvrA subunit. 5’-Labeled duplex containing a lesion was digested with DNase I in the presence of varying amounts of UvrA as indicated. (a) Lanes 1 to 10 are BA-containing duplex and lanes 11 to 20 are AP-containing duplex. Lanes A, G, T and C refer to the Maxam-Gilbert sequencing reactions for A + G, G, T + C and C, respectively. Lanes 1 and 11 are control lanes with duplex in the absence of protein and DNase I. The regions protected from DNase I digestion are indicated by brackets, Al to 4. The band resulting from strand breakage at an AP site upon heating prior to gel loading is indicated by an asterisk. A hypersensitive site indicative of UvrA binding is also shown (a+). The AP and the BA reactions were analyzed on 2 different 10% (w/v) polyacrylamide gels. (b) The binding isotherms were determined using the bands indicated in (a). The percentage bound was calculated as the quantification of the disappearance of a band due to protection of a Dru’ase I sensitive site by protein binding. For additional details on data analysis see Materials and Methods: (0) AP; (A) BA. The inset is an expanded view of the binding isotherm from 0 to 80 nM-UvrA. (&) for AP and BA lesions are remarkably similar, being 6 x lo-’ M for the AP and for the BA-containing duplex 14 x lop9 M (Table 1).

constants

(b) Binding

of the UvrA,B

complex

The binding of the UvrA,B complex was performed in parallel with the determination of UvrA binding. Interaction of the UvrA,B complex results in a footprint that is smaller than the UvrA, footprint (20 bp), contacting only two distinct regions (BI and B2, Pig. 3). As seen in Figure 3, the binding affinities of the UvrA,B complex for the AP and BA substrate are quite different. The apparent Kd for UvrAzB binding to the BA-containing DNA is 4 nM. Much higher UvrA concentrations, 80 to 120 nM, are required for similar binding to the AP-containing DNA, suggesting that the formation of the preincision UvrA,B-DNA complex is the limiting factor in the incision of the AP-containing duplex (presented below). DNase footprinting

experiments were also performed on DNA duplexes in which the label was on the non-damaged strand termini . The footprint sizes and the apparent Table 1 The apparent equilibrium dissociation constants of UvrA, and UvrA$ for AP and BA-containing DNA Apparent Substrate

equilibrium dissociation constants(K,)

UvrA,

AP

6 x 1O-9 M

BA

14 x 1om9 M

UvrA2 B 80 x 1o-9 to 120 X l@ MT 4 x 1oF M

The apparent equilibrium dissociation constants (ZQ of the UvrA protein and the UvrA,B complex for the 49 bp duplex containing either an AP or BA lesion were calculated as described in the text (see Materials and Methods). The Kd for UvrA, and UvrA,B is expressed as the concentration of UvrA as monomer. TThe binding of the UvrA,B complex to AP-containing DNA never reached saturation and therefore the Kd of the UvrA,B complex for AP-containing DNA is an approximate value.

-

-

1

IUvrAl

IUvrBl

Lane

Subunit

2

+

0 3

4 5

6 7

8

9 10

10 20 40 80 120160 200

+-l--t-+++++

2 A

G

T C

0

2 10

20 40

80120160200

11 12 13 14 15 16 17 18 19 20

-+++++++++

HIM

a --

--

-

Bl

I IAl I

Initiation

of UvrABC

Nuclease

Cleavage Reaction

25

t -t-t mtm 5’ - GACTACTTGGTACACTGACGCGAGCXCGCGGAAGCTCATTCCAGTGCGC CIj I I C,l t t 6

1;

1;

2i

i5

io

i5

t - 3’

4’0

4:

Figure 4. Summary of DNase I footprint of the UvrA and UvrAB subunits. The extent of DNA contact by the UvrA, and UvrA,B complexes (as observed in Figs 2 and 3) are shown. The filled areas indicate areas of UvrA, contact. The hatched area is an area of UvrA, binding that occurs only at high UvrA concentrations. The open bars indicate regions of UvrA,B binding. The broken lines indicate UvrA binding superimposed on UvrA,B binding. Hypersensitive sites are indicated by arrows. The sites of UvrABC incision are marked by filled triangles on the DNA helix. The DNA molecule is drawn so that each letter in the sequence corresponds to 1 bp in the double helix.

binding affinities of the UvrA, and UvrA,B complexes obtained on DNA duplexes labeled on the non-damaged strand were quite similar to those obtained using label in the damaged strand (data not shown). of UvrA, and A summary of the interaction UvrA,B with the DNA substrates is illustrated in Figure 4. The hatched areas indicate regions where UvrA binding is weaker (appears at a higher UvrA concentration) than the filled areas. The broken lines indicate UvrA binding superimposed on the UvrA,B footprint, which is seen at higher UvrA These footprints suggests that concentrations. neither of the Uvr proteins makes direct contact with the lesion. However, this observation needs to be confirmed by other chemical footprinting methods. (c) UvrABC incisions of AP and BA-containing duplexes Incision reactions done simultaneously with UvrA and UvrA,B footprinting were performed to correlate the binding of UvrA and the UvrA,B complex with the relative efficiency of incision near the two different lesions. The quantification of the incisions is shown in Figure 5. The BA-containing duplex was incised to the greatest extent (45%) with concentrations of UvrA between 20 and 40 nM. The incision efficiency decreases to 20% at higher UvrA concentrations. The AP-containing duplex was incised less efficiently than the BA substrate.

Incisions of the AP substrate increase slightly, from 2% to 19%, as the UvrA concentration increases. Interestingly, at high UvrA concentrations (greater than 80 nM), the incision efficiency for the two substrates becomes similar. This exemplifies the importance of relative subunit concentrations in various reaction conditions. (d) Inhibition

of incision

occurs with UvrA

challenge

Since high UvrA concentrations decrease the extent of incisions of the BA substrate (Fig. 5), the nature of this inhibition was further investigated. UvrA could inhibit incision in several ways including: (1) non-specific binding; (2) interference with the binding of the UvrC subunit; or (3) a competition between UvrA, and UvrA,B for the damaged site. To help to discriminate between these possibilities; high concentrations of UvrA were added t’o preformed UvrA,B complexes on the BA substrate. As shown in Figure 6, inhibition of incisions of the BA-containing duplex is seen when the BA-containing substrate is first incubated with lower concentrations of UvrA (20 nM) in the presence of UvrB, and then challenged with higher concentrations of UvrA (100 to 400 nM). DNase I footprinting experiments indicate that the addition of UvrA to the preformed preincision complex (UvrA,B-DNA) causes a change in the appearance of the preincision footprint so that the reappearance of a UvrA, footprint is evident (Fig. 6(a), lanes 10 to 12). The corresponding incision reactions are

Figure 3. DNase I footprint of the UvrAaB complex. 5’.Labeled duplex containing a lesion was digested with DNase I in the presence of varying amounts of UvrA as indicated and UvrB (120 nM). L anes l-10 are BA-containing duplex and lanes 11 to 20 are AP-containing duplex. Lanes A, G, T and C refer to the Maxam-Gilbert sequencing reactions for A + G, G, T+ C and C: respectively. Lanes 1 and 11 are control lanes with duplex in the absence of protein and DBase I. The regions protected from DNase I digestion by the UvrA,B complex are indicated by brackets, Bl to 2. The areas of contact for the UvrA subunit are indicated by broken lines Al and A4. The band resulting from strand breakage at an AP site upon heating prior to gel loading is indicated by an asterisk. The hypersensitive sites observed with UvrA binding (a-) and UvrA,B binding (b-+) are indicated.

26

A. Xnowden and B. Van No&en

IlJvrAl

Lane

1

2

10

20

40

2

3

4

5

80 120 160200 7

(al Fig. 5.

shown in Figure 6(b). Lanes 1 to 4 are the incision products that occur following the addition of UvrA at concentrations of 400, 200, 100 and 20 nM, respectively, to incision reactions (UvrB and UvrC were added simultaneously following addition of UvrA). Lanes 5, 6 and 7 show the incision products following a shift in the UvrA concentration from 20 nM to 100 nM, 20 nx to 200 nM, and 20 nM to 400 nM UvrA, respectively (UvrB and UvrC were added following the shift to high UvrA). These

results suggest that high levels of UvrA inhibit incision of the BA substrate by the eonversion of a UvrA,B footprint to a more UvrA,-like footprint, 4. IXscussion We have used quantitative DNase I footprinting titrations to measure the relative binding affinity of the UvrA subunit to two structurally related DKA lesions, an apyrimidinic (AP) site and an o-benzyl-

[UvrAl Lane1

Initiation

of UvrABC

Nuclease Cleavage Reaction

0

10 3

20

40

80

4

5

6

2 2

27

120 160 200 nM 8 9 7

b) Fig. 5 (contd).

hydroxylamine-modified AP (BA) site. The former lesion is incised rather poorly by UvrABC while the latter, BA, substrate is incised quite efficiently (Snowden et al., 1990 and this work). The data in this paper demonstrate three important aspects of damage recognition by the UvrABC complex: (1) although specificity of damage recognition is mediated by the UvrA subunit, the formation of a stable preincision complex is dependent upon the UvrA2B complex; (2) incision efficiency is not correlated to UvrA binding affinity; and (3) high concentrations of UvrA are inhibitory to efficient incision in a lesion-dependent manner. (a) UvrA as the speci$city

subunit

Quantitative DNase I footprinting indicates that the relative binding aEinity of the UvrA subunit to

both the AP and BA lesions is similar with an apparent K, of 6 x lo-’ M and 14 x lop9 M, respectively (Pig. 2 and Table 1). These results were surprising as we anticipated that the differences observed in the ability of the enzyme to incise at these lesions was a consequence of a decreased affinity of the UvrA protein to recognize the smaller AP lesion. These results have been confirmed using band-shift gel retardation assays (data to be presented elsewhere). (b) The formation

UvrA,B-DNA

of the preincision

complex

Since UvrA binding affinity was not indicative of the UvrABC nuclease incision efficiency, we sought to establish which step following UvrA binding could be correlated with the incision efficiency of the

28

A. Snowden and B. van Houten

40

80

120 UvrA

concentration

160

200

(nM)

CC)

Figure 5. The effect of UvrA concentration

on UvrABC

incisions of &%-containing

substrate. Incision reactions were performed on the BA and the AP-containing duplex with varying amounts of VvrA (as indicated), 120 nx CvrB and 110 nM UvrC. The reactions were for 30 min at 37°C and analyzed on 10% polyacrylamide sequencing gels. (a) Incisions on BA-containing duplex and (b) incisions on AP-containing duplex. Lane 1 in both panels is a control lane containing only duplex. The asterisks indicate the sites of strand breakage resulting from cleavage at AP sites due to heating the DLLA prior to gel loading. The arrows indicate the 5’ incision products in lanes 2 to 9. (c) Q uantification of the incision products. The fraction of Dn’A incised by UvrABC was calculated as t’he fraction of radioactivity that migrated in t)he bands corresponding to the incision products, as compared with the total radioactivity in both the full-length and the digestion products: (a) AP; (A) BA.

UvrABC complex. To this end the effect of UvrB on the binding affinity of the UvrA subunit was examined (Fig. 3). Qualitatively, the UvrA,B footprint is smaller than the UvrA footprint (28 bp versus 20 bp) and is shown in Figure 4. A similar change in footprint size observed in the presence of UvrB was also seen by Van Houten et al. (1987) using a psoralen-modified substrate where the UvrA, footprint was 33 bp and in the presence of UvrB decreased to 19 bp. These data and the data presented here suggest that the UvrA, and UvrA,B complexes are making direct contact with the DNA in the major groove 5’ and 3’ to the site of the lesion. Experiments with high-resolution chemical footprinting techniques will help to dissect the molecular architecture of the UvrA,B-DLC’A preincision complex. Addition of UvrB to UvrA results in a DNase I hypersensitive site (not present in the UvrA, footprint) at the tenth phosphodiester bond 5’ to the lesion. This also was observed in the psoralen studies (Van Houten et al., 1987). The change in footprint size as well as the appearance of a new hypersensitive site seems indicative of conformational changes in the nucleoprotein complex. The exact nature of these changes is not well under-

stood. This conformational change has been reported by Grossman and colleagues, who demonstrated a limited helicase activity that results in localized unwinding at the site of UvrA,B complex formation (Oh & Grossman, 1987). St,udies by Orren & Sancar (19896, 1990) suggest that the UvrA dimer dissociates once UvrB is loaded onto the DNA near the lesion and UvrA does not participate in the incision process. Since the UvrB protein has little or no affinity for DNA in the absence of UvrA, a conformational change in either the protein complex or the DKA ma,v be necessary for the formation of a stable preincision complex that contains only t’he UvrB subunit. The most interesting feature of the DNase I footprint’s of t’he UvrA,B complex are the differences that are observed between the binding of the preincision complex for an ,4P site or a BA s&e. The binding affinity of the preincision UvrA,B complex is higher for the larger BA lesion than for the AP lesion, with an apparent dissociation constant’ Kd of 4 x IOm9 X. Much higher UvrA concentrations are required to achieve similar binding on the AP-containing substrate (80 x 10e9 to 120 x 1W9 M, Table 1). This suggest,s that the abilitv of the enzyme subunit’s to achieve a. stable preinc&ion complex is different depending on the lesion.

of UvrABC

Initiation

[UvrAl [UvrB]

Lane

1

Nuclease Cleavage Reaction

400 4OO2002OOlOO + + 2

3

4

5

100 20 + -

6

7

8

29

a!$& 8 nM

20 zo\ & qp\ + -+ ‘+ -+ 9

101112

(d Fig. 6.

A decrease in the formation of a stable preincision complex could, therefore, lead to the decrease in UvrABC incision efficiency for the AP lesion. If the ability to form a stable preincision is dependent on the lesion there must be structural features of the lesion and surrounding DNA helix that determine complex stability. Although the AP and BA lesions are structurally similar, the addition of a benzyl group could result in significant alteration in the DNA helix at or near the lesion. Preliminary molecular modeling studies demonstrate that a BA lesion can not be accommodated into the DNA helix without inducing a localized bend and helix unwinding, whereas an apyrimidinic site has been

shown to induce relatively little distortion in the DNA helix (Cuniasse et al., 1987, 1990; Kalnik et al., 1989). It is also possible that the benzyl group may interact with the hydrophobic UvrB protein and somehow stabilize the preincision complex. More physical studies on the structural alterations induced by AP and BA lesions are needed to aid in the understanding of lesion-dependent, stable preincision complex formation.

(c) Inhibition High sequent

of incision

concentrations UvrABC

by high UvrA concentrations of UvrA inhibit nuclease incision

the of

subthe

A. Snowden and B. Van Nouten

30

0

[UvrAl Lane

400

200

100

20

1

2

3

4

\-dQ ,200 \pP " 2Q 9 $5 5

6

7

Fig. 6 (contd).

BA-containing that of substrates and not AP-containing substrates (Fig. 5). This inhibition of incision was observed also when high UvrA concentrations were used to challenge a preincision complex formed at low UvrA concentrations (Fig. 6). Analysis of DBase I footprinting reactions shows that challenge with high UvrA concentrations results in a UvrA,-like footprint that is superimposed on the UvrA,B footprint (Fig. 6(a), lanes 10 to 12). The data presented here demonstrate that

potential interactions of UvrA2 with the preformed nucleoprotein incision complex may lead to an inhibition of incisions as illustrated in Figure 7 (pathways I, IT and III). One possibility is that challenge with high UvrA concentrations could reverse the formation of the preincision complex and result in the conversion of a Uvr(A,)B-DXA complex to a UvrA,B-DZ\‘A complex that inhibits the binding of UvrC (I), Taken further, if UvrA, does dissociate following loading of the UvrB pro-

Initiation

50

of UvrABC

Nuclease Cleavage Reaction

31

r

1

40

T) ‘iiz

30

.E :: 0 z t z 0. 20

IO

0, 20

200

100 UvrA

concentration

400

(ntd)

Cc)

Figure 6. UvrAB binding and incision challenged with high UvrA concentrations. The BA-containing substrate was incubated with UvrA concentrations as indicated for 30 min. Portions of the reactions were then digested with DNase I, incubated with UvrB or incubated with UvrB and UvrC in an incision reaction. The portions incubated with UvrB were then either digested with DNase I or challenged with high UvrA concentration. Following challenge (30 min) the reaction was subjected to either DNase I treatment or UvrABC digestion. (a) DNase I footprinting of UvrA and UvrA,B binding. Lane 1 contains BA duplex incubated with DNase I in the absence of Uvr proteins as a control. Lanes 2 to 9 are DNase I digestions of BA substrate incubated with a single UvrA concentration and UvrB when indicated. Lanes 10, 11 and 12 are DNase I digestions of BA substrate with a preformed preincision complex (UvrA,B-DNA) challenged with high UvrA concentrations as indicated. The arrows indicate the hypersensitive sites indicative of either, a-t, UvrA binding or, b-t, Uvr(A,)B binding. (b) UvrABC incision reactions. Lanes 1 to 4 are the incision reactions in the presence of a single UvrA concentration as indicated. Lanes 5, 6 and 7 show the incision following a shift to increased UvrA concentrations from 20 to 100 nM, 20 to 200 nM and 20 to 400 nM. The 5’ incision products are indicated by an arrow. (c) Quantification of incisions. The amount of radioactivity in the bands corresponding to the full-length substrate and the incision products was quantified. The percentage of DNA incised by UvrABC was calculated as the fraction of radioactivity corresponding to the incision products as compared with the total radioactivity in both the full-length and the digestion products. Filled bars, incisions following addition of UvrA to preformed preincision complexes. Open bars, incisions at UvrA concentrations as indicated.

tein onto the damaged DNA as suggested by Orren & Sancar (1989b), and if this dissociation is reversible, then it might be expected that high UvrA concentrations could drive the UvrB off the DNA to form the UvrA,-DNA complex (II). A third possibility is that the inhibition is due to non-specific UvrA interactions with the substrate (III). While this third possibility cannot be completely ruled out, the reappearance of the specific UvrA, footprint with higher UvrA concentrations suggests a specific interaction (Fig. 6). Orren & Sancar (1989b, 1990) have reported that high UvrA concentrations may inhibit the UvrA loading of UvrB onto the DNA. Their data, taken together with our data that show the reappearance of the UvrAz footprint, indicate that the inhibition of incision is probably due

to the competition for binding to the damage site between UvrA, and UvrA,B. The inhibition of incisions on the BA-containing substrate at high UvrA concentrations can be abolished by increasing the salt concentrations in the reaction from 50 mM to 150 mM-KC1 (data not shown). Higher ionic strength buffers have been shown to decrease the specific binding of UvrA (Seeberg & Steinum, 1982; Yeung et al.,. 1983; Kalinowski & Van Houten, unpublished results). Consequently, higher ionic strength buffers may lead to a decrease in the interaction of UvrA with Alternatively, the preformed incision complex. higher salt concentrations may lead to less competition for substrate binding by UvrA,, as compared with the UvrA,B complex.

A. Bnowden

32

and B. Van Ho&en

A* +B A2+S

A,S

+ B

III. A, + NS Figure 7. Potential interactions of Uvra with the preincision complex that lead to inhibition of incision. This Figure illustrates the interactions of UvrA, with the preincision complex that may lea,d to inhibition of incisions. 8,, UvrA protein dimer; B, UvrB protein; S, damage-containing DNA substrate; C, UvrC protein; P, incision products: NS, nonspecific binding. UvrA can interact with the DNA fragment containing the substrate in at least 3 different ways. Pathway I illustrates the formation of a UvrA,B complex that binds specifically to the substrate DNA to form the preincision complex. In pathway II; the formation of the preincision complex occurs by CTvrA, binding to the DNA followed by the binding of UvrB to the UvrA,-DNA complex. This then results in the forma,tion of the preincision complex (A,)BS as in pathway T. UvrC may then bind to this preincision complex and incisions result, (P). The 3rd to the DNA. The sites at which UvrA could interact to pathwa,y (III) demonstrates UvrAz binding non-specifically 0, @ and 0. For additional details, see the text. inhibit incision are indicated,

In

conclusion,

recognition,

although

we

demonstrate mediated

by

that the

damage suband that the UvrA

unit, appears to be lesion-independent, stability of the UvrAzB preincision complex is a determining factor in the extent of the incision process. It thus appears that the incision efficiency of the UvrABC nuclease complex is not correlated with UvrA binding affinity. Finally, it is shown that high UvrA concentrations are able to inhibit the incision efficiency in a lesion-dependent manner. We thank Dr Yoke Wah Kow for generously supplying uracil glycosylase, and Dr Yoke Wah Kow, Dr Nick Heintz and Dr Sriram Krishnaswamy for helpful discussions and critical comments, and Judy Kessler for the artwork. This work was supported in part by the Associates in Pathology and A.S. is supported by Predoctoral Environmental Pathology Training Grant ES07122-09.

References P. R. (1969). Data Reduction and Error Analysis for the Physical Sciences, McGraw-Hill, New

Bevingt,on,

York. Brenowitz, M., Senear, D., Shea, MM. & Ackers, G. (1986). Footprint titrations yield valid thermodynamic isotherms. Proc. Nat. Acad. Sci., U.S.A. 83, 8462-8466. Caron, P. R.; Kushner, S. R,. & Grossman, L. (1985). Involvement, of helicase II (uvrD gene product) and DN$ polymerase I in excision mediated by the UvrABC protein complex. Proc. Nat. Acad. Sci.,

U.S.A. 82, 4925-4929. Cuniasse, Ph., Sowers, L. C., Eritja, R., Goodman M. F., Cognet, J. A. H., Lebret, M., Guschlbauer, W. & Fazakerley, G. V. (1987). An abasic sit,e in DNA. Solution conformation determined by proton NMR

and molecular mechanics calculations. Xucl. d&a Res. 15; 8003-8022. Cuniasse, Ph.; Fazakerley, G. V., Guschlbauer, l’c’., Kaplan, B. E. & Sowers, L. C. (1990). The abasic site as a challenge to DNA polymerase. A nuclear magnetic resonance study of C. C and T opposite a model abasic site. J. MOE. Biol. 213. 303-314. Duncan: B. K. & Chambers. J. A. (1984). The cloning and overproduction of E. coli uracil-DNA g!ycosylase. Gene, 28, 211-219. Grossman, L. 85 Yeung, A. T. (1990). The UvrABC endonuclease of Escherichia coli. Photochem. Photobiol. 5 1, 749-755. I., Van Houten. B., Thomas, D. C., Husain, Abdel-Monem, M. & Sanca.r, A. (1985). Effect of DNA polymerase I and helicase II on the turnover rate of UvrABC excision nuclease. Proc. Nat. Acad. Sci.,

U.S.A. 82, 6774-6778. Husain, I., Griffith; J. & Sancar, A. (1988). Thymine dimers bend DNA. Proc. Nat. Acad. Sci., U.S.A. 85, 25582562. Kalnik, M. W., Chang, C-N.. Johnson, F.. Grollman. A. P. & Patel, D. J. (1989). NMR studies of abasic sites in DNA duplexes: deoxyadenosine st#acks into the helix opposite acyclic lesions. Biochemistry. 28. 3373-3383. Kow, Y. W., Wallace, S. S. & Van Houten, B. (1990). UvrABC n&ease complex repairs thymine glycols, an oxidative base damage. Mutat. Res. 235, 147-156. Lindahl, T., Ljungquist, S., Siegert, W., Nyberg, B. & Sperens, B. (1977). DNA N-glycosidase. Properties of aracil-DNA glyeosidase from E. c&i. J. Biol. Chem. 252, 328G-3294. Maxam, A. M. & Gilbert, W. (1980). Sequencing endlabeled DNA with base-specific chemical cleavages.

Methods Enzymol. 65, 499G60. Oh, E. Y. & Grossman, L. (1987). Kelicase properties of the E. coli UvrAB protein complex. Proc. Nat. Acad, Sci., U.S.A. 84, 3638-3642. Oh, E. Y. & Grossman, L. (1989). Characterization of the helicase activity of the E. coli UvrABprotein complex. J. Biol. Chem. 244, 1336-1343.

Initiation

qf

UvrABC

Nuclease

Oh, E. Y., Claasen, S., Thiagalingam, S., Mazur, S. & Grossman, L. (1989). ATPase activity of the UvrA and UvrB protein complexes of the E. coli UvrABC endonuclease Nucl. Acids Res. 17, 41454159. Orren, D. K. & Sancar, A. (1989a). Subunits of ABC excinuclease interact in solution in the absence of DNA. UCLA Syrnp. Mol. Cell Biol. 83, 87-94. Orren, D. K. & Sancar, A. (1989b). The (A)BC excinuclease of E. coli has only the UvrB and UvrC subunits in the incision complex. Proc. Nat. Acad. Sci., U.S.A. 86, 5237-5241. Orren, D. K. & Sancar, A. (1990). Formation and enzymatic properties of the UvrB-DNA complex. J. Biol. Chem. 265, 15796-15803. Sambrook, J., Fritsch, E. F. C Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, vol. 3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sancar, A. & Sancar, G. (1988). DNA repair enzymes. Annu. Rev. Biochem. 57, 29-67. Sancar, A., Thomas, D. C., Van Houten, B. & Husain, I. (1987). Purification and properties of ABC excision nuclease and its utilization in detecting bulky DNA Repair: A Laboratory Manual of adducts. DNA Research Procedures (Freidberg, E. C. & Hanawalt; P. C., eds), vol. 3, Marcel Dekker Inc., New York. Seeberg, E. & Steinum, A. L. (1982). Purification and properties of the UvrA protein from E. co&. Proc. Nat. Acad. Sci.,

U.S.A.

79, 988-992.

Sherman, S. E. & Lippard, S. J. (1987). Structural aspects of platinum anticancer drug interactions with DNA. Chem. Rev. 87, 1153-1181. Edited

Cleavage Reaction

33

Snowden, A., Kow, Y. W. & Van Houten, B. (1999). Damage repertoire of the E. coli UvrABC nuclease complex includes abasic sites, base-damage analogues and lesions containing adjacent 5’ or 3’ nicks. Biochemistry,

Van Houten,

29, 7251-7259.

B. (1990). Nucleotide

E. coli. Microbial.

excision

repair

in

Rev. 54, 18-51.

Van

Houten, B. & Sancar, A. (1987). Repair of N-methyl-N-nitronitrosoguanidine DNA damage by ABC excision nuclease. J. Bacterial. 169, 540-545. Van Houten, B., Gamper, H., Hearst, J. E., Holbrook, S. R. & Sancar, A. (1986). Action mechanism of ABC excision nuclease on a DNA substrate containing a psoralen cross-link at a defined position. Proc. Nat. Acad. Sci., U.S.A.

83, 80758083.

Van Houten, B., Gamper, H., Sancar, A. & Hearst, J. E. (1987). DNase I footprint of ABC excinuclease. J. Biol. Chem. 262, 13180-13187. Voigt, J. M., Van Houten, B., Sancar, A. & Topal, M. D. (1989). Repair of 06-methylguanine by ABC excinucJ. Biol. Chem. 264, lease of E. coli in vitro. 5172-5176. Walter, R. B., Pierce, J., Case, R. & Tang, M-S. (1988). Recognition of the DNA helix stabilizing anthramycin-N2 guanine adduct by UvrABC nuclease. J. Mol.

Biol.

203, 934-947.

Yeung, A. T., Mattes, W. B., Oh, E. Y. & Grossman, L. (1983). Enzymatic properties of purified E. coli UvrABC proteins. Proc. Nat. Acad. Sci., U.S.A. 80, 6157-6161.

by R. Schleif