Initiation, processing and termination of ribosomal RNA from a hybrid 5 S ribosomal RNA gene in a plasmid

J. Mol. Biol. (1983) 168, 525-561

Initiation, Processing and Termination of Ribosomal R N A from a Hybrid 5 S Ribosomal R N A Gene in a Plasmid J()ZSEF SZI.]BERIi]NYI~" AND DAVH)

APmmx:~

Department of Microbiology and Immunology Washington University School of Medicine St Lot~is, Mo. 63110, t ( S . A . (Received 4 Jan~tary 1983) Transformation of an RNA-processing m u t a n t (me, RNase E - ) of Escherichia coil with a recombinant plasmid containing the promoter region of the ribosomal cluster rrnA and portions from the 3' region of the rrnD cluster results in the accumulation of the precursors to 5 S ribosomal RNAs at the permissive as well as t h a t of two fldl-length transcripts and a processing intermediate at the nonpermissive temperature. The two full-length transcripts s t a r t fl'om the two rrnA promoters, which am about 120 nucleotides apart. This plasmid, pJR3A, contains an intact 5 S rRNA gene and portions from the 16 S and 23 S rRNA genes. Analysis of the major plasmid-specific RNA species revealed t h a t RNA molecules initiated in vit,o from the first promoter (P1) s t a r t with pppA, while transcripts from the second promoter (P2) contain either pppG or pppC at their 5' ends. Termination occurs mainly at the first available termination site. Fulllength transcripts initiated from both promoters are processed to precursors of 5 S rRNAs in ~;i~,o at the permissive temperature, but only about 20% of these transcripts are processed to mature 5 S rRNA. RNA1 and RNA2 (the transcripts initiated from PI and P2, respectively) and RNA3 (an RNA-processing intermediate containing the entire 5 S region and the 3' end of the transcripts) can be cleaved in vitro by cell extracts of wild type strains resulting in precursor and mature 5 S rRNAs in a reaction t h a t is RNase E dependent but n o t ribosome dependent. The 5' end of the processed 5 S r R N A can correspond to the 5' end of mature 5 S rRNA or it can contain one to three additional nucleotides.

1. Introduction A n a l y s i s o f r i b o s o m a l R N A p r o c e s s i n g in v a r i o u s m u t a n t s o f Escherichia coli i n d i c a t e d t h a t p r o c e s s i n g o f 5 S : ' R N A is i n i t i a t e d b y t h e e n z y m e R N a s e E , w h i c h c l e a v e s t h e n a s c e n t r R N A t r a n s c r i p t in t w o p o s i t i o n s , one b e f o r e a n d one a f t e r t h e 5 S r R N A . I n s t r u m e n t a l in t h e s e s t u d i e s w e r e t h e a n a l y s e s o f R N A m e t a b o l i s m in a n rne m u t a n t in w h i c h t h e e n z y m e R N a s e E is t h e r m o l a b i l e ( G h o r a & A p i r i o n , 1978: M i s r a & A p i r i o n , 1979,1980: S i n g h & A p i r i o n , 1982; R o y et al., 1983). O n e o f t h e p r o b l e m s e n c o u n t e r e d in t h e s e s t u d i e s r e s u l t e d f r o m t h e f a c t t h a t t h e ? Permanent address: Department of Bio!ogy, Medical School, P~cs. Hungary. Please address reprint requests and any other inquiries to this author. 525 0022-2836/83/230525-37 $03.00/0 V Academic Press Inc. (London)Ltd.

526

J. SZEBERI~NYI AND D. APIP~ION

r R N A is derived fi'om seven gene clusters (Kenerley et al., 1977 ; Kiss et al., 1977 ; Boros et al., 1979: Morgan et al., 1980) and there is considerable heterogeneity a m o n g them, especially toward the 3' end of the rrn clusters, following the 5 S r R N A genes. While some of the clusters contain transfer R N A s after the 5 S r R N A gene, others do not (Morgan et al., 1980). Since R N a s e E cleaves in this region of the r R N A transcript, this problem had to be considered, and indeed in the rne m u t a n t a v a r i e t y of R N A precursors were identified, all of which contain 5 S r R N A but only some of which contain distal t R N A s (Ghora & Apirion, 1978 ; R a y et al., 1982; Singh & Apirion, 1982). I n order to simplify the analysis of r R N A metabolism in an rne m u t a n t , it would have been useful to follow the products of 5 S r R N A from a single gene. This was accomplished in the studies reported here by s t u d y i n g a strain containing a plasmid t h a t carries only one 5 S r R N A gene. The gene was preceded b y an r R N A p r o m o t e r from the r r n A cluster and followed b y an R N A t e r m i n a t o r from the rrnD cluster. The studies reported here revealed certain expected and some unexpected features. We found t h a t the rrnA p r o m o t e r is a complex double p r o m o t e r in vivo, the R N A from the first initiator starts with p p p A and the R N A from the second initiator starts 120 nucleotides d o w n s t r e a m with either pppC or pppG. Such a possibility was indicated previously from studies reported by Lund & Dahlberg (1979). F r o m a n u m b e r of possible terminators, the m a j o r t e r m i n a t i o n in vivo occurred a t the first possible t e r m i n a t i o n site. The t e r m i n a t e d R N A contains a stem and a loop structure. The R N A produced from this mini r R N A gene was processed to p 5 t r R N A by R N a s e E in vivo and in vitro and to 5 S (m5) b y a n o t h e r enzyme(s). The last reaction(s) t h a t produces a rugged 5' end of 5 S r R N A could be d e m o n s t r a t e d in vitro. Surprisingly, a n o t h e r region of the t r a n s c r i p t t h a t resembles to a certain e x t e n t the sequence around the 5' end of 5 S r R N A was also processed in vitro in the same fashion, leading to four final products, each one nucleotide larger t h a n the previous m e m b e r in the series. 2. Materials a n d M e t h o d s

(a) Bacterial strains Strain N5706 was derived fl'om strain N3438 (rne-3071, rpsL (strr), his29, trpA9605, recA, lac) by transformation with the recombinant plasmid pJR32 (a gift fi'om Dr W. M. Holmes) according to the method of Cohen et al. (1972). The derivation of the plasmid is described in the Appendix (see also Fig. 13). Strain D10 was described by Gesteland (1966). Strain X5510 is an rne + strain that contains 1 extra rne + gene. (b) A nalytical .~cale labeling of cells and electrophoretic fractionation of RNA Cultm'es were grown at 37~ in a low phosphate medium. When the absorbance at 560 nm was 0"25, portions of the cultures were transferred to 43~ and incubated for 20 min. The cells were then labeled with 32P i (100 t~Ci/ml) for 60 min. The cells were opened t Abbreviations used : 1)5. precursor to 5 S rRNA : m5, mature 5 S rRNA : PEIC. polyethyleneiminecellulose.

RIBOSOMAL RNA P R O ( ' E S S I N G

527

and fractionated in a 5%/8% tandem polyacrylamide gel (17"0cm x 12"0 cm x0-15 cm) containing 8 M-urea: for further details, see Gegenheimer et al. (1977). (c) Isolation and purification of plasmid-specific R N A s (',ells fi'om strain N5706 were grown in 3 ml of low phosphate medium at 37~ and at A56o ~0"25 the culture was transferred to 43~ Labeling with 32p i (2 to 3 mCi/ml) was performed after 20 min at 43~ and the cells were incubated at this temperature for another 60 rain. Labeling was stopped by adding 2 vol. ice-cold stop solution (80% (v/v) ethanol containing 0-1% (v/v) diethyl pyrocarbonate, 3 mM-aurintricarboxylic acid and 1% (v/v) dimethyl sulfoxide) and cells were harvested by centrifugation at 4~ for 10 min at 1500g. The pellet was suspended in l ml of lysis buffer (20 mM-Tris-HCl (pH 7"4), 10 mMNa2EDTA, 20% (v/v) glycerol, 1% (w/v) sodium dodeeyl sulfate, 4mM-diethyl pyrocarbonate, 0"01% (w/v) bromphenol blue) and heated for 3 rain at 100~ Samples were subjected to electrophoresis in a 5%/8% preparative tandem polyacrylamide gel (17"0 cm x 12"0 cm x 0"3 cm) containing 8 M-urea. Plasmid-specific RNA bands were excised from the gel, after a wet autoradiography, and subjected to further purification. High molecular weight RNAs (RNA1 and RNA2, see Fig. l) were rerun first in a 5% polyacrylamide preparative gel containing 7 M-urea, then in a 10% gel containing 7 M-urea and finally in a 12% gel. RNA3 was rerun in a 10% gel containing 7 M-urea, followed by reelectrophoresis in a 12% gel containing 7 M-urea and finally in a 15% gel. Purified bands were excised, eluted, precipitated with ethanol and washed as described by Gurevitz et al. (1982), except that yeast RNA (10 ~g/ml) was used as carrier. (d) Isolation of p5 rRNAs Strains N3438 and N5706 were grown and labeled with 1 mCi 32pi/ml either at 37~ or at 43~ and the cells were handled as described in section (c), above. RNA4 (corresponding to 5 S rRNA) was excised fl'om the first preparative gel (5%/8% gel containing 8 M-urea), eluted and precipitated. When necessary, a further electrophoretic purification step was performed in a 20O/o polyacry[amide gel.

(e) Structural analysis of labeled RNAs RNA samples (10 s to 2 x l 0 S e t s / m i n ) were digested with RNase T l and the oligonucleotides were separated by the minifingerprinting method of Volekaert et al. (1976) with the modifications described by Gegenheimer & Apirion (1978). Tl-generated oligonucleotides were eluted from the polyethyleneimine-cellulose plates digested with pancreatic RNase and analyzed as described by Volckaert &Fmrs (1977). When necessary, the eluted oligonucleotides were also digested with RNase T 2 or nuclease Pl and the products were analyzed by 2-dimensional chromatography on cellulose plates according to the method of Saneyoshi et al. (1972) or by chromatography on PEIC plates using 1"6 MLiCl as solvent as described by Gegenheimer & Apirion (1980a). Quantitation of oligonucleotides was pei~'ormed by liquid scintillation counting. (f) Analysis of 5' termini Purified RNAs were digested with nuclease PI as described by Gegenheimer & Apirion (1980a) and the products were separated on PEIC plates, which were chromatographed with 1"6 M-LiCI as in section (e), above. In some experiments, nucleoside triphosphates were separated from nucleotides on P E I C plates using 1"25 M-LiCI as solvent, eluted and rechromatographed with 1'6 M-LiCI. When necessary, the spots were eluted and the identity of the nucleotides was confirmed by rechromatography on PEIC plates using 0"75 M-sodium phosphate (pH 3"4) as solvent, as described by Celma et al. (1977). Spots were quantitated by liquid scintillation counting.

528

J. 8ZEBERI~NYI AND D. APIRION

(g) Digestion of RNA2 with nl~clease ~'l Preparative-scale digestion of RNA2 (3'0 x l05 cts/min) with nuclease SI was pe,r in a 200-t~l reaction mixture containing l0 mu-sodium acetate (pH 4"8), 150 mM-Na(,l, 25 tLg yeast carrier RNA and 250 units of nuclease S1. The mixture was incubated at 300( ' for 60 min and terminated by the addition of 0-2 volume of a solution containing 50 mMNa2EDTA, 1% sodium dodecyl sulfate, 50O/o glycerol and 0'01~ bromphenol blue. This procedure is a modification of the method described by Shishido & Ando (1972). Nuclease Si produces 5' phosphate and 3' OH (Ando, 1966). (h) Processing of RNAs in vitro Purified RNAs (104 cts/min) were incubated in a volume of 20tLl containing 10mMTris'HCI (pH 8-0), 100 mM-NH4CI, 0'l mm-Na2EDTA, 1 mM-MnCl:, 0-1 mMdithioerythritol and 2 tLg of yeast carrier RNA. Cleavage was performed either with an $30 fraction (38 t~g of protein) prepared fi'om strain Di0 as described by Misra & Apirion (1979) or with 50/zg of protein from an ammonium sulfate precipitate (40% saturation) of the $200 fraction from strain N5510. Mixtures were incubated at 30~ for 30 min and the reaction was terminated as described in section (g), above. For preparative-scale processing, 200-~1 mixtures were used containing RNA2 (5.0x i06 cts/min) or RNA3 (106 cts/min), 25/~g of yeast carrier' YCNA and 750 tzg of ammonium sulfate-precipitated protein from the $200 fraction from strain N5510 (see above). Other reagents were used in the same final concentrations as in the analytical reactions. Incubations were for 30 min at 30~ The reactions were terminated as described in section (g). above.

3. R e s u l t s

(a) Prominent RNA species synthesized from the plasmid The r e c o m b i n a n t plasmid p J R 3 A , which arose from plasmid p J R 3 p r o b a b l y b y a recombination event, contains the p r o m o t e r region of the ribosomal gene cluster rrnA, 18 nucleotides from the gal operon and the distal p a r t of the r ~ D cluster (see Fig. 13; for the physical m a p and derivation of the p J R 3 A plasmid, see the Appendix). The plasmid contains the two p r o m o t e r s (P1 and P2) and a short segment of the 16 S gene of rrnA, tile 3' end of the 23 S gene, the 23 S-5 S spacer, a hybrid 5 S r R N A gene (see below) and the t e r m i n a t o r region of rrnD. In order to investigate the expression of this hybrid ribosomal gene cluster, we introduced the plasmid into an RNA-processing m u t a n t strain of E. coli in which the processing endoribonuclease R N a s e E is thermolabile (an ~ e strain). Since the r R N A encoded b y this plasmid does not contain a p p r o p r i a t e cleavage sites for R N a s e I I I (the double-stranded stems flanking the 16 S and 23 S r R N A sequences are missing (Bram et al., 1980; Gegenheimer & Apirion, 1980b)) and for R N a s e P (the cluster does not contain t R N A genes), the only known processing endonuclease t h a t is capable of cleaving the p r i m a r y transcript(s) is R N a s e E, the e n z y m e producing p5 r R N A from the ribosomal transcripts. Therefore, we could have expected the accumulation of full-length transcripts of the rrnA-rrnD hybrid cluster in the rne strain a t the non-permissive t e m p e r a t u r e . Figure 1 shows an a u t o r a d i o g r a m of 32prlabeled whole cell e x t r a c t from an rne strain and from the same strain t r a n s f o r m e d with the p J R 3 A plasmid, including material from the permissive (37~ and the non-permissive (43~ t e m p e r a t u r e . At 43~ in addition to the R N A species characteristic of the R N a s e E -

RIBOSOMAL RNA PROCESSING rne/pJR

rne

?. ?.

?- ?.

529

:: 2

~--3!

Fic. 1. Electrophoretic separation of RNAs from tile pJR3A-carrying transformant (N5706) and the rne host strain (N3438).~2P-labeled samples were prepared as described in Materials arid Methods and fractionated in a 5~ tandem polyacrylamide gel containing 8 ~l-urea. The 5% layer is not shown in this autoradiogram.

p h e n o t y p e (Apirion, 1978; Ghora & Apirion, 1978), four major RNAs (designated RNA1 to RNA4) accumulate in the plasmid-carrying strain: RNA1 and RNA2 are full-length primary transcripts of the hybrid r r n cluster, RNA3 is a processing intermediate, and RNA4 is 5 S r R N A (see below). The presence of the multicopy plasmid with a 5 S rRNA gene led also, as expected, to the accumulation of 5 S rRNAs (RNA4) in large amounts at permissive temperatures. The q u a n t i t y of 5 S rRNA was reduced at 43~ ; however, complete inhibition of the production of 5 S rRNA was achieved only at 45~ (data not shown). This is in agreement with previous observations (Ghora & Apirion, 1979; R a y & Apirion, 1981), t h a t the expression of the RNase E - p h e n o t y p e is less pronounced at lower temperatures.

, ...,/"

.,~.!i~

#

% ~o ~_,-, ~0 ~" o.., L / ' o ~ 0 ~ " ,.F) ,.-, :O~.,u'U 0 ,~

I

~.o oO %u~,.,,. ~0

II

l l l i III

,,

t

o

Q

,~o ~

o~

="' 0 ~90 ~

~0

i~ l

0

.oo

|

r.,o "".,,,

=0

I o n

e4

. pu~

0

~0

It

'

""''it ii i

oo ~O

o ~9o0

t

'

o '~ "0

0

,,~ C', _'2 7--, _~

~0,., ~ .~ = ~ o

'#"

II1 ~'I,

* I

~,,o

,..I,

0 2,-, e,,

- L,o,~ )^

c' 0

,.,

~O

ti ,_,

II

P

~0

1t

0 u

=o ~0

~)

RIBOSOMAL RNA PROCESSING

531

(b) Structural analysis of plasmid-specific R N A s accumulated after

RNase E is inactivated In order to characterize the RNA species accumulated in the p J R 3 d - c a r r y i n g cells at 43~ 32p-labeled RNAs were purified from strain N5706 and subjected to fingerprinting after digestion with R N a s e T l . The fingerprints of RNA1 and RNA2 are shown in Figure2. The analysis of the spots derived from RNA1, RNA2 and RNA3 are summarized in Table 1. The complete sequence of RNA1 deduced from the fingerprint analysis and from the known DNA sequence of the rrnA region (de Boer et al., 1979), the gal-fragment (W. M. Holmes, personal communication) and the rrnD region (Duester & Holmes, 1980) is shown in Figure 3. RNA1 contains all the unique oligonucleotides corresponding to a full-length transcript of the hybrid rrn cluster starting from the first promoter. The last oligonucleotide present in molar yield in RNA1 is t39 (position 738 to 744; see Fig. 3). We identified an oligonucleotide in the fingerprint of RNA1 (spot t63) t h a t corresponds to a 3' end oligonucleotide starting at position 745. However, this spot appears in a low molar yield. Therefore, we consider its presence in RNA1 to result from readthrough beyond the usual termination site {see Discussion). All the unique oligonucleotides corresponding to the sequence between the two promoters (see Figs 3 and 13) are missing in RNA2; otherwise all the oligonucleotides in RNA1 and RNA2 are identical (see Fig. 2 and Table 1). The first unique oligonucleotide in this molecule is t30b at positions 132 to 137. Therefore, we suggest t h a t this RNA is a full-length transcript of the rrnA-italrrnD region initiated from the second p r o m o t e r (see below). The only oligonucleotide t h a t appears in an approximately molar yield in the fingerprints of RNA1 and RNA2 and cannot be deduced from the DNA sequence is spot t49. Since we found this oligonucleotide consistently in our fingerprints of these RNAs but not in t h a t of RNA3, we raise the possibility t h a t it is a part of a small RNA molecule t h a t is bound tightly to the full-length transcripts between position 118 (the second promoter) and 581 (the 5' end of RNA3, see below). (After four successive electrophoretic purification steps, it is still present in the RNA preparations.) Another possibility is t h a t the presence of this oligonucleotide in RNA1 and RNA2 is the consequence of a change in the DNA sequence in the region mentioned above. However, we could not generate this oligonucleotide by a single base substitution and the probability of two or more nearby nucleotide substitutions is rather low. Moreover, we found all the oligonucleotides t h a t can be derived according to the DNA sequence. Hence, we favor the first explanation concerning the origin of spot t49 in the fingerprints of RNA1 and RNA2.

Fro. 2. Fingel])rints of (a) RNAI and (b) RNA2 fl'om strain N5706 after digestion with RNase T I. An interpretation of (a) and (b) is shown in (c} and (d}, respectively. Purified RNAs were digested with RNase T l and fingerprinted as described in Materials and Methods. The oligonucleotide numbel~ assigned to the spots are used throughout this paper. Some spots appeared in less than 1 Myield and were not numbeT~d. The 5' end of RNA2 was not detected in the fingerprint shown in (b). A detailed analysis of the spots is given in Table I.

+ + + + +

I

I +

I +++

I +

I

I

+ + + + + + + + + + + + + + + +

I +

I +

I +

I +++

I

I

I

I

I

I

I

I + + + +

I +

I ++

I

I

I

I

I

I

I

I + + + + + + + + + + +

I

+ + + + + + + + + + + + + + + + + § 2 4 7

e~

I

II I I I r l l l

~

--

~

,., ~ 7 " ~ 7 " . .~

~.. ~

r_. . r~

:.--

~

~

-

~ ' - ~ - =.

~

I

~

. ~-.,.< ~ - ,

I

I

I

I+1

I

I

I+1

I

I ++1

I

I

I

I + + + + + + 1 +

I

I

I

+1

I

I

I

I

I

I

I

I

I

I+1

I + + + + e-,

++1

I + + + + + + 1

+ + + + + + + + + + + + + + + + + + + + +

+ + + + + 1 + 1 + + + + + + +

I

I

I

I

+ + + + + + + + + + + + + + +

I

I

I

I

+

e..

r~

E

o

. ~

~

~ <

, ,.,~

~

, ~

<

k,.

~

. . . . .

~ e~

2-.

~E

~=~

.-~ ~ . _ ~

m

r~

534

J. SZEBER~NYI

~o

2o

I

PI

A N D D. A P I R I O N

~o

?o

,o

6o

?o

ACUGACACGGAACAACGGCAAACACGCCGCCGGGUCAGCGGGGUUCUCCUGAGAACUCCGGCAGAGAAAG L,,. 80 90 i00 110 120 130 lqO CAAAAAUAAAUGCUUGACUCUGUAGCGGGAAGGC~IAUUAU~CACACCCCGCGCCGCUGAGAAAAAGCGA I

I

r - - - ~ - - " .

.

.

.

.

.

9

.

$

9

I

P2 L,,. L,.

150 160 I 170 180 190 200 210 I i I AGCGGCACUGCUCULIUAACAAUIJUAUCAGACAAUCUGUGUGGGCACUCGAAGAUACGGAUUCUUAACGUC . . . . . . . . . . . . . . . . . . . . . . . . . . I ,

220 230 2qO 250 260 270 280 I I / I GCAAGACGAAAAUGAAUACCAAGUCUCAAGAGUGAACACGUAAULICAUUACGAAGUUUA~UUCUUUGAGC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 290 300 310 320 ~.0 3qO 350 GUCAAACUIUUAAAUUGAAGAGIUI.IF~AUCAUGGCUCAGAUU GAACGCUGGCGGCAGGCCU/~GCUUACUC 16

3FO 370 380 390 bOO q] 0 "20 C('CAUCCC(IPCGAGAUC~AGI'UCUCCCUGACCCUI)UAAGGGUCCUGAAGGAACGUUGAAGACGACGACGUU

S-gal

pal-25 S

~30 q"O ~FO uGO q70 qSO q90 I I I GAU~GGCCGGGUGUGU~AGCGCAGCGALIGCGUUGAGCUAACCGGUACUAAUGAACCGUGAGGCUUAACCU 23 S i

500 510 520 530 5qO 550 560 I I I I I IJACAACGCCG~AGAUGULIUUGGCGGAUGAGAGAAGAUUUUCAGCCUGAUACAGALIUAAAUCAGAACGCAG 23

S

570 580 590 600 610 620 &30 ~AGCGGUCUGAUAAAACAGA~.UUUGCCUGGCGGCCGUAGCGCGGU F~GI'C . CCACCUGACCCC_tIG t, CCGAAC 5 S

RNa,e-E- . . . . . . . . . . . . . . . . . . . . . . 5/40 650 FF0 670 G80 G90 700 I I I I I IICA(:AAGUGAAACGCCEUAGCGCCGAUGGUN3UGUGGGGUCUCCCCNII~CGAGAGUAGGGAACUGCCAGA 7ZO

72o

7,o

5S

750

C AUCAA.~AUAAAA.C.A.AA AGGCUCAGUCGGAAGAC"UGGGCCOUUUGUUUUAUCU" -. . . . . . . . . . . . . . . . . . . . . . . . . . . . .

5 S

RNose E FI(:. 3. 'File nucleotide sequence of R N A I . Tim starting points corresl)onding to tile promoters Pl and P2 am labeled with arrows. Sequences of 16 S, 23 S and 5 S rRNAs are underlined with unbroken lines. RXA2 starts fl'om tim second promoter (P2) and RNA3 starts at position 581. R N A l . RNA2 and RNA3 all terminate primarily at the same position (745). The gal-fi'agment is boxed with unbroken lines and the sequence corresponding to tim Pribnow box in the second promoter is boxed with broken lines. The nuclease S,-resistant fi'agments ( ) and the cleavage prodt, cts i~r ritro of RX~A2 and RNA3 ( . . . . . ) are underlined as indicated. The putative termination stem is overlined. The cleavage sites of RNase E are indicated by arrows after' nucleotides 580 and 706. P in position 360 stands for pyrimidine, which most likely corresponds to C (see Table l). According to the published sequences of rrnD (Brain et al., 1980: Duester & Holmes. 1980). there is a G residue in the DNA sequence corresponding to position 573 in RNA1. In our" T l fingerp,ints we did not find an oligonucleotide with a sequence of A-A-A-C-A-Gp (position 574 to 579). Instead. we identified an oligonucleotide (t44c. see Table l ) that can correspond to a sequence of A-U-A-A-A-A-C-A-G (position 57] to 579). Therefore. we concluded that the base at position 573 in the pJR3zl plasmid was A rather than G. Sequence hyphens trove been omitted fl'om the Figures for clarity.

RIBOSOMAL RXA PROCESSING

535

RNA3 contains all the oligonucleotides characteristic of p5 rRNA, including the four" different 5' end oligonucleotides (5'a, 5'b, 5'c and 5'd in Table l ; see also Fig. S). as well as those present in the 3' end region of the primary transcripts, up to position 744 (t39). This RNA represents a processing intermediate of the primary transcripts and its accumulation could be due to a partial inactivation of RNase E (see below). The distal region of an intact rrnD ribosomal cluster contains the t R N A T M gene flanked by two 5 S rRNA genes (Duester & Holmes, 1980). In the recombinant plasmid pJR3A, a 245 nucleotide long region of this part of the rrnD fl'agment was deleted. The deletion spans sequences starting in one of the 5 S genes and terminating in the second, creating a full-length 120 nucleotide long hybrid 5 S rRNA gene. The fingerprint analysis of RNAs 1, 2 and 3 support this assumption. (1) All the unique oligonucleotides corresponding to the DNA sequence between the two 5 S rRNA genes of rrnD were missing. (2) The quantitation of the spots of a T 1 fingerprint fl'om RNA1 did not give any sign for the presence of two 5 S rRNA sequences in the transcript. The average 32p cts/min values per nucleotide of unique oligonucleotides present and absent in 5 S rRNA were similar'. (3) There are three differences in the sequence between the two 5 S rRNA genes in the rrnD

Cp AUp ACp AAAACp

AAAUp "U

AAAAGp

j Ist

FI(:. 4. Analysis of oligonucleotide t61 derived fl'om R.NA3 after T l fingerprinting. The spot was eluted fl'om the PEI(' plate, digested with RNase A and subjected to chromatography in 2 dimensions (see Materials and Methods).

536

./. S Z E B E R ~ N Y I AND D. A P I R I O N

cluster: a t positions 3, 12 and l l 7 (corresponding to positions 586, 595 a n d 700 respectively, in the sequence in Fig. 3). I n the first 5 S r R N A gene these bases are C., C and G, and in the second t h e y are T, A and A. T h e fingerprint o f R N A 3 (see Table l) contains the oligonucleotide tl 5 (C-C-U-Gp, c h a r a c t e r i s t i c o f the first 5 S r R N A gene), b u t n o t the oligonucleotide U - C - U - G p t h a t could have been originated fi'om the second 5 S r R N A gene. Thus, the base at position 586 is C r a t h e r t h a n U. F r o m this, we conclude t h a t the 5' end o f the 5 S r R N A gene in p J R 3 A is derived fi'om the first 5 S r R N A gene o f rrnD. T h e p a n c r e a t i c analysis of s p o t t61 of R N A 3 revealed the presence of the dinucleotide A-C in this oligonucleotide (see Fig. 4). Thus, this oligonucleotide c o n t a i n s the 3' end region o f a 5 S r R N A sequence characteristic o f the second 5 S r R N A gene (A-C-A-U, ~ , e r s ~ s C-A-U in the flint 5 S r R N A gene: positions 700 to 703. Fig. 3). Since the Tt

pN-

pppC _ pppA-

pp ~

pppGOrigin-

A

p~pC

PI A .~

B

y C

POP

p G D

FI(:. 5. 5' end analysis of RNA1 (tracks A and (') and RNA2 (tracks B and D). 32P-labeled RNAs (10s cts/min) were digested with nuclease Pl and analyzed by thin-layer chronmtograT)hy on PEI(' plates. Chromatography was performed either with the whole digests (tracks A and B) or with nueleoside triphosphates (tracks (' and D) separated from the mononucleotides as described in Materials and Methods. Unlabeled 5'-nucleoside triphosl)hates were used as internal markers. The quantitation of a similar experiment to that shown here is presented in Table 2.

RIBOSOMAL RNA PROCESSING

537

TABLE 2

Quantitation of 5' termini of RNA1 and RNA2 RNA species

5' end

Corrected ets/min

RNAI RNA2 RNA2

pppA pppG pppC

328 216 163

% of total radioactivity in RNA Observed Expected 0"39 0.22 \ 0-[6 i

0-40 0.48

5'-Nucleoside triphosphates were isolated after nuclease PI digestion of RNA1 and RNA2 as described in the legend to Fig. 5 and in Materia|s and Methods. (Cultures were labeled with 32Pi at 43~ for {50min.) The radioactivity of the excised spots, nucleoside triphosphates and monophosphates (see Fig. 5) was determined and corrected using appropriate portions from the same PEIC plate (the backgrounds ranged from 30 to 50 cts/min). The length of RNAI and RNA2 was assumed to be 750 and 63() nuc]eotides, respectively (see Fig. 3).

fingerprint of RNA3 does not contain the spot t6a (C-A-Gp) in a molar yield, but contains t5 (C-C-Gp), the base at position 595 is more likely C (from the first 5 S rRNA gene) than A (from the second 5 S rRNA gene). In brief, the structural analysis of RNA3 led us to the conclusion t h a t the crossing over between the two 5 S rRNA genes occurred somewhere between positions 12 and 117 in the 5 S rRNA sequence (corresponding to positions 595 and 700, respectively, in the sequence in Fig. 3). (4) The cleavage of RNA2 and RNA3 in vitro resulted in hybrid p5 molecules containing C, C and A at positions 3, 12 and l l 7 , respectively (see below).

(c) rRNA from rrnA initiates in any one of three positions The structural analysis of RNA1 and RNA2, presented above, made it very likely t h a t these RNAs were initiated from the two promoters of the rrnA gene cluster. To find out all the possible 5' ends of these two RNAs, they were incubated with nuclease P1 and the digestion products were separated on P E I C plates (Fig. 5 and Table 2). We can see from Figure 5 that, in addition to the nucleoside monophosphates, the digest of RNA1 contained pppA (lanes A and C). This result was expected, since we identified an oligonucleotide in the T1 fingerprint of R N A I , pppA-C-U-Gp (t56 in Fig. 2 and in Table 1), which corresponds to the 5' end of RNA1. The nuclease P1 digestion of RNA2 resulted in the appearance of two 5' triphosphates, pppC and pppG (lanes B and D in Fig. 5). The percentage of RNA molecules starting with 5' nucleoside triphosphate was estimated from counting the amounts of radioactivity appearing in the nucleoside monophosphate and nucleoside triphosphate regions of the chromatogram (Fig. 5 and Table 2). We found t h a t in the case of RNA1, almost all the molecules started with adenosine triphosphate, while in the case of RNA2 about 460/0 of the molecules initiated with guanosine triphosphate and 33% with cytosine triphosphate. On the basis of these observations we conclude t h a t the initiation from the second promoter is heterogeneous, the most likely starting points being position l l 8 for pppC and 121 for pppG (see Fig. 3 and Discussion).

538

J. S Z E B E R ] ~ N Y I

A N D D. A P I R I O N

While we did find the oligonucleotide pppA-C-U-Gp in the T1 fingerprint, we did not find the oligonucleotides pppGp and pppC-CI-3 Gp. Either they appeared in low levels or they are not included in the region of the PEIC plate that was analyzed. This could have resulted if these oligonucleotides did not leave the origin in the first dimension of the separation, or if they moved relatively slow or fast with respect to the bulk of the oligonucleotides.

(d) The termination stem and another nuclease Srresistant fragment A common feature of rho-independent termination regions, already sequenced in E. coli, is a dyad symmetry before the termination site resulting in the formation of a hairpin structure at the 3' end of the transcript (for reviews, se~ Adhya & Gottesman, 1978; Rosenberg & Court, 1979; Platt, 1981). From the fingerprint analysis of RNA1 and RNA2 (Fig. 2 and Table 1), we already knew that these RNAs could contain termination stems. However, since the last detected nucleotide (excluding readthrough, see above) was the G nucleotide 744 in oligonucleotide t39, we did not know exactly where the molecules terminated. In order to determine the point of termination in the rRNA transcribed from the pJR3A plasmid, the termination stem of RNA2 was isolated after digesting the

TABLE 3

Composition of T~ oligonucleotides from nuclease Srresistant fragments of RNA2 Spot number

Composition

Suggested sequence

Gp (A-C, U)Gp (('2, U)A-Gp (C2, U 4 ) G p pA-A-C,A-A-A-A-Gp pA-Gp pGp (C, U}XoH

Gp A-C-U-Gp C-U-C-A-Gp C-C-U-U-U-U-Gp pA-A-C-A-A-A-A-Gp pA-Gp pGp U-C-GoH

Gp A-Gp U. Gp A-A-Gp (A-C, A-U)Gp (C2, A-C, U ) G p (C'2, U2)A-A-Gp A-A-A-A-U,Gp (C, A-C,A-A-U)A-A-Gp pGp pU, Gp (A-C, A-A-C)XoH ((', U, A - U ) X o H

Gp A-Gp U-Gp A-A-Gp A-U-A-C-Gp C-A-C-U-C-Gp U-C-U-C-A-A-Gp A-A-A-A-UGp A-A-U-A-C-C-A-A-Gp pGp pU-Gp A-A-C-A-C-GoH A-U-U-C-Uoa

Fragment (a) tl t17

t25b t39

5'a 5'b 5'e 3'

Fragment (b) tl

t3 t4 t7 t26b t30a t37 t38a

t44b 5'a 5'b 3'a 3'b

RNA2 was digested with nuclease $1, the 2 resistant fragments were purified and digested with RNase T l and the oligonueleotides were further analyzed with RNase A and RNase T2, when necessary (for further details see the text and Figs 6 and 7). Spot numbers are as in Fig. 2 and Table I.

RIBOSOMAL

RNA PROCESSING

539

(a )

D

1St = (~5'a I

0(2) 5 c 39

1

o5'b

"~

C~25b

9 1 1

(b)

q~

Fro. 6. RNase T 1 fingerprint of the nuclease Si-resistant fragment (a) of RNA2. Purified RNA (3 x l0 s cts/min) was digested with nuelease S I as described in Materials and Methods and the products were fraetionated in a 5%/15% tandem polyacrylamide gel. Two major bands (designated (a) and (b); see also Fig. 7) were excised, eluted and precipitated with ethanol. T l fingerprinting was performed as described in Materials and Methods. The numbers of the oligonucieotides are according to Fig. 2. An interpretation of (a) is shown in (b). Fro" further details, see the text. The detailed analysis is shown in Table 3.

540

J. SZEBERl~NYI AND D. APIRION

RNA with nuclease S 1. After the incubation of RNA2 with nuclease $1, two fragments persisted: (a) the smaller, a b o u t 35 nucleotides and (b) the larger, a b o u t 60 nucleotides. Each of these two fragments was purified and digested with RNase T1 and fingerprinted. The structural analysis of fragment (a) shows t h a t it corresponds to the termination stem. I t consists of two pieces, one from position 711 to 727, and the other from position 730 to 745 (Fig. 3). I t is compatible with a double-stranded structure starting with A at position 712 (oligonucleotide 5'a) and ending with Uon at position 745 (see Fig. 3). The most distal T 1 oligonucleotide in the termination stem (fragment (a)) is t39 from 738 to 744. Since we did not find a spot t h a t corresponded to an oligonucleotide beyond this site, we assume t h a t the last nucleotide in the nuclease Sl-resistant stem is Uon at position 745. The fact t h a t A in position 712 is p a r t of the stem suggests t h a t it base-pairs with the U in position 745. A in position 711 is resistant to nuclease $1 digestion because it is n e x t to a stem. Besides the major 5' end oligonucleotide (5'a in Fig. 6 and Table 3), the fingerprint of fragment (a) contains two other 5' end oligonucleotides

Q 9

P (OI

5'b

.,,,.

05'a

38a044b

1st

0 37 ~

C) 30a

C226b

i::: c,4

07

4

(b)

c2)

Q3

3'b

o

3b

Fro. 7. RNase T~ fingerprint of nuelease Sl-resistant fragment (b) of RNA2. For further details, see the legend to Fig. 6 and the text. The detailed analysis is shown in Table 3.

RIBOSOMAL RXA PROCESSING

541

(5'b and 5'c) as well as a 3' end oligonucleotide. The presence of these spots represents cleavages in the single-stranded loop after nucleotides 727,729 and 730, giving rise to oligonucleotides U-C-GoH (3'); pA-Gp (5'b) and pGp (5'c), respectively (see Fig. 3). Thus, it is clear that the rRNA synthesized from the pJR3zl plasmid terminates mainly in a single point at the first possible termination site. Another region of RNA2 that was resistant to nuclease Sl was also isolated and characterized. The T 1 fingerprint of this fragment (designated $1 fragment (b)) is shown in Figure 7 and the analyses of the T 1 oligonucleotides are summarized in Table 3. Fragment (b) contains sequences from the leader region of rrnA which, in the primary transcript of an intact rrnA cluster, is involved in the formation of the double-stranded stem flanking the 23 S rRNA (Bram et al., 1980; Gegenheimer & Apirion, 1980b). Like Sl fragment (a), it consists of two pieces, one from position 178 to 203, and the other from 218 to 250 (see Fig. 3). However, these two fragments do not contain obvious complementary regions (no more than 5 uninterrupted bases). Therefore, these Sl-resistant sequences could not form an authentic double-stranded structure in RNA2. The nuclease S~ resistance of this region of RNA2 could be the consequence of an unusual tertiary structure.

(e) Processing in vivo of rRNA from the plasmid Although the rRNA transcripts of the pJR3A plasmid are abnormal RNA molecules, as compared to rRNA transcripts from a whole rRNA gene cluster, the RNA-processing machinery of the cells is capable of processing them into p5 and, less efficiently, into m5 rRNA. This conclusion is based on the accumulation of 5 S rRNAs (RNA4 ; which consists of p5 and m5) and on the lack of accumulation of precursor molecules (RNA1, RNA2 and RNA3) in the plasmid-carrying cells labeled at 37~ (see Fig. 1). The inhibition of RNase E activity at 43~ reduced the amount of 5 S rRNAs and led to the accumulation of the precursors (RNAs 1, 2 and 3). The appearance of RNA3 at 43~ might be a consequence of partial inhibition of RNase E activity. RNA3 contains the entire p5 sequence and the terminator region of the transcripts (see above and Fig. 3). Since RNA3 is still produced at a temperature (45~ at which the 5 S rRNA production is inhibited virtually completely (data not shown), the cleavage at the 5' end of p5 is still accomplished even when the processing of the 3' end of p5 rRNA is completely blocked. This means that the cleavage at the 5' end of p5 is more efficient than the cleavage at its 3' end, even though they are both introduced by the same enzyme (Apirion, 1978; Misra & Apirion, 1979). It was also observed in vitro that the first cleavage is more efficient than the second (Roy el al., 1983). In order to investigate the maturation of p5 into m5 rRNA at different temperatures, strains N3438 and N5706 were labeled at 37 ~ and 43~ and 5 S rRNAs were isolated. They were fingerprinted after digestion with RNase TI. Further analysis showed that all the 5 S rRNAs contained foul" different 5' ends. Figure 8 shows two representative fingerprints of this kind. All the 5 S rRNAs were analyzed and the four 5' end oligonucleotides were quantitated. The results

J. SZEBERI~NYI AND D. A P I R I O N

542

50a 44a 43 ql' ~ 41, 36b~ 24

C:,

260

O4

25 0 q115

o3

12 I _h _

%

Q2 ,::.b

(o)

0

.

50a e

4 4 a O 1st ~ l t 36b o 43 2 6 ~ 25,~ .e24 -o 015 12~ ~ 109 8 e7 ,a,.wr 6 31

pAUUUGp

,--,;*-, ,.-,pUGp pUUUGp 0

{b )

C'-"

4

2qllb br ~ :':.

FI(i. 8. RNase T I fingerprints of p5 rRNAs isolated fi'om N5706 cells grown (a) at 37~ ' or (b) at 430('. p5 rRNAs (RNA4 in Fig. l) were isolated, partially ptlrified and fingerprinted as described in Materials and Methods. Oligonucleotides are numbered as in Fig. 2. Spots a (A-CoH)and b (A-C-XoH) are not relevant to the 3' end of p5 rRNA (see also Figs 3 and 10. and Table 5). The quantitation of an experiment similar to that depicted here is presented in Table 4.

o f the q u a n t i t a t i o n are presented in T a b l e 4. A l t h o u g h the R N A s a m p l e s in Figure 8 were p a r t i a l l y purified, tile 5 S r R N A region eluted f r o m the first gel usually g a v e suitable m a t e r i a l for such q u a n t i t a t i o n s . While t h e 5 S r R N A s were heavily c o n t a m i n a t e d with o t h e r R N A species, the region o f the 5' end oligonucleotides of 5 S r R N A was r a t h e r clear a n d all four oligonucleotides could be identified easily b y visual inspection. I n the r n e h o s t strain (N3438), m o r e t h a n 4 0 % o f the 5 S r R N A s r e a c h e d c o m p l e t e m a t u r a t i o n (molecules w i t h p U - G p a t their 5' ends in T a b l e 4), even at 43~ On the o t h e r h a n d , t h e relative a m o u n t o f m5 was reduced in the plasmidc a r r y i n g strain (N5706) a t 37~ (23% o f t h e t o t a l 5 S r R N A ) , m o s t likely due to t h e o v e r l o a d i n g o f t h e m a t u r a t i o n s y s t e m b y t h e e n o r m o u s a m o u n t s o f p5 r R N A

RIBOSOMAL RNA PROCESSING

543

TABLE 4

Quantitation of the 5' termini of p5 rRNAs fl'om strains N3438 and N5706

Strain

Temperature (o(,)

pA-U-U-U-Gp (%)

N3438 N3438 N5706 N5706

37 43 37 43

26.4 14.] 30"0 43"5

5' end oligonucleotides pU-U-U-Gp pU-U-Gp (%) (%) 2"4 4.8 18.4 19"0

27-0 38-9 27'9 27"5

pU-Gp (%) 44.2 42-2 23'7 10.0

32P-labeled p5 rRNAs were isolated from strains N3438 and N5706 grown at 37~ and 43~ (see Fig. l) as described in Materials and Methods (60 rain labeling). RNAs were purified by a single electrophoresis in a polyacrylamide gel and fingerprinted after digestion with RNase T 1 (see Materials and Methods). Spots corresponding to the 5' ends (see Figs 8 and 10) were excised from the PEIC plates and their radioactivities were determined. The values were corrected by using appropriate blanks from the same plates. The 100% values were 1302, 720, 871 and 2392, respectively, and the subtracted background values were in tile range of 30 to 50 cts/min.

produced f r o m the plasmid a t permissive t e m p e r a t u r e s . Surprisingly, the m a t u r a t i o n of 5 S r R N A s is even less a t 43~ (10~/o), in spite of lower yields of p5 r R N A a t this t e m p e r a t u r e (for possible e x p l a n a t i o n s of this phenomenon, see Discussion).

(f) Processing in vitro of the major R N A species synthesized

from the plasmid All m a j o r precursors ( a N A l , R N A 2 and RNA3) can be processed in vitro to 5 S r R N A by the $30 fraction of wild t y p e E. coli cells or b y ' p r o t e i n from an $200 p r e p a r a t i o n (an a m m o n i u m sulfate fraction: Fig. 9). Of the three R N A species, R N A 3 was the best substrate, the yield of 5 S r R N A processed in vitro from RNA1 and R N A 2 was r a t h e r low under the conditions used {Fig. 9). Similar results were obtained using more purified p r e p a r a t i o n s of R N a s e E. With the m o r e purified enzyme, the relative efficiency of processing of a N A l and R N A 2 as c o m p a r e d to R N A 3 (7 S RNA) was even lower. T h a t indeed the processing of these R N A s to p5 was R N a s e E d e p e n d e n t was indicated clearly b y the f a c t t h a t an e x t r a c t from an rne cell failed to process all of these R N A s to p5. The TI fingerprints of 5 S r R N A s processed in vitro from R N A 2 (product 1) and from R N A 3 (product l') are similar (Fig. l0 and T a b l e 5), and correspond to fulllength 5 S r R N A molecules encoded b y the hybrid 5 S r R N A gene (see a b o v e and Discussion). Some of the oligonucleotides t h a t are relevant to the 5 S r R N A sequence are present in a low m o l a r yield in our fingerprints (spots t24, t26a and t36b). However, since all of t h e m are internal oligonucleotides in the sequence of 5 S r R N A , the low yield of these spots is p r o b a b l y due to an inefficient t r a n s f e r of these oligonucleotides from the cellulose a c e t a t e strip to the P E I C plate. O t h e r oligonucleotides (spots t8b and t25b) are n o t p a r t of the 5 S r R N A sequence, a n d are considered to be derived from a c o n t a m i n a t i n g molecule(s) t h a t a t t a c h e s

544

J. S Z E B E R I ~ N Y I

RNA I 2

RNA3

RNA 2 I

1

A N D D. A P I R I O N

34

mJ

I

789

56

V

5S

'---'3S" ,,,,,,,,,,,ram-B PB Fro. 9. Processing of RNAI. RNA2 and RNA3 in 7,ilro. Incubation of RNAs was peribrmed as described in Materials and Metbods. without enzyme (lanes I, 4 and 7), with the $30 fl'action of strain D10 (lanes 2, 5 and 8) or with tbe 40~ ammonium sulfate precipitate of $200 fl'om strain N5510 (lanes 3, 6 and 9). The products were analyzed in a 5 % / 1 0 % tandem polyacrylamide gel. BPB. brompheno] blue.

tightly to the processed 5 S rRNA molecules (oligonucleotides t8b and t25b appear in the stem; see Fig. 3). The predominant 5' end oligonucleotide of product 1 (5'a in Fig. 10(a) and in Table 5) from RNA2, as expected, corresponded to the longest form of p5, pA-UU-U-Gp. This suggests that the 5' end of product 1 was generated by the cleavage

RIBOSOMAL RNA P R O C E S S I N G

50a 440 43

5'0 -~

t

545

l st~J

elP elP elb.

36b r'~ 25 26,

. I

,;

9D

t "

-.24

lj15 10 9 8

eat

-'o c

~12 :'

"

5

04

lqlb gb

(o)

a

5'a

50a ~1~,a ,-,

26 ~..~

109

qlP4

8

24 25 ~e" " " 12 i S ~,

015

~'7

cup3

2 ~3'a

Ik

3'b

(b)

o

FI(;. 10. RNase T l fingerprints of (a) product 1 and (b) product l' processed in vitro fl'om RNA2 and RNA3. respectively. Large-scale cleavage was performed in vitro as described in Materials and Methods. The products were fl'aetionated in a 5%/10% tandem polyacrylamide gel, followed by purification in a 15% polyacrylamide gel containing 7 M-urea. Purified products were excised, eluted and precipitated with ethanol. Fingerprinting was performed as described in Materials and Methods. The same oligonucleotide assignment is used as in Fig. 2. The detailed analysis of the oligonucleotides is presented in Table 5. Spots t8, t25 and t26 in product l and 1' correspond to oligonucleotides t8b, t25b and t26a of Table 5, respectively.

w i t h R N a s e E a f t e r p o s i t i o n 580 in t h e t r a n s c r i p t (see F i g . 3). H o w e v e r , all t h e t h r e e o t h e r 5' e n d o l i g o n u c l e o t i d e s (5'b, 5'c a n d 5'd) w e r e also p r e s e n t in t h e f i n g e r p r i n t , i n d i c a t i n g t h a t t h e e n z y m e ( s ) r e s p o n s i b l e for r e m o v i n g t h e l a s t t h r e e n u c l e o t i d e s f r o m t h e 5' e n d o f 5 S r R N A is p r e s e n t in a r i b o s o m e - f r e e cell e x t r a c t a n d t h a t t h e t r i m m i n g o f t h e 5' e n d c a n be a c c o m p l i s h e d b y t h i s e x t r a c t i n vitro.

f~

o

c~ ~f

P~

p~

o

b~D

C~

q~

o

rol

I

I + 1 §

I

I

I + § 2 4 7

+ + 1 + 1 + + + + 1

I

I

:"

I+1

I + + 1 +

'<

+ + 1 + 1 + + + + 1

I

0-

I

r

"0

~ o

~

0 .--

Q

~0o0 .___'--

~ --~

"0"~

.-~

I + + 1 +

o

9 84

9

~

,

,

,

,

,

,

,

,

~

"~ ~

O;

"~ ~ ' ~ .~00

<

~o

~.~.~

,

~

o

o.,<

",-'o

~._~

~ ~

= o.-~'~"I

~.-;_~ 9-

~ o.<'~ ~ ~ ~ . - ~ ~..~ ~ 0 . ~,~ ~ "

0 ''~ ~' ~. 0 r 0 " 0

~

0

~e~ ]g

0

O'F. . . ~.,

9 P~.~ ~

~0~

548

J. SZEBERI~NYI

'.:;

"$

A N D D. A P I R I O N

o

9 O

e o

O

O

(c,)

lib s'g

5'h

w~ r

5'f

9

9

05'e 37

(,3'r

(~38a

O 26b

80 CZZ)4

1st "--I ?

44b

53

O

I

(b)

e

29 (~0 30a 013a

70

-~ c-

%6

3C2b

2

c::, 1

CZb

Fro. 11. gNase T l fingerprint of product 2 ("3 S") processed in vitro from RNA2. For details, see the legend to Fig. 10. An interpretation of the fingerprint in (a) is shown in (b). Spots t6 and t8 of product 2 correspond to oligonucleotides t6b and t8b in Table 5, respectively.

The 3' end oligonucleotides (3'a and 3'b) identified in the fingerprints of product 1 and product 1' from RNA2 and RNA3, respectively, corresponded to the sequence A-C-A-U-C-A-Aom indicating that the cleavage by RNase E was introduced three nucleotides downstream from the mature 3' end of 5 S rRNA after position 706 (see Fig. 3). The exact site of this cleavage will be determined using purified RNase E, since the cleavage by RNase E could have been followed by trimming from the 3' end. Using a different substrate (9 S RNA), it was found that RNase E introduces cleavages three nucleotides downstream and upstream from the mature 5 S rRNA sequences (Roy et al., 1983).

RIBOSOMAL RNA PROCESSING

(a)

549

(b)

Gp

Up O pUp

pep Qb

t,-

lst~ t

Cp

Cp

Up

Gp

Gp

pup e

(c)

Up

(a)

pAUp e

Fro. 12. Analysis of the 5' end oligonucleotides of product 2 obtained by cleavage of RNA2 in vitro. Spots 5'e, 5'f, 5'g and 5'h (see Fig. II and Table 5) were eluted from the PEI(! plate, digested with RNase A and analyzed by the 2-dimensional chromatography method of Volckaert & Fiers (1977). The identity of the 5' end digestion products was confirmed by incubation with RNase T 2 and subsequent chromatography using the method of Saneyoshi et al. (1972).

A n o t h e r f r a g m e n t of R N A 2 processed i n v i t r o was also purified and fingerprinted (product 2 in Fig. 11 and in T a b l e 5, designated 3 S in Fig. 9). This p r o d u c t is a 90 nucleotide long f r a g m e n t derived from the leader region of r r n A s t a r t i n g a t position 173 a n d ending a t position 262 (see Fig. 3). Most interestingly, p r o d u c t 2 contained also four different 5' end oligonucleotides (5'e, 5'f, 5'g and 5'h in Fig. 11 and T a b l e 5), which are similar to the 5' end oligonucleotides of the p5

.==

0 O~

A

q0 Om ~0

n-

u 0

Z n-

o 0

E

o-

~

o-

o~

z

E

E

c

o~

ol

Z n~

I

0 O ~

It)

0 0

"1"

~

0 O ~

o4

0

t~

0

t~ B

.o 0 0

I I

~

a.

oo_

~T

u ~L

RIBOSOMAL RNA PROf'ESSIXG

551

rRNA processed in vitro from RNA2 (Fig. 12). The 5' end oligonucleotides corresponded to pA-U-C-U-Gp, pU-C-U-Gp, pC!-U-Gp and pU-Gp (see Fig. 12). The possible significance of this finding will be discussed.

4. Discussion The experiments presented here show t h a t it is possible to construct an rRNA minigene t h a t contains intact sequences only for 5 S rRNA and t h a t transcription from such a gene is normal: initiation and termination are exactly as could have been expected. Since some of the RNA processing signals, t h a t are present in a normal rRNA gene cluster, are missing, it is significant t h a t the RNA produced from this hybrid minigene is processed properly to 5 S rRNA. This indicates t h a t the rRNA processing enzymes can work independently. I t is clear from Figure 1 t h a t the 5 S r g N A gene included in this segment of DNA is expressed at a fairly high fi'equency. The growth of the strain containing the plasmid is normal and is not in the least affected compared to the strain without the plasmid. Thus, it is clear t h a t the cloning of an rRNA p r o m o t e r and terminator, in concert, and production of large quantities of unused rRNA are not harmful in any obvious way to the cell. I t is interesting t h a t all the major RNA species accumulated in the cell in the presence of the plasmid are derived fi'om the rRNA region. This suggests t h a t either the rRNA p r o m o t e r is more efficient than the other plasmid promoters, or t h a t the rRNA is more stable than the other plasmid RNAs, or a combination of both. The experiments presented here shed some light on initiation and termination of rRNA in t,ivo, and for the first time establish processing in vitro to 5 S (m5) rRNA fi'om p5.

(a) Origin of the pJ R3A plasmid I t is clear fl'om the analysis of the rRNA transcribed from the pJR3A plasmid t h a t the transcripts contain sequences only from a single 5 S rRNA gene and no t R N A (see above). This plasmid has been derived from a plasmid t h a t contained the 5 S rRNA region of the rrnD cluster, which contains the t R N A T M gene flanked by two 5 S rRNA genes (Duester & Holmes, 1980). Assuming no rearrangement on the RNA level, we have to conclude t h a t the plasmid DNA was rearranged. Two types of rearrangements could explain the observed results: a deletion or a recombination event. The fact t h a t the remainder DNA (see Appendix) contains sequences only for one exact 5 S rRNA gene (see Results) makes the first possibility rather unlikely. Therefore, we propose t h a t an intra-chromosomal

Fl(~. 13. Map of the rrnA-gal-mtD region of tile [~IR3Zl plasmid and its transcription products. A, the rrnA-gal-rrnD region in the original plasmid: B, homologous recombination between the two 5 S rRNA genes: C. structtn'e of the rrnA-gal-rrnD region in tile deleted plasmid ; D, RNA1; E, RNA2; F, RNA3: G, RNA4: H. the major in ~,itroprocessing products of RNA2: I, tile major in vitro processing product of RNA3 : J. the major fl~tgmentsgenerated by nuclease S, digestion of RNA2. bp, base-pairs.

552

J. SZEBERENYI

A N D D. A P I R I O N

recombination event took place between the two 5 S rRNA genes (Fig. 13). As a result of such a recombination, a deletion arose. Such a mechanism can explain why the remaining 5 S rRNA gene is hybrid and why it is the precise size for a 5 S rRNA gene. Since this recombination event took place apparently in a plasmid, it is likely that it could happen in the chromosome itself. However, the fact that the E. coli chromosome does contain two 5 S rRNA genes in the r ~ D gene cluster (Duester & Holmes, 1980) suggests that there is some mechanism to suppress its occurrence.

(b) Initiation of transcription There have been only two studies on the initiation of rRNA transcription units in vivo. de Boer & Nomura (1979) used pulse-labeled RNA and selected from it sequences that hybridized to the promoter region of the rrnE gene, while Lund & Dahlberg (1979) made use of the RNase I I I - mutant and analyzed 30 S RNA that accumulates in such a mutant. Both groups concluded that rRNA transcripts from a single rRNA gene cluster initiate from two promoters, and Lund & Dahlberg (1979) also suggested that RNA from the second promoter can initiate from two nearby positions. The experiments presented here show that the r ~ A gene contains two promoters and that RNA initiated from the second promoter can start in at least two positions. The two promoters are about 120 nucleotides apart (Fig. 3). The precise positions from where the RNA initiates in the second promoter were not determined here. Since the first unique oligonucleotide identified in RNA2 was t30b (A-A-A-A-A-Gp; positions 132 to 137), and we did not find oligonucleotide t41 (C-A-C-A-C-C-C-C-Gp; positions 113 to 121) it is clear that RNA2 should initiate between nucleotides 113 to 131. The positions indicated in Figure 3 for the initiation of RNA2 were chosen for four reasons. First, we found that RNA2 initiates either with G or C (Fig. 5). Second, analysis of RNA initiation from numerous promoters of E. coli and its bacteriophages showed that RNA usually starts five to eight nucleotides downstream from the end of the Pribnow box (Rosenberg & Court, 1979). Third, Gilbert et al. (1979) showed that initiation in vitro from the second rrnA promoter started with the dinucleotide pppCpCp. Fourth, Lund & Dahlberg (1979) demonstrated that initiation from an rRNA promoter started with either C or G, and they suggested t h a t the C and G are three to four nucleotides apart. From all these considerations, we suggest that initiation from position 121 is quite certain, while the initiation from position 118 could have taken place also from positions 117 and/or 119. In the experiment shown in Figure 1, the ratio of RNA1 (from the first promoter) to RNA2 (from the second promoter) is about 1 to 3. However, in other experiments we observed various ratios of the two transcripts, from about 3 to 1 to 1 to 3. Since we determined that both RNAs have a similar stability, this is likely to reflect differential usage of both promoters. We do not know what the reason is for this variation in ratios between the two RNAs, but it is likely to be affected by certain cellular conditions. Since we observe these molecules by labeling cells under lethal conditions (high temperature: the cell is temperature

RIBOSOMAL RNA PROCESSING

553

sensitive), where there is probably no homeostasis, this result is not surprising. I t would be interesting to find out if the level of the nucleotide pool or of the magic spot (ppGpp) is affecting promoter utilization. In the particular conditions that we tested, the RNA from the second promoter started with either pppG or pppC at almost equal frequencies (Table 2). Thus, it is clear from the results presented here that a single rRNA gene can initiate in one of three positions, but the significance of this finding is not clear. (c) Termination of transcription The experiments presented here show that the terminated RNA contains a stem and loop structure, typical of rho-independent termination sites (Adhya & Gottesman, 1978; Rosenberg & Court, 1979; Platt, 1981). The stem is very substantial, containing 15 base-pairs. It is interesting that in rRNA, even though there is a sequence of A residues in the end of the coding DNA strand, apparently only the first A from this stretch is transcribed. In other genes, the RNA terminates in a series of U residues, but the stem is shorter (Rosenberg & Court, 1979). A similar situation was observed for other rRNA genes that do not contain distal tRNAs (Singh & Apirion, 1982). In the last case, the stem is almost identical to the stem found here with the minor difference that the third basepair before the terminated RNA is C ' G rather than U ' A 'as it is in the RNA studied here (Fig. 3). We therefore suggest that if the stem is relatively long, termination is efficient and the RNA does not contain many U residues at the end of the transcripts. Termination at the end of the stem (nucleotide 745 ; see Fig. 3), however, is not 100~/o efficient. In the case of both RNA1 and RNA2, we found some readthrough (see Fig. 2, t63). We quantitated this oligonucleotide and found it to be present in 0"13 to 0"15 molar yield in the two RNAs. In these cases, transcription continued to nucleotide 752. This estimation of 13 to 15% readthrough is obviously an underestimate, since if there are products of readthrough that have heterogeneous endings we probably would have failed to identify them. We did scan gels like that shown in Figure 1, as well as more porous polyacrylamide gels, to detect larger molecules, but have not found other RNA molecules that are plasmidrelated. Therefore, we conclude that the level of readthrough could be significant, and perhaps the various potential multitermination si~s that exist in the DNA sequence beyond the rrnD gene cluster (Duester and Holmes, 1978) could function in the termination of readthrough molecules. As expected, the level of readthrough and the site of termination was unaffected by rho, since in an ~ e rho double m u t a n t that contained the pJR3zJ plasmid, the rRNA transcripts were identical to those observed in strain N5706 (~'ne rho + ). I t is useful to mention that in all the cases of rho-independent termination that we have studied, the transcript terminated primarily at the first possible termination site (i.e. at the first possible stem and loop structure). This was the case for rrnD (as found here) as well as for the other rRNA gene clusters that do not contain distal (trailer) tRNA (Singh & Apirion, 1982). This was also the case for the RNA synthesized from the T4 bacteriophage tRNA gene cluster (Pragai & Apirion, 1982; Gurevitz et al., 1982).

554

J. SZEBER]~NYI AND D. APIRION

I t is interesting that, while both RNA1 and RNA2 always contained the readthrough oligonucleotide t63, in RNA3 (7 S RNA), which also terminates at the same nucleotide (745, Fig. 3 and Table 1), we never observed this oligonucleotide, regardless of the level of purity of the molecule. Since 7 S is a product of RNA processing, this finding suggests that perhaps the readthrough RNAs cannot be processed to 5 S rRNA: While the readthrough would not affect the level of 16 S or 23 S rRNA, it might affect the level of 5 S rRNA. This could explain why there is one extra 5 S rRNA gene in the E. coli genome. Such a device could ensure more nearly equal amounts of products of the three RNAs. In this case, the extra 5 S rRNA gene could be a compensation for the loss of 5 S rRNA due to inefficient processing of readthrough transcripts.

(d) R N A processing We find it truly remarkable that the rRNA produced from the minigene carried in the pJR3A plasmid is properly processed in vivo to 5 S rRNA in strain N5706. It is rather astonishing, since RNase E, which is the only primary RNA processing enzyme required to deal with this RNA, is thermolabile in strain N5706. The RNase E is somewhat defective even at lower temperatures but the increased level of rRNA transcripts is properly processed by RNase E. I t is rather the secondary processing, which is unaffected by the me-3071 mutation, that is the bottleneck in the processing reactions. This is deduced from the fact that in the presence of the plasmid even at the permissive temperature of 37~ no 7 S RNA is accumulated, but substantial amounts of p5 rRNA are produced. Thus, it is clear that the capacity of the cell to convert p5 to m5 is rather limited and is almost at its full capacity under normal growth conditions. The fact that at the non-permissive temperature whole transcripts accumulate, coupled with the fact that purified RNase E can process RNA1 and RNA2 to p5 rRNA (Fig. 9, and unpublished observations), suggests rather strongly that RNase E is the only RNA processing enzyme required for the primary processing of the RNA from this minigene. I t is interesting that the processing of RNA1 and RNA2 to p5 in vitro is relatively inefficient compared to the processing of 7 S RNA to p5 rRNA (Fig. 9). I t had already been suggested that the sequence (or at least part of it) between 23 S and 5 S rRNA is required for processing by RNase E (Ray et al., 1982 ; Roy et al., 1983). This sequence is included in RNA1 and RNA2. However, while 7 S RNA does not have any extraneous sequences (in addition to those found in RNA products processed from normal rRNA genes), RNAI and RNA2 contain a large amount of extraneous sequences, which probably affect the secondary-tertiary structure of the RNase E processing site. Such a deleterious effect of extra nucleotides had already been indicated by finding 25 S rRNA in rnc cells (Gegenheimer et al., 1977), since this RNA, which contains 23 S and 5 S rRNA (Ghora & Apirion, 1979); accumulates in the presence of apparently normal levels of RNase E. In previous experiments using the rne strain N3421 we did not find 5 S rRNA at 43~ (Ray & Apirion, 1981), while using strain N3438 we did find some (see Fig. 1 and Table 4). In strain N5706, while the production of 5 S rRNA

555

RIBOSOMAL RNA PROCESSING

stopped at 45~ 7 S RNA continued to accumulate. The production of both 7 S and 5 S R N A requires the participation of RNase E (Misra & Apirion, 1979 ; R o y et al., 1983; and unpublished observations). The differences between these strains are probably due to their different genetic backgrounds; while to construct strain N3421 the rne-3071 m u t a t i o n was introduced to a strain t h a t was Ts + at 43~ b u t not at 45~ N3438 was constructed by using a strain t h a t was Ts + at 45~ We do not know w h e t h e r the defect in the original strain into which the rne-3071 m u t a t i o n was introduced is directly related to R N A processing. I t is somewhat curious t h a t the relative level of m a t u r e 5 S rRNA (Table 4) produced in the rne strain (N3438) is higher at 37~ or 43~ in comparison to the relative levels of m a t u r e 5 S r R N A produced in strain N5706 (N3438/pJR3A). This could be due to the fact t h a t the trimming activity is limiting (see above) and is somewhat t e m p e r a t u r e sensitive. The level of RNA in the presence of the plasmid is obviously higher t h a n in its absence, which could explain the relatively low level of m a t u r e 5 S r R N A in the plasmid-containing strain. One of the surprising results reported here is the fact t h a t lO5 rRNA can be t r i m m e d properly to 5 S rRNA in a reaction t h a t requires only post-ribosomal s u p e r n a t a n t ($200 fraction; see Figs 9 and 10, and Table 5). This is surprising, since the accepted dogma is t h a t p5 matures to 5 S r R N A by trimming of three nucleotides at the 5' end only in a ribosome particle (see reviews by Pace, 1973; Gegenheimer & Apirion, 1981). We can see t h a t this trimming activity, which seems to remove the first three nucleotides from the RNase E product, is present in $200, since processing RNA2 with $200 resulted in the formation of 5 S r R N A t h a t contained 0, 1, 2 or 3 e x t r a nucleotides (0 being the m a t u r e 5 S r R N A ; see Fig. 11 and Table 5). E v e n more astonishing is the finding t h a t from RNA2 a n o t h e r molecule was processed, product 2 (3 S, see Figs 9 and 11, and Table 5), and this product, which is rather unlike 5 S rRNA, contains also four different 5' ends (Fig. 12) very similar to those found in p5 (product 1). I t is most interesting t h a t the positions where the trimming occurs in p5 (product 1) and in p r o d u c t 2 have some sequence similarities (see Fig. 14). Therefore, it is possible t h a t the trimming activity t h a t produces 5 S r R N A (m5) from p5 is a specific type of 5' exonuclease t h a t can

160

]70

570

Ib)

... GCG~UCUG

'

180

580

190

590

600 D . . .

FIo. 14. Sequence homologies flanking the 5' ends of the two major in v/fro processed products of RNA2. The sequences are aligned at the major 5' cleavage sites (long arrows) of (a) product 2 and (b) product 1 (see Fig. 13). Nueleotides are numbered as in Fig. 3. Homologies in the 2 sequences are boxed. Short arrows indicate the trimming sites at the 5' ends of the processed products (for further details, see the text, Table 5 and Fig. 12).

556

J. SZEBERI~NYI AND D. APIRION

remove nucleotides one at a time. This enzyme could have some sequence specificity, and might stop removing nucleotides when reaching regions of s e c o n d a r y - t e r t i a r y structure. Finally, we would like to mention the peculiar structure within RNA1 and RNA2 t h a t is resistant to nuclease $1 (Fig. 3 and Table3). This structure is relatively resistant, even though it clearly cannot produce a proper stem structure (see Fig. 3). I t is most interesting t h a t it is exactly this RNA t h a t a p p a r e n t l y provides a site for RNase E (processing of RNA1 or RNA2 with an e x t r a c t from an rne m u t a n t does not produce this RNA), which is then trimmed by this 5' exonuclease as if it was 5 S rRNA. As we mentioned earlier, this RNA does not exist when a full rRNA gene cluster is present, since it is cleaved b y RNase III. The experiments presented here indicate t h a t ~ne cells transformed with the pJR3/I plasmid provide a relatively simple system for the investigation of processing of 5 S rRNA in E . coli. Furthermore, the accumulation of primary transcripts of the hybrid rrn gene cluster could facilitate the s t u d y of the regulation of p r o m o t e r preference in the initiation of transcription of rRNA. Moreover, the system is very suitable for studies of R N A termination. Finally, RNA3 is an excellent substrate for f u r t h e r characterization of the cleavage reaction due to the R N A processing enzyme RNase E a t the 3' end of 5 S rRNA, and it can be used also as a substrate in the search for the putative RNase M5 activity, which is responsible for the conversion of p5 to the m a t u r e 5 S rRNA.

We are grateful to Dr W. M. Holmes for providing us with the pJR3d plasmid. We are very grateful to our colleagues Drs Bheem Bhat and Michael Gurevitz for discussions concerning the fingerprinting technique, and Dr Monoj Roy for supplying us with a cellular fraction containing RNase E. This study was supported by a United States Public Health Services grant (GM19821) from the National Institute of Health.

REFERENCES Adhya, S. & Gottesman, M. (1978). Annu. Rev. Biochem. 47, 967-996. Ando, T. (1966). Biochi~n. Biophys. Acta, 114, 158-168. Apirion, D. (1978). Genetics, 90, 659-671. Apirion, D. & Lassar, A. B. (1978). J. Biol. Chem. 253, 1738-1742. Boros, I., Kiss, A. & Venetianer, P. (1979). Nucl. Acids Res. 6, 18]7-1830. Brain, R. J., Young, R. A. & Steitz, J. A. (1980). Cell, 19, 393-401. Celma, M. L., Pan, J. & Weissman, S. M. (1977). J. Biol. Chem. 252, 9043-9046. Cohen, S. N., Chang, A. C. Y. & Hsu, L. (1972). Proc. Nat. Acad. Sci., U.S.A. 69, 21102114. deBoer, H. A. & Nomura, M. (1979). J. Biol. Chem. 254, 5609-5612. deBoer, H. A., Gilbert, S. F. & Nomura, M. (1979). Cell, 17, 201-209. Duester, G. L. & Holmes, W. M. (1980). Nucl. Acids Res. 8, 3793-3807. Gegenheimer, P. & Apirion, D. (1978). Cell, 15, 527-539. Gegenheimer~ P. & Apirion. D. (1980a). J. Mol. Biol. 143, 227-257. Gegenheimer, P. & Apirion, D. (1980b). Nucl. Acid8 Res. 8, 1873-1891. Gegenheimer, P. & Apirion, D. (1981). Microbiol. Rev. 45, 502-541. Gegenheimer, P., Watson, N. & Apirion, D. (1977). J. Biol. Chem. 252, 3064-3073. Gesteland, R. F. (1966). J. Mol. Biol. 16, 67-84.

RIBOSOMAL RNA PROCESSING

557

Ghora, B. K. & Apirion, D. (1978). Cell, 15, 1055-1066. Ghora, B. K. & Apirion, D. (1979). J. Mol. Biol. 127, 507-513. Gilbert, S. F., deBoer, H. A. & Nomura, M. (1979). Cell, 17, 211-224. Gurevitz, M., Watson, N. & Apirion, D. (1982). Eur. J. Biochem. 124, 553-559. Kenerley, M. E., Morgan, E. A., Post, L., Lindahl, L. & Nomura, M. (1977). J. Bacteriol. 132, 931-949. Kiss, A., Sain, B. & Venetianer, P. (1977). F E B S Letters, 79, 77-79. Lund, E. & Dahlberg, J. E. (1979). Proc. Nat. Acad. Sci., U.S.A. 76, 5480~ Misra, T. K. & Apirion, D. (1979). J. Biol. Chem. 254, 11154-11159. Misra, T. K. & Apirion, D. (1980). J. Bacteriol. 142, 359-361. Morgan, E. A., Ikemura, T., Post, L. E. & Nomura, M. (1980). In Transfer RNA : Biological Aspects (S511, D., Abelson, J. & Schimell, P., eds), pp. 25,9-266, Cold Spring Harbor Laboratory Press, ('.old Spring Harbor. Pace, N. R. (1973). Bacteriol. Rev. 37, 562-603. Platt, T. (1981). Cell, 24, 10-23. Pragai, B. & Apirion, D. (1982). J. Mol. Biol. 154, 465-484. Ray, B. K. & Apirion, D. (1980). J. Mol. Biol. 139, 329-348. Ray, B. K. & Apirion, D. (1981). Eur. J. Biochem. 114, 517-524. Ray, B. K., Singh, B., Roy, M. K. & Aprion, D. (1982). Eur. J. Biochem. 125, 283-289. Rosenberg, M. & Court, D. (1979). Annu. Rev. Genet. 13, 319-353. Roy, M. K., Singh, B., Ray, B. K. & Apirion, D. (1983). Eur. J. Biochem. 131, 119-127. Saneyoshi, M., Ohasbi, A., Harada, F. & Nishimura, S. (1972). Biochim. Biophys. Aeta, 262, 1-10. Shishido, K. & Ando, T. (1972). Bioehim. Biophys. Acta, 287, 477-484. Singb, B. & Apirion, D. (1982). Biochim. Biophys. Acta, 698, 252-259. Volckaert, G. & Fiem, W. (1977). Anal. Biochs 83, 228-239. Volckaert, G., Min Jou, W. & Fiers, W. (1976). Anal. Biochem. 72, 433-446. Edited by J. Miller

APPENDIX

F u s i o n o f the Tandem Escherichia coli rrnA Promoters to a Transcription Termination Signal from the End o f rrnD ROBERTA M. ELFORD AND W. M. HOLMES Department of Microbiology Medical College of Vi~yinia Virginia Commonwealth University Richmond, VA 23298, U.S.A.

We h a v e reported the p r i m a r y s t r u c t u r e of the distal (3') end of the ribosomal operon rrnD (Duester & Holmes, 1980). I n t h a t report we noted an extensive region of d y a d s y m m e t r y j u s t beyond the final 5 S r R N A gene of rrnD. This sequence, which we here designate T 1, exhibits a G + C-rich inverted r e p e a t flanked b y A + T - r i c h sequences. Based on this structure, we proposed t h a t T 1 m a y be a