Innate BDNF expression is associated with ethanol intake in alcohol-preferring AA and alcohol-avoiding ANA rats

brain research 1579 (2014) 74–83

Available online at www.sciencedirect.com

www.elsevier.com/locate/brainres

Research Report

Innate BDNF expression is associated with ethanol intake in alcohol-preferring AA and alcohol-avoiding ANA rats Noora Raivio, Pekka Miettinen, Kalervo Kiianmaan Department of Alcohol, Drugs and Addiction, National Institute for Health and Welfare, POB 30, Helsinki 00271, Finland

ar t ic l e in f o

abs tra ct

Article history:

We have shown recently that acute administration of ethanol modulates the expression of

Accepted 4 July 2014

brain-derived neurotrophic factor (BDNF) in several rat brain areas known to be involved in

Available online 18 July 2014

the development of addiction to ethanol and other drugs of abuse, suggesting that BDNF

Keywords: BDNF

may be a factor contributing to the neuroadaptive changes set in motion by ethanol exposure. The purpose of the present study was to further clarify the role of BDNF in reinforcement from ethanol and in the development of addiction to ethanol by specifying

Ethanol Selected rat lines Addiction

the effect of acute administration of ethanol (1.5 or 3.0 g/kg i.p.) on the expression profile of BDNF mRNA in the ventral tegmental area and in the terminal areas of the mesolimbic dopamine pathway in the brain of alcohol-preferring AA and alcohol-avoiding ANA rats, selected for high and low voluntary ethanol intake, respectively. The level of BDNF mRNA expression was higher in the amygdala and ventral tegmental area of AA than in those of ANA rats, and there was a trend for a higher level in the nucleus accumbens. In the amygdala and hippocampus, a biphasic change in the BDNF mRNA levels was detected: the levels were decreased at 3 and 6 h but increased above the basal levels at 24 h. Furthermore, there was a difference between the AA and ANA lines in the effect of ethanol, the ANA rats showing an increase in BDNF mRNA levels while such a change was not seen in AA rats. These findings suggest that the innate levels of BDNF expression may play a role in the mediation of the reinforcing effects of ethanol and in the control of ethanol intake. & 2014 Elsevier B.V. All rights reserved.

Abbreviations: AA rat,

alcohol-preferring AA (Alko Alcohol) rat; ANA rat,

alcohol-avoiding ANA (Alcohol Non-Alcohol) rat;

BDNF,

brain-derived neurotrophic factor; GABA,

gamma-aminobutyric acid; GAPDH,

MAPK,

mitogen-activated protein kinase; NP rat,

alcohol nonpreferring NP rat; P rat,

pCREB,

phosphorylated cAMP response element-binding protein; RT-qPCR,

VTA, ventral tegmental area n Corresponding author. E-mail address: kalervo.kiianmaa@thl.fi (K. Kiianmaa). http://dx.doi.org/10.1016/j.brainres.2014.07.006 0006-8993/& 2014 Elsevier B.V. All rights reserved.

glyceraldehyde 3-phosphate dehydrogenase; alcohol-preferring P rat;

real-time quantitative polymerase chain reaction;

75

brain research 1579 (2014) 74–83

1.

Introduction

Brain-derived neurotrophic factor (BDNF) is one of the most abundant neurotrophic factors widely expressed in the adult mammalian brain (Lewin and Barde, 1996; Hofer et al., 1990) and, as with most neurotrophins, it is a key player in neuronal survival, development and plasticity (Schuman, 1999; Goggi et al., 2002; Chao, 2003; Lipsky and Marini, 2007). The involvement of BDNF in several psychiatric and neurological conditions has been well established (Nestler et al., 2002; Shirayama et al., 2002; Bramham and Messaoudi, 2005; Autry and Monteggia, 2012) as well as its contribution to the reinforcing effects and neuroadaptive changes set in motion by drugs of abuse (Russo et al., 2009; Ghitza et al., 2010). The addictive properties of drugs are generally believed to be based on their reinforcing effects. The mesolimbic dopamine pathway is suggested to be the primary neural substrate for reinforcement from ethanol and other substances of abuse, and has a role in their self-administration (Koob et al., 1998; Wise, 1998). Cell bodies of the mesolimbic dopamine neurons are located in the ventral tegmental area and their axons project to the nuclei of the forebrain (Koob, 1992; Chick and Erickson, 1996). It has been demonstrated that essentially all mesencephalic dopaminergic neurons express BDNF (Numan and Seroogy, 1999). Several studies have shown that BDNF plays a role in the reinforcing effects of psychostimulants and opiates (Ghitza et al., 2010; McGinty et al., 2010). There are also data suggesting that BDNF may act as an endogenous regulator of ethanol intake. It has been found that the expression of endogenous BDNF is related to the levels of ethanol intake and is altered by exposure to ethanol (Hensler et al., 2003; McGough et al., 2004; Kerns et al., 2005; Raivio et al., 2012), and that the basal BDNF levels in the nucleus accumbens differ between rat lines showing different preference to ethanol (Yan et al., 2005). Furthermore, clinical studies have provided evidence that BDNF may be one factor underlying genetic vulnerability to alcohol dependence (Matsushita et al., 2004; Keun-Ho et al., 2007). We showed recently in Wistar rats that acute ethanol administration modulates the expression profile of BDNF in a temporal manner in several brain regions associated with the development of addiction to ethanol and other drugs of abuse (Raivio et al., 2012). In the present study we wanted to clarify further the role of the expression of BDNF in reinforcement from

ethanol by exploring the effects of acute administration of ethanol on the expression of BDNF mRNA in the ventral tegmental area as well as in the projection areas of the dopamine pathway of alcohol-preferring Alko Alcohol (AA) and alcohol-avoiding Alko Non-Alcohol (ANA) lines of rats selected for high and low voluntary ethanol intake, respectively (Eriksson, 1968). The lines represent two non-overlapping phenotypic distributions of voluntary ethanol consumption. The utility of selected lines for unraveling the biological factors underlying the predisposition for high and low ethanol intake is based on the assumption that in the high-drinking line, the selection pressure applied gradually leads to enrichment of alleles promoting ethanol intake, while the alleles accumulated in the lowdrinking line have opposite effects. The most common strategy for probing the mechanisms behind regulation of ethanol intake is the comparison of various central neurotransmitter systems in the selected lines. Therefore, examination of neurobiological differences between the lines – either in naïve animals or in their response to ethanol – is supposed to reveal the nature of interaction between the innate predisposition and ethanol exposure, and will help to identify the neuronal mechanisms underlying ethanol intake and abuse (Kiianmaa et al., 1992; Sommer et al., 2006). The present data complement the earlier work done in respect to the role of BDNF in the control of ethanol intake, and provide new information on the role of BDNF in the different levels of intake of ethanol in the two rat lines.

2.

Results

2.1.

Blood ethanol concentrations

The ethanol doses resulted in blood ethanol concentrations as shown in Table 1. The blood ethanol concentrations were similar between comparable groups in the dose response study and in the time course study. Blood ethanol concentrations were similar between the AA and ANA lines in respective groups.

2.2.

Effect of ethanol on BDNF expression

2.2.1.

Basal levels

There was a significant difference in the basal levels of BDNF mRNA expression between the AA and ANA lines in several brain parts [F(4,473)¼5.48, p¼ 0.3  10  3, for the interaction between effects of rat line and brain region; F(4,473)¼5.48,

Table 1 – The concentration of ethanol in the blood of alcohol-preferring AA and alcohol-avoiding ANA rats after administration of ethanol 1.5 or 3 g/kg i.p. Ethanol

Time point

Dose g/kg

Rat line

90 min

3h

6h

24 h

AA

n/a n/a

16.471.4 18.070.8

n/a n/a

n/a n/a

74.971.3 77.970.8

64.471.0 63.670.8

38.471.6 37.071.1

1.770.4 2.070.6

1.5

ANA 3

AA ANA

The samples were collected from the animals both in the dose response and time course studies. Values (mean7SEM) are given in mM; n¼ 9–20.

76

brain research 1579 (2014) 74–83

p¼ 0.2  10  3, for the main effect of brain region]. The levels were higher in the amygdala and ventral tegmental area of AA rats than in those of ANA rats [F(1,92)¼ 7.21; p¼ 0.009, F(1,92)¼9.73; p¼ 0.2  10  3, respectively], while the levels were lower in the hippocampus of AA rats than in that of ANA rats [F(1,98)¼17.53; p¼ 0.6  10  4] (Fig. 1). The results of all the saline groups of different time points were pooled for the comparison. It should be noted that the BDNF mRNA levels in the saline groups also differed among several time points in some brain regions. However, for the ease of interpretation, the focus of this paper is on the interaction between effects of rat line and brain region only. The circadian variation of the BDNF expression in the AA and ANA rats is not discussed in this paper.

2.2.2.

2.2.3.1. Frontal cortex. The BDNF mRNA levels were increased in response to ethanol administration [F(1,158)¼16.29; p¼0.88  10  4, for the main effect of treatment]. The changes in the temporal pattern were also significant [F(3,142)¼ 4.02; p¼0.009, for the main effect of time]. Furthermore, the effect of ethanol was different between the AA and ANA lines [F (3,142)¼3.20; p¼ 0.025, for the interaction between effects of treatment, rat line, and time]. In ANA rats, ethanol increased the BDNF mRNA at time points 90 min and 24 h after the injection [F(1,18)¼ 10.53; p¼ 0.005, and F(1,19)¼ 8.30; p¼ 0.010, respectively]. In AA rats, the effect was significant only after 24 h [F(1,19)¼11.74; p¼ 0.003].

Dose response study

The BDNF mRNA levels were decreased dose-dependently in the hippocampus after ethanol administration [F(2,55)¼ 12.1, p¼ 0.5  10  4, for the main effect of treatment] (Fig. 2). The effect was significant after the higher dose, 3 g/kg ethanol. The levels were increased dose-dependently in the ventral tegmental area [F(2,50)¼ 3.25, p¼ 0.048, for the main effect of treatment]. The effect of ethanol was significant in the AA line after the 3 g/kg dose. No differences were observed between the rat lines in their response to ethanol.

2.2.3.

Time course study

Fig. 3 shows the ethanol-induced temporal changes in BDNF mRNA levels in the AA and ANA rats. Since the effects of ethanol were significant only after the higher dose of ethanol in the dose response experiment, 3 g/kg ethanol dosage was used here.

Fig. 1 – Basal BDNF mRNA levels of the alcohol-preferring AA and alcohol-avoiding ANA rats. The saline groups of all time points of the corresponding rat line both in the dose response and the time course studies were pooled for comparison. BDNF mRNA levels were normalized against the GAPDH mRNA in the corresponding samples. ANA saline group is shown as the control group representing 100%. VTA¼ventral tegmental area. Bar charts represent mean7SEM, n ¼ 45–49, nnpo0.01, nnnpo0.001.

Fig. 2 – Ethanol induced changes in the BDNF mRNA levels in the brain of alcohol-preferring AA and alcohol-avoiding ANA rats. The effect of an acute dose of ethanol (1.5 or 3 g/kg, i.p.) on BDNF expression in the frontal cortex, nucleus accumbens, amygdala, hippocampus, and ventral tegmental area (VTA) of AA and ANA rats 3 h after the injection. BDNF mRNA levels were normalized against the GAPDH mRNA in the corresponding samples. Ethanol groups are referred to the saline group of the corresponding rat line. Bar charts represent mean7SEM, n ¼6 10, npo0.05, nnpo0.01.

brain research 1579 (2014) 74–83

77

p¼ 0.047, respectively] before returning to the level of the controls at 24 h.

2.2.3.3. Amygdala. The effects of ethanol on the BDNF mRNA levels in the amygdala were also time dependent [F(3,138)¼ 14.44; p¼ 0.3  10  7, for the interaction between the effects of treatment and time]. The pattern of changes was, however, similar between the two lines. The BDNF mRNA levels first decreased at 3 h and 6 h, and then increased at 24 h [AA: F(1,19)¼ 4.70; p¼ 0.044, F(1,18)¼ 31.16, p ¼0.3  10  4; F(1,17)¼ 5.48; p¼ 0.032, and ANA: F(1,19)¼4.48; p ¼0.049, F(1,19)¼7.45; p¼ 0.014, F(1,19)¼8.06; p¼ 0.011, respectively]. 2.2.3.4. Hippocampus. Administration of ethanol was followed by similar significant changes in the temporal pattern of changes in the hippocampus as in the amygdala [F(3,141)¼ 25.22; p¼ 0.4  10  14, for the interaction between the effects of treatment and time], but there was no difference in the response between the rat lines. The BDNF mRNA levels first decreased at 3 h and 6 h in both rat lines, and then increased significantly at 24 h in the AA line [AA: F(1,19)¼ 30.16; p¼ 0.3  10  4, F(1,19)¼28.03; p¼ 0.5  10  4, F(1,17)¼5.76; p¼ 0.029, and ANA: F(1,19)¼29.53; p¼ 0.4  10  4, F(1,19)¼ 89.17; p¼ 0.2  10  9, F(1,19)¼ 1.52; p ¼0.23, respectively]. 2.2.3.5. Ventral tegmental area. In the ventral tegmental area, treatment with ethanol increased the BDNF mRNA levels [F(1,138)¼ 7.66; p ¼0.006, for the main effect of treatment]. The increase was significant only in the AA strain at the 90 min time point [F(1,20)¼ 4.48; p ¼0.048]. There was no difference between the lines in the effect of ethanol.

Fig. 3 – Ethanol induced region-specific temporal changes in the BDNF mRNA levels in the brain of alcohol-preferring AA and alcohol-avoiding ANA rats. BDNF expression in the frontal cortex, nucleus accumbens, amygdala, hippocampus, and ventral tegmental area (VTA) 90 min, 3 h, 6 h, and 24 h after an acute dose of ethanol (3 g/kg, i.p.). Two-way ANOVA revealed a significant treatment  rat line  time interaction (p¼ 0.025). BDNF mRNA levels were normalized against the GAPDH mRNA in the corresponding samples. Ethanol groups are referred to the saline group of the corresponding rat line and time point. Values of salinetreated control animals are shown as a dashed line. Bar charts represent mean7SEM, n¼ 8–10, npo0.05, nnpo0.01, nnn po0.001.

2.2.3.2. Nucleus accumbens. Administration of ethanol modified the BDNF mRNA levels in the nucleus accumbens in a time dependent manner [F(3,155)¼ 8.37; p¼ 0.37  10  4, for the interaction between the effects of treatment and time], but there was no differences between the lines in the effects of ethanol. The BDNF mRNA levels were increased at 90 min, but the increase was significant only in ANA rats [F(1,19)¼ 6.03; p¼ 0.025]. After the initial increase, the BDNF mRNA levels returned back to basal level in ANA rats, whereas for AA rats the levels decreased below basal levels at 3 h and 6 h [F(1,18)¼ 4.59; p¼ 0.047, and F(1,18)¼4.58;

3.

Discussion

We reported recently that acute administration of ethanol to Wistar rats modulates the expression of BDNF mRNA in several regions of the brain associated with the development of addiction to ethanol and other drugs of abuse (Raivio et al., 2012). The purpose of the present study was to further clarify the role of BDNF in reinforcement from ethanol and in the development of addiction to ethanol by specifying the effect of acute administration of ethanol on the expression profile of BDNF mRNA in the ventral tegmental area and in the terminal areas of the mesolimbic dopamine pathway in the brain of alcohol-preferring AA and alcohol-avoiding ANA rats selected for high and low voluntary intake of ethanol, respectively. These and other selectively bred rodent lines differing in ethanol-related phenotypes have been widely used to identify the neuronal mechanisms underlying ethanol abuse (Kiianmaa et al., 1992; McBride and Li, 1998). Although AA and ANA rats were originally developed from a foundation population of Wistar origin, Wistars cannot be considered to represent a control genotype for the AA and ANA lines or a reference for the present measurements (Eriksson, 1968). The data collected from Wistar rats in our previous study provided important background information for the present study (Raivio et al., 2012). We found here innate differences between the rat lines in their BDNF expression in the amygdala, ventral tegmental area and

78

brain research 1579 (2014) 74–83

hippocampus. The mRNA levels were modulated by ethanol in a temporal region-specific manner in all brain regions. A difference between the lines was revealed in their response to ethanol in the frontal cortex. BDNF has been implicated in the development of drug addiction due to its role in the regulation of synaptic plasticity (Davis, 2008; Ghitza et al., 2010). Several studies on the interactions between the BDNF system and drugs of abuse suggest that BDNF within the mesocorticolimbic dopamine system is a positive modulator of psychostimulant and opiate reward (Shen et al., 2006; Bahi et al., 2008; Vargas-Perez et al., 2009; Ghitza et al., 2010). It has also been reported that exposure to ethanol alters the expression of BDNF (Hensler et al., 2003; McGough et al., 2004; Kerns et al., 2005; Raivio et al., 2012), and that BDNF serves as a modulator of ethanol reward (McGough et al., 2004; Jeanblanc et al., 2006, 2009; Logrip et al., 2009; Jeanblanc et al., 2013). BDNF mRNA levels are regulated by neuronal activity. Glutamatergic neurotransmission generally increases BDNF mRNA levels, while the activation of GABA (gamma-aminobutyric acid) transmission reduces them (Zafra et al., 1991).

3.1.

Basal levels of BDNF mRNA in AA and ANA rats

In the present study, differences were found in the innate levels of the expression of BDNF mRNA in between the AA and ANA rats (Fig. 1). The level of BDNF mRNA expression was higher in the amygdala and ventral tegmental area of AA than in those of ANA rats, and there was a trend for a higher level in the nucleus accumbens. Furthermore, the hippocampal level of BDNF expression was higher in the ANA than AA rats. These findings might suggest that the higher level of ethanol intake by AA rats than by ANA rats is associated with the higher level of BDNF expression in the ventral tegmental area, amygdala and possibly nucleus accumbens and the lower level of expression in the hippocampus. In contrast to the present results, it has been reported earlier that the innate levels of BDNF expression in the central and medial amygdala of alcohol-preferring P rats were lower than those of alcohol nonpreferring NP rats, while there was no difference in the accumbal levels of BDNF expression between the rat lines (Prakash et al., 2008; Moonat et al., 2011). In contradiction to these studies, it has been reported that the alcoholpreferring P rats have lower basal BDNF protein levels in the nucleus accumbens than alcohol nonpreferring NP rats (Yan et al., 2005). Several other findings suggest an association of lower levels of BDNF to higher ethanol preference and the inhibitory effect of BDNF on ethanol intake. Heterozygote BDNF knockout mice have been demonstrated to consume more ethanol than wild type controls (Hensler et al., 2003; McGough et al., 2004). Furthermore, reduction of BDNF mRNA in the dorsolateral striatum by viral mediated siRNA increased ethanol intake, while injections of BDNF in the dorsal striatum or lentiviral-mediated overexpression of BDNF in the dorsolateral striatum decreased it (Logrip et al., 2008; Jeanblanc et al., 2009; Bahi and Dreyer, 2013). Drawing conclusions of the role of endogenous levels of BDNF in the control of ethanol intake level is, however, difficult. The studies have been focused on different regions of the brain, and according to several reports there are clear distinctions

between brain regions in BDNF signaling (cf. Russo et al., 2009). There is some evidence that BDNF contributes to anxietyrelated phenotypes (Cowansage et al., 2010). Since the alcohol-preferring P rats haven been shown to display higher levels of anxiety-like behaviors and lower levels of BDNF expression in some structures of amygdala than the nonpreferring NP rats, it has been speculated that deficiency in BDNF within the regions of the amygdala may be a factor predisposing alcohol-preferring P rats to anxiety-like behaviors and high ethanol intake (Prakash et al., 2008; Pandey et al., 2008; Moonat et al., 2011). Interestingly, the alcoholavoiding ANA rats used in the present study have been reported to show more anxiety-like behavior and were here found to express less BDNF in the amygdala than the alcoholpreferring AA rats (Sommer et al., 2006). Therefore the results may suggest that lower amygdaloid endogenous BDNF is more likely involved in other co-selected behavioral traits of AA rats than high ethanol intake behavior, directly. BDNF and its signaling have been proposed as regulating neuroadaptations that alter individual's responses to drugs of abuse, such as tolerance and sensitization (Russo et al., 2009). Besides showing a higher level of ethanol intake the AA rats also show enhanced development of tolerance to the behavioral effects of ethanol, become more sensitized to the locomotor effects of morphine, survive longer, and have higher innate expression of pCREB (phosphorylated cAMP response element-binding protein) and fosB-derived proteins than the ANA rats (Lê and Kiianmaa, 1988; Ojanen et al., 2003; Sarviharju et al., 2004; Kaste et al., 2009). Taken together, these findings suggest that the AA rats are more liable to drug-induced as well as other neuroadaptations than ANA rats. Whether the higher endogenous level of BDNF in the ventral tegmental area and possibly also in the amygdala and nucleus accumbens in the AA rats is a contributing factor to the higher neuroplasticity of the AA than ANA rats is still a matter of speculation. It has earlier been shown that BDNF promotes sensitized response to cocaine at the level of ventral tegmental area and nucleus accumbens (Pierce et al.,1999; Bahi et al., 2008). In another study, neurochemical neuroadaptations in the mesolimbic dopamine pathway induced by chronic treatment with morphine or cocaine were, however, counteracted by infusions of BDNF into the ventral tegmental area (Berhow et al., 1995).

3.2. Effects of ethanol administration on BDNF mRNA levels in AA and ANA rats The studies on the effects of ethanol on BDNF mRNA expression revealed that there was a difference between the AA and ANA lines in the effect of ethanol, the ANA rats showing an increase in BDNF mRNA levels in the frontal cortex at 90 min while such a change was not seen in AA rats (Fig. 3). The difference between the lines in the temporal modulation of BDNF by ethanol in the frontal cortex is of great interest, since this brain region seems to be important in cognitive functions and also possibly in the development of ethanol addiction (Hodge et al., 1996; Volkow et al., 2002; Ruéda et al., 2012). These findings differ from those of our previous study, where ethanol (2.5 g/kg) decreased the level

brain research 1579 (2014) 74–83

of BDNF mRNA in the frontal cortex of Wistar rats at 3 h and 24 h (Raivio et al., 2012). Whether the discrepancy between the studies can be explained by the use of different rat strains remains unclear. Others have shown previously that a single 4-hour session of voluntary ethanol intake (5.6 g/kg) or an acute dose of 2 g/kg of ethanol had no effect on the mRNA levels in the prefrontal cortex of C57BL/6 mice immediately after the session or at 45 min after the injection, respectively (McGough et al., 2004; Logrip et al., 2009). Both the species and the experimental protocol used in these experiments were, however, different from those of the present study. The profile of BDNF mRNA expression in the nucleus accumbens after ethanol administration was complex (Figs. 2 and 3). The suppression of BDNF after ethanol is in line with our previous results where ethanol decreased the levels of BDNF mRNA in the nucleus accumbens of Wistar rats (Raivio et al., 2012). Measurements of the expression of BDNF mRNA in the nucleus accumbens is hampered by the very low levels, barely within the limits of detection of realtime quantitative PCR (Conner et al., 1997; McGough et al., 2004). It has been suggested that rather than the nucleus accumbens or ventral striatum, a more significant role in the homeostatic pathway that gates ethanol self-administration is played by the dorsal striatum. In the study by Logrip and others BDNF mRNA levels were not altered in the nucleus accumbens after 4 h of self-administration of ethanol (5.6 g/kg) but they were increased in the dorsal striatum (Logrip et al., 2009). Furthermore, an increase in BDNF levels in the dorsal striatum has been reported after an acute dose of ethanol (2 g/kg), and after 4 weeks of continuous access to ethanol (McGough et al., 2004); according to a recent study, BDNF attenuates ethanol intake via activation of the mitogen-activated protein kinase (MAPK) pathway in a protein synthesis-dependent manner within the dorsolateral striatum (Jeanblanc et al., 2013). In the amygdala, the biphasic change in the BDNF mRNA levels in both rat lines (Fig. 3) is in line with our previous study where ethanol (2.5 g/kg) decreased BDNF mRNA levels in the amygdala of Wistar rats at 6 h (Raivio et al., 2012). In contrast to these results, an acute dose of ethanol (1 g/kg) has previously been reported to increase significantly the levels of BDNF mRNA in the central and medial nuclei of amygdala 1 h after the administration of ethanol (Pandey et al., 2008). There are, however, striking differences in the distribution of BDNF mRNA and protein among the subdivisions of amygdala, and the subdivisions are differentially involved in the interactions of ethanol and BDNF (Conner et al., 1997; Pandey et al., 2006, 2008; Prakash et al., 2008; Moonat et al., 2011). Therefore, it is possible that the true levels and the responses of BDNF mRNA in one part of amygdala may be masked by those in another part in the event that the amygdala is punched and homogenized as a whole as was done in the present study. The higher dose of ethanol (3 g/kg) induced a significant decrease in BDNF mRNA levels in the hippocampus in both rat lines at 3 and 6 h (Figs. 2 and 3). The expression had recovered to the basal level in ANA rats at 24 h and increased significantly above that in AA rats (Fig. 3). These findings are consistent with our previous studies in Wistar rats, where we saw a dose-dependent decrease of BDNF mRNA levels after two doses of ethanol (1.25 g/kg and 2.5 g/kg) (Raivio et al.,

79

2012). The effect was prominent at 3 h and started to recover at 6 h returning back to basal levels at 24 h. Others have reported a decrease in BDNF mRNA levels after administration of other drugs such as diazepam that potentiate GABA mediated inhibition in the hippocampus (Zafra et al., 1991). Continuous exposure to ethanol has also been shown to down-regulate BDNF expression (Tapia-Atancibia et al., 2001; McGough et al., 2004; Hauser et al., 2011). In contrast to these findings, an increase in hippocampal BDNF expression has been reported both in vitro at ethanol concentrations of 10–25 mM at 30 min of ethanol exposure, and in vivo at 45 min after an injection of 2 g/kg of ethanol in adult animals, and furthermore, at 2 h after an acute ethanol vapor exposure in juvenile animals (McGough et al., 2004; Kulkarny et al., 2011). There were numerous methodological differences among the studies, which may partly explain the discrepancies. In contrast to the other investigated brain areas, in the ventral tegmental area, ethanol evoked an increase in the BDNF mRNA (Figs. 2 and 3). The increment was seen in AA rats 90 min and 3 h after administration of ethanol (Fig. 3). We have previously reported an increase of BDNF mRNA levels in the ventral tegmental area in Wistar rats at 3 and 24 h after ethanol (2.5 g/kg) administration (Raivio et al., 2012). BDNF in the ventral tegmental area is of particular interest from the point of the effects of ethanol, since BDNF is synthesized in dopaminergic neurons in the ventral tegmental area, transported anterogradely, and released at the nerve endings in the projection areas (Conner et al., 1997). Expression of BDNF in this pathway has been associated in the addictive properties of drugs of abuse (Berhow et al., 1995; Graham et al., 2007; Bahi et al., 2008). Infusion of BDNF into the ventral tegmental area blocks the development of molecular adaptations to chronic morphine or cocaine treatment (Berhow et al., 1995), and induces an enhancement of cocaine seeking after withdrawal for up to 30 days (Lu et al., 2004). Recently it was reported that a single infusion of intra-VTA BDNF also promoted a switch in the mechanism mediating ethanol motivation, from a dopamine-dependent to a dopamine-independent pathway (Ting-A-Kee et al., 2013). This phenomenon is exactly the opposite to what has been shown to be true with morphine (Vargas-Perez et al., 2009).

4.

Conclusions

The present results obtained with alcohol-preferring AA and alcohol-avoiding ANA rats offer further insight into the expression profile of BDNF after acute ethanol administration relative to the work in Wistar rats that we have published recently (Raivio et al., 2012). The aim of studying rat lines selected for their difference in preference to ethanol is to give us information about the neurobiological mechanisms underlying their phenotypes and the neuronal mechanisms controlling ethanol intake. The main novel finding in the present results was that there were differences in the innate expression of BDNF in the amygdala, hippocampus and ventral tegmental area between the AA and ANA rats. Furthermore, there was a difference in the effect of ethanol on the BDNF mRNA levels in the frontal cortex between the AA and ANA

80

brain research 1579 (2014) 74–83

rats, with the ANA rats showing the effect earlier than the AA rats. The alterations in the levels of mRNA measured by RT-PCR reflect, however, rather global changes, since the brain areas investigated in the present study were homogenized without separating any subdivisions or analyzing e.g. in situ hybridization. Moreover, the data are rather limited, since no information on protein translation or receptor activation is available. Consequently, understanding of the pharmacological significance of the ethanol-induced changes in BDNF mRNA expression requires further studies. The discrepancies between the results of the present study and some previous studies by others covering the effects of ethanol on the BDNF system is probably based on several differences in the methodology of studies, e.g. in species, doses and administration protocols of ethanol, time points of sampling, and dissection methods. The doses of ethanol given in the present study can be considered relevant, since the blood ethanol levels attained here can be reached in humans after self-administration and result in marked signs of behavioral impairment (cf. Wallgren and Barry, 1970; Koob and Le Moal, 2006). As noted above, the BDNF mRNA levels of amygdala are highly dependent on the sub-partition of the area. Similarly, the BDNF mRNA levels around nucleus accumbens are much higher than those of nucleus accumbens (Conner et al., 1997), which itself has low levels of BDNF mRNA being near the limit of the RT-PCR protocol detection. These issues make the measurement of BDNF mRNA at the specific regions challenging, and in the dose–response study the differences between groups are mostly obfuscated due to large variation in the data of these regions. To this end, the dissection of brain regions was done with utmost care in the time-course study, where the variation in the data was notably smaller and the effects of ethanol and rat line can be discerned. Still, the data for all brain regions are shown for the sake of completeness of the studies. In summary, the present study demonstrated that the innate expression of BDNF in several brain regions between the AA and ANA rats may be associated with the level of ethanol self-administration and possibly in the predisposition to develop addiction to ethanol and other drugs of abuse. Acute administration of ethanol also modulated the expression of BDNF in all the investigated brain regions, while a difference between AA and ANA rat lines was found only in the frontal cortex. In conjunction with our previous findings, this study confirmed that there are regional differences in the interaction between ethanol and the BDNF system and a complex role for BDNF in the acute effects of ethanol.

5.

Experimental procedure

5.1.

Animals

A total of 220 three-month-old male AA and ANA rats from generations F101 and F102 weighing 259–449 g (AA: 32272 g, ANA: 37573 g; mean7SEM) at the time of experiment were used in the present study. Rats were housed pair-wise or in groups of three in plastic cages (makrolon IV 56 cm  34 cm  19 cm) in a

temperature and humidity controlled room with food (SDS RM1 (E) SQC, Witham, Essex, England) and water available ad libitum. The light/dark cycle was 12/12 h (lights on at 0600 h) and the experiments were conducted during the light phase of the cycle. All experimental procedures using animals were carried out in accordance with the European Communities Council Directive (2007/526/EEC) and the National Animal Welfare Act and were reviewed and approved according to the Act on the Use of Animals for Experimental Purposes (62/2006) by the National Animal Ethics Committee in Finland.

5.2.

Chemicals and reagents

Ethanol (Etax A, 96% v/v) was purchased from Altia (Rajamäki, Finland). TRI reagent and Polyacryl Carrier were purchased from Molecular Research Center Inc. (Cincinnati, OH, USA). DNAse I recombinant RNAse free was obtained from Roche (Basel, Switzerland). The DyNAmo cDNA synthesis kit with M-MuLV RNase Hþ reverse transcriptase including RNAse inhibitor, the Phusion High-Fidelity PCR kit and the DyNAmo Flash SYBR Green qPCR kit were purchased from Finnzymes (Espoo, Finland). Saline, sterile water and nuclease-free water were obtained from the in-house laboratory equipment unit. All primers were synthesized by Oligomer (Helsinki, Finland).

5.3.

Administration of ethanol

Effects of ethanol on BDNF expression were studied in a dose response and in a time course study (with generations F101 and F102, respectively). Rats received habituation injections of saline on alternate days prior to the experiment day, totaling 4–6 habituations per rat. For the dose response study, the rats were injected intraperitoneally with 1.5 or 3 g/kg ethanol (12% w/v in saline) or saline and sacrificed 3 h after the injection. Based on the results of the dose response study, ethanol doses of 3 g/kg and saline injections were employed in the time course study, where the rats were sacrificed 90 min, 3 h, 6 h or 24 h after the intraperitoneal injection. Rats were sacrificed with carbon dioxide, decapitated and their brains were rapidly removed and frozen on dry ice. The frontal cortex was dissected and samples of nucleus accumbens, amygdala, hippocampus and ventral tegmental area were taken from frozen brain slices cut with a microtome. Samples of nucleus accumbens (2.7–1.5 mm anterior to bregma as given in the atlas of rat brain (Paxinos and Watson, 1998) were taken with a puncher of 2 mm in diameter from 1.2 mm thick brain slices, and those of the ventral tegmental area (5.2–6.2 mm posterior to bregma) from 1 mm thick brain slices with a puncher of 1.2 mm in diameter. The hippocampus was dissected bilaterally from a slice of 1 mm thickness (3.0–4.0 mm posterior to bregma). Samples for the amygdala were taken with a 2 mm puncher or using a scalpel from a slice of 1.2 mm in thickness (1.8– 3.0 mm posterior to bregma). Brains were kept frozen during the procedure to minimize RNA degradation and all samples were stored at 70 1C.

brain research 1579 (2014) 74–83

5.4.

RNA extraction and cDNA synthesis

Total RNA was extracted using TRI reagent according to the protocol of the manufacturer, with 3–5 ml of Polyacryl Carrier added to the homogenization solution to obtain a better yield. The RNA concentrations and purity were quantified with a spectrophotometer (NanoView Plus, GE Healthcare, Buckinghamshire, England) according to optical density. Solutions of equal concentrations were prepared from the samples of each brain area and samples were treated with DNAse I recombinant RNAse free at 37 1C for 20 min followed by inactivation at 75 1C for 10 min. In the dose response study, 0.8 mg of total RNA for ventral tegmental area, 5 mg for frontal cortex and hippocampus, 3.3 mg for nucleus accumbens, and 2.4 mg for amygdala was used to synthesize cDNA with random hexamers using DyNAmo cDNA synthesis kit. In the time course study, 0.88 mg of total RNA for the ventral tegmental area and 3.5 mg for the frontal cortex, nucleus accumbens, amygdala, and hippocampus were used instead to optimize reagent use. The reaction was run at 25 1C for 10 min for the primer extension, at 45 1C for 30 min for cDNA synthesis and at 85 1C for 5 min for reaction termination. The resulting first-strand cDNA solution was diluted from two- to four-fold with nuclease free water for downstream stages. PCR was performed with a Phusion High-Fidelity PCR kit according to the protocol of the manufacturer using Hdac7a primers to check for genomic contamination, (gene accession number XM_345868.4, F: TAGCCAGCAGTGTGGTCAAG, R: CCAAGGGCTCAAGAGTTCTG). PCR products were subjected to 1.5% agarose gel electrophoresis to ensure purity of the samples and exclude genomic contamination.

5.5.

Real-time quantitative PCR

Real-time quantitative PCR (RT-qPCR) was performed with an ABI PRISM 7300 instrument (Applied Biosystems, Carlsbad, CA, USA). In the dose response study, a 20 ml reaction mixture volume was used containing 10 ml of DyNAmo Flash SYBR Green MasterMix, 8 ml of diluted cDNA solution, 300 nmol/l primer pairs, and 1  ROX reference dye. In the time-course study, reaction volumes of 10 and 20 ml were used, containing 5 or 10 ml DyNAmo Flash SYBR Green MasterMix and 4.5 or 8 ml of diluted cDNA solution, respectively, with 300 nmol/l primer pairs and 1  ROX reference dye. All assays were run in duplicates or triplicates. Glyceraldehyde-3-phosphate dehydrogenase was chosen as a housekeeping gene for normalization. The following forward (F) and reverse (R) primers were used for BDNF (gene accession number NM_012513.3, product length 135 base pairs) as the target gene, F: GAAGGCTGCAGGGGCATAGAC and R: TACACAGGAAGTGTCTATCCTTAT, and for GAPDH (glyceraldehyde 3-phosphate dehydrogenase, gene accession number XR_085886.2, product length 121 bp) as the housekeeping gene, F: GGTGAAGGTCGGTGTGAACGG and R: CATGTAGTTGAGGTCAATTGAAG GG.. The nucleic acid sequence for BDNF was chosen to match the sequence for the exon IX of the BDNF gene, which is included in all BDNF mRNA splicing variants (Aid et al., 2007). Thus, detecting the presence of the exon IX should be sufficient to detect all instances of BDNF mRNA regardless of the specific splicing variant produced. The thermal profile for the PCR was as follows: initial denaturation at 95 1C for 7 min,

81

followed by 40 cycles of denaturation at 95 1C for 10 s, annealing at 63 1C for 15 s, and extension at 74 1C for 30 s. Detection of the fluorescent products was carried out at the end of each extension phase. In each plate double or triple non-template controls (NTC) and a triple inter-plate calibration sample was also run. The baseline was determined automatically and threshold cycle values were set manually for each sample following a calibration within the target gene plates and housekeeping gene plates. To confirm application specificity, the PCR products from every sample were subjected to a melting curve analysis (60–95 1C). The amounts of the target gene BDNF mRNA were normalized against the housekeeping gene GAPDH in the corresponding samples. Quantification of the samples was carried out with Sequence Detection Software version 1.2.2 (Applied Biosystems). The expression of the target gene BDNF mRNA with respect to the housekeeping gene GAPDH was calculated using the method presented by Pflaffl (Pfaffl, 2001), using efficiencies 2.073 and 2.056 for BDNF and GAPDH genes, respectively, obtained from preliminary dilution curve analyses. The amounts of the target gene BDNF mRNA were normalized against the housekeeping gene in the corresponding samples.

5.6.

Blood ethanol determination

For blood ethanol determination, two parallel 10 ml trunk blood samples were drawn instantly after decapitation and blown into 90 ml of distilled water in 22 ml gas chromatography vials. The samples were stored at  20 1C until analysis. They were analyzed with headspace gas chromatography (Perking Elmer, GC 8410 gas chromatography and HS 40 headspace autosampler, Shelton, CT, USA) as described elsewhere (Nurmi et al., 1994).

5.7.

Statistical analysis

Group means and standard errors were calculated for each animal group comprising 6–10 animals. All statistical analyses for the BDNF mRNA expression were carried out using IBM SPSS Statistics program (version 20). The criterion of significance was set at 0.05. In the dose response experiment, the analyses were done using two-way analysis of variance (two-way ANOVA), with ethanol treatment (saline, 1.5 g/kg, or 3 g/kg) and rat line (AA or ANA) as independent variables. In the time course experiment, three-way ANOVA was used, with treatment (saline or 3 g/kg ethanol), rat line (AA or ANA), and time point (decapitation after 90 min, 3 h, 6 h, or 24 h of injection) as independent variables. Ethanol groups of each time point were compared with a saline group of the corresponding time point. In the study of basal levels, the control groups were combined from both the dose response and the time course experiments, resulting in a group size of 45–49 animals. These groups were then considered for the analysis of the basal levels, and were analyzed using twoway ANOVA with brain region and rat line as independent variables. If significant main or interactions effects were found in the analyses, the data were analyzed again for each rat line separately and finally with one-way ANOVAs to find significant differences between each corresponding treatment and control group (as shown with stars in Figs. 1–3). For the blood ethanol concentration experiment, three-way ANOVA was used as well,

82

brain research 1579 (2014) 74–83

with ethanol dosage, rat line, and time point as independent variables.

Conflict of interest The authors declare no conflict of interest.

Acknowledgments This work was funded by the Finnish Foundation for Alcohol Studies. The authors thank Ms. Leena Tanner-Väisänen for skillful technical assistance.

references

Aid, T., Kazantseva, A., Piirsoo, M., Palm, K., Timmusk, T., 2007. Mouse and rat BDNF gene structure and expression revisited. J. Neurosci. Res. 85, 525–535. Autry, A.E., Monteggia, L.M., 2012. Brain-derived neurotrophic factor and neuropsychiatric disorder. Pharmacol. Rev. 64, 238–258. Bahi, A., Dreyer, J., 2013. Striatal modulation of BDNF expression using microRNA124a-expressing lentiviral vectors impairs ethanol-induced conditioned-place preference and voluntary alcohol consumption. Eur. J. Neurosci. 38, 2328–2337. Bahi, A., Boyer, F., Dreyer, J., 2008. Role of accumbens BDNF and TrkB in cocaine-induced psychomotor sensitization, conditioned-place preference, and reinstatement in rats. Psychopharmacology 199, 169–182. Berhow, M.T., Russell, D.S., Terwilliger, R.Z., Beitner-Johnson, D., Self, D.W., Lindsay, R.M., Nestler, E.J., 1995. Influence of neurotrophic factors on morphine- and cocaine-induced biochemical changes in the mesolimbic dopamine system. Neuroscience 68, 969–979. Bramham, C.R., Messaoudi, E., 2005. BDNF function in adult synaptic plasticity: the synaptic consolidation hypothesis. Prog. Neurobiol. 76, 99–125. Chao, M.V., 2003. Neurotrophins and their receptors: a convergence point for many signalling pathways. Nat. Rev. Neurosci. 4, 299–309. Chick, J., Erickson, C.K., 1996. Conference summary: consensus conference on alcohol dependence and the role of pharmacotherapy in its treatment 20, 391–402Alcohol. Clin. Exp. Res. 20, 391–402. Conner, J.M., Lauterborn, J.C., Yan, Q., Gall, C.M., Varon, S., 1997. Distribution of brain-derived neurotrophic factor (BDNF) protein and mRNA in the normal adult rat cns: evidence for anterograde axonal transport. J. Neurosci. 17, 2295–2313. Cowansage, K.K., LeDoux, J.E., Monfils, M., 2010. Brain-derived neurotrophic factor: a dynamic gatekeeper of neural plasticity. Curr. Mol. Pharmacol. 3, 12–29. Davis, M.I., 2008. Ethanol-BDNF interactions: still more questions than answers. Pharmacol. Ther. 118, 36–57. Eriksson, K., 1968. Genetic selection for voluntary alcohol consumption in the albino rat. Science 159, 739–741. Ghitza, U.E., Zhai, H., Wu, P., Airavaara, M., Shaham, Y., Lu, L., 2010. Role of BDNF and GDNF in drug reward and relapse: a review. Neurosci. Biobehav. Rev. 35, 157–171. Goggi, J., Pullar, I.A., Carney, S.L., Bradford, H.F., 2002. Modulation of neurotransmitter release induced by brain-derived neurotrophic factor in rat brain striatal slices in vitro. Brain Res. 941, 34–42.

Graham, D.L., Edwards, S., Bachtell, R.K., DiLeone, R.J., Rios, M., Self, D.W., 2007. Dynamic BDNF activity in nucleus accumbens with cocaine use increases self-administration and relapse. Nat. Neurosci. 10, 1029–1037. Hauser, S.R., Getachew, B., Taylor, R.E., Tizabi, Y., 2011. Alcohol induced depressive-like behavior is associated with a reduction in hippocampal BDNF. Pharmacol. Biochem. Behav. 100, 253–258. Hensler, J.G., Ladenheim, E.E., Lyons, W.E., 2003. Ethanol consumption and serotonin-1A (5-HT1A) receptor function in heterozygous BDNF (þ/ ) mice. J. Neurochem. 85, 1139–1147. Hodge, C.W., Chappelle, A.M., Samson, H.H., 1996. Dopamine receptors in the medial prefrontal cortex influence ethanol and sucrose-reinforced responding. Alcohol. Clin. Exp. Res. 20, 1631–1638. Hofer, M., Pagliusi, S.R., Hohn, A., Leibrock, J., Barde, Y., 1990. Regional distribution of brain-derived neurotrophic factor mRNA in the adult mouse brain. EMBO J. 9, 2459–2464. Jeanblanc, J., He, D., McGough, N.N.H., Logrip, M.L., Phamluong, K., Janak, P.H., Ron, D., 2006. The dopamine D3 receptor is part of a homeostatic pathway regulating ethanol consumption. J. Neurosci. 26, 1457–1464. Jeanblanc, J., He, D., Carnicella, S., Kharazia, V., Janak, P.H., Ron, D., 2009. Endogenous BDNF in the dorsolateral striatum gates alcohol drinking. J. Neurosci. 29, 13494–13502. Jeanblanc, J., Logrip, M.L., Janak, P.H., Ron, D., 2013. BDNFmediated regulation of ethanol consumption requires the activation of the MAP kinase pathway and protein synthesis. Eur. J. Neurosci. 37, 607–612. Kaste, K., Kivinummi, T., Piepponen, T.P., Kiianmaa, K., Ahtee, L., 2009. Differences in basal and morphine-induced FosB/ΔFosB and pCREB immunoreactivities in dopaminergic brain regions of alcohol-preferring AA and alcohol-avoiding ANA rats. Pharmacol. Biochem. Behav. 92, 655–662. Kerns, R.T., Ravindranathan, A., Hassan, S., Cage, M.P., York, T., Sikela, J.M., Williams, R.W., Miles, M.F., 2005. Ethanolresponsive brain region expression networks: implications for behavioral responses to acute ethanol in DBA/2J versus C57BL/ 6J mice. J. Neurosci. 25, 2255–2266. Keun-Ho, J., Yong-Ku, K., Tae-Suk, K., Sung-Won, R., Sam-Wook, C., Young-Bo, K., Hee-Jin, L., Dai-Jin, K., 2007. Decreased plasma brain-derived neurotrophic factor levels in patients with alcohol dependence. Alcohol. Clin. Exp. Res. 31, 1833–1838. Kiianmaa, K., Hyytia¨, P., Sinclair, J.D., 1992. Development of an animal model of ethanol abuse. In: Boulton, A., Baker, G.B., Wu, P.H. (Eds.), Neuromethods, 24. Humana Press, Totowa, NJ, pp. 29–63. Koob, G.F., 1992. Drugs of abuse: anatomy, pharmacology and function of reward pathways. Trends Pharmacol. Sci. 13, 177–184. Koob, G.F., Roberts, A.J., Schulteis, G., Parsons, L.H., Heyser, C.J., Hyytia, P., Merlo-Pich, E., Weiss, F., 1998. Neurocircuitry targets in ethanol reward and dependence. Alcohol. Clin. Exp. Res. 22, 3–9. Koob, G.F., Le Moal, M., 2006. Neurobiology of Addiction. Elsevier, Amsterdam, The Netherlands. Kulkarny, V.V., Wiest, N.E., Marquez, C.P., Nixon, S.C., Valenzuela, C.F., Perrone-Bizzozero, N.I., 2011. Opposite effects of acute ethanol exposure on GAP-43 and BDNF expression in the hippocampus versus the cerebellum of juvenile rats. Alcohol 45, 461–471. Leˆ, A.D., Kiianmaa, K., 1988. Characteristics of ethanol tolerance in alcohol drinking (AA) and alcohol avoiding (ANA) rats. Psychopharmacology 94, 479–483. Lewin, G.R., Barde, Y., 1996. Physiology of the neurotrophins. Annu. Rev. Neurosci. 19, 289–317.

brain research 1579 (2014) 74–83

Lipsky, R.H., Marini, A.M., 2007. Brain-derived neurotrophic factor in neuronal survival and behavior-related plasticity. Ann. N. Y. Acad. Sci. 1122, 130–143. Logrip, M.L., Janak, P.H., Ron, D., 2008. Dynorphin is a downstream effector of striatal BDNF regulation of ethanol intake. FASEB J. 22, 2393–2404. Logrip, M.L., Janak, P.H., Ron, D., 2009. Escalating ethanol intake is associated with altered corticostriatal BDNF expression. J. Neurochem. 109, 1459–1468. Lu, L., Dempsey, J., Liu, S.Y., Bossert, J.M., Shaham, Y., 2004. A single infusion of brain-derived neurotrophic factor into the ventral tegmental area induces long-lasting potentiation of cocaine seeking after withdrawal. J. Neurosci. 24, 1604–1611. Matsushita, S., Kimura, M., Miyakawa, T., Yoshino, A., Murayama, M., Masaki, T., Higuchi, S., 2004. Association study of brainderived neurotrophic factor gene polymorphism and alcoholism. Alcohol. Clin. Exp. Res. 28, 1609–1612. McBride, W.J., Li, T.K., 1998. Animal models of alcoholism: neurobiology of high alcohol-drinking behavior in rodents. Crit. Rev. Neurobiol. 12, 339–369. McGinty, J.F., Whitfield Jr., T.W., Berglind, W.J., 2010. Brain-derived neurotrophic factor and cocaine addiction. Brain Res. 1314, 183–193. McGough, N.N.H., He, D., Logrip, M.L., Jeanblanc, J., Phamluong, K., Luong, K., Kharazia, V., Janak, P.H., Ron, D., 2004. RACK1 and brain-derived neurotrophic factor: a homeostatic pathway that regulates alcohol addiction. J. Neurosci. 24, 10542–10552. Moonat, S., Sakharkar, A.J., Zhang, H., Pandey, S.C., 2011. The role of amygdaloid brain-derived neurotrophic factor, activityregulated cytoskeleton-associated protein and dendritic spines in anxiety and alcoholism. Addict. Biol. 16, 238–250. Nestler, E.J., Barrot, M., DiLeone, R.J., Eisch, A.J., Gold, S.J., Monteggia, L.M., 2002. Neurobiology of depression. Neuron 34, 13–25. Numan, S., Seroogy, K.B., 1999. Expression of trkB and trkC mRNAs by adult midbrain dopamine neurons: a double-label in situ hybridization study. J. Comp. Neurol. 403, 295–308. Nurmi, M., Kiianmaa, K., Sinclair, J.D., 1994. Brain ethanol in AA, ANA, and Wistar rats monitored with one-minute microdialysis. Alcohol 11, 315–321. Ojanen, S., Koistinen, M., Ba¨ckstro¨m, P., Kankaanpa¨a¨, A., Tuomainen, P., Hyytia¨, P., Kiianmaa, K., 2003. Differential behavioural sensitization to intermittent morphine treatment in alcohol-preferring AA and alcohol-avoiding ANA rats: role of mesolimbic dopamine. Eur. J. Neurosci. 17, 1655–1663. Pandey, S.C., Zhang, H., Roy, A., Misra, K., 2006. Central and medial amygdaloid brain-derived neurotrophic factor signaling plays a critical role in alcohol-drinking and anxietylike behaviors. J. Neurosci. 26, 8320–8331. Pandey, S.C., Zhang, H., Ugale, R., Prakash, A., Xu, T., Misra, K., 2008. Effector immediate-early gene arc in the amygdala plays a critical role in alcoholism. J. Neurosci. 28, 2589–2600. Paxinos, G., Watson, C., 1998. The Rat Brain in Stereotaxic Coordinates, fourth ed Academic Press, San Diego. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucl. Acids Res. 29, e45. Pierce, R.C., Pierce-Bancroft, A.F., Prasad, B.M., 1999. Neurotrophin-3 contributes to the initiation of behavioral sensitization to cocaine by activating the ras/mitogen-activated protein kinase signal transduction cascade. J. Neurosci. 19, 8685–8695. Prakash, A., Zhang, H., Pandey, S.C., 2008. Innate differences in the expression of brain-derived neurotrophic factor in the

83

regions within the extended amygdala between alcohol preferring and nonpreferring rats. Alcohol. Clin. Exp. Res. 32, 909–920. Raivio, N., Tiraboschi, E., Saarikoski, S.T., Castre´n, E., Kiianmaa, K., 2012. Brain-derived neurotrophic factor expression after acute administration of ethanol. Eur. J. Pharmacol. 687, 9–13. Rue´da, A.V.L., Teixeira, A.M.A., Yonamine, M., Camarini, R., 2012. Environmental enrichment blocks ethanol-induced locomotor sensitization and decreases BDNF levels in the prefrontal cortex in mice. Addict. Biol. 17, 736–745. Russo, S.J., Mazei-Robison, M.S., Ables, J.L., Nestler, E.J., 2009. Neurotrophic factors and structural plasticity in addiction. Neuropharmacology 56, 73–82. Sarviharju, M., Riikonen, J., Jaatinen, P., Sinclair, D., Hervonen, A., Kiianmaa, K., 2004. Survival of AA and ANA rats during lifelong ethanol exposure. Alcohol. Clin. Exp. Res. 28, 93–97. Schuman, E.M., 1999. Neurotrophin regulation of synaptic transmission. Curr. Opin. Neurobiol. 9, 105–109. Shen, F., Meredith, G.E., Napier, T.C., 2006. Amphetamine-induced place preference and conditioned motor sensitization requires activation of tyrosine kinase receptors in the hippocampus. J. Neurosci. 26, 11041–11051. Shirayama, Y., Chen, A.C., Nakagawa, S., Russell, D.S., Duman, R.S., 2002. Brain-derived neurotrophic factor produces antidepressant effects in behavioral models of depression. J. Neurosci. 22, 3251–3261. Sommer, W., Hyytia¨, P., Kiianmaa, K., 2006. The alcohol-preferring AA and alcohol-avoiding ANA rats: neurobiology of the regulation of alcohol drinking. Addict. Biol. 11, 289–309. Tapia-Atancibia, L., Rage, F., Givalois, L., Dingeon, P., Arancibio, S., Beauge´, F., 2001. Effects of alcohol on brain-derived neurotrophic factor mRNA expression in discrete regions of the rat hippocampus and hypothalamus. J. Neurosci. Res. 63, 200–208. Ting-A-Kee, R., Vargas-Perez, H., Bufalino, M., Bahi, A., Dreyer, J., Tyndale, R.F., Kooy, D., 2013. Infusion of brain-derived neurotrophic factor into the ventral tegmental area switches the substrates mediating ethanol motivation. Eur. J. Neurosci. 37, 996–1003. Vargas-Perez, H., Kee, R.T., Walton, C.H., Hansen, D.M., Razavi, R., Clarke, L., Bufalino, M.R., Allison, D.W., Steffensen, S.C., van der Kooy, D., 2009. Ventral tegmental area BDNF Induces an opiate-dependent-like reward state in naive rats. Science 324, 1732–1734. Volkow, N.D., Fowler, J.S., Wang, G.J., Goldstein, R.Z., 2002. Role of dopamine, the frontal cortex and memory circuits in drug addiction: insight from imaging studies. Neurobiol. Learn. Mem. 78, 610–624. Wallgren, H., Barry III, H., 1970. Actions of Alcohol, 1. Elsevier, Amsterdam, The Netherlands. Wise, R.A., 1998. Drug-activation of brain reward pathways. Drug Alcohol Depend. 51, 13–22. Yan, Q., Feng, M., Yan, S., 2005. Different expression of brainderived neurotrophic factor in the nucleus accumbens of alcohol-preferring (P) and -nonpreferring (NP) rats. Brain Res. 1035, 215–218. Zafra, F., Castre`n, E., Thoenen, H., Lindholm, D., 1991. Interplay between glutamate and y-aminobutyric acid transmitter systems in the physiological regulation of brain-derived neurotrophic factor and nerve growth factor synthesis in hippocampal neurons. Proc. Natl. Acad. Sci. USA 88, 10037–10041.