- Email: [email protected]
Inositol 1,4,5-trisphosphate receptor expression in mammalian olfactory tissue
Molecular Brain Research 44 Ž1997. 347–354
Short communication
Inositol 1,4,5-trisphosphate receptor expression in mammalian olfactory tissue Gregory Smutzer a b
a,)
, John E. Zimmerman a,1, Chang-Gyu Hahn a,2 , Delta D. Ruscheinsky a , a Amaris Rodrıguez , Li-Ying Han a , Steven E. Arnold a,b ´
Department of Psychiatry, UniÕersity of PennsylÕania School of Medicine, Philadelphia, PA 19104, USA Department of Neurology, UniÕersity of PennsylÕania School of Medicine, Philadelphia, PA 19104, USA Accepted 8 October 1996
Abstract Two cDNAs encoding inositol 1,4,5-trisphosphate ŽIP3 . receptors were amplified from rat olfactory tissue, and both exhibited 100% sequence identity to the short ŽSegment II y . variant of type I IP3 receptor. Type III IP3 receptor was also expressed in olfactory tissue. The distribution of IP3 receptors included the olfactory epithelium, lamina propria, and glandular tissue. These results demonstrate the co-expression of multiple IP3 receptor subtypes in olfactory cells, and suggest multiple functions for IP3 receptors in this tissue. Keywords: IP3 receptor; Gene expression; Olfaction; Alternate splicing; Signal transduction; Sensory epithelium; Secretion; Calcium channel
Many cellular responses are mediated by the second messengers o-myo-inositol 1,4,5-trisphosphate ŽIP3 . and snŽ1,2.-diacylglycerol ŽDAG. w3x. The synthesis of IP3 and DAG can be stimulated by two separate signal transduction pathways w3,17x. In both pathways, the subsequent binding of IP3 to a tetameric receptor channel can regulate the quantal release of calcium into the cytoplasm w3x. IP3 receptors exhibit heterogeneity at the genetic level since three major IP3 receptor subtypes, named types I, II, and III, have been reported w4,11,13,18x. Further IP3 receptor heterogeneity arises from alternate splicing since type I receptor is spliced at two distinct sites w6,13x, and one alternately spliced fragment named Segment II ŽSII., may be neuron-specific w6,13x. Finally, receptor heterogeneity occurs from subunit mixing since IP3 receptors can assemble into functional heterotetrameric complexes of specific receptor subtypes w8,12,23x. Type I, II, and III IP3 recep-
) Corresponding author. Department of Psychiatry, University of Pennsylvania School of Medicine, 111 Clinical Research Building, 415 Curie Boulevard, Philadelphia, PA 19104, USA. Fax: q1 Ž215. 573-2041; E-mail: [email protected] 1 Present address: Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. 2 Present address: Department of Psychiatry, Allegheney University of the Health Sciences, Broad and Vine Streets, Philadelphia, PA 19103, USA.
tors possess different binding affinities for IP3 w14x; furthermore, these receptors may be differentially regulated by proteolysis w22x and possibly by phosphorylation w6,10,13x. This heterogeneity suggests that IP3 receptor subtypes are functionally diverse. In this report, the expression of IP3 receptor subtypes is characterized in mammalian olfactory tissue by DNA sequence analysis, RNase protection, Northern analysis, in situ hybridization, and immunocytochemistry. Adult rat olfactory tissue, cerebellum, and cortex were dissected from Sprague-Dawley rats. Human cerebellar tissue was from the Mental Health Clinical Research Center in Schizophrenia at the University of Pennsylvania. Rat pituitary GH 3 cells were grown in Dulbecco’s modified Eagle’s medium with low glucose and 10% bovine calf serum with antibiotics. Total RNA was prepared by acidphenol extraction or by TRIzol extraction ŽGibco-BRL.. Reverse-transcriptase PCR ŽRT-PCR. was carried out with the Perkin-Elmer RNA-PCR core kit according to the manufacturer’s instructions. Primers for amplification of a transmembrane region of type I receptor were GAACAGGATAAGGAGCACACG Žforward ., and AGATTGGTGACCAGCTTCATGG Žreverse.. Reaction conditions were 1 min at 948C, 1 min at 608C, and 3 min at 728C for 50 cycles. Primers for amplification of the alternately spliced region that flanked segment II of type I IP3 receptor were TCGTGGATGTTCTACACAGACC
0169-328Xr97r$17.00 Copyright q 1997 Elsevier Science B.V. All rights reserved. PII S 0 1 6 9 - 3 2 8 X Ž 9 6 . 0 0 2 8 2 - 3
348
G. Smutzer et al.r Molecular Brain Research 44 (1997) 347–354
Žforward., and CACTGTCGCCTTGATTTCCTGC Žreverse.. Reaction conditions were 1 min at 948C, 1 min at 488C, and 1 min at 728C for 35 cycles. DNA fragments of predicted size were directly cloned into the pCRII vector ŽInvitrogen. using the TA cloning kit, and transformed w19x. Amplified DNA was sequenced by the Sequenase system ŽUS Biochemicals.. For Northern analysis, pre-hybridization and hybridization occurred at 42 or 458C in 50% formamide by standard procedures w2x. The cDNA previously amplified from a transmembrane domain of type 1 IP3 receptor Žclone pUP3. was excised by EcoRI digestion, purified, and labeled by random primer w19x. A PAGE-purified oligonucleotide unique to the alternately spliced segment SII was commercially synthesized ŽKeystone Labs.. The sequence was 5X-CAAGCTCCTCTGTGGACTTCTCAGCTTCCGGTGGCTGTGGCAGCTCGGC-3X , and corresponded to nucleotides 5433–5481 of rat type I IP3 receptor w10x. Finally, a PAGE-purified antisense oligonucleotide that represented a unique sequence of rat type III IP3 receptor was commercially synthesized. This sequence was 5X-CTGCTTGTTGTTGAGGCTGAGCATGGAAGAGATGCCCTCGGCCTCCTC-3X , and corresponded to nucleotides 6368– 6416 w4x. Both oligomers were end-labeled with deoxynucleotidyl transferase and 32 P-dATP w19x, and hybridized to RNA as described above. The DNA sequence of clone pUP7 both spans, and includes, segment II of type I IP3 receptor. This DNA was used to identify the expression of SII splice variants in tissue. An antisense probe for RNase protection was prepared by in vitro transcription with SP6 DNA-dependent RNA polymerase, and RNA was hybridized with 5 = 10 4 dpm of riboprobe at 658C w2x. For histological studies, entire nasal structures from 31–35 day old adult rats were removed and frozen in isopentane at y408C. Antisense transcripts from the transmembrane probe pUP3 detected IP3 receptor expression by in situ hybridization. 16-m m-thick fresh-frozen sections of rat olfactory tissue and adult human cerebellums were sectioned and thaw-mounted onto ProbeOnq slides. 35 Slabeled antisense RNA probes were synthesized by standard means w1x. Sense transcripts were also synthesized and processed exactly as above. Antibodies prepared to synthetic peptides of the Ctermini of types I and III IP3 receptors are specific for their cognate peptides w8,22,23x. Antibody T210 is specific for type I IP3 receptor, and antibody CT-3 is specific for type III receptor w8,11,21x. For immunohistochemistry, primary antibodies were localized to tissue with a horseradish peroxidase-conjugated anti-rabbit IgG, and 3X 3X-diaminobenzidinerH 2 O 2 was used for the chromogenic reaction. For antibody T210, primary antibody was pre-absorbed with a 20-fold excess of peptide antigen before incubation with tissue to demonstrate antigenic specificity. For further identification of type I and III IP3 receptor antibody reactivity, rat and human post-mortem olfactory tissue was
decalcified, fixed, and embedded. This tissue was processed for immunocytochemistry as described above for comparison to fresh-frozen tissue. The results show that IP3 receptor cDNA from rat olfactory tissue was amplified with primers to the highly conserved transmembrane domain seven of type I IP3 receptor. This transmembrane domain shows high DNA sequence identity among the three major vertebrate and invertebrate IP3 receptor subtypes and to ryanodine receptor w4,6,10,11,18,25x. This primer pair consistently amplified a product of 575 bases in length, and no other product sizes were detected Ždata not shown; GenBank Accession No. U38812.. This amplicon exhibited 100% DNA sequence identity to type I Žcerebellar. IP3 receptor previously identified w10x. These findings indicate that a population of IP3 receptors expressed in rat olfactory tissue contained transmembrane sequences that were identical to type I IP3 receptor. If type I IP3 receptor is expressed in rat olfactory tissue, a second amplified fragment from this tissue should show sequence identity to type I receptor. Furthermore, alternate splicing of type I receptor produces two alternately spliced variants that differ in length by 117 bp. Amplification of a second DNA fragment of type I receptor that included this splice site would determine if either or both splice variants was expressed in olfactory tissue. Sequence analysis of this product would confirm type I IP3 receptor expression in this tissue. A DNA fragment that traversed the SII splice site was amplified, and this amplification yielded a single product of 629 bp. The DNA sequence of this product also shared 100% sequence identity to the SII y variant of type I IP3 receptor Ždata not shown; GenBank Accession No. U38653.. These two DNA fragments thus represented the DNA sequence of type I IP3 receptor cDNA, and suggested that only SII y splice variants were expressed in rat olfactory tissue. Finally, RT-PCR analysis of rat cerebellar RNA with these identical primers amplified a DNA sequence of 746 bp in length that exhibited 100% sequence identity to SII q Žneuronal. form of type I receptor Ždata not shown; GenBank Accession No. U38665.. The expression of type I IP3 receptor splice variants was analyzed by RNase protection studies with the amplified cDNA from rat cerebellum that included the SII q splice variant. RNA populations that express only SII y splice variants of IP3 receptor would protect only the two fragments that flank this splice site – fragments of 200 and 429 nucleotides, respectively. In RNA that contains only the SII q receptor variant, a single fragment of 746 bp would be protected. In RNA that contains both alternately spliced transcripts, fragments of 746, 429, and 200 nucleotides would be protected. In tissue that expresses additional IP3 receptor subtypes, further complexity in the number and size of protected fragments may arise from sequence heterogeneity. RNase protection of RNA from rat olfactory tissue, rat cortex, and rat GH 3 cells that hybridized to the SII q IP3 receptor riboprobe are shown in
G. Smutzer et al.r Molecular Brain Research 44 (1997) 347–354
Fig. 1A ŽGH 3 cells are derived from rat pituitary secretory cells, and this autostimulating cell line exhibits high levels of IP3 binding w9x.. Two protected fragments of f 425 and 200 bases were observed in all three RNA samples; furthermore, the SII q IP3 receptor probe hybridized to fragments of identical size, number, and intensity in both rat olfactory and GH 3 cellular RNA. These two RNA populations revealed considerably fewer protected fragments Žand intensity of hybridization signal. when compared to cortex. In contrast, a band of f 725 nucleotides in length was protected in rat cortex, but was absent in both rat olfactory and GH 3 RNA. The signal corresponded to SII q transcripts of type I IP3 receptor. These results further indicated that the SII q Žneuronal. splice variant was not expressed in either rat olfactory tissue or in GH 3 cell while the SII y transcript was expressed in all three tissues. Based on DNA sequence identity to type I receptor, these results suggested that type I IP3 receptor transcripts expressed in rat olfactory tissue should be similar in size to cerebellar transcripts. Northern analysis was undertaken to determine relative message size and expression levels of IP3 receptors in tissue. The transmembrane probe pUP3 of type I IP3 receptor exhibits 77 and 79% sequence identity to types II and III receptors, respectively. This cDNA was used to identify overall IP3 receptor expression. A single message that corresponded to a size of f 9.5 kb was
349
observed in both rat olfactory and rat cerebellar tissue ŽFig. 1B.. Furthermore, no other hybridization signals were observed with either olfactory or cerebellar RNA. Similar results have been reported with a transmembrane probe of type I IP3 receptor cloned from rat cerebellum w20x. Finally, IP3 receptor expression was considerably greater in rat cerebellar tissue than in olfactory tissue. To measure expression of SII q splice variants of type I receptor by Northern analysis, an antisense oligonucleotide of segment II was hybridized to total RNA. This oligonucleotide demonstrated a strong hybridization signal near 9.5 kb in rat cerebellar tissue with no corresponding hybridization signal in rat olfactory RNA at identical RNA concentrations ŽFig. 1C.. In summary, DNA sequence analysis, RNase protection, and Northern analysis all demonstrated that the SII q variant of type I IP3 receptor was expressed in cerebellar tissue while only the SII y variant was expressed in olfactory tissue. Next, type III IP3 receptor expression was measured in rat olfactory RNA. Northern analysis demonstrated a strong hybridization signal near 9.5 kb in rat olfactory tissue with essentially no signal in rat cerebellar tissue ŽFig. 1D.. These results indicate that type III IP3 receptor is expressed in rat olfactory tissue, but not in rat cerebellum. In situ hybridization studies with the transmembrane probe pUP3 previously amplified from rat olfactory tissue
Fig. 1. A: RNase protection of SII IP3 receptor splice variants expressed in rat tissue and in GH 3 cells. Lane 1, antisense probe; lanes 2 and 3, 30 m g rat olfactory RNA each; lane 4, 15 m g rat cortex RNA; and lane 5, 15 m g GH 3 cell RNA. Sizes of protected fragments are indicated at left. B: Northern analysis of IP3 receptor expression. Lane 1, 15 m g rat olfactory RNA; lane 2, 30 m g rat olfactory RNA; and lane 4, 15 m g rat cerebellar RNA. C: Northern analysis with antisense oligonucleotide of SII segment of rat type I IP3 receptor. Lane 1, 15 m g rat olfactory RNA; lane 2, 30 m g rat olfactory RNA; lane 3, 15 m g rat cerebellar RNA; lane 4, 30 m g rat cerebellar RNA. D: Northern analysis with antisense oligonucleotide of rat type III IP3 receptor. Lane 1, 15 m g rat olfactory RNA; lane 2, 30 m g rat olfactory RNA; lane 4, 15 m g rat cerebellar RNA; lane 5, 30 m g rat cerebellar RNA.
350
G. Smutzer et al.r Molecular Brain Research 44 (1997) 347–354
Fig. 2A–C.
G. Smutzer et al.r Molecular Brain Research 44 (1997) 347–354
were employed to determine the cellular localization and relative expression of IP3 receptors in mammalian olfactory tissue. As shown in Fig. 2, hybridization was carried out with coronal sections of rat olfactory tissue and human post-mortem tissue. In olfactory tissue, a relatively uniform hybridization signal was observed above the olfactory epithelium, and no concentration of signal was observed at the basolateral surface ŽFig. 2A–C.. Within the sensory epithelium, the strongest hybridization was observed at the juncture of the dorsal turbinates and nasal
351
epithelium, and this signal decreased in intensity in the ventral epithelium. Localization of silver grains to specific epithelial cell populations could not be determined. In addition, no silver grains above background were observed around capillary cell walls, or above axons that extended from the sensory epithelium into the lamina propria. In the underlying lamina propria of the main olfactory epithelium, clusters of silver grains were localized above non-sensory cell populations. This clustering of signal was randomly distributed within the lamina propria of olfactory
Fig. 2. In situ hybridization of rat olfactory tissue and human cerebellum. A: bright-field image of unstained rat olfactory tissue. Arrows show clusters of silver grains which appear as dark spots. B: bright-field image of olfactory tissue briefly stained with Nissl to show grain clusters within the lamina propria Žarrows., and silver grains above the olfactory epithelium. C: dark-field image of rat olfactory epithelium showing silver grain clusters in the lamina propria Žwhite arrow., and uniform labeling in the olfactory epithelium and epithelium of nasal turbinates. D: dark-field image of rat olfactory epithelium demonstrating concentration of silver grains above septal glands Žwhite arrow.. Clusters of silver grains in lamina propria that lines both sides of nasal septum appear as bright spots. E: bright-field image of human cerebellar tissue briefly stained with Nissl. Arrows point to clusters of silver grains above individual Purkinje cells, and extended arrow at right points to hybridization signal within dendritic projection of a Purkinje cell. BV, blood vessel; E, epithelial cell layer; ML, molecular layer of cerebellum; NC, nasal cavity; OE, main olfactory epithelium; S, nasal septum; SMG, submucosal gland; T, nasal turbinate.
352
G. Smutzer et al.r Molecular Brain Research 44 (1997) 347–354
Fig. 3. Immunolocalization of IP3 receptor subtypes in rat olfactory tissue. A: bright-field image of septal glands of olfactory epithelium stained with antibodies to type I IP3 receptor. B: bright-field image of olfactory epithelium showing dense staining with type III IP3 receptor antibodies. C: bright-field image of olfactory tissue stained with type III IP3 receptor antibodies showing dense staining of Bowman’s Žsubmucosal. glands, and lateral nasal glands. E, epithelium; G, submucosal glands; LN, lateral nasal glands; NS, nasal septum; OE, olfactory epithelium; SG, septal glands.
G. Smutzer et al.r Molecular Brain Research 44 (1997) 347–354
tissue, and clusters were also localized to the lamina propria of the dorsal and ventral nasal turbinates ŽFig. 2A–C.. Hybridization signal was also detected above the septal glands located near the base of the nasal septum ŽFig. 2D.. Finally, IP3 receptor mRNA was highly expressed in epithelial cells that formed the two nasolacrimal ducts. Connective tissue at the periphery of these ducts also exhibited clusters of silver grains. These results indicated that IP3 receptor expression occurred in a variety of cell types, and suggested that IP3 has multiple functions in olfactory tissue. With sense controls, no clustering of silver grains was observed in the lamina propria. In other chemosensory tissue, no labeling was observed above the olfactory epithelium of channel catfish under identical hybridization conditions Ždata not shown.. Finally, a positive control consisted of in situ hybridization experiments with human cerebellar tissue. This tissue was hybridized with the same IP3 receptor probe under identical conditions. A high density of silver grains was observed in Purkinje cells ŽFig. 2E., and no signal was observed with sense transcripts. Subtype-specific antibodies that recognize type I IP3 receptor stained two regions of rat olfactory tissue ŽFig. 3.. First, low staining was detected in both sensory neurons and sustentacular cells of the olfactory epithelium. The greatest immunoreactivity in this layer occurred in cells located at the juncture of the dorsal turbinate and the olfactory epithelium of the nasal septum. The epithelium also showed labeling by in situ hybridization for IP3 receptor message. Second, dense staining occurred in septal glands of the lamina propria of the main olfactory system. Cells that composed this glandular tissue exhibited a diffuse staining pattern that is consistent with a cytoplasmic localization for IP3 receptor ŽFig. 3A.. Identical staining patterns were observed in both fresh-frozen and paraffin-embedded rat olfactory tissue. Monoclonal antibodies that recognized type III IP3 receptor also demonstrated immunoreactivity in two distinct regions. First, this antibody showed robust staining in both sustentacular and sensory neurons of the sensory epithelium ŽFig. 3B.. Diffuse binding of antibody throughout the cytoplasm of these cells was observed, and is consistent with an endoplasmic reticulum ŽER. location for type III receptor. Second, intense staining was observed in secretory tissue. This tissue included acinar cells of Bowman’s glands, septal glands, and lateral nasal glands ŽFig. 3C.. However, immunoreactivity was not localized to cilia of sensory neurons since immunogold labeling at the surface of the sensory epithelium showed essentially no reactivity above background Ždata not shown.. These immunocytochemical results further demonstrated that multiple IP3 receptor subtypes were expressed in rat olfactory tissue. Finally, these results suggested that multiple IP3 receptor subtypes were localized to sensory neurons, to non-sensory sustentacular cells, and to glandular cells of the main olfactory system. Co-expression of multiple IP3 receptors
353
within cells may be a universal characteristic of the IP3 signaling pathway w14x, and implies that a population of IP3 receptors may exist as heterotetramers in these cells. IP3 receptor subtypes differ in their affinities for ligand w14x, and heterotetrameric channels could display a graduated range of ligand sensitivities for activation and regulation of calcium channel activity w23x. This report is the first systematic characterization of IP3 receptor expression in specific olfactory cell populations. Recent immunocytochemical evidence has localized IP3 receptor proteins to the apical ER of sustentacular cells and to the cilia of sensory neurons w5x. Our results extend these observations to include the localization of multiple IP3 receptor subtypes to the cytoplasm of sensory neurons, sustentacular cells, and secretory cells. The mammalian olfactory system is highly dependent on secretory processes for perireceptor events w16x, and requires a cellular mechanism for regulation of secretory processes. The expression of specific IP3 receptor genes and gene products in secretory cells of olfactory tissue and GH 3 cells is consistent with a role for IP3 in calciummediated secretory processes w7,24x. For example, IP3 and calcium may mediate secretory activity in the sensory epithelium since sustentacular cells may directly secrete serous substances into the mucus layer w15x. Our observations also implicate IP3 in neuronal differentiation since sensory neurons undergo continuous replacement. Finally, the co-expression of multiple IP3 receptor subtypes in both sensory neurons and sustentacular cells of the olfactory epithelium may help to maintain an environment conducive to odorant detection by cell surface receptors. The nucleotide sequences reported in this paper have been submitted to the GenBank Data Bank with Accession Nos. U38812, U38653, and U38665.
Acknowledgements This research was supported by the Johnson and Johnson Focused Giving Program. The authors thank Dr. L. Chamberlin and Ms. S. Greger for their valuable assistance, S. Reskoy, G. Gold, and J. Brand for helpful discussions, and Dr. P. Rittenhouse for rat olfactory tissue. The authors thank Dr. T. Sudhof for antibodies to type I ¨ IP3 receptor, Dr. S. Joseph for antibodies to type III IP3 receptor, and Dr. P. De Camilli for the peptide to type I IP3 receptor. The authors also thank Dr. John Q. Trojanowski for his gift of decalcified human and rat tissue.
References w1x Angerer, L.M. and Angerer, R.C., In situ hybridization to cellular RNA with radiolabelled RNA probes. In Wilkinson, D.G. ŽEd.., In Situ Hybridization, A Practical Approach. IRL Press at Oxford University Press, Oxford, 1992, pp. 15–32.
354
G. Smutzer et al.r Molecular Brain Research 44 (1997) 347–354
w2x Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. ŽEds.., Current Protocols in Molecular Biology, John Wiley and Sons, New York, NY, 1987. w3x Berridge, M.J., Inositol trisphosphate and calcium signalling, Nature, 361 Ž1993. 315–325. w4x Blondel, O., Takeda, J., Janssen, H., Seino, S. and Bell, G.I., Sequence and functional characterization of a third inositol trisphosphate receptor subtype, IP3 R-3, expressed in pancreatic islets, kidney, gastrointestinal tract, and other tissues, J. Biol. Chem. 268 Ž1993. 11356–11363. w5x Cunningham, A.M., Ryugo, D.K., Sharp, A.H., Reed, R.R., Snyder, S.H. and Ronnett, G.V., Neuronal inositol 1,4,5-trisphosphate receptor localized to the plasma membrane of olfactory cilia, Neuroscience 57 Ž1993. 339–352. w6x Danoff, S.K., Ferris, C.D., Donath, C., Fischer, G.A., Munemitsu, S., Ullrich, A., Snyder, S.H. and Ross, C.A., Inositol 1,4,5-trisphosphate receptors: distinct neuronal and nonneuronal forms derived by alternative splicing differ in phosphorylation, Proc. Natl. Acad. Sci. USA 88 Ž1991. 2951–2955. w7x Fujino, I., Yamada, N., Miyawaki, A., Hasegawa, M., Furuichi, T. and Mikoshiba, K., Differential expression of type 2 and type 3 inositol 1,4,5-trisphosphate receptor mRNAs in various mouse tissues: in situ hybridization study, Cell Tiss. Res. 280 Ž1995. 201–210. w8x Joseph, S.K., Lin, C., Pierson, S., Thomas, A.P. and Maranto, A.R., Heteroligomers of type-1 and type-III inositol trisphosphate receptors in WB rat liver epithelial cells, J. Biol. Chem. 270 Ž1995. 23310–23316. w9x Lucas, D.O., Bajjalieh, S.M., Kowalchyk, J.A. and Martin, T.F.J., Direct stimulation by thyrotropin-releasing hormone ŽTRH. of polyphosphoinositide hydrolysis in GH 3 cell membranes by a guanine nucleotide-modulated mechanism, Biochem. Biophys. Res. Commun. 132 Ž1985. 721–728. w10x Mignery, G.A., Newton, C.L., Archer, III, B.T. and Sudhof, T.C., ¨ Structure and expression of the rat inositol 1,4,5-trisphosphate receptor, J. Biol. Chem. 265 Ž1990. 12679–12685. w11x Mignery, G.A., Sudhof, T.C., Takei, K. and De Camilli, P., Putative ¨ receptor for inositol 1,4,5-trisphosphate similar to ryanodine receptor, Nature 342 Ž1989. 192–195. w12x Monkawa, T., Miyawaki, A., Sugiyama, T., Yoneshima, H., Yamamoto-Hino, M., Furuichi, T., Saruta, T., Hasegawa, M. and Mikoshiba, K., Heterotetrameric complex formation of inositol 1,4,5-trisphosphate receptor subunits, J. Biol. Chem. 270 Ž1995. 14700–14704. w13x Nakagawa, T., Okano, H., Furuichi, T., Aruga, J. and Mikoshiba, K., The subtypes of the mouse inositol 1,4,5-trisphosphate receptor are expressed in a tissue-specific and developmentally specific manner, Proc. Natl. Acad. Sci. USA 88 Ž1991. 6244–6248. w14x Newton, C.L., Mignery, G.A. and Sudhof, T.C., Co-expression in ¨
w15x
w16x
w17x
w18x
w19x
w20x
w21x
w22x
w23x
w24x
w25x
vertebrate tissues and cell lines of multiple inositol 1,4,5-trisphosphate ŽInsP3 . receptors with distinct affinities for InsP3 , J. Biol. Chem. 269 Ž1994. 28613–28619. Okano, M. and Takagi, S.F., Secretion and electrogenesis of the supporting cell in the olfactory epithelium. J. Physiol. 242 Ž1974. 353–370. Rama Krishna, N.S., Getchell, M.L., Margolis, F.L. and Getchell, T.V., Differential expression of vomeromodulin and odorant-binding protein, putative pheromone and odorant transporters, in the developing rat nasal chemosensory mucosae, J. Neurosci. Res. 40 Ž1995. 54–71. Roskams, A.J.I., Bethel, M.A., Hurt, K.J. and Ronnett, G.V., Sequential expression of Trks A, B, and C in the regenerating olfactory neuroepithelium, J. Neurosci. 16 Ž1996. 1294–1307. Ross, C.A., Danoff, S.K., Schell, M.J., Synder, S.H. and Ullrich, A., Three additional inositol 1,4,5-trisphosphate receptors: molecular cloning and differential localization in brain and peripheral tissues, Proc. Natl. Acad. Sci. USA 89 Ž1992. 4265–4269. Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Smutzer, G.S., Vitali, N. and Rodrıguez, A., Expression of inositol ´ 1,4,5-trisphosphate receptor in chemosensory tissue of channel catfish and rat ŽAbstr. No. 225., The 15th Annual Meeting of Association for Chemoreception Sciences, Sarasota, FL, 1993. Sugiyama, T., Furuya, A., Monkawa, T., Yamamoto-Hino, M., Satoh, S., Ohmori, K., Miyawaki, A., Hanai, N., Mikoshiba, K. and Hasegawa, M., Monoclonal antibodies distinctively recognizing the subtypes of inositol 1,4,5-trisphosphate receptor: application to the studies on inflammatory cells, FEBS Lett. 354 Ž1994. 149–154. Wojcikiewicz, R.J.H., Type I, II, and III inositol 1,4,5-trisphosphate receptors are unequally susceptible to down-regulation and are expressed in markedly different proportions in different cell types, J. Biol. Chem. 270 Ž1995. 11678–11683. Wojcikiewicz, R.J.H. and He, Y., Type I, II and III inositol 1,4,5-trisphosphate receptor co-immunoprecipitation as evidence for the existence of heterotetrameric receptor complexes, Biochim. Biophys. Res. Commun. 213 Ž1995. 334–341. Wolf, B.A., Wertkin, A.M., Jolly, Y.C., Yasuda, R.P., Wolfe, B.B., Konrad, R.J., Manning, D., Ravi, S., Williamson, J.R. and Lee, V.M.-Y., Muscarinic regulation of Alzheimer’s disease amyloid precursor protein secretion and amyloid b-protein production in human neuronal NT2N cells, J. Biol. Chem. 270 Ž1995. 4916–4922. Yoshikawa, S., Tanimura, T., Miyawaki, A., Nakamura, M., Yuzaki, M., Furuichi, T. and Mikoshiba, K., Molecular cloning and characterization of the inositol 1,4,5-trisphosphate receptor in Drosophila melanogaster, J. Biol. Chem. 267 Ž1992. 16613–16619.
Short communication
Inositol 1,4,5-trisphosphate receptor expression in mammalian olfactory tissue Gregory Smutzer a b
a,)
, John E. Zimmerman a,1, Chang-Gyu Hahn a,2 , Delta D. Ruscheinsky a , a Amaris Rodrıguez , Li-Ying Han a , Steven E. Arnold a,b ´
Department of Psychiatry, UniÕersity of PennsylÕania School of Medicine, Philadelphia, PA 19104, USA Department of Neurology, UniÕersity of PennsylÕania School of Medicine, Philadelphia, PA 19104, USA Accepted 8 October 1996
Abstract Two cDNAs encoding inositol 1,4,5-trisphosphate ŽIP3 . receptors were amplified from rat olfactory tissue, and both exhibited 100% sequence identity to the short ŽSegment II y . variant of type I IP3 receptor. Type III IP3 receptor was also expressed in olfactory tissue. The distribution of IP3 receptors included the olfactory epithelium, lamina propria, and glandular tissue. These results demonstrate the co-expression of multiple IP3 receptor subtypes in olfactory cells, and suggest multiple functions for IP3 receptors in this tissue. Keywords: IP3 receptor; Gene expression; Olfaction; Alternate splicing; Signal transduction; Sensory epithelium; Secretion; Calcium channel
Many cellular responses are mediated by the second messengers o-myo-inositol 1,4,5-trisphosphate ŽIP3 . and snŽ1,2.-diacylglycerol ŽDAG. w3x. The synthesis of IP3 and DAG can be stimulated by two separate signal transduction pathways w3,17x. In both pathways, the subsequent binding of IP3 to a tetameric receptor channel can regulate the quantal release of calcium into the cytoplasm w3x. IP3 receptors exhibit heterogeneity at the genetic level since three major IP3 receptor subtypes, named types I, II, and III, have been reported w4,11,13,18x. Further IP3 receptor heterogeneity arises from alternate splicing since type I receptor is spliced at two distinct sites w6,13x, and one alternately spliced fragment named Segment II ŽSII., may be neuron-specific w6,13x. Finally, receptor heterogeneity occurs from subunit mixing since IP3 receptors can assemble into functional heterotetrameric complexes of specific receptor subtypes w8,12,23x. Type I, II, and III IP3 recep-
) Corresponding author. Department of Psychiatry, University of Pennsylvania School of Medicine, 111 Clinical Research Building, 415 Curie Boulevard, Philadelphia, PA 19104, USA. Fax: q1 Ž215. 573-2041; E-mail: [email protected] 1 Present address: Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA. 2 Present address: Department of Psychiatry, Allegheney University of the Health Sciences, Broad and Vine Streets, Philadelphia, PA 19103, USA.
tors possess different binding affinities for IP3 w14x; furthermore, these receptors may be differentially regulated by proteolysis w22x and possibly by phosphorylation w6,10,13x. This heterogeneity suggests that IP3 receptor subtypes are functionally diverse. In this report, the expression of IP3 receptor subtypes is characterized in mammalian olfactory tissue by DNA sequence analysis, RNase protection, Northern analysis, in situ hybridization, and immunocytochemistry. Adult rat olfactory tissue, cerebellum, and cortex were dissected from Sprague-Dawley rats. Human cerebellar tissue was from the Mental Health Clinical Research Center in Schizophrenia at the University of Pennsylvania. Rat pituitary GH 3 cells were grown in Dulbecco’s modified Eagle’s medium with low glucose and 10% bovine calf serum with antibiotics. Total RNA was prepared by acidphenol extraction or by TRIzol extraction ŽGibco-BRL.. Reverse-transcriptase PCR ŽRT-PCR. was carried out with the Perkin-Elmer RNA-PCR core kit according to the manufacturer’s instructions. Primers for amplification of a transmembrane region of type I receptor were GAACAGGATAAGGAGCACACG Žforward ., and AGATTGGTGACCAGCTTCATGG Žreverse.. Reaction conditions were 1 min at 948C, 1 min at 608C, and 3 min at 728C for 50 cycles. Primers for amplification of the alternately spliced region that flanked segment II of type I IP3 receptor were TCGTGGATGTTCTACACAGACC
0169-328Xr97r$17.00 Copyright q 1997 Elsevier Science B.V. All rights reserved. PII S 0 1 6 9 - 3 2 8 X Ž 9 6 . 0 0 2 8 2 - 3
348
G. Smutzer et al.r Molecular Brain Research 44 (1997) 347–354
Žforward., and CACTGTCGCCTTGATTTCCTGC Žreverse.. Reaction conditions were 1 min at 948C, 1 min at 488C, and 1 min at 728C for 35 cycles. DNA fragments of predicted size were directly cloned into the pCRII vector ŽInvitrogen. using the TA cloning kit, and transformed w19x. Amplified DNA was sequenced by the Sequenase system ŽUS Biochemicals.. For Northern analysis, pre-hybridization and hybridization occurred at 42 or 458C in 50% formamide by standard procedures w2x. The cDNA previously amplified from a transmembrane domain of type 1 IP3 receptor Žclone pUP3. was excised by EcoRI digestion, purified, and labeled by random primer w19x. A PAGE-purified oligonucleotide unique to the alternately spliced segment SII was commercially synthesized ŽKeystone Labs.. The sequence was 5X-CAAGCTCCTCTGTGGACTTCTCAGCTTCCGGTGGCTGTGGCAGCTCGGC-3X , and corresponded to nucleotides 5433–5481 of rat type I IP3 receptor w10x. Finally, a PAGE-purified antisense oligonucleotide that represented a unique sequence of rat type III IP3 receptor was commercially synthesized. This sequence was 5X-CTGCTTGTTGTTGAGGCTGAGCATGGAAGAGATGCCCTCGGCCTCCTC-3X , and corresponded to nucleotides 6368– 6416 w4x. Both oligomers were end-labeled with deoxynucleotidyl transferase and 32 P-dATP w19x, and hybridized to RNA as described above. The DNA sequence of clone pUP7 both spans, and includes, segment II of type I IP3 receptor. This DNA was used to identify the expression of SII splice variants in tissue. An antisense probe for RNase protection was prepared by in vitro transcription with SP6 DNA-dependent RNA polymerase, and RNA was hybridized with 5 = 10 4 dpm of riboprobe at 658C w2x. For histological studies, entire nasal structures from 31–35 day old adult rats were removed and frozen in isopentane at y408C. Antisense transcripts from the transmembrane probe pUP3 detected IP3 receptor expression by in situ hybridization. 16-m m-thick fresh-frozen sections of rat olfactory tissue and adult human cerebellums were sectioned and thaw-mounted onto ProbeOnq slides. 35 Slabeled antisense RNA probes were synthesized by standard means w1x. Sense transcripts were also synthesized and processed exactly as above. Antibodies prepared to synthetic peptides of the Ctermini of types I and III IP3 receptors are specific for their cognate peptides w8,22,23x. Antibody T210 is specific for type I IP3 receptor, and antibody CT-3 is specific for type III receptor w8,11,21x. For immunohistochemistry, primary antibodies were localized to tissue with a horseradish peroxidase-conjugated anti-rabbit IgG, and 3X 3X-diaminobenzidinerH 2 O 2 was used for the chromogenic reaction. For antibody T210, primary antibody was pre-absorbed with a 20-fold excess of peptide antigen before incubation with tissue to demonstrate antigenic specificity. For further identification of type I and III IP3 receptor antibody reactivity, rat and human post-mortem olfactory tissue was
decalcified, fixed, and embedded. This tissue was processed for immunocytochemistry as described above for comparison to fresh-frozen tissue. The results show that IP3 receptor cDNA from rat olfactory tissue was amplified with primers to the highly conserved transmembrane domain seven of type I IP3 receptor. This transmembrane domain shows high DNA sequence identity among the three major vertebrate and invertebrate IP3 receptor subtypes and to ryanodine receptor w4,6,10,11,18,25x. This primer pair consistently amplified a product of 575 bases in length, and no other product sizes were detected Ždata not shown; GenBank Accession No. U38812.. This amplicon exhibited 100% DNA sequence identity to type I Žcerebellar. IP3 receptor previously identified w10x. These findings indicate that a population of IP3 receptors expressed in rat olfactory tissue contained transmembrane sequences that were identical to type I IP3 receptor. If type I IP3 receptor is expressed in rat olfactory tissue, a second amplified fragment from this tissue should show sequence identity to type I receptor. Furthermore, alternate splicing of type I receptor produces two alternately spliced variants that differ in length by 117 bp. Amplification of a second DNA fragment of type I receptor that included this splice site would determine if either or both splice variants was expressed in olfactory tissue. Sequence analysis of this product would confirm type I IP3 receptor expression in this tissue. A DNA fragment that traversed the SII splice site was amplified, and this amplification yielded a single product of 629 bp. The DNA sequence of this product also shared 100% sequence identity to the SII y variant of type I IP3 receptor Ždata not shown; GenBank Accession No. U38653.. These two DNA fragments thus represented the DNA sequence of type I IP3 receptor cDNA, and suggested that only SII y splice variants were expressed in rat olfactory tissue. Finally, RT-PCR analysis of rat cerebellar RNA with these identical primers amplified a DNA sequence of 746 bp in length that exhibited 100% sequence identity to SII q Žneuronal. form of type I receptor Ždata not shown; GenBank Accession No. U38665.. The expression of type I IP3 receptor splice variants was analyzed by RNase protection studies with the amplified cDNA from rat cerebellum that included the SII q splice variant. RNA populations that express only SII y splice variants of IP3 receptor would protect only the two fragments that flank this splice site – fragments of 200 and 429 nucleotides, respectively. In RNA that contains only the SII q receptor variant, a single fragment of 746 bp would be protected. In RNA that contains both alternately spliced transcripts, fragments of 746, 429, and 200 nucleotides would be protected. In tissue that expresses additional IP3 receptor subtypes, further complexity in the number and size of protected fragments may arise from sequence heterogeneity. RNase protection of RNA from rat olfactory tissue, rat cortex, and rat GH 3 cells that hybridized to the SII q IP3 receptor riboprobe are shown in
G. Smutzer et al.r Molecular Brain Research 44 (1997) 347–354
Fig. 1A ŽGH 3 cells are derived from rat pituitary secretory cells, and this autostimulating cell line exhibits high levels of IP3 binding w9x.. Two protected fragments of f 425 and 200 bases were observed in all three RNA samples; furthermore, the SII q IP3 receptor probe hybridized to fragments of identical size, number, and intensity in both rat olfactory and GH 3 cellular RNA. These two RNA populations revealed considerably fewer protected fragments Žand intensity of hybridization signal. when compared to cortex. In contrast, a band of f 725 nucleotides in length was protected in rat cortex, but was absent in both rat olfactory and GH 3 RNA. The signal corresponded to SII q transcripts of type I IP3 receptor. These results further indicated that the SII q Žneuronal. splice variant was not expressed in either rat olfactory tissue or in GH 3 cell while the SII y transcript was expressed in all three tissues. Based on DNA sequence identity to type I receptor, these results suggested that type I IP3 receptor transcripts expressed in rat olfactory tissue should be similar in size to cerebellar transcripts. Northern analysis was undertaken to determine relative message size and expression levels of IP3 receptors in tissue. The transmembrane probe pUP3 of type I IP3 receptor exhibits 77 and 79% sequence identity to types II and III receptors, respectively. This cDNA was used to identify overall IP3 receptor expression. A single message that corresponded to a size of f 9.5 kb was
349
observed in both rat olfactory and rat cerebellar tissue ŽFig. 1B.. Furthermore, no other hybridization signals were observed with either olfactory or cerebellar RNA. Similar results have been reported with a transmembrane probe of type I IP3 receptor cloned from rat cerebellum w20x. Finally, IP3 receptor expression was considerably greater in rat cerebellar tissue than in olfactory tissue. To measure expression of SII q splice variants of type I receptor by Northern analysis, an antisense oligonucleotide of segment II was hybridized to total RNA. This oligonucleotide demonstrated a strong hybridization signal near 9.5 kb in rat cerebellar tissue with no corresponding hybridization signal in rat olfactory RNA at identical RNA concentrations ŽFig. 1C.. In summary, DNA sequence analysis, RNase protection, and Northern analysis all demonstrated that the SII q variant of type I IP3 receptor was expressed in cerebellar tissue while only the SII y variant was expressed in olfactory tissue. Next, type III IP3 receptor expression was measured in rat olfactory RNA. Northern analysis demonstrated a strong hybridization signal near 9.5 kb in rat olfactory tissue with essentially no signal in rat cerebellar tissue ŽFig. 1D.. These results indicate that type III IP3 receptor is expressed in rat olfactory tissue, but not in rat cerebellum. In situ hybridization studies with the transmembrane probe pUP3 previously amplified from rat olfactory tissue
Fig. 1. A: RNase protection of SII IP3 receptor splice variants expressed in rat tissue and in GH 3 cells. Lane 1, antisense probe; lanes 2 and 3, 30 m g rat olfactory RNA each; lane 4, 15 m g rat cortex RNA; and lane 5, 15 m g GH 3 cell RNA. Sizes of protected fragments are indicated at left. B: Northern analysis of IP3 receptor expression. Lane 1, 15 m g rat olfactory RNA; lane 2, 30 m g rat olfactory RNA; and lane 4, 15 m g rat cerebellar RNA. C: Northern analysis with antisense oligonucleotide of SII segment of rat type I IP3 receptor. Lane 1, 15 m g rat olfactory RNA; lane 2, 30 m g rat olfactory RNA; lane 3, 15 m g rat cerebellar RNA; lane 4, 30 m g rat cerebellar RNA. D: Northern analysis with antisense oligonucleotide of rat type III IP3 receptor. Lane 1, 15 m g rat olfactory RNA; lane 2, 30 m g rat olfactory RNA; lane 4, 15 m g rat cerebellar RNA; lane 5, 30 m g rat cerebellar RNA.
350
G. Smutzer et al.r Molecular Brain Research 44 (1997) 347–354
Fig. 2A–C.
G. Smutzer et al.r Molecular Brain Research 44 (1997) 347–354
were employed to determine the cellular localization and relative expression of IP3 receptors in mammalian olfactory tissue. As shown in Fig. 2, hybridization was carried out with coronal sections of rat olfactory tissue and human post-mortem tissue. In olfactory tissue, a relatively uniform hybridization signal was observed above the olfactory epithelium, and no concentration of signal was observed at the basolateral surface ŽFig. 2A–C.. Within the sensory epithelium, the strongest hybridization was observed at the juncture of the dorsal turbinates and nasal
351
epithelium, and this signal decreased in intensity in the ventral epithelium. Localization of silver grains to specific epithelial cell populations could not be determined. In addition, no silver grains above background were observed around capillary cell walls, or above axons that extended from the sensory epithelium into the lamina propria. In the underlying lamina propria of the main olfactory epithelium, clusters of silver grains were localized above non-sensory cell populations. This clustering of signal was randomly distributed within the lamina propria of olfactory
Fig. 2. In situ hybridization of rat olfactory tissue and human cerebellum. A: bright-field image of unstained rat olfactory tissue. Arrows show clusters of silver grains which appear as dark spots. B: bright-field image of olfactory tissue briefly stained with Nissl to show grain clusters within the lamina propria Žarrows., and silver grains above the olfactory epithelium. C: dark-field image of rat olfactory epithelium showing silver grain clusters in the lamina propria Žwhite arrow., and uniform labeling in the olfactory epithelium and epithelium of nasal turbinates. D: dark-field image of rat olfactory epithelium demonstrating concentration of silver grains above septal glands Žwhite arrow.. Clusters of silver grains in lamina propria that lines both sides of nasal septum appear as bright spots. E: bright-field image of human cerebellar tissue briefly stained with Nissl. Arrows point to clusters of silver grains above individual Purkinje cells, and extended arrow at right points to hybridization signal within dendritic projection of a Purkinje cell. BV, blood vessel; E, epithelial cell layer; ML, molecular layer of cerebellum; NC, nasal cavity; OE, main olfactory epithelium; S, nasal septum; SMG, submucosal gland; T, nasal turbinate.
352
G. Smutzer et al.r Molecular Brain Research 44 (1997) 347–354
Fig. 3. Immunolocalization of IP3 receptor subtypes in rat olfactory tissue. A: bright-field image of septal glands of olfactory epithelium stained with antibodies to type I IP3 receptor. B: bright-field image of olfactory epithelium showing dense staining with type III IP3 receptor antibodies. C: bright-field image of olfactory tissue stained with type III IP3 receptor antibodies showing dense staining of Bowman’s Žsubmucosal. glands, and lateral nasal glands. E, epithelium; G, submucosal glands; LN, lateral nasal glands; NS, nasal septum; OE, olfactory epithelium; SG, septal glands.
G. Smutzer et al.r Molecular Brain Research 44 (1997) 347–354
tissue, and clusters were also localized to the lamina propria of the dorsal and ventral nasal turbinates ŽFig. 2A–C.. Hybridization signal was also detected above the septal glands located near the base of the nasal septum ŽFig. 2D.. Finally, IP3 receptor mRNA was highly expressed in epithelial cells that formed the two nasolacrimal ducts. Connective tissue at the periphery of these ducts also exhibited clusters of silver grains. These results indicated that IP3 receptor expression occurred in a variety of cell types, and suggested that IP3 has multiple functions in olfactory tissue. With sense controls, no clustering of silver grains was observed in the lamina propria. In other chemosensory tissue, no labeling was observed above the olfactory epithelium of channel catfish under identical hybridization conditions Ždata not shown.. Finally, a positive control consisted of in situ hybridization experiments with human cerebellar tissue. This tissue was hybridized with the same IP3 receptor probe under identical conditions. A high density of silver grains was observed in Purkinje cells ŽFig. 2E., and no signal was observed with sense transcripts. Subtype-specific antibodies that recognize type I IP3 receptor stained two regions of rat olfactory tissue ŽFig. 3.. First, low staining was detected in both sensory neurons and sustentacular cells of the olfactory epithelium. The greatest immunoreactivity in this layer occurred in cells located at the juncture of the dorsal turbinate and the olfactory epithelium of the nasal septum. The epithelium also showed labeling by in situ hybridization for IP3 receptor message. Second, dense staining occurred in septal glands of the lamina propria of the main olfactory system. Cells that composed this glandular tissue exhibited a diffuse staining pattern that is consistent with a cytoplasmic localization for IP3 receptor ŽFig. 3A.. Identical staining patterns were observed in both fresh-frozen and paraffin-embedded rat olfactory tissue. Monoclonal antibodies that recognized type III IP3 receptor also demonstrated immunoreactivity in two distinct regions. First, this antibody showed robust staining in both sustentacular and sensory neurons of the sensory epithelium ŽFig. 3B.. Diffuse binding of antibody throughout the cytoplasm of these cells was observed, and is consistent with an endoplasmic reticulum ŽER. location for type III receptor. Second, intense staining was observed in secretory tissue. This tissue included acinar cells of Bowman’s glands, septal glands, and lateral nasal glands ŽFig. 3C.. However, immunoreactivity was not localized to cilia of sensory neurons since immunogold labeling at the surface of the sensory epithelium showed essentially no reactivity above background Ždata not shown.. These immunocytochemical results further demonstrated that multiple IP3 receptor subtypes were expressed in rat olfactory tissue. Finally, these results suggested that multiple IP3 receptor subtypes were localized to sensory neurons, to non-sensory sustentacular cells, and to glandular cells of the main olfactory system. Co-expression of multiple IP3 receptors
353
within cells may be a universal characteristic of the IP3 signaling pathway w14x, and implies that a population of IP3 receptors may exist as heterotetramers in these cells. IP3 receptor subtypes differ in their affinities for ligand w14x, and heterotetrameric channels could display a graduated range of ligand sensitivities for activation and regulation of calcium channel activity w23x. This report is the first systematic characterization of IP3 receptor expression in specific olfactory cell populations. Recent immunocytochemical evidence has localized IP3 receptor proteins to the apical ER of sustentacular cells and to the cilia of sensory neurons w5x. Our results extend these observations to include the localization of multiple IP3 receptor subtypes to the cytoplasm of sensory neurons, sustentacular cells, and secretory cells. The mammalian olfactory system is highly dependent on secretory processes for perireceptor events w16x, and requires a cellular mechanism for regulation of secretory processes. The expression of specific IP3 receptor genes and gene products in secretory cells of olfactory tissue and GH 3 cells is consistent with a role for IP3 in calciummediated secretory processes w7,24x. For example, IP3 and calcium may mediate secretory activity in the sensory epithelium since sustentacular cells may directly secrete serous substances into the mucus layer w15x. Our observations also implicate IP3 in neuronal differentiation since sensory neurons undergo continuous replacement. Finally, the co-expression of multiple IP3 receptor subtypes in both sensory neurons and sustentacular cells of the olfactory epithelium may help to maintain an environment conducive to odorant detection by cell surface receptors. The nucleotide sequences reported in this paper have been submitted to the GenBank Data Bank with Accession Nos. U38812, U38653, and U38665.
Acknowledgements This research was supported by the Johnson and Johnson Focused Giving Program. The authors thank Dr. L. Chamberlin and Ms. S. Greger for their valuable assistance, S. Reskoy, G. Gold, and J. Brand for helpful discussions, and Dr. P. Rittenhouse for rat olfactory tissue. The authors thank Dr. T. Sudhof for antibodies to type I ¨ IP3 receptor, Dr. S. Joseph for antibodies to type III IP3 receptor, and Dr. P. De Camilli for the peptide to type I IP3 receptor. The authors also thank Dr. John Q. Trojanowski for his gift of decalcified human and rat tissue.
References w1x Angerer, L.M. and Angerer, R.C., In situ hybridization to cellular RNA with radiolabelled RNA probes. In Wilkinson, D.G. ŽEd.., In Situ Hybridization, A Practical Approach. IRL Press at Oxford University Press, Oxford, 1992, pp. 15–32.
354
G. Smutzer et al.r Molecular Brain Research 44 (1997) 347–354
w2x Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. ŽEds.., Current Protocols in Molecular Biology, John Wiley and Sons, New York, NY, 1987. w3x Berridge, M.J., Inositol trisphosphate and calcium signalling, Nature, 361 Ž1993. 315–325. w4x Blondel, O., Takeda, J., Janssen, H., Seino, S. and Bell, G.I., Sequence and functional characterization of a third inositol trisphosphate receptor subtype, IP3 R-3, expressed in pancreatic islets, kidney, gastrointestinal tract, and other tissues, J. Biol. Chem. 268 Ž1993. 11356–11363. w5x Cunningham, A.M., Ryugo, D.K., Sharp, A.H., Reed, R.R., Snyder, S.H. and Ronnett, G.V., Neuronal inositol 1,4,5-trisphosphate receptor localized to the plasma membrane of olfactory cilia, Neuroscience 57 Ž1993. 339–352. w6x Danoff, S.K., Ferris, C.D., Donath, C., Fischer, G.A., Munemitsu, S., Ullrich, A., Snyder, S.H. and Ross, C.A., Inositol 1,4,5-trisphosphate receptors: distinct neuronal and nonneuronal forms derived by alternative splicing differ in phosphorylation, Proc. Natl. Acad. Sci. USA 88 Ž1991. 2951–2955. w7x Fujino, I., Yamada, N., Miyawaki, A., Hasegawa, M., Furuichi, T. and Mikoshiba, K., Differential expression of type 2 and type 3 inositol 1,4,5-trisphosphate receptor mRNAs in various mouse tissues: in situ hybridization study, Cell Tiss. Res. 280 Ž1995. 201–210. w8x Joseph, S.K., Lin, C., Pierson, S., Thomas, A.P. and Maranto, A.R., Heteroligomers of type-1 and type-III inositol trisphosphate receptors in WB rat liver epithelial cells, J. Biol. Chem. 270 Ž1995. 23310–23316. w9x Lucas, D.O., Bajjalieh, S.M., Kowalchyk, J.A. and Martin, T.F.J., Direct stimulation by thyrotropin-releasing hormone ŽTRH. of polyphosphoinositide hydrolysis in GH 3 cell membranes by a guanine nucleotide-modulated mechanism, Biochem. Biophys. Res. Commun. 132 Ž1985. 721–728. w10x Mignery, G.A., Newton, C.L., Archer, III, B.T. and Sudhof, T.C., ¨ Structure and expression of the rat inositol 1,4,5-trisphosphate receptor, J. Biol. Chem. 265 Ž1990. 12679–12685. w11x Mignery, G.A., Sudhof, T.C., Takei, K. and De Camilli, P., Putative ¨ receptor for inositol 1,4,5-trisphosphate similar to ryanodine receptor, Nature 342 Ž1989. 192–195. w12x Monkawa, T., Miyawaki, A., Sugiyama, T., Yoneshima, H., Yamamoto-Hino, M., Furuichi, T., Saruta, T., Hasegawa, M. and Mikoshiba, K., Heterotetrameric complex formation of inositol 1,4,5-trisphosphate receptor subunits, J. Biol. Chem. 270 Ž1995. 14700–14704. w13x Nakagawa, T., Okano, H., Furuichi, T., Aruga, J. and Mikoshiba, K., The subtypes of the mouse inositol 1,4,5-trisphosphate receptor are expressed in a tissue-specific and developmentally specific manner, Proc. Natl. Acad. Sci. USA 88 Ž1991. 6244–6248. w14x Newton, C.L., Mignery, G.A. and Sudhof, T.C., Co-expression in ¨
w15x
w16x
w17x
w18x
w19x
w20x
w21x
w22x
w23x
w24x
w25x
vertebrate tissues and cell lines of multiple inositol 1,4,5-trisphosphate ŽInsP3 . receptors with distinct affinities for InsP3 , J. Biol. Chem. 269 Ž1994. 28613–28619. Okano, M. and Takagi, S.F., Secretion and electrogenesis of the supporting cell in the olfactory epithelium. J. Physiol. 242 Ž1974. 353–370. Rama Krishna, N.S., Getchell, M.L., Margolis, F.L. and Getchell, T.V., Differential expression of vomeromodulin and odorant-binding protein, putative pheromone and odorant transporters, in the developing rat nasal chemosensory mucosae, J. Neurosci. Res. 40 Ž1995. 54–71. Roskams, A.J.I., Bethel, M.A., Hurt, K.J. and Ronnett, G.V., Sequential expression of Trks A, B, and C in the regenerating olfactory neuroepithelium, J. Neurosci. 16 Ž1996. 1294–1307. Ross, C.A., Danoff, S.K., Schell, M.J., Synder, S.H. and Ullrich, A., Three additional inositol 1,4,5-trisphosphate receptors: molecular cloning and differential localization in brain and peripheral tissues, Proc. Natl. Acad. Sci. USA 89 Ž1992. 4265–4269. Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Smutzer, G.S., Vitali, N. and Rodrıguez, A., Expression of inositol ´ 1,4,5-trisphosphate receptor in chemosensory tissue of channel catfish and rat ŽAbstr. No. 225., The 15th Annual Meeting of Association for Chemoreception Sciences, Sarasota, FL, 1993. Sugiyama, T., Furuya, A., Monkawa, T., Yamamoto-Hino, M., Satoh, S., Ohmori, K., Miyawaki, A., Hanai, N., Mikoshiba, K. and Hasegawa, M., Monoclonal antibodies distinctively recognizing the subtypes of inositol 1,4,5-trisphosphate receptor: application to the studies on inflammatory cells, FEBS Lett. 354 Ž1994. 149–154. Wojcikiewicz, R.J.H., Type I, II, and III inositol 1,4,5-trisphosphate receptors are unequally susceptible to down-regulation and are expressed in markedly different proportions in different cell types, J. Biol. Chem. 270 Ž1995. 11678–11683. Wojcikiewicz, R.J.H. and He, Y., Type I, II and III inositol 1,4,5-trisphosphate receptor co-immunoprecipitation as evidence for the existence of heterotetrameric receptor complexes, Biochim. Biophys. Res. Commun. 213 Ž1995. 334–341. Wolf, B.A., Wertkin, A.M., Jolly, Y.C., Yasuda, R.P., Wolfe, B.B., Konrad, R.J., Manning, D., Ravi, S., Williamson, J.R. and Lee, V.M.-Y., Muscarinic regulation of Alzheimer’s disease amyloid precursor protein secretion and amyloid b-protein production in human neuronal NT2N cells, J. Biol. Chem. 270 Ž1995. 4916–4922. Yoshikawa, S., Tanimura, T., Miyawaki, A., Nakamura, M., Yuzaki, M., Furuichi, T. and Mikoshiba, K., Molecular cloning and characterization of the inositol 1,4,5-trisphosphate receptor in Drosophila melanogaster, J. Biol. Chem. 267 Ž1992. 16613–16619.