Insight into the response of anammox granule rheological intensity and size evolution to decreasing temperature and influent substrate concentration

Water Research 162 (2019) 258e268

Contents lists available at ScienceDirect

Water Research journal homepage: www.elsevier.com/locate/watres

Insight into the response of anammox granule rheological intensity and size evolution to decreasing temperature and influent substrate concentration Yayi Wang*, Hongchao Xie, Duanli Wang, Weigang Wang State Key Laboratory of Pollution Control and Resources Reuse, Shanghai Institute of Pollution Control and Ecological Security, College of Environmental Science and Engineering, Tongji University, Siping Road, Shanghai, 200092, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 31 March 2019 Received in revised form 4 June 2019 Accepted 22 June 2019 Available online 25 June 2019

Anammox granules are advantageous because of their relatively higher nitrogen removal rate (NRR) and biomass retention capacity in ammonia-containing wastewater treatment. However, little attention has been paid to granule rheological intensity and size evolution, especially under low temperature and substrate concentration conditions. In this study, the size evolution and variations in rheological properties associated with biochemical characteristics of anammox granules were investigated at decreasing 1 temperatures (35 / 13
C) and influent substrate concentrations (300 / 50 mg NHþ 4 -N L ). Both the specific anammox activities (SAA) and yield stress (tc) (or storage modulus (G0 )), which reflected granules' intensity, decreased with decreasing temperature and influent substrate concentration. An exponential correlation was found between SAA and tc (or G0 ). Granule size strongly decreased at low 1 temperature (13
C) and influent substrate concentration (50 mg NHþ 4 -N L ), despite slight variations in tc (or G0 ). A threshold tc (or G0 ) that is closely related to the hydrodynamic shear force in the reactor may exist for the anammox granules. Once the tc (or G0 ) of the anammox granules was lower than this threshold value (t*c ¼ 10.13e15.63 kPa), granules that could not endure hydrodynamic shear forces would disintegrate and their size would decrease substantially. Candidatus Kuenenia was the dominant genus in the expanded granular sludge bed reactor, reaching a minimum abundance of 14.6% at 16
C because of the low-temperature shock, but increasing in abundance to 57.0% at 13
C, indicating it has a competitive advantage at low temperatures. This contributed to achieving a high reactor nitrogen loading rate 1 influent. Overall, the results of this study will (>1.0 kg N m3 d1) even at 13
C or with 50 mg NHþ 4 -N L facilitate management of anammox bioreactors that run at various temperatures and influent substrate concentrations by clarifying the correlation between rheological intensity and anammox granule sludge activity and identifying the tc (or G’) threshold. © 2019 Elsevier Ltd. All rights reserved.

Keywords: Anammox Granule size Yield stress Rheology Temperature and influent substrate concentration Extracellular polymer substance

1. Introduction The anammox process combined with partial nitrification has been implemented in various full-scale applications for the treatment of ammonium-rich wastewater because of its low oxygen demand and lack of requirement for organic carbon (Star et al., 2007). The advantages of applying granular sludges to anammox wastewater treatment have been widely recognized (Liu et al., 2009; Ma et al., 2016; Tang et al., 2017). For example, a relatively higher nitrogen removal rate (NRR), biomass retention capacity and

* Corresponding author. E-mail addresses: [email protected], [email protected] (Y. Wang). https://doi.org/10.1016/j.watres.2019.06.060 0043-1354/© 2019 Elsevier Ltd. All rights reserved.

shock resistance were achieved by anammox granules than by anammox flocs (Tang et al., 2011). However, the nitrogen removal performance of anammox granules depends greatly on their physicochemical properties, such as granule size and intensity (Lin and Wang, 2017; Zhu et al., 2018). Size is an important parameter impacting the stability of anammox granules and the efficient operation of the bioreactors (Peng et al., 2013). When particle size is too large (e.g., >4 mm) (Lu et al., 2013), a dead zone forms in the granules, which could result in sludge floatation and losses (Chen et al., 2010). This can further reduce the efficiency of mass transfer between anammox granular sludge and pollutants. However, it is difficult to increase the biomass and activity of anammox sludge when the particle size is

Y. Wang et al. / Water Research 162 (2019) 258e268

too small (e.g. <0.2 mm) (Zhu et al., 2018). Moreover, the size of the anammox granules may be affected by environmental shifts, such as in temperature and influent substrate concentration; however, how the evolution of anammox granule size is affected by these shifts remains unclear. Intensity is another key parameter influencing robust anammox granules (Pereboom, 1997). Low-intensity granules are unable to endure frequent hydrodynamic shear forces in reactors and might disintegrate, resulting in granule size evolution and biomass loss, whereas high-intensity granules might not be disturbed by the hydrodynamic shear stress and could increase in size, but are prone to floating (Chen et al., 2014; Lu et al., 2012). Rheology, which is the science of the flow and deformation behavior of a material, is used to explore the correlations between deformation, shear stress, and time (Lin et al., 2013; Mulder and Alexander, 2001), which describe the material intensity. The storage modulus (G0 ) and loss modulus (G00 ) are the amounts of energy stored and dissipated during deformation, or the real and imaginary parts, respectively, of the dynamic complex modulus. G0 and yield stress (tc) are direct indicators of the mechanical strength of a material. A higher G0 or tc generally represents a stronger structure; thus, rheological parameters have been introduced to profile anammox granules in prior studies (Lin and Wang, 2017; Shi et al., 2017). By using a controlled stress and strain rheometer with selective enzymatic hydrolysis, Lin and Wang (2017) verified the role of extracellular polymeric substances (EPS) in the formation and stabilization of anammox granules. They showed that a-polysaccharides and proteins were the backbones of anammox granules, contributing greatly to their excellent intensity. In their study, the tc of granular sludge in an anammox-sequencing batch reactor (SBR) at 33
C was determined to be 16 kPa; however, there is little information available in the current literature regarding the effects of temperature and influent substrate concentrations on the rheological properties and granule size of anammox granules. Shi et al. (2017) and Xing et al. (2015) studied the effects of temperature on the apparent viscosity of anammox granules, but did not consider more detailed rheological parameters (such as G’ and tc) reflecting the intensity of the granules. To the best of our knowledge, the correlation between intensity and activity of anammox granules has not been elucidated, even though this information would deepen the understanding of anammox granule properties. In this study, we investigated the effects of temperature and influent substrate concentration variations on the nitrogen removal performance of an anammox expanded granular sludge bed (EGSB) reactor, as well as the rheological properties and effects of particle size of anammox granules by combining laser particle size and rheological analyses. The specific objectives of this study were i) to explore the physicochemical, morphological, and microbiological evolution of anammox granules along with decreasing temperature and influent substrate concentration, and ii) to identify the relationships between anammox activities and granule sizes and granule intensities. The results presented herein provide valuable information that will guide the design and operation of anammox granular sludge reactors at various temperatures and influent substrate concentrations. 2. Materials and methods 2.1. Reactor setup and operation A lab-scale EGSB reactor (working volume: 2.17 L, diameter: 50 mm, height-to-diameter ratio: 21.2) was established for anammox granular sludge culture and covered with black cloth to prevent the penetration of light (van der Star et al., 2007). The inoculated biomass (about 1.3L) was taken from a lab-scale

259

anammox SBR reactor (Wang et al., 2016), in which Candidatus Kuenenia was the dominant genus, accounting for 81% ± 9% of the total microbial population based on fluorescence in-situ hybridization. The reactor was operated in a continuous flow mode, with effluent recirculated by a peristaltic pump (BT100-2J, China) and temperature controlled by thermostatic water baths (HHS/DC0506, China) connected to the double wall of the reactor. During the startup period (160 days), the nitrogen loading rate (NLR) was gradually increased by increasing the influent ammonium and nitrite concentrations or shortening the hydraulic retention time (HRT). The liquid upflow velocity (UFV) was controlled at 2.67 m h1 to maintain a good fluidization. In the 16 days before Day 1 (formal experiment), the anammoxEGSB reactor achieved stable nitrogen removal performance (NLR ¼ 4.80 ± 0.31 kg N m3 d1, NRR ¼ 4.18 ± 0.23 kg N m3 d1), after which it was operated under various conditions including decreasing temperatures (35 / 25 / 20 / 16 / 13
C, Phase I / II / III / IV / V, respectively) and influent substrate con1 centrations (300 / 150 / 50 mg NHþ 4 -N L , Phase III / VI / VII, respectively) in sequence. The HRT remained at 2.18 h for the operational period except at 13
C (HRT ¼ 3.79 h). The operational parameters of the EGSB reactor during various operation phases are shown in Table 1. Ammonium and nitrite were added to a mineral medium in the form of NH4Cl and NaNO2, respectively. Specifically, the mineral medium was composed of the following (g L1): NaHCO3 (1.25), KH2PO4 (0.025), CaCl2 (0.3), MgSO4$7H2O (0.3), FeSO4$7H2O (0.00625), and Na2EDTA (0.00625) as well as 0.5 mL L1 of trace elements solution prepared according to Wang et al. (2016). The influent pH was kept in the range of 7.0e7.5 by adding 3 mol L1 hydrochloric acid.

2.2. Analytical methods   The NHþ 4 -N, NO2 -N, and NO3 -N levels were measured using ion chromatography (Thermo Scientific Dionex ICS5000þ, USA). Temperature and pH were monitored with a portable digital thermometer (Apuhua TM-902C, China) and a portable detection instrument (WTW Multimate 350i, Germany), respectively. The mixed liquid volatile suspended solids (MLVSS) were analyzed according to the standard methods (APHA., 1998). Experimental granular sludge samples of all phases were collected on Day 55, 150, 265, 324, 365, 396 and 431.

2.3. EPS and SAA assays The method described by Li and Yang (2007) was employed for EPS extraction. The extracellular proteins were determined with a BCA Protein Assay kit (Wang et al., 2016) and the polysaccharide content was analyzed by the anthrone method using glucose as the standard (Jing et al., 2009). Specific anammox activity (SAA) characterizes the rate of substrate consumed per biomass via the anammox pathway. To investigate the long-term effects of temperature and influent substrate concentration on SAA, the in situ SAA of the granules was determined by batch tests in the closed reactor. The experimental temperature was consistent with the temperature (13e35
C) of the corresponding phase (He et al.,  2018). The initial NHþ 4 -N and NO2 -N were both controlled at 1 about 100 mg L by adding the concentrated substrate solution and the pH was set at approximately 7.5. The SAA was calculated from the slope of the decrease curve of the substrate concentration  (the sum of NHþ 4 -N and NO2 -N) during the reaction time and related to the biomass concentration in the reactor (expressed as N g1 VSS d1).

260

Y. Wang et al. / Water Research 162 (2019) 258e268

Table 1 Performance of anammox-EGSB reactor in different operational phases. Phase

I II III IV V VI VII

Day

1e76 77e158 159e271 272e339 340e366 380e397 398e440

Temp.a (
C)

35 25 20 16 13 20 20

Inf. Concentration b (mg N L1) Ammonium

Nitrite

264.9 ± 21.9 295.7 ± 30.4 285.4 ± 13.9 273.1 ± 18.0 292.8 ± 13.8 148.3 ± 27.5 52.6 ± 2.0

381.1 ± 8.8 373.8 ± 23.2 347.5 ± 10.8 350.8 ± 11.0 344.2 ± 11.5 171.9 ± 27.9 57.8 ± 1.9

NLR c (kg N m3 d1)

NRR c (kg N m3 d1)

NRE c (%)

MLVSS (g L1)

7.42 ± 0.74 7.42 ± 0.50 7.02 ± 0.25 6.92 ± 0.30 4.05 ± 0.10 3.56 ± 0.61 1.24 ± 0.03

6.51 ± 0.61 6.48 ± 0.49 6.24 ± 0.22 6.07 ± 0.32 3.54 ± 0.09 3.18 ± 0.54 0.99 ± 0.04

87.8 ± 0.8 87.3 ± 1.5 88.9 ± 0.7 87.8 ± 1.3 87.4 ± 0.9 89.4 ± 1.5 80.3 ± 3.4

11.85 13.99 14.44 16.62 15.69 14.14 13.72

a

Temperature. Influent concentration. Nitrogen loading rate (NLR), nitrogen removal rate (NRR), nitrogen removal efficiency (NRE) and influent concentration of ammonium and nitrite data were taken from the stable operation stage. b c

2.4. Rheological properties Rheological measurements were performed on a controlled stress and strain rheometer (Anton Paar MCR-102, Austria) at ambient temperature with a slight normal force. The sludge sample pretreatment and rheological measurements were conducted as described by Lin and Wang (2017). Dynamic oscillatory shear measurements were performed by applying a time (t)-dependent strain of gðtÞ ¼ g0 sinðutÞ, where u is the oscillation frequency, g0 denotes the maximum strain amplitude, and the resultant shear stress is sðtÞ ¼ g0 ½G0 sinðutÞ þ G00 cosðutÞ, where G0 and G” are the storage and loss modulus, respectively. The G’ of anammox granules was determined as a parameter reflecting the mechanical strength of the material, with an oscillatory amplitude sweep performed from about 0.05% to 150% strain amplitude (g) at a fixed angular frequency (u) of 5 rad s1 to avoid reducing the duration of the experiment because of high frequencies (Lin et al., 2013). 2.5. Granule size and sludge morphological characteristics Granule size was determined using a Malvern laser particle size analyzer (Mastersizer 3000, UK). The microbial morphology and structure of the granules were observed using a stereoscopic microscope (SZX16, Japan) and scanning electron microscope (SEM) (Hitachi S4800, Japan). For the SEM observations, the sludge samples were first fixed with 2.5% glutaraldehyde for one night at 4
C, then rinsed three times with 0.1 mM phosphate buffer (pH 7.0). After fixing with 1% osmic acid solution for 1e2 h, the samples were rinsed three times with 0.1 mM phosphate buffer. Subsequently, the samples were dehydrated through a series of ethanolic solutions (50%, 70%, 80%, 90%, and 95%, 15 min per step). After rinsing twice with ethanol for 20 min each, the sludge samples were treated with a mixture of absolute ethanol and isoamyl acetate (1:1) for 30 min, then infiltrated with isoamyl acetate for 1e2 h and dried with a critical-point drier before being sputter-coated with gold. 2.6. 16S rRNA gene sequencing The evolution of the microbial community during the operational period was analyzed by high-throughput sequencing. Briefly, microbial DNA was extracted from the sludge samples in triplicate and purified using an E.Z.N.A.® DNA Kit (Omega Bio-tek, USA) according to the manufacturer's protocols. The 16S rRNA genes were amplified from the DNA extracts using the 338F (50 ACTCCTACG GGAGGCAGCAG30 ) and 806R (50 GGACTACATCGACGGGTATT CTAAT30 ) primers (Muyzer et al., 1993). PCR amplifications were performed using a DNA thermocycler (ABI GeneAmp® 9700, USA). Amplicons were then extracted from 2% agarose gels and purified

using an AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, USA) according to the manufacturer's instructions, after which they were quantified using QuantiFluor™-ST (Promega, USA). Purified amplicons were subsequently pooled in equimolar amounts and high-throughput sequenced using the Illumina MiSeq platform (Majorbio, China) according to the standard protocols. Operational taxonomic units with 97% similarity cutoff were clustered using USEARCH (v9.2.64, http://drive5.com/uparse/) (Edgar, 2010), and chimeric sequences were identified and removed using UCHIME (Edgar et al., 2011). 3. Results 3.1. Long-term performance of the anammox EGSB reactor with decreasing temperature and influent substrate concentrations 3.1.1. Nitrogen removal performance From day 1e38, the NLR and NRR of the anammox-EGSB reactor remained at 4.74 ± 0.61 kg N m3 d1 and 4.26 ± 0.55 kg N m3 d1,  respectively, with NHþ 4 -N and NO2 -N almost completely consumed (Fig. 1a, b, d and Table 1). On Day 39 (Phase I), the NLR was elevated by decreasing the HRT from 3.21 to 2.18 h, after which it remained unchanged except for Phase V (HRT ¼ 3.79 h). On Day 58, a sudden power outage in the laboratory caused the breakdown of the peristaltic pump used for recirculation, while on Day 66, the recirculation tube was squashed by the peristaltic pump. These two accidents both caused the interruption of the recirculation system. Without the dilution of effluent recirculation, the anammox activity was inhibited by the high influent substrate concentration on Day 58e63 and Day 66e69 (Fig. 1a, b, c and d). After being diluted by the low substrate concentration water, the performance of the EGSB reactor recovered rapidly on Day 70e73 by increasing the influent substrate concentration from 135.4 to 1 333.9 mg NHþ (Fig. 1a, b, c and d) gradually. Considering that 4 -N L the anammox activity was not irreversibly inhibited by short-term exposure to the high concentration substrate in the EGSB reactor, the temperature was decreased to 25
C on Day 77 (Table 1). As shown in Fig. 1d and Table 1, as the temperature gradually decreased from 35
C to 16
C in Phases IeIV, the EGSB reactor achieved a high nitrogen removal capacity with an NRR >6.0 kg N m3 d1 and a nitrogen removal efficiency (NRE) of approximately 85%. In Phase V, as the temperature continued to decrease to 13
C, the anammox activity was negatively affected by low temperature.  On Day 343, the effluent NHþ 4 -N and NO2 -N concentration reached 1 1 190.0 mg L and 227.9 mg L , respectively (Fig. 1a and b), indicating that the EGSB reactor was no longer able to withstand the previous NLR (Fig. 1d). Accordingly, to prevent further negative effects of low temperature on reactor performance, the HRT was increased from 2.18 h to 3.79 h on Day 351, while the NLR and NRR

Y. Wang et al. / Water Research 162 (2019) 258e268

261

Fig. 1. Long-term performance of the reactor at various temperatures and influent substrate concentrations. In Phases I, II, III, IV, and V, the reactor was operated at various 1 temperatures with similar influent substrate concentrations (approximately 300 mg L1 NHþ NO 4 -N and 360 mg L 2 -N). In Phases III, VI, and VII, the reactor was operated at various  influent substrate concentrations with the same temperature (20
C). (a) Variations of NHþ 4 -N concentrations and removal efficiency; (b) variations of NO2 -N concentrations and  þ  þ removal efficiency; (c) the ratio of NO2 -N/NH4 -N and NO3 -N/NH4 -N; and (d) nitrogen loading rate (NLR), nitrogen removal rate (NRR) and nitrogen removal efficiency (NRE). Note: Gap I (days 167e194) corresponds to the Spring Festival in China; Gap II (days 367e379) corresponds to laboratory maintenance.

were decreased to 4.05 ± 0.10 kg N m3 d1 and 3.54 ± 0.09 kg N m3 d1 (Table 1), respectively. During Phases VIeVII, the operational temperature was returned to 20
C for the EGSB reactor from Day 380 (Phase VI), and the influent ammonium and nitrite concentrations decreased to 1 1 approximately 150 mg NHþ and 180 mg NO in Phase 4 -N L 2 -N L  1 1 VI, and 50 mg NHþ -N L and 60 mg NO -N L in Phase VII, 4 2 respectively (Fig. 1a and b and Table 1). Specifically, in Phase VII, the NRE slightly decreased to 80.3% ± 3.4% because of the decreased influent substrate concentration and residual effluent ammonium þ (Fig. 1d and Table 1). Nevertheless, the ratios of NO 2 -N/NH4 -N and þ NO -N/NH -N were generally similar to the theoretical values of 3 4 the anammox reaction stoichiometry of 1.32 and 0.26 (Strous et al., 1998), respectively, during both Phase VI and VII (Fig. 1c). 3.1.2. Biomass concentration and specific anammox activities The biomass concentration of the EGSB reactor was >10 g MLVSS L1 throughout the operational period (Table 1). Specifically, it gradually increased from 11.85 g MLVSS L1 in Phase I to 16.62 g MLVSS L1 in Phase IV, then decreased to 15.69, 14.14, and 13.72 g MLVSS L1 in Phases V, VI, and VII, respectively (Table 1). Decreases in both temperature and influent substrate

concentration also led to decreased SAA (Fig. 2a). When the temperature gradually decreased from 35
C to 16
C (Phases IeIV), the SAA decreased at about 0.004 g N g1 VSS d1
C1, while further decreases from 16
C to 13
C (Phase V) resulted in the SAA decreasing at a high rate of 0.028 g N g1 VSS d1
C1 (Fig. 2a). The SAA at 13
C (Phase V) decreased by about 24% compared with that at 16
C (Phase IV) (Fig. 2a). This was also reflected in the variation of NRR during the reactor operation process (Table 1), during which the NLR had to be decreased to 13
C (Phase V) to prevent further deterioration of performance (Fig. 1d). A similar phenomenon was observed by Sobotka et al. (2016), who found substantially different temperature coefficients (q) in the Arrhenius equation for two temperature ranges, 1.07 (15e30
C) and 1.65 (11e15
C); additionally, the anammox activity decreased significantly when the temperature was below 15
C, with SAA values of 0.41 g N g1 VSS d1, 0.27 g N g1 VSS d1 and 0.09 g N g1 VSS d1 being observed at 20, 15 and 13
C, respectively. The mass transfer resistance resulting from the low influent substrate concentration could be another factor leading to the decreased SAA. Although the initial substrate concentrations were the same in all SAA batch tests, long-term starvation still affected the anammox activity (Xing et al., 2016). Indeed, the SAA decreased to a low rate of about 0.0008 g N g1 VSS

262

Y. Wang et al. / Water Research 162 (2019) 258e268

where Candidatus Kuenenia was more abundant (55.2%) in the microbial community at 13
C. It has also been reported that Candidatus Kuenenia is more adaptable to low temperatures than other genera such as Candidatus Brocadia (De Cocker et al., 2018). As the influent substrate concentration decreased (Phases III, VI, and VII), the relative abundances of Candidatus Kuenenia decreased from 43.0% to 33.2% and 27.8%, respectively, because of the weaker selection inhibitory effects of low ammonium and nitrite concentration on Candidatus Kuenenia than on other microorganisms (Zhang et al., 2014) (Fig. 2b). Another nitrogen conversion bacterium in the anammox system relates to denitrifiers, which compete for nitrite with anammox bacteria (Fig. 2b), such as Haliangium (Chen et al., 2016; McIlroy et al., 2016) and norank_f_Caldilineaceae (Cao et al., 2016; Kindaichi et al., 2012). The relative abundances of Haliangium increased from 1.2% to 4.7% as temperature decreased from 20
C (Phase III) to 16
C (Phase IV) (Fig. 2b). norank_f_Caldilineaceae can use organic compounds in the dead biomass and metabolites of anammox bacteria (Cao et al., 2016; Kindaichi et al., 2012; Li et al., 2009), and its relative abundance reached its highest value of 2.8% at 16
C, which may have been associated with the highest content of EPS being present at 16
C (Fig. 2c). Specifically, the increased EPS could be used as a carbon source by norank_f_Caldilineaceae, favoring their growth. It is worth noting that Denitratisoma (Fahrbach et al., 2006) was the second most abundant bacteria (Fig. 2b). However, there was no obvious relationship between Denitratisoma variation and decreasing temperature (Fig. 2b), and further studies are needed to investigate this. 3.2. Rheological characteristics of anammox granules

Fig. 2. The (a) specific anammox activities (SAA), (b) microbial community composition at the genus level, and (c) variations in protein, polysaccharide and extracellular polymeric substances (EPS) content of anammox granules in different operation phases 1 1 þ
of the reactor. Phase I (35
C, 300 mg NHþ 4 -N L ); Phase II (25 C, 300 mg NH4 -N L ); 1 1 þ
Phase III (20
C, 300 mg NHþ 4 -N L ); Phase IV (16 C, 300 mg NH4 -N L ); Phase V 1 1 þ

(13
C, 300 mg NHþ 4 -N L ); Phase VI (20 C, 150 mg NH4 -N L ); Phase VII (20 C, 1 50 mg NHþ 4 -N L ).

1 1 d1 (mg NHþ with decreasing influent substrate con4 -N L ) centration (Phase III, VI and VII), and reached the lowest value of 0.21 g N g1 VSS d1 in Phase VII (Fig. 2a).

3.1.3. Microbial structure evolution of anammox bacteria and denitrifiers The 16S rDNA high-throughput sequencing showed that Candidatus Kuenenia was the dominant anammox bacteria at the genus level in the EGSB reactor during all operational phases (Fig. 2b). As the temperature decreased (Phase IeIV), the relative abundance of Candidatus Kuenenia was maintained at about 50%, except for at 16
C (Phase IV), during which it decreased remarkably to 14.6% (Fig. 2b). After the temperature decreased further to 13
C (Phase V), the relative abundance of Candidatus Kuenenia rapidly increased to 57.0% (Fig. 2b). Similar results were observed in a upflow anaerobic sludge blanket (UASB) reactor (He et al., 2018),

3.2.1. Linear viscoelastic regimes As shown in Fig. 3aeg, the storage modulus (G0 ) of anammox granules had a relatively constant value with low strains (g < 2%) in all operational phases, suggesting that anammox granules had linear viscoelastic regimes (LVE) (Lin and Wang, 2017). This property was consistent with the dynamic mechanical behavior of physical gels (Ayol et al., 2006; Raghavan and Khan, 1995). Anammox granules, which have a relatively constant G’ within a certain range of shear strain (Fig. 3aeg) until reaching a critical strain level (gc) (Wang et al., 2011), showed yield stress fluid characteristics in all phases (Lin and Wang, 2017). It should be noted that tc ( tC ¼ G0 gc ) can be used to characterize the intensity of anammox granules (Lin et al., 2013; Mori et al., 2006; Wang et al., 2011). When the shear stress is below the tc value, only elastic deformation occurs for anammox granules, otherwise plastic deformation occurs, and this strain increases without further increases in stress (Yang et al., 2009). Thus, this mechanical properties of anammox granules was considered to resemble that of hydrogels consisting of an extracellular polysaccharide interacting with peptides (Lin and Wang, 2017). 3.2.2. tc and G’ variation The tc and G0 of anammox granular sludges during different operation phases were determined (Fig. 3h). The mechanical properties of anammox granular sludge were greatly affected by the influent substrate concentration and temperature. With the decrease in temperatures (Phases IeV) and influent substrate concentrations (Phases III, VI, and VII), the G0 and tc of anammox granular sludges decreased (Fig. 3h). Taking tc as an example, as the temperature gradually decreased from 35
C to 16
C (Phase I/IV), the tc steadily decreased at a rate of about 1.82 kPa
C1. However, when the temperature further decreased from 16
C to 13
C (Phase IV/V), the tc rapidly decreased at a rate of 6.55 kPa
C1 (Table 1 and Fig. 3h). In the decreasing influent substrate concentrations

Y. Wang et al. / Water Research 162 (2019) 258e268

263

Fig. 3. The strain (g (%)) dependence of storage modulus (G0 (Pa)), loss modulus (G’’ (Pa)) and complex viscosity (h*(Pa$S)) of anammox granules from Phases (a) I (35
C, 300 mg 1 1 1 1 1 1 þ þ þ þ þ




NHþ 4 -N L ), (b) II (25 C, 300 mg NH4 -N L ), (c) III (20 C, 300 mg NH4 -N L ), (d) IV (16 C, 300 mg NH4 -N L ), (e) V (13 C, 300 mg NH4 -N L ), (f) VI (20 C, 150 mg NH4 -N L ), 1 0 and (g) VII (20
C, 50 mg NHþ 4 -N L ); and (h) the variations of G and tc of anammox granular sludges in different operation phases.

264

Y. Wang et al. / Water Research 162 (2019) 258e268

period (Phases III, VI, and VII), the tc steadily decreased at 0.12 kPa 1 1 (mg NHþ , and a similar decrease trend was obtained for G’ 4 -N L ) variation (Fig. 3h). It should be noted that the tc of anammox granular sludges reached 64.31 kPa in Phase I and decreased to 10.13 kPa and 1 8.64 kPa in Phases V (13
C) and VII (50 mg NHþ 4 -N L ), respectively (Fig. 3h). These tc values of anammox granules were much higher than those of aerobic granules (950 Pa) (Seviour et al., 2009), anaerobic digestion sludge (420 Pa) (Jiang et al., 2014), and copolymer hydrogels (23 Pa) (Yamaguchi et al., 2005). The high tc reflects the high mechanical intensity of anammox granular sludge. 3.2.3. Shear thinning behavior of anammox granules The aforementioned rheological experiments were performed on a constant angular frequency (u ¼ 5 rad s1). To deepen our understanding of the mechanical properties of anammox granules, the frequency dependences of dynamic modulus were measured by varying u from approximately 1 to 100 rad s1 at a fixed strain of 1%, in which G0 and G00 were virtually independent of u (Figs. S1aeg). The anammox granules displayed a shear thinning behavior, as reflected by the clear decline in complex viscosity (h*) 0 00 j (jh *j ¼ jG þiG u ) as u increased (Fig. S1h) (Griskey, 1995; Zare et al., 2019). Thus, the anammox granules can be classified as polymer gels (Lin and Wang, 2017). Additionally, the change in the intercept of the curve (log u-log h*) was consistent with the changes in temperature and influent substrate concentration, but the slope of the curve did not vary (Fig. S1h). In other words, the changes in temperature and influent substrate concentration could affect the log h* of anammox granules, but not the change rate of log h* with log u, suggesting that the shear thinning behavior characteristics of anammox granules was almost unchanged with variations in temperature and influent substrate concentration. 3.3. Anammox granule size and morphological characteristics As shown in Fig. 4 and Table 2, the granule size decreased significantly (p < 0.05) with decreasing influent substrate concen1 trations (300 / 50 mg NHþ 4 -N L ), but did not always significantly decrease with decreasing temperature (35 / 13
C). For example, there was no significant difference (p > 0.05) in D [4, 3] values as the temperature decreased from 35
C (Phase I) to 20
C (Phase III); however, when the temperature further decreased to 16
C (Phase IV), D [4, 3] significantly (0.01 < p < 0.05) decreased to 767 ± 13 mm (Table 2). After the temperature decreased to 13
C (Phase V), D [4, 3] decreased significantly (p < 0.01) to 569 ± 10 mm (Table 2). Moreover, as shown in Fig. 4a, anammox granules with sizes >2 mm were not detected in Phase V (13
C). Notably, the D [4, 3] 1 values in both Phase V (13
C) and VII (50 mg NHþ 4 -N L ) were significantly (p < 0.01) lower than those in other phases (Table 2). These findings suggest that most of the anammox granules, especially the large granules (>2 mm), disintegrated in these two phases 1 (Phases V (13
C) and VII (50 mg NHþ 4 -N L )), which were primarily influenced by low temperature and low-strength ammonium loading. The morphological characteristics of anammox granules in the EGSB reactor revealed that they mainly appeared as “iron red cauliflowers” during the operational process (Fig. S2a), indicating a relatively high abundance of anammox bacteria enriched in the reactor. The voids on the surface of large particles may be because of aggregation of relatively small sludge particles (Lu et al., 2012). As shown in Fig. S2b, the surface of granular sludges was mainly covered by cocci, with few bacilli and filamentous bacterium. The cocci were speculated to be anammox bacteria, which are reportedly coccoid with an average size ranging between 800 and 1100 nm (Laura and Jetten, 2012). Cavities in granular sludge were

considered to be the channels that transferred substrates into the particles and the generated metabolites and gas out of particles (Muda et al., 2010; Subramanyam and Mishra, 2008). Additionally, a large amount of EPS were observed on the surface of granular sludges, indicating their importance in granular sludge (Lu et al., 2012). 3.4. EPS content and composition variations The contents of proteins (PN) and polysaccharides (PS) of anammox granules were determined, and proteins were identified as the main component of EPS (PN/PS radio ¼ 3.4 ± 0.5) (Fig. 2c). The EPS content decreased as the influent substrate concentration decreased (Phases III, VI, and VII) and decreased significantly (p < 0.05) to the lowest value (98.1 mg g1 VSS) in Phase VII, which was mainly reflected by the decrease in protein content (Fig. 2c). This may have been because the microbial metabolic activity was inhibited by the limited substrate availability (Ma et al., 2017) and lower mass transfer efficiency in the lower substrate concentration, which decreased the EPS production of anammox bacteria (He et al., 2018). However, there was no significant difference (p > 0.05) in EPS content as the temperature decreased from 35
C (Phase I) to 20
C (Phase III). As the temperature further decreased to 16
C (Phase IV), the EPS content increased significantly (p < 0.01) to the maximum value (150.0 mg g1 VSS) (Fig. 2c). After the temperature ultimately decreased to 13
C (Phase V), the EPS decreased significantly (p < 0.01) to 118.8 mg g1 VSS (Fig. 2c). A similar phenomenon was also observed in a previous study (He et al., 2018), in which the EPS increased to a maximum value (131.9 mg g1 VSS) at 18
C. This was attributed to the protective responses of anammox biomass under the stress of low temperature. At 13
C, the EPS decreased to 118.8 mg g1 VSS because of decreasing cell secretions resulting from low anammox activities (He et al., 2018). 4. Discussion The remarkable advantages of anammox granules such as good settleability, high activity and shock resistance have been widely recognized for application in biological wastewater treatment (Liu et al., 2009; Ma et al., 2016; Tang et al., 2017). Studies of the characteristics of anammox granule sludge at low temperatures (Cao et al., 2016; He et al., 2018) and low-strength ammonium loading (Lotti et al., 2014; Ma et al., 2013) have become increasingly important in wastewater nutrient removal, as anammox technology can save a large amount of energy and carbon sources if applied in mainstream wastewater treatment plants. However, maintaining the anammox activity, anammox granule size and intensity of granule sludges represent major challenges for anammox technology in mainstream wastewater treatment, especially from a long-term steady operation perspective (Dosta et al., 2008; Guo et al., 2015; Ma et al., 2017). Thus, characterization of anammox granules with decreasing temperature and influent substrate concentration is needed to enable optimum control of granules and provide robust anammox reactions. 4.1. Characteristics of anammox granules affected by decreasing temperature To explore the intensity and size evolution of anammox granules, we comprehensively analyzed variations in the anammox granule characteristics in response to decreasing temperature in phases (35
C/16
C/13
C). As the temperature decreased from 35
C (Phase I) to 16
C (Phase IV), both the SAA and tc (or G’) of the anammox granules decreased gently (Figs. 2a and 3h). However,

Y. Wang et al. / Water Research 162 (2019) 258e268

265

1 Fig. 4. Particle size distribution of anammox sludges at (a) different temperatures and (b) different influent substrate concentrations. Phase I (35
C, 300 mg NHþ 4 -N L ); Phase II 1 1 1 1 1 þ þ þ þ



(25
C, 300 mg NHþ 4 -N L ); Phase III (20 C, 300 mg NH4 -N L ); Phase IV (16 C, 300 mg NH4 -N L ); Phase V (13 C, 300 mg NH4 -N L ); Phase VI (20 C, 150 mg NH4 -N L ); 1 Phase VII (20
C, 50 mg NHþ 4 -N L ).

Table 2 Particle size parameters of sludges during different operation phases. Phase I II III IV V VI VII

a

D10(mm)b

D50(mm)

146 ± 2 170 ± 6 152 ± 6 176 ± 2 112 ± 2 220 ± 7 100 ± 6

670 ± 6 664 ± 13 693 ± 15 656 ± 5 507 ± 8 682 ± 15 544 ± 24

b

D90(mm)

b

1530 ± 46 1570 ± 82 1700 ± 46 1490 ± 36 1110 ± 26 1440 ± 46 1230 ± 98

D[4, 3] c (mm) 777 ± 15 792 ± 27 834 ± 20 767 ± 13 569 ± 10 776 ± 21 624 ± 47

a 1 1 þ
Phase I (35
C, 300 mg NHþ 4 -N L ); Phase II (25 C, 300 mg NH4 -N L ); Phase III 1 1 þ

(20
C, 300 mg NHþ 4 -N L ); Phase IV (16 C, 300 mg NH4 -N L ); Phase V (13 C, 1 1
300 mg NHþ ); Phase VI (20
C, 150 mg NHþ 4 -N L 4 -N L ); Phase VII (20 C, 50 mg 1 NHþ 4 -N L ). b D10, D50, and D90 indicate particle diameters less than these three values account for 10%, 50% and 90% of the total particles volume, respectively. c D [4, 3] indicates the particle volume average diameter, which is the ratio of the sum of the biquadratic particle sizes to the sum of the cubic particle size and can characterize the overall size variation in particles in the reactor.

the granule size distribution showed little variation (Fig. 4a). The maximum EPS contents of the anammox granules was reached at 16
C (Phase IV) (Fig. 2c), which could be a protective response of anammox biomass to this low temperature (Shi et al., 2017). However, because EPS can serve as a carbon source for heterotrophic bacteria, an increased EPS amount may stimulate the proliferation of heterotrophic bacteria, which have a higher yield rate and could compete with anammox bacteria for substrate and living space (Chen et al., 2016; McIlroy et al., 2016). The combination of increased EPS and low-temperature shock caused the relative abundance of Candidatus Kuenenia to decrease to the lowest value of 14.6% in Phase IV (16
C) (Fig. 2b). When the temperature decreased further to 13
C, both SAA and tc (or G0 ) decreased remarkably (Figs. 2a and 3h). The granule size decreased significantly (p < 0.01) at 13
C (Phase V), which was accompanied by biomass loss and decreased MLVSS (Fig. 4a, Tables 1 and 2). Similar results were also reported by (Xing et al., 2015), who observed lower annamox activities, sizes, and intensities of anammox granules in a UASB reactor at ambient temperatures of 9e25
C than at 35 ± 2
C. The disintegration of granules induced by low temperature led to a portion of SAA being exhausted for small granules, which then lowered the nitrogen removal capacity of the EGSB reactor (Table 1). Moreover, the EPS content reached the lowest value of 118.8 mg g1 VSS at 13
C (Fig. 2c). a-polysaccharides and proteins are considered to be the

backbones of anammox granules, contributing greatly to their intensity (Lin and Wang, 2017), and polysaccharides play important roles in maintaining the EPS structure (Zhu et al., 2018). The EPS content might play an important role in maintenance of intensity and size of anammox granules. However, in this study, the maximum EPS contents occurred at 16
C and did not increase the anammox granule intensity or size (Fig. 2c). Thus, besides EPS contents, temperature itself or other factors may have a comprehensive effect on anammox granule intensity and size. At 13
C, the relative abundance of Candidatus Kuenenia increased instead, indicating that Candidatus Kuenenia might have a competitive advantage for low temperature compared with other bacteria (De Cocker et al., 2018). Therefore, a critical temperature threshold of SAA, tc (or G’), and size of anammox granules might exist between 13
C (Phase V) and 16
C (Phase IV). It was previously shown that 15
C was a critical temperature threshold for changes in anammox granule activities in an anammox granule system (Sobotka et al., 2016).

4.2. Characteristics of anammox granules affected by influent substrate concentration Variations in SAA (Fig. 2a), tc (or G0 ) (Fig. 3h), and granule size (Fig. 4b and Table 2) of anammox granules with decreasing influent substrate concentrations of 300 to 150 and 50 mg L1 NHþ 4 -N in Phases III, VI, and VII were similar to those of decreasing temperature scenario. The decrease in SAA and tc (or G’) of granules with decreasing influent substrate concentration (Figs. 2a and 3h) can be attributed to the starvation and/or lower mass transfer by the low substrate availability (Ma et al., 2017; Xing et al., 2016; Zhang et al., 2015). The decrease in EPS (Fig. 2c) could increase the porosity and permeability of anammox granules (Xing et al., 2015), which might lead to decreased granule intensity and the disintegration of large granules (Fig. 4b and Table 2). Moreover, the MLVSS of the EGSB decreased in Phases VI and VII (Table 1), which was partially attributed to the lower growth rate of anammox bacteria under the limited substrate as well as the biomass loss caused by the granule disintegration. Among anammox bacteria, the relative abundance of Candidatus Kuenenia decreased to 33.2% and 27.8% in Phases VI and VII (Fig. 2b), respectively. Therefore, the competitive advantage of anammox bacteria declined in low-strength ammonium wastewater (Zhang et al., 2014) compared with other microorganisms, which then negatively impacted the EGSB reactor performance. For

266

Y. Wang et al. / Water Research 162 (2019) 258e268

example, although the NRR was inevitably limited by low influent substrate concentrations and NLR, the NRE of 80.3% ± 3.4% in Phase VII was significantly lower than that of other phases (p < 0.05) (Fig. 1d and Table 1). The decrease in relative abundance of Candidatus Kuenenia also led to a decrease in SAA (Fig. 2a). Notably, the anammox granule characteristics in Phase VI might have been affected by the low temperature (13
C) in Phase V. Although the data from Phase III, VI and VII could reflect the regular effects of influent substrate concentration on anammox granule characteristics, the effects of temperature in the previous phase (phase V) on biomass might still exist. Accordingly, future studies to investigate the effects of influent substrate concentration are warranted.

4.3. Relationship of granule size and intensity with anammox activity Relationships of G0 and tc with SAA were established for the studied EGSB-anammox system when decreasing the temperature and influent substrate concentration. Based on this, an exponential dependence (R2 > 0.94) of tc and G0 on the SAA of anammox granules was obtained (Fig. 5a). A higher granule intensity was associated with higher anammox activities, and was regulated by both temperature and influent substrate concentration. Moreover, the degree of the decrease in the tc (or G0 ) of the anammox granule decreased as SAA decreased. For example, the tc decreased by 26.72 kPa when the SAA decreased from 0.44 g N g1 VSS d1 (Phase I, 35
C) to 0.41 g N g1 VSS d1 (Phase III, 20
C), but only decreased by 6.99 kPa when SAA decreased from 0.33 g N g1 VSS 1 1 d1 (Phase VI, 150 ng NHþ VSS d1 (Phase VII, 4 -N L ) to 0.21 g N g 1 þ 50 mg NH4 -N L ) (Fig. 5a). In addition, the majority of the relatively high SAA values (>0.35 g N g1 VSS d1) occurred in the decreasing temperature period (Phases IeIV) (Fig. 2a). These findings indicate that temperature variations had a greater impact on granule intensity than variations in influent substrate concentration. Nevertheless, both SAA, tc and G0 , decreased steadily as the temperature gradually decreased from 35
C to 16
C, while they decreased substantially when the temperature decreased to 13
C (Figs. 2a and 3h). Therefore, when compared with temperature, the SAA might have a stronger association with the intensity of anammox granules. When the SAA was less than approximately 0.3 g N g1 VSS d1, the effects of SAA variation on the intensity of anammox granules was not obvious (Fig. 5a) and the tc (or G’) of anammox granules tended to be stable. Our findings indicate future

studies focusing on anammox granule intensity evolution with anammox activity variation under other conditions are needed. The relationship among anammox granule size, tc (or G0 ) and hydrodynamic shear force was also investigated. The average particle volume diameters (D [4, 3]) in both Phase V (569 mm) and Phase VII (624 mm) were much lower than those in other phases (793 ± 26 mm), even though the tc (or G0 ) of 10.13 kPa in Phase V and 8.66 kPa in Phase VII were both close to that of 15.63 kPa in Phase VI (Table 2 and Fig. 5b). It has been reported that the selection pressure for granulation depends on the UFV, which affects the hydrodynamic shear force imposed on the biomass (Jin et al., 2013). Thus, the fixed UFV (2.67 m h1) in this study indicated that the hydrodynamic shear force of the investigated EGSB reactor was basically unchanged. Based on this hypothesis, we identified a threshold value of the tc (or G0 ) between 10.13 kPa (Phase V) and 15.63 kPa (Phase VI)) (Fig. 5b) in the present study, which was closely related to the hydrodynamic shear force in the reactor. When the tc (or G’) of anammox granules decreases to below this value or range, granules that cannot stand the hydrodynamic shear forces in the system will disintegrate, leading to a significant decrease in granule size.

4.4. Design and operation optimization of the granular anammox reactors based on rheological parameters Our findings regarding anammox granule activity, intensity, and size evolution with decreasing temperature and influent substrate concentration are favorable for the optimum control of anammox granules and anammox performance. In particular, a lower granular intensity being associated with lower anammox activities was elucidated for the first time. Our results reveal that the SAA and tc (or G0 ) values of anammox granules were significantly influenced by temperature and influent substrate concentration. Therefore, the hydrodynamic shear force associated with the threshold value of tc (or G’) is the key parameter that should be controlled appropriately during wastewater treatment with low-strength ammonia influent at low temperature. Based on these findings, the disintegration and wastage of low intensity granules in response to hydrodynamic shear forces produced in the system might be avoidable to some extent. Conversely, high hydrodynamic shear forces in the reactor can be applied to high temperature and high-strength ammonium treatment processes. In such cases, the issue of anammox biomass loss resulting from granules floatation should be considered carefully

Fig. 5. (a) Exponential dependence of storage modulus (G0 ) and yield stress (tc) on specific anammox activities (SAA), and (b) variations of D[4, 3], G0 , and tc of anammox granules in 1 1 1 1 þ þ þ


different operation phases. Phase I (35
C, 300 mg NHþ 4 -N L ); Phase II (25 C, 300 mg NH4 -N L ); Phase III (20 C, 300 mg NH4 -N L ); Phase IV (16 C, 300 mg NH4 -N L ); Phase 1 1 1 þ þ

V (13
C, 300 mg NHþ 4 -N L ); Phase VI (20 C, 150 mg NH4 -N L ); Phase VII (20 C, 50 mg NH4 -N L ).

Y. Wang et al. / Water Research 162 (2019) 258e268

(Chen et al., 2010). Previous studies have reported that the severe problem of granules (especially large size granules (>4 mm)) (Lu et al., 2013) floatation and wastage occurred in reactors with high NRR and anammox activities (Dapena-Mora et al., 2004; Jianwei et al., 2010; Lu et al., 2012). Additionally, the volume of gas pockets increased with increasing anammox granule size, leading to decreased density and floatation of anammox granules (Lu et al., 2012). Therefore, we speculate that granules with high SAA and intensity beyond the critical values of tc (or G0 ) may grow continually and be almost unaffected by hydrodynamic shear stress, eventually floating up. Nevertheless, floatation of the anammox granules could be effectively prevented by adjusting the liquid velocity to maintain a shear rate of more than 0.778 s1 in a UASB 
reactor with about 280 mg L1 NHþ 4 -N or NO2 -N at 35 ± 1 C (Chen et al., 2014). In other words, properly increasing the threshold value of tc (or G0 ) by adjusting the hydrodynamic shear forces (e.g., the UFV) can effectively prevent excessively large granules with a high tc (or G0 ) from forming and floating up. Therefore, further studies are required to accurately identify this threshold value of tc (or G’) of anammox granules under different reactor operating conditions to better guide the design and operation of anammox granule sludge reactors. 5. Conclusions This study investigated the effects of decreasing temperature and influent substrate concentration on anammox granule activity, rheological intensity and size evolution and analyzed the biochemical characteristics of anammox biomass in a granular EGSB. The following conclusions can be drawn from this study.  Candidatus Kuenenia was the dominant genus in the studied EGSB and its relative abundance was maintained at 57.0% and 1 27.8% at 13
C and 50 mg NHþ 4 -N L , respectively. This contributed to achievement of a high NLR (>1.0 kg N m3 d1) of the anammox-EGSB reactor at low temperature and influent substrate concentration.  Anammox granules had excellent mechanical intensity. The lowest tc value (8.64 kPa) of anammox granules at 20
C with 1 50 mg NHþ in influent was still much higher than that of 4 -N L the aerobic granules (950 Pa).  Both the SAA and tc (or G0 ) of the anammox granules decreased with decreasing temperature and influent substrate concentration, with the lowest values occurring at 13
C or in the 50 mg 1 NHþ influent phases. Additionally, the exponential 4 -N L dependence of tc and G0 on the SAA of anammox granules was elucidated.  Granule size decreased significantly at low temperature (13
C) 1 and low influent substrate concentration (50 mg NHþ 4 -N L ), 0 despite slight variations in tc (or G ) values. A threshold value of tc (or G0 ) that was closely related to the hydrodynamic shear force was identified for the studied anammox granules (10.13e15.63 kPa).

Declaration of interests The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgements This work was supported by the National Natural Science Foundation of China (51778446and 51522809). The Foundation of

267

the State Key Laboratory of Pollution Control and Resource Reuse (Tongji University, China) (PCRRY 0400231010) is also acknowledged. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.watres.2019.06.060. References APHA, 1998. Standard Methods for the Examination of Water and Wastewater, twentieth ed. American Public Health Association, Washington DC, USA. Ayol, A., Dentel, S.K., Filibell, A., 2006. Toward efficient sludge processing using novel rheological parameters: dynamic rheological testing. Water Sci. Technol. 54 (5), 17e22. Cao, S.B., Du, R., Li, B.K., Ren, N.Q., Peng, Y.Z., 2016. High-throughput profiling of microbial community structures in an ANAMMOX-UASB reactor treating highstrength wastewater. Appl. Microbiol. Biotechnol. 100 (14), 6457e6467. Chen, H., Ma, C., Yang, G.F., Wang, H.Z., Yu, Z.M., Jin, R.C., 2014. Floatation of flocculent and granular sludge in a high-loaded anammox reactor. Bioresour. Technol. 169C (5), 409e415. Chen, J., Ji, Q., Zheng, P., Chen, T., Wang, C., Mahmood, Q., 2010. Floatation and control of granular sludge in a high-rate anammox reactor. Water Res. 44 (11), 3321e3328. Chen, Y.S., Zhao, Z., Peng, Y.K., Li, J., Xiao, L., Yang, L.Y., 2016. Performance of a fullscale modified anaerobic/anoxic/oxic process: high-throughput sequence analysis of its microbial structures and their community functions. Bioresour. Technol. 220, 225e232. ndez, R., Dapena-Mora, A., Campos, J.L., Mosquera-Corral, A., Jetten, M.S.M., Me 2004. Stability of the ANAMMOX process in a gas-lift reactor and a SBR. J. Biotechnol. 110 (2), 159e170. De Cocker, P., Bessiere, Y., Hernandez-Raquet, G., Dubos, S., Mozo, I., Gaval, G., Caligaris, M., Barillon, B., Vlaeminck, S.E., Sperandio, M., 2018. Enrichment and adaptation yield high anammox conversion rates under low temperatures. Bioresour. Technol. 250, 505e512. ndez, I., Va zquez-Padín, J.R., Mosquera-Corral, A., Campos, J.L., MataDosta, J., Ferna  ndez, R., 2008. Short- and long-term effects of temperature on the Alvarez, J., Me Anammox process. J. Hazard Mater. 154 (1), 688e693. Edgar, R.C., 2010. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26 (19), 2460. Edgar, R.C., Haas, B.J., Clemente, J.C., Christopher, Q., Rob, K., 2011. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 27 (16), 2194. Fahrbach, M., Kuever, J., Meinke, R., Kampfer, P., Hollender, J., 2006. Denitratisoma oestradiolicum gen. nov., sp nov., a 17 beta-oestradiol-degrading, denitrifying betaproteobacterium. Int. J. Syst. Evol. Microbiol. 56, 1547e1552. Griskey, R.G., 1995. Applied Polymer Rheology. Springer Netherlands, Dordrecht. Guo, Q., Xing, B.S., Li, P., Xu, J.L., Yang, C.C., Jin, R.C., 2015. Anaerobic ammonium oxidation (anammox) under realistic seasonal temperature variations: characteristics of biogranules and process performance. Bioresour. Technol. 192, 765e773. He, S.L., Chen, Y., Qin, M., Mao, Z., Yuan, L.M., Niu, Q.G., Tan, X.C., 2018. Effects of temperature on anammox performance and community structure. Bioresour. Technol. 260, 186e195. Jiang, J., Wu, J., Poncin, S., Li, H.Z., 2014. Rheological characteristics of highly concentrated anaerobic digested sludge. Biochem. Eng. J. 86, 57e61. Jianwei, C., Ping, Z., Yi, Y., Chongjian, T., Qaisar, M., 2010. Promoting sludge quantity and activity results in high loading rates in Anammox UBF. Bioresour. Technol. 101 (8), 2700e2705. Jin, R.C., Ma, C., Yu, J.J., 2013. Performance of an Anammox UASB reactor at high load and low ambient temperature. Chem. Eng. J. 232 (10), 17e25. Jing, W., Hong-Ming, Z., Huai-Zhi, L., Peng-Cheng, Z., Jie, J., 2009. Impacts of hydrodynamic shear force on nucleation of flocculent sludge in anaerobic reactor. Water Res. 43 (12), 3029e3036. Kindaichi, T., Yuri, S., Ozaki, N., Ohashi, A., 2012. Ecophysiological role and function of uncultured Chloroflexi in an anammox reactor. Water Sci. Technol. 66 (12), 2556e2561. Laura, V.N., Jetten, M.S.M., 2012. Anaerobic ammonium-oxidizing bacteria: unique microorganisms with exceptional properties. Microbiol. Mol. Biol. Rev. Mmbr 76 (3), 585e596. Li, X.-R., Du, B., Fu, H.-X., Wang, R.-F., Shi, J.-H., Wang, Y., Jetten, M.S.M., Quan, Z.-X., 2009. The bacterial diversity in an anaerobic ammonium-oxidizing (anammox) reactor community. Syst. Appl. Microbiol. 32 (4), 278e289. Li, X.Y., Yang, S.F., 2007. Influence of loosely bound extracellular polymeric substances (EPS) on the flocculation, sedimentation and dewaterability of activated sludge. Water Res. 41 (5), 1022e1030. Lin, X., Wang, Y., 2017. Microstructure of anammox granules and mechanisms endowing their intensity revealed by microscopic inspection and rheometry. Water Res. 120, 22e31. Lin, Y.M., Sharma, P.K., van Loosdrecht, M.C., 2013. The chemical and mechanical differences between alginate-like exopolysaccharides isolated from aerobic

268

Y. Wang et al. / Water Research 162 (2019) 258e268

flocculent sludge and aerobic granular sludge. Water Res. 47 (1), 57e65. Liu, X.W., Sheng, G.P., Yu, H.Q., 2009. Physicochemical characteristics of microbial granules. Biotechnol. Adv. 27 (6), 1061e1070. Lotti, T., Kleerebezem, R., Kip, C., Hendrickx, T.L.G., Kruit, J., Hoekstra, M., van Loosdrecht, M.C.M., 2014. Anammox growth on pretreated municipal wastewater. Environ. Sci. Technol. 48 (14), 7874e7880. Lu, H.F., Ji, Q.X., Ding, S., Zheng, P., 2013. The morphological and settling properties of ANAMMOX granular sludge in high-rate reactors. Bioresour. Technol. 143 (17), 592e597. Lu, H.F., Zheng, P., Ji, Q.X., Zhang, H.T., Ji, J.Y., Wang, L., Ding, S., Chen, T.T., Zhang, J.Q., Tang, C.J., Chen, J.W., 2012. The structure, density and settlability of anammox granular sludge in high-rate reactors. Bioresour. Technol. 123, 312e317. Ma, B., Peng, Y., Zhang, S., Wang, J., Gan, Y., Chang, J., Wang, S., Wang, S., Zhu, G., 2013. Performance of anammox UASB reactor treating low strength wastewater under moderate and low temperatures. Bioresour. Technol. 129, 606e611. Ma, B., Wang, S.Y., Cao, S.B., Miao, Y.Y., Jia, F.X., Du, R., Peng, Y.Z., 2016. Biological nitrogen removal from sewage via anammox: recent advances. Bioresour. Technol. 200, 981e990. Ma, X., Wang, Y.Y., Zhou, S., Yan, Y., Lin, X.M., Wu, M., 2017. Endogenous metabolism of anaerobic ammonium oxidizing bacteria in response to short-term anaerobic and anoxic starvation stress. Chem. Eng. J. 313, 1233e1241. McIlroy, S.J., Starnawska, A., Starnawski, P., Saunders, A.M., Nierychlo, M., Nielsen, P.H., Nielsen, J.L., 2016. Identification of active denitrifiers in full-scale nutrient removal wastewater treatment systems. Environ. Microbiol. 18 (1), 50e64. Mori, M., Seyssiecq, I., Roche, N., 2006. Rheological measurements of sewage sludge for various solids concentrations and geometry. Process Biochem. 41 (7), 1656e1662. Muda, K., Aris, A., Salim, M.R., Ibrahim, Z., Yahya, A., van Loosdrecht, M.C.M., Ahmad, A., Nawahwi, Z., 2010. Development of granular sludge for textile wastewater treatment. Water Res. 44 (15), 4341e4350. Mulder, T., Alexander, J., 2001. The physical character of subaqueous sedimentary density flows and their deposits. Sedimentology 48 (2), 269e299. Muyzer, G.,., Waal, E.C., De, Uitterlinden, A.G., 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59 (3), 695e700. Peng, A., Xu, X., Yang, F., Li, Z., 2013. Comparison of the characteristics of anammox granules of different sizes. Biotechnol. Bioproc. Eng. 18 (3), 446e454. Pereboom, J.H.F., 1997. Strength characterisation of microbial granules. Water Sci. Technol. 36 (6e7), 141e148. Raghavan, S.R., Khan, S.A., 1995. SHEAR-INDUCED MICROSTRUCTURAL CHANGES IN FLOCCULATED SUSPENSIONS OF FUMED SILICA. J. Rheol. 39 (6), 1311e1325. Seviour, T., Pijuan, M., Nicholson, T., Keller, J., Yuan, Z., 2009. Understanding the properties of aerobic sludge granules as hydrogels. Biotechnol. Bioeng. 102 (5), 1483e1493. Shi, Z.J., Guo, Q., Xu, Y.Q., Wu, D., Liao, S.M., Zhang, F.Y., Zhang, Z.Z., Jin, R.C., 2017. Mass transfer characteristics, rheological behavior and fractal dimension of anammox granules: the roles of upflow velocity and temperature. Bioresour. Technol. 244 (Pt 1), 117e124. Sobotka, D., Czerwionka, K., Makinia, J., 2016. Influence of temperature on the activity of anammox granular biomass. Water Sci. Technol. 73 (10), 2518e2525. Star, W.R.L.V.D., Abma, W.R., Blommers, D., Mulder, J.W., Tokutomi, T., Strous, M., Picioreanu, C., Loosdrecht, M.C.M.V., 2007. Startup of reactors for anoxic

ammonium oxidation: experiences from the first full-scale anammox reactor in Rotterdam. Water Res. 41 (18), 4149e4163. Strous, M., Heijnen, J.J., Kuenen, J.G., Jetten, M.S.M., 1998. The sequencing batch reactor as a powerful tool for the study of slowly growing anaerobic ammonium-oxidizing microorganisms. Appl. Microbiol. Biotechnol. 50 (5), 589e596. Subramanyam, R., Mishra, I.M., 2008. Treatment of catechol bearing wastewater in an upflow anaerobic sludge blanket (UASB) reactor: sludge characteristics. Bioresour. Technol. 99 (18), 8917e8925. Tang, C.J., Duan, C.S., Yu, C., Song, Y.X., Chai, L.Y., Xiao, R., Wei, Z., Min, X.B., 2017. Removal of nitrogen from wastewaters by anaerobic ammonium oxidation (ANAMMOX) using granules in upflow reactors. Environ. Chem. Lett. 15 (2), 311e328. Tang, C.J., Ping, Z., Wang, C.H., Mahmood, Q., Zhang, J.Q., Chen, X.G., Lei, Z., Chen, J.W., 2011. Performance of high-loaded ANAMMOX UASB reactors containing granular sludge. Water Res. 45 (1), 0e144. van der Star, W.R.L., Abma, W.R., Blommers, D., Mulder, J.W., Tokutomi, T., Strous, M., Picioreanu, C., Van Loosdrecht, M.C.M., 2007. Startup of reactors for anoxic ammonium oxidation: experiences from the first full-scale anammox reactor in Rotterdam. Water Res. 41 (18), 4149e4163. Wang, Y., Dieude-Fauvel, E., Dentel, S.K., 2011. Physical characteristics of conditioned anaerobic digested sludge - a fractal, transient and dynamic rheological viewpoint. J. Environ. Sci. 23 (8), 1266e1273. Wang, Y., Ma, X., Zhou, S., Lin, X., Ma, B., Park, H.D., Yan, Y., 2016. Expression of the nirS, hzsA, and hdh genes in response to nitrite shock and recovery in Candidatus Kuenenia stuttgartiensis. Environ. Sci. Technol. 50 (13), 6940. Xing, B.-S., Guo, Q., Jiang, X.-Y., Chen, Q.-Q., He, M.-M., Wu, L.-M., Jin, R.-C., 2016. Long-term starvation and subsequent reactivation of anaerobic ammonium oxidation (anammox) granules. Chem. Eng. J. 287, 575e584. Xing, B.S., Guo, Q., Yang, G.F., Zhang, Z.Z., Li, P., Guo, L.X., Jin, R.C., 2015. The properties of anaerobic ammonium oxidation (anammox) granules: roles of ambient temperature, salinity and calcium concentration. Separ. Purif. Technol. 147, 311e318. Yamaguchi, N., Chae, B.S., Zhang, L., Kiick, K.L., Furst, E.M., 2005. Rheological characterization of polysaccharide-poly(ethylene glycol) star copolymer hydrogels. Biomacromolecules 6 (4), 1931e1940. Yang, F., Bick, A., Shandalov, S., Brenner, A., Oron, G., 2009. Yield stress and rheological characteristics of activated sludge in an airlift membrane bioreactor. J. Membr. Sci. 334 (1e2), 83e90. Zare, Y., Park, S.P., Rhee, K.Y., 2019. Analysis of complex viscosity and shear thinning behavior in poly (lactic acid)/poly (ethylene oxide)/carbon nanotubes biosensor based on CarreaueYasuda model. Results Phys. 13, 102245. Zhang, X., Li, D., Liang, Y., Zeng, H., He, Y., Zhang, Y., Zhang, J., 2014. Performance and microbial community of completely autotrophic nitrogen removal over nitrite (CANON) process in two membrane bioreactors (MBR) fed with different substrate levels. Bioresour. Technol. 152 (1), 185e191. Zhang, Z.-Z., Buayi, X., Cheng, Y.-F., Zhou, Y.-H., Wang, H.-Z., Jin, R.-C., 2015. Anammox endogenous metabolism during long-term starvation: impacts of intermittent and persistent modes and phosphates. Separ. Purif. Technol. 151, 309e317. Zhu, G.B., Wang, S.Y., Ma, B., Wang, X.X., Zhou, J.M., Zhao, S.Y., Liu, R.P., 2018. Anammox granular sludge in low-ammonium sewage treatment: not bigger size driving better performance. Water Res. 142, 147e158.