Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization

Article MATBIO-1271; No. of pages: 13; 4C:

Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization Shaohua Li a, b † , Yanmei Qi a, † , Karen McKee b , Jie Liu a , June Hsu a and Peter D. Yurchenco b a - Department of Surgery, Rutgers-Robert Wood Johnson Medical School, New Brunswick, NJ 08903, USA b - Department of Pathology & Laboratory Medicine, Rutgers-Robert Wood Johnson Medical School, Piscataway, NJ 08854, USA

Correspondence to: Shaohua Li, Department of Surgery, Rutgers - Robert Wood Johnson Medical School, 125 Paterson Street, New Brunswick, NJ 08903, USA. P. D. Yurchenco, Department of Pathology & Laboratory Medicine, Rutgers - Robert Wood Johnson Medical School, 675 Hoes Lane West, Piscataway, NJ 08854, USA. [email protected], [email protected] http://dx.doi.org/10.1016/j.matbio.2016.07.005

Abstract During early embryogenesis, endodermal γ1-laminin expression is required for basement membrane (BM) assembly, promoting conversion of non-polar pluripotent cells into polarized epiblast. The influence of laminin-111 (Lm111) and its integrin and dystroglycan (DG) receptors on epiblast in embryoid bodies (EBs), a model for differentiation of the embryonic plate, was further investigated. Lm111 added to the medium of EBs initiated conversion of inner nonpolar cell to the polarized epiblast epithelium with an exterior-to-central basal-to-apical orientation. Microinjection of Lm111 into EB interiors resulted in an interior BM with complete inversion of cell polarity. Lm111 assembled a BM on integrin-β1 null EBs with induction of polarization at reduced efficiency. β-Integrin compensation was not detected in these nulls with integrin adaptor proteins failing to assemble. A dimer of laminin LG domains 4–5 (LZE3) engineered to strongly bind to α-dystroglycan almost completely inhibited laminin accumulation on integrin β1-null EBs, reducing BM and ablating cell polarization. When Lm111 was incubated with integrin-β1/dystroglycan double-knockout EBs, laminin failed to accumulate on the EBs, the EBs did not differentiate, and the EBs underwent apoptosis. Collectively the findings support the hypotheses that the locus of laminin cell surface assembly can determine the axis of epithelial polarity. This requires integrin- and/ or dystroglycan-dependent binding to laminin LG domains with the highest efficiency achieved when both receptors are present. Finally, EBs that cannot assemble a matrix undergo apoptosis. © 2016 Elsevier B.V. All rights reserved.

Introduction During peri-implantation development, primitive endoderm and polarized epiblast are two epithelia that develop from the nonpolar inner cell mass (ICM) of the implanting blastocyst. The endoderm is responsible for synthesis and secretion of α1β1γ1 and α5β1γ1 laminins needed for assembly of the basement membrane (BM) between endoderm and the epiblast. This BM mediates differentiation and polarization of the epiblast, leading to the formation of the pseudostratified columnar epiblast epithelium which is the source of the three definitive germ layers [1]. The epiblast cells that do not contact the BM die by apoptosis, creating the proamniotic cavity. During 0022-2836/© 2016 Elsevier B.V. All rights reserved.

these morphogenetic processes, the expression of pluripotency transcription factors such as Nanog and Oct4 is downregulated while the expression of markers for the pre-gastrulation epiblast such as Brachyury and Snail1 is upregulated [2,3]. The acquisition of these molecular signatures is essential for the embryo to enter gastrulation [3]. Analysis of embryoid bodies (EBs) derived from mouse embryonic stem (ES) cells has revealed that while a polarized endodermal layer forms in the absence of a BM to become the factory for laminin synthesis, conversion of the nonpolar pluripotent inner cells to a polarized epiblast and central cavity is dependent upon laminin secretion, laminin anchorage to the cell surface through the LG domains, and Matrix Biol. (2016) xx, xxx–xxx

Please cite this article as: S. Li, et al., Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization, Matrix Biol (2016), http://dx.doi.org/10.1016/j.matbio.2016.07.005

2

Laminin and cell polarity

laminin polymerization mediated by the LN domains [4,5]. Exogenous laminin-111 rescues the defect of BM and the columnar epiblast epithelium observed in endoderm-containing laminin γ1-null EBs when added at low (0.025 mg/ml) concentrations [4,5]. Examination of the transport of fluorescent-tagged laminin-111 in a chase experiment suggests that the laminin is transported across the endodermal layer, accumulating in the sub-endodermal space (Li & Yurchenco, unpublished observations). In EBs selected from ES clones that are unable to form an endodermal layer, rescue of BM assembly was observed at higher (0.1 mg/ml) concentrations of laminin at its critical concentration of polymerization, providing a simpler model for analysis of receptors that mediate laminin anchorage and epiblast differentiation [6]. Integrins and dystroglycan are two major types of cell surface receptors that interact with laminins in the BM. Targeted deletion of integrin β1, the main β subunit expressed in early development led to embryonic lethality at the same stage (E5.5) as laminin γ1 knockout [7–9]. In the mutant embryo, germ layer formation and cavitation were disrupted because of the detachment and defective maturation of endoderm cells [10,11]. Interestingly, treatment of integrin β1-null EBs with low concentrations of laminin could partially rescue endoderm, BM and epiblast polarization, suggesting that β1 integrins are not absolutely essential for BM and downstream differentiation [5]. In contrast to integrin β1-null embryos, genetic ablation of dystroglycan did not affect endoderm, BM or epiblast differentiation. The mutant embryo died from failure of Reichert's membrane at E6.5 before gastrulation [12]. However, an outstanding question is whether β1 integrins and dystroglycan compensate each other to mediate BM anchorage and epiblast polarization. This is difficult to evaluate in vivo because of integrin compensation. In addition, the contribution of other integrins to these early development processes remains unknown. In this study, we show that laminin-mediated BM assembly not only determines the basoapical polarity vector of the epiblast epithelium but induces epiblast lineage differentiation. Analysis of inhibition of dystroglycan binding and of integrin β1 and dystroglycan double knockout EBs suggests that integrin β1 and dystroglycan compensate each other to mediate BM anchorage and cell survival.

Results Laminin is sufficient to induce BM-assembly and epiblast morphogenesis Endoderm-free EBs can be generated by selecting for ES cell clones for this attribute (Fig. 1). Such EBs

remained as compact spherules of polygonal cells without obvious polarity, BM assembly or subsequent epiblast development. However, when these EBs were treated with laminin-111 (Lm111) at 0.1 mg/ml (corresponding to the critical concentration of Lm111 polymerization), a BM containing laminin, nidogen-1, type IV collagen and perlecan assembled on the outer surface of the EBs. The components were distributed on the EB surface in a dense circumferential manner (the cell-associated BM) with a looser filamentous ECM extending from the periphery that became easily detached from the EBs with washing of the EBs, leaving behind the circumferential BM. Type IV collagen, the only other component known to form a network-like polymer, was found to be inessential for BM assembly or epiblast polarization at this stage since its selective degradation by bacterial collagenase did not adversely affect the cell-associated laminin polymer or epiblast polarity. This confirms the conclusion that laminins but not type IV collagen are necessary to assemble a BM and induce epiblast morphogenesis. The epiblast which polarized in response to laminin was oriented such that its basal side was adjacent to the ECM and the apical side faced the internal cavity. Effect of laminin-mediated BM-assembly on lineage differentiation and polarity Epithelial polarization is often coupled with cell lineage specification during germ layer formation and organ development [13]. To test if laminin-induced BM assembly also controls epiblast lineage differentiation, normal EBs were treated with 0.1 mg/ml of laminin-111 on day 2 of culturing prior to endodermal development (Fig. 2) as monitored by phase-contrast microscopy. The endodermal layer was not observed to form as late as 6 days of culturing in these EBs. This was confirmed by the absence of the endoderm markers α-fetoprotein and cytokeratin-8 (Fig. 2A and C). On the other hand, a BM, polarized epiblast epithelium, and cavity were observed to develop by 5 days of culturing with laminin. In addition, the epithelial polarity landmark proteins MUPP1, CRB3 and syntaxin-3 were upregulated whereas the pluripotency transcription factors Nanog and Oct4 were downregulated, comparable to 7-day untreated normal EBs (Fig. 2B and C). Thus laminin111 selectively suppressed endoderm formation and induced epiblast epithelialization when applied to EBs under conditions in which it formed an external cell surface polymer. However, expression of the late epiblast/early mesoderm markers Brachyury and fibroblast growth factor-5 (FGF-5) was significantly lower in the laminin-treated, endoderm-free EBs (Fig. 1D). Furthermore, Snail1, a transcription factor essential for epithelial-mesenchymal transition in gastrulation [14], was not detected in the laminin-treated but present in the untreated control EBs. Taken together, these results suggest that polarity and cell fate are regulated by distinct extracellular cues. Laminin-mediated BM

Please cite this article as: S. Li, et al., Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization, Matrix Biol (2016), http://dx.doi.org/10.1016/j.matbio.2016.07.005

3

Laminin and cell polarity

assembly is sufficient to induce pluripotent stem cells to form polarized epiblast while additional endoderm-derived soluble factors are required for pre-gastrulation lineage specification.

We then asked whether laminin would alter the endodermal layer if applied after its formation (Fig. 2E). This treatment induced the assembly of an ectopic BM on the apical surface and resulted in the

Fig. 1. Surface assembly of basement membrane on endoderm-free embryoid bodies. EHS laminin-111 (0.1 mg/ml) was added to the culture media of 1-day endoderm free EBs which were then cultured for 7 days. The untreated (NT) and laminin-treated (+ Lm) EBs were fixed, sectioned and examined by phase and immunofluorescence microscopy. A BM containing laminin-111 (Lm), type IV collagen (Col-IV), nidogen-1 (Nd) and perlecan (Perl) was present on the outer surface of laminin-treated but not the untreated EBs. It consisted of a cell-associated component surrounded by a more loosely associated ECM that was easily detached and generally lost during the washing step, leaving behind the cellular BM. Co-treatment with collagenase removed the collagen but not the laminin-based ECM. Differentiation was detected by phase, apical F-actin (Fact), and central apoptosis (cleaved caspase-3) staining.

Please cite this article as: S. Li, et al., Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization, Matrix Biol (2016), http://dx.doi.org/10.1016/j.matbio.2016.07.005

4

Laminin and cell polarity

sandwiching of the endoderm, now several cell layers thick, between an inner and outer BM. In addition, endodermal polarity was disturbed as evidenced by

loss of an apical distribution of ZO-1 associated with tight junctions of the endoderm and loss of a basal distribution of GM130 (cis-Golgi protein normally found

Fig. 2 (legend on next page)

Please cite this article as: S. Li, et al., Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization, Matrix Biol (2016), http://dx.doi.org/10.1016/j.matbio.2016.07.005

5

Laminin and cell polarity

in the basal aspect of the endoderm and the apical aspect of polarized epiblast). Interestingly, scattered endodermal cells expressed vimentin, a mesenchymal protein, as well. Thus masking the free apical surface with an ectopic BM disrupted endoderm polarity and caused partial trans-differentiation of endoderm cells to mesenchymal cells (epithelial-mesenchymal transition). Laminin-mediated BM-assembly determines the polarity orientation Another question is whether the site of laminin accumulation on epiblast can influence the basal-apical orientation of these cells. If so, it was predicted that EBs exposed only to an internal source of laminin would develop epiblast with a reversal of polarity, particularly if the outer endodermal layer was absent so as to allow the apical side to rest adjacent to a fluidic space. To test this, very small volumes of laminin-111 was microinjected at high (1 mg/ml) concentrations into the interior of endoderm-free EBs (Fig. 3). The EB architecture present at four days post-injection was characterized by the presence of a laminin-rich ECM in the interior of the EB with a surrounding epiblast layer. The apical side, as indicated by the distributions F-actin, pericentrin and GM130, faced the exterior free surface whereas the basal side, as indicated by the distributions of dystroglycan and integrin α6, was adjacent to the internal ECM. Thus it was concluded that the basal-apical polarity of the epiblast layer was inverted in response to the alteration of laminin topography. Targeted deletion of both integrin β1 and dystroglycan abolishes laminin-induced BM-assembly The next question was “what are the receptors responsible for laminin-induced BM assembly and epiblast polarization?” Integrins and dystroglycan are major receptors of BM ligands expressed during early embryonic development [1]. Our previous studies revealed that ablation of dystroglycan in EBs had no effect on endoderm differentiation, epiblast polarity or

cavitation although the BM became thicker [5]. By contrast, deletion of integrin β1 inhibited endoderm maturation and synthesis of the laminin α1 chain, and consequently abrogated BM and epiblast polarization [5,10]. However, BM and epiblast polarity could be partially rescued by addition of laminin-111 to the culture medium, suggesting that dystroglycan and/or other integrins may compensate for the loss of β1 integrins. To test this possibility, ES cells were isolated from integrin β1/dystroglycan double floxed (β1 fl/fl /DG fl/fl ) blastocysts and the floxed alleles were removed by transient transfection of the cells with Cre recombinase. Several ES cell clones null for both integrin β1 and dystroglycan were established (Fig. 4A). In 2-day β1 fl/fl/DG fl/fl EBs, disabled-2-positive endoderm cells were detected on the EB surface and associated with an underlying BM (Fig. 4B). By contrast, β1 −/− /DG −/− EBs failed to form endoderm or BM, similar to β1 knockout EBs [5]. Compared with the smooth β1 fl/fl/DG fl/fl EBs, β1 −/−/DG −/− EBs were granulated and less compact. DAPI staining for nucleic acids showed numerous fragmented nuclei, suggesting extensive apoptosis. Most of the double knockout EBs disintegrated after 3 days of culturing. BM assembly requires endoderm secretion and receptor-mediated anchorage of laminins and other BM components. Since ablation of both integrin β1 and dystroglycan blocked endoderm differentiation, the contribution of receptors to BM and downstream events cannot be evaluated in the natural differentiation process of the double knockout EBs. To circumvent this problem, we treated 1-day EBs with 0.1 mg/ml of Lm111 for 24 h to induce an ectopic BM. Wild-type, β1 −/− and DG −/− EBs formed smooth, compact spherules with a dense laminin-containing ECM on their surface (Fig. 4C). Cleaved caspase-3 immunofluorescence revealed sparse apoptotic cells in the interior. By contrast, none of the laminin-treated β1 −/−/DG −/− EBs assembled a BM on their surface. Massive apoptosis was detected throughout the EBs, together with a few laminin aggregates. To quantify the binding of exogenously added Lm111 to the EB surface, we performed immunoblot analysis of washed EBs for the laminin-α1 chain, which is not synthesized by EBs without endoderm. We observed

Fig. 2. Laminin alteration of lineage differentiation and polarity. A. One-day wild-type EB were treated or untreated with laminin-111 (0.1 mg/ml) prior to spontaneous formation of endoderm (day 2). Treatment with laminin resulted in the formation of a cell-associated ECM and epiblast differentiation despite selective suppression of endoderm formation. α-PF: α-fetoprotein. Arrowheads point to the accumulation of F-actin and the apical polarity protein MUPP1 on the apical side of epiblast. B. Immunoblots show that laminin treatment downregulated the pluripotent markers Nanog and Oct4. C. Immunoblots show that laminin treatment suppressed the expression of the endodermal marker cytokeratin-8 and induced the expression of the epithelial polarity proteins syntaxin-3 and CRB3. D. Compared with the 7-day spontaneously differentiated EBs, laminin treatment induced very little if any late epiblast markers (FGF-5, fibroblast growth factor-5; Bra: Brachyury; Snai1: Snail 1). E. Three-day EBs following endoderm formation were treated with 0.1 mg/ml laminin-111 (added on day 4) and cultured to 7 days. Late treatment with laminin resulted in assembly of an outer BM following assembly of a subendodermal BM. The endoderm sandwiched between the two BMs was multilayered with loss of apical ZO-1 and basal GM-130, and scattered intracellular expression of vimentin (Vm). Arrows point to vimentin-positive cells. E. Diagram of polarity transitions resulting from media treatments with laminin-111 (en, endoderm; epi, epiblast; Lm, laminin; TJ, tight junction; act, F-actin; Go, Golgi).

Please cite this article as: S. Li, et al., Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization, Matrix Biol (2016), http://dx.doi.org/10.1016/j.matbio.2016.07.005

6

Laminin and cell polarity

Fig. 3. Microinjection of laminin into endoderm-free embryoid bodies. Panel A. Laminin-111 was introduced into the interior of 4 day old endoderm-free EBs by microinjection followed by culturing for 4 days before harvesting. Untreated wild-type (WT), untreated endoderm-free and endoderm-free EBs treated with (external) laminin in medium are shown as controls. In laminin-treated control EBs, dystroglycan (DG) and α6-integrin, two basal components, are concentrated on the outer circumferential surface adjacent to laminin (Lmα1) while the F-actin belt, pericentrin and (for epiblast) GM130, three apical markers, are concentrated on the inner aspect of the EBs. Microinjection of laminin completely reversed the basal-apical orientation of these markers in the layer. Panel B. Diagram of polarity transitions resulting from external (media) vs. internal (microinjection) placement of laminin-111 (I/DG, α6-integrin/dystroglycan; pc, pericentrin).

~ 50% reduction in laminin binding in β1 −/− and DG −/− EBs compared with the wild-type control (Fig. 4D). Only a trace amount of laminin (7% of the wild-type control) was detected in β1 −/−/DG −/− EBs, likely representing the laminin aggregates trapped in the EB interior. These results suggest that both integrin β1 and dystroglycan serve as anchors on the cell surface to mediate BM assembly. They compensate each other to mediate BM-dependent cell survival. Laminin-induced epiblast polarization in integrin β1-null EBs is not mediated by integrin αV Microarray analysis revealed that the integrin subunits β1, β5, α2, α3, α5, α6 and αV were expressed in differentiating EBs (data not shown). Among them, β1 can form a heterodimer with α2, α3, α5, α6 or αV

whereas β5 can only dimerize with αV. To test whether the partial rescue of epiblast differentiation by laminin-111 treatment of integrin β1-null EBs might be mediated by αV integrins [5], we first confirmed our previously findings by incubating 1-day β1 −/− EBs with 0.1 mg/ml of laminin-111, which induced an ectopic BM on the surface of both wild-type and β1 −/− EBs. Even though nearly all the EBs had a BM, epiblast polarization was observed in ~ 20% of β1 −/− EBs, whereas ~ 80% of wild-type EBs developed a polarized epiblast epithelium after 5 days of laminin treatment (Fig. 5A and B). If integrin αV contributes to the partial rescue of epiblast differentiation, it would be expected to be recruited to the cell-BM interface. However, immunostaining of laminin-treated 2 day EBs demonstrated that integrin αV was localized intracellularly in a punctate pattern in wild-type as well

Please cite this article as: S. Li, et al., Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization, Matrix Biol (2016), http://dx.doi.org/10.1016/j.matbio.2016.07.005

7

Laminin and cell polarity

Fig. 4. Ablation of both integrin β1 and dystroglycan inhibits endoderm differentiation and BM assembly. A. Immunoblots show that integrin β1, β-dystroglycan (β-DG) and α-dystroglycan (α-DG) are absent from integrin β1/dystroglycan double knockout (β1 −/−/DG −/−, clone C6 and C7) EBs compared with the floxed control (β1 fl/fl/DG fl/fl). B. Phase and immunofluorescence images of 2-day EBs show that β1fl/fl/DG fl/fl formed endoderm on the EB surface and an underlying BM. Endoderm was identified by disabled-2 (Dab2) immunofluorescent while the BM was stained with laminin α1 (Lm α1) and perlecan antibodies. C. One-day wild-type (WT), integrin β1-null (β1−/−), dystroglycan-null (DG −/−) and β1−/−/DG −/− EBs were treated with laminin-111 (0.1 mg/ml) for 24 h. Phase images of live cultures show extensive apoptosis occurring on the surface of β1 −/−/DG −/− EBs (arrowheads). Immunostaining for laminin α1 (Lm α1) demonstrated that a dense laminin-containing ECM assembled on the surface of WT, β1 −/− and DG −/− EBs but not that of β1−/−/DG −/− EBs. In addition, high levels of apoptosis were detected in the double knockout EBs. D. EBs were washed twice with PBS to remove the loosely attached ECM and then analyzed by immunoblotting for laminin α1. EB-associated laminin was reduced in β1 −/− and DG −/− EBs and barely detectable in the double knockout EBs. Actin was used as a loading control.

as β1 −/− EBs, whereas α-dystroglycan was recruited to the BM zone (Fig. 5C). In addition, the adaptor proteins talin and integrin-linked kinase accumulated at the BM zone in wild-type but not β1 −/− EBs. These results suggest that members of the β1 subfamily are the major integrins to mediate epiblast polarization while αV integrins are unlikely to play an important role at this stage of development. To further test this hypothesis, integrin αV was depleted by stable shRNA transfection in β1 −/− EBs [10]. Silencing of integrin αV did not affect BM assembly or epiblast polarization (Fig. 5D and E). These results argue against a compensatory role for αV integrins in BM assembly and epiblast polarization in the absence of integrin β1. Blockade of laminin binding to dystroglycan inhibits BM assembly and epiblast polarization in integrin β1 −/− embryoid bodies We next addressed whether the laminin-induced BM assembly and epiblast polarity seen in the absence of β1 integrin was due to compensation by dystroglycan, a

major laminin receptor recruited to the BM zone in the absence of integrin β1 (Fig. 5C). To this end, a recombinant protein was engineered (LZE3, Fig. 6A, B) by joining two laminin α1 LG4-5 (equivalent to the EHS-laminin elastase fragment E3) domains with a leucine zipper coiled-coil sequence to force dimerization of the LG4-5 fragment and increase LG-dependent binding to the O-linked mannosyl-glycan xylosylcontaining chains essential for laminin-DG binding [15]. The LG4-5 domain harbors dystroglycan, heparin, and galactosyl-sulfatide binding sites [16] (Fig. 6, A, B). In a solid phase binding assay, LZE3 bound strongly (KD ~ 1 nM) to α-dystroglycan (Fig. 6C), an increase compared to E3 alone and comparable to that of the agrin LG domains. In a competition assay with Lm111, LZE3 inhibited laminin-111 binding to muscle dystroglycan and to a much lesser extent sulfatide (Fig. 6D). LZE3 had no effect on laminin binding to α7β1 integrin (chosen because it is the most strongly-binding Lm111 integrin receptor [17]). When 1-day wild-type EBs were incubated with 0.1 mg/ml Lm111 in the presence or absence of 0.05 mg/ml LZ-E3 (5 fold in molar excess),

Please cite this article as: S. Li, et al., Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization, Matrix Biol (2016), http://dx.doi.org/10.1016/j.matbio.2016.07.005

8

Laminin and cell polarity

Fig. 5. Contribution of integrins to epiblast polarization. A. One-day β1 −/− EBs were treated with laminin-111 (0.1 mg/ml) for 5 days and immunostained for the apical marker MUPP1 and basement membrane perlecan (perl). F-actin was visualized using rhodamine-phalloidin. Arrowheads indicate apical accumulation of MUPP1 and F-actin. The arrow indicates apoptotic cells. B. EBs with BM and polarized epiblast were counted and plotted as percentage of total EBs examined. N = 4 for each group with a total of 1379–1744 EBs. P b 0.01 vs WT. C. One-day EBs were treated with laminin-111 (0.1 mg/ml) for 24 h and immunostained for integrin αV, talin, integrin-linked kinase (ILK) and α-dystroglycan (α-DG). BM was identified with laminin γ1 or α1 antibody. Integrin αV was largely intracellular while α-DG (arrowheads) was recruited to the cell-ECM adhesion site in wild-type and integrin β1 −/− EBs. Talin and ILK were recruited to the BM zone in wild-type (arrowheads) but no integrin β1 −/− EBs. D. One-day β1 −/− EBs stably transfected with integrin αV shRNA (αV knockdown, αV KD) or the scrambled control (SC) were treated with laminin-111 (0.1 mg/ml) for 5 days. About 20% of αV KD EBs and the scrambled control formed BM and polarized epiblast. Arrowheads indicate apical accumulation of the polarity marker MUPP1. Arrows point to apoptotic debris. E. EBs with polarized epiblast were counted and plotted as percentage of total EBs examined. N = 4 for each group with a total of 325–327 EBs.

LZE3 partly reduced the laminin α1 by immunoblotting (Fig. 6E), but did not affect BM or epiblast frequency in EBs (Fig. 6F). When DG −/− EBs similarly treated were

examined, no reduction of laminin was noted by immunoblotting (Fig. 6G) and no significant change in BM or epiblast frequency was detected (Fig. 6H).

Please cite this article as: S. Li, et al., Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization, Matrix Biol (2016), http://dx.doi.org/10.1016/j.matbio.2016.07.005

9

Laminin and cell polarity

Fig. 6. Blockade of laminin binding to dystroglycan. A. A diagram shows the structure of laminin α1 and recombinant leucine zipper E3 (LZE3). LZE3 consists of an N-terminal leucine zipper sequence fused to the Lmα1 fragment corresponding to the elastase fragment E3. The leucine zipper mediates dimerization of the laminin fragment. LZE3 was predicted to bind to α-dystroglycan at higher affinity (inset). B. SDS-PAGE, reduced (10% acrylamide gel) of recombinant LZE3, Coomassie blue stained. C. Direct solid-phase binding of recombinant LZE3, miniagrin and Lmα1 LG4–5 to immobilized rabbit muscle α-dystroglycan (3 μg/ml coat). Ligands, incubated for 1 h in blocking buffer, were detected with HRP-conjugated anti-FLAG M2 antibody or anti-agrin rabbit antibody. Apparent KD values determined from simple binding fit shown in parentheses. D. Solid-phase inhibition binding assay shows that LZE3 inhibits lamainin-111 binding to α-dystroglycan in a dose-dependent fashion. LZE3 moderately inhibited laminin binding to sulfatide but had no effect on the laminin-integrin interaction. Plates were separately coated (a) with WGA-purified muscle dystroglycan for αDG binding, (b) soluble α7β1 integrin, and (c) galactosyl-sulfatide for sulfatide binding. EHS Lm111 (14 nM, constant) was added to the wells mixed with serial two-fold dilutions of LZE3. The bound laminin was detected with anti-laminin E4 antibody (β1LN-LEa specificity). Average and s.d. shown for n = 3 wells. E–J. One-day wild-type (E,F), DG −/− (G,H) and integrin β1 −/− (I, J) EBs were incubated with laminin-111 (0.1 mg/ml) in the presence or absence of LZE3 (0.05 mg/ml) for 24 h (for immunoblotting), or incubated for five additional days for detection of BM and determination of epiblast conversion by phase and immunofluorescence microscopy. For laminin immunoblotting, EBs were washed twice with PBS followed by SDS-PAGE (reducing conditions), transferred to membranes and the α1-subunit detected with laminin-specific antibody. Actin or E-cadherin (integrin-null EBs to increase sensitivity) was used as a loading control. The above EBs cultured to 5 days were analyzed by phase contrast (epiblast differentiation count) and laminin antibody/phalloidin fluorescence microscopy to detect BMs and confirm differentiation. The extent of BM (fraction of EBs with a linear laminin-staining pattern) and fraction of EBs showing epiblast differentiation were determined with corresponding plots shown in F, H and J; n = 3 culture in wells for each group with the following total EBs counted/group: 92 to 104 WT, 88 to 94 DG−/−, and 182–248 integrin β1 −/− EBs. The laminin-treated EBs were compared to the laminin + LZE3 EBs by Student t-test. P values determined were 0.09 for WT BM, 0.11 for epiblast conversion, 0.87 for DG −/− BM, 0.81 for DG −/− epiblast conversion, b 0.01 for integrin β1 −/− BM and b 0.01 for integrin β1 −/− epiblast conversion. Only the integrin β1−/− EBs exhibited significant BM and epiblast decreases.

In contrast, for integrin-β1 −/− EBs, LZE3 inhibited the accumulation of laminin as assessed by immunoblotting (Fig. 6I). Furthermore, LZE3 treatment greatly reduced laminin-induced BM and abolished epiblast differentiation (Fig. 6J). The effect of LZE3 on the integrin-null EBs is likely solely through DG inhibition because LZE3 had no effect on DG −/− EBs and while there is a modest sulfatide effect, there is no detectable galactosyl sulfatide in EBs using the Sulf-1 antibody [18]. These results support the hypothesis that β1 integrins and dystroglycan are each capable of mediating laminin-dependent BM assembly and epiblast polarization and that at least one of the two receptors must interact with laminin.

Discussion That laminins, in contrast to other BM proteins, are crucial for induction of cell polarity in many epithelia has been deduced from a variety of tissue culture and animal studies, the latter conducted in both invertebrates and vertebrates [1,19–23], with integrins, acting substantially through Rac-1, playing an important role [24,25]. The findings of this study reveal the polarizing influence of laminin assembly on cell surfaces in which laminin can suppress, alter or induce polarity and differentiation depending upon its topography and inductive potential of the adherent cell. They

Please cite this article as: S. Li, et al., Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization, Matrix Biol (2016), http://dx.doi.org/10.1016/j.matbio.2016.07.005

10 offer an explanation for the epiblast orientation that develops in the embryo in which the endoderm secretes laminin into the diffusion-limited potential space that resides between endoderm and ICM. The laminin polymerizes and adheres to the adjacent ICM cells, initiating basal polarization. This instructive property of laminin likely influences many developing epithelia to varying degrees and may serve to impede neoplastic loss of polarity [26]. What then is required for BM assembly and this inductive effect? First, it has been found that laminins are essential for BM assembly, and likely must become attached to the cell surface for this to occur [1,7,9,25,27]. This activity depends upon laminin polymerization and cell-adhesive LG domains. Laminin α1 and α5 each contain five LG domains. In these laminins, LG domains 1–3 bind to integrins while the LG4 domain binds to dystroglycan, heparan sulfate proteoglycans and the sulfated glycolipid galactosyl-sulfatide [16,28]. Mouse embryos that lack the critical LARGE-dependent carbohydrate of αdystroglycan essential for laminin-dystroglycan binding, and EBs that lack dystroglycan, are still capable of assembling a BM [5,29,30]. Ablation of integrin β1 inhibited synthesis of the laminin α1 chain and caused detachment of endoderm cells from the EB surface [10,31]. This integrin-dependency of laminin α-subunit synthesis is a striking attribute of EBs and may also be unique to this stage of differentiation. Nonetheless, treatment of the mutant EBs with low concentrations of laminin-111 partially rescued BM assembly and EB differentiation [5]. Collectively these results suggest that neither dystroglycan nor β1 integrins are uniquely essential with β1-integrin in particular making a strong contribution to epiblast differentiation but not BM assembly. This notion is supported by a new finding that treatment of 1-day EBs prior to endoderm differentiation with high concentrations of laminin induced an ectopic BM on the surface of all the wild-type and the mutant EBs deficient in integrin β1 or dystroglycan. However, laminin binding was reduced by ~ 50% in both mutants. Of note, laminin failed to bind to EBs null for both integrin β1 and dystroglycan. Since dystroglycan is significantly upregulated in integrin β1-null EBs [32], these results strongly suggest that integrin β1 and dystroglycan compensate each other to mediate laminin-induced BM assembly. What is largely unknown at this stage are the pathways common to integrin and dystroglycan that initiate the complex steps of differentiation uniquely initiated by laminin. Genetic analyses in mice, reflected in tissue culture studies, have shown that among the four major BM components of laminins, type IV collagen, nidogens and perlecan, only laminin is uniquely required for epithelial polarization [9,27,33–36]. However, the receptors that mediate the laminin function remain unclear. Our new and published data on laminintreated integrin β1-null EBs demonstrated significantly

Laminin and cell polarity

decreased efficiency of epiblast polarization in the presence of a BM [5]. These results are in agreement with the findings that epiblast polarity depends upon expression of integrin-linked kinase (ILK) and to a lesser extent Pinch1, adaptor proteins that interact with the integrin β1 cytoplasmic tail [37,38]. Therefore, β1 integrins play a pivotal role in laminin-induced epiblast epithelialization. In spite of reduced efficiency, lamininmediated BM assembly in integrin β1-null EBs could achieve ~25% rescue of epiblast polarity. This integrin β1-independent epiblast polarization is unlikely due to compensation by other integrins since shRNA depletion of integrin αV in integrin β1-null EBs was unable to further knock down epiblast polarity. In support of this conclusion, neither integrin αV nor β5, the only other β subunit expressed in EBs, were recruited to the BM zone. Instead, they located intracellularly in a punctate pattern. In conclusion, laminin and its assembled topography on EBs play critical roles for epithelial cell polarization. Polarization requires laminin interactions cognate β1integrin(s) and/or dystroglycan with the two receptors partially compensating for each other. A challenge going forward is to determine the signaling mechanisms that are shared by both and that in particular mediate the dystroglycan-dependent contributions to polarization. Experimental procedures Antibodies and reagents Monoclonal antibodies to GM130, integrin α6, integrin β1 and ILK were from BD Biosciences (San Diego, CA). Rabbit anti-cleaved caspase-3, Nanog, Oct-4 and vimentin antibodies were from Cell Signaling (Danvers, MA). Rabbit anti-integrin αV polyclonal antibody and anti-laminin γ1, ZO-1 and GAPDH monoclonal antibodies were from EMD Millipore (Billerica, MA). Rabbit anti-collagen IV antibody was from Rockland Immunochemicals (Gilbertsville, PA). Rabbit anti-α-fetoprotein antibody was from ICN (Irvine, CA). Rat anti-perlecan and mouse anti-disabled-2 monoclonal antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit anti-pericentrin antibody was from Covence (Princeton NJ). Rabbit anti-actin polyclonal antibody and mouse anti-talin monoclonal antibody were from Sigma (Saint Louis, MO). Anti-cytokeratin-8 and anti-α- and β-DG monoclonal antibody were from Developmental Studies Hybridoma Bank (Iowa City, IW). Rabbit anti-MUPP1 was provided by Dr. Makoto Adachi of Kyoto University (Kyoto, Japan). Rabbit anti-CRG3 antibody was provided by Dr. Ben Margolis of University of Michigan (Ann Arbor, MI). Rabbit antinidogen, laminin α1 and laminin-111 were produced in our lab and used as described [5]. Cy3-, Cy5-, and horseradish peroxidase-conjugated secondary antibodies were from Jackson ImmunoResearch (West

Please cite this article as: S. Li, et al., Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization, Matrix Biol (2016), http://dx.doi.org/10.1016/j.matbio.2016.07.005

11

Laminin and cell polarity

Grove, PA). Rhodamine-phalloidin and Alexa 488conjugated secondary antibodies were from Molecular Probes (Eugene, OR). Culturing of ES cells and embryoid bodies Wild type (R1 and D3) and DG −/− ES cells were grown on feeder layers of mitomycin-treated SNL STO cells in ES medium [DMEM supplemented with 15% FBS, 0.1 mM nonessential amino acids, 0.1 mM β-mercaptoethanol, 1 mM sodium pyruvate, 100 μg/ml penicillin, 100 μg/ml streptomycin, and 1000 U/ml leukemia inhibitory factor (LIF)] as previously described [5]. Integrin β1 −/− ES cells and β1 −/− ES cells stably transfected with either integrin αV shRNA or the scrambled control were directly cultured on plastic tissue culture dishes [10]. To culture EBs, sub-confluent ES cells were dispersed into small clusters with 0.05% trypsin-0.53 mM EDTA and cultured on bacteriological Petri dishes in ES medium without leukemia-inhibiting factor (LIF). ES clones were selected on gelatin-coated dishes in ES cell medium containing 2× LIF and evaluated for their inability to form EBs with endoderm. Generation of integrin β1/dystroglycan double knockout ES cells β1 fl/fl /DG fl/fl ES cells were isolated from the blastocysts of β1 fl/fl/DG fl/fl mice and expanded on embryonic fibroblast feeder layers. The double floxed ES cells were transiently transfected with Cre recombinase-GFP using the jetPRIME transfection reagent. After transfection, cells were plated onto vitronectin-coated dishes and clones were selected based on GFP fluorescence. β1 −/−/DG −/− clones were confirmed by immunoblotting and expanded on vitronectin-coated dishes. Immunofluorescence microscopy and microinjection EBs were collected, washed and fixed with 3% paraformaldehyde, embedded in Tissue-Tek OCT (Miles), frozen, and sectioned as described [32]. Non-specific binding sites were blocked with 5% goat serum. Alexa488- and/or Cy3-conjugated antibodies were used as secondary reagents and nuclei were counter-stained with DAPI. Slides were viewed by indirect immunofluorescence using a NikonTE2000-U inverted microscope. Digital images were acquired with an Orca-03 cooled charge-coupled-device (CCD) camera (Hamamatsu) controlled by IP Lab software (Scanalytics). Micro-injection was performed on an Olympus IX70 inverted microscope fitted with a XenoWorks Micromanipulator (Bio-Rad). A single EB was held gently by vacuum with a holding pipette (Eppendorf Vacutips). An injection needle (Eppendorf Transfertips) was

inserted into the central cavity (for normal EBs) or the apoptotic zone (for endoderm-free EBs) through a junction of endodermal cells. Laminin-111 (1 mg/ml in 50 mM Tris, pH 7.4, 100 mM NaCl and 1 mM EDTA) or BSA was injected into the EB interior at a small volume that causes slight expansion of EBs. The injected EBs were transferred to 35-mm bacteriological Petri dishes with a transfer micropipette and cultured for 2–5 days. Immunoblotting EBs were collected, washed twice in phosphatebuffered saline and lysed in SDS lysis buffer (50 mM Tris, pH 7.4, 1% SDS) containing protease and phosphatase inhibitor cocktails. Protein concentrations were determined using BCA reagents (Pierce). Proteins were resolved by SDS-PAGE and were transferred onto PVDF membranes which were blocked with 5% nonfat dry milk. After incubation with primary antibodies, specific signals were detected with HRPconjugated secondary antibodies and ECL reagents. RT-PCR Total RNA was isolated with TRIzol reagent (ThermoFisher) and reverse-transcribed to cDNA using M-MLV reverse transcriptase (ThermoFisher). PCR primers were as follows: FGF-5 forward: 5′-CAA AGT CAA TGG CTC CCA C-3′, reverse: 5′-CAT CCA AAG CGA AAC TTC AG-3′; Brachyury forward: 5′-AGTACCGAGTGGACCACCTG-3′, reverse: 5′GTTGGT GAGTTTGACTTTGCT-3′; Snail1 forward: 5′-AACTATAGCGAGCT. GCAGG-3′, reverse: 5′-GGATGTGCATCTTCA GAGC-3′. Engineered and native proteins (a) The leucine zipper E3 construct, pE3-GCN4, was generated from an AvrII- NheI pcr insert of 0.1Kb (fv5′ggcccctagggcacatgaaacaactagaagacaaagtagaagaactactatcaaaaaactaccacctagaaaacgaagtagcacgactaaaaaagctagtaggagaacgaggaggatcaggagcgctagcgggcc3′ rv-5′ggcccgctagcgctcgt tctcctactagcttttttagtcgtgctacttcgttttctaggtggtagttttttgatagtagttcttctactttgtcttctagttgtttcatgtgccctagggggcc3′. The insert was ligated into an AvrII- NheI digested pRCX3-E3 vector, linearized, and transfected into the human embryonic kidney cell line 293 (ATCC) as previously described [16]. Clones secreting LZE3 into medium were selected and cloned. LZE3 was purified from conditioned medium by FLAG affinity chromatography as described for recombinant Lmα1-LG4–5 [16]. (b) Recombinant fragment E3, consisting of the Lmα1-LG domains 4–5 (corresponding to the EHS-Lm111 elastase fragment-3) that contains the principal α-dystroglycan binding

Please cite this article as: S. Li, et al., Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization, Matrix Biol (2016), http://dx.doi.org/10.1016/j.matbio.2016.07.005

12 locus, was also prepared as described [16]. (c) Miniagrin (mA), a protein that bridges the laminin coiled-coil domain to α-dystroglycan and consisting of the chick agrin NtA domain, intervening follistatin domain, and C-terminal LG domains was prepared as described [39]. (d) Native laminin-111 was prepared from the EHS tumor matrix by EDTA extraction, gel filtration and DEAE ion-exchange chromatography [40].

Laminin and cell polarity

cells used to generate EBs. We also thank Sergei Smirnov (Robert W. Johnson Medical School) for assistance in the preparation of the LZE3 construct. Received 31 May 2016; Received in revised form 15 July 2016; Accepted 15 July 2016 Available online xxxx Keywords: cell polarity; endoderm; epiblast; embryonic stem cell

Solid phase binding and inhibition assays (a) Direct binding of LZE3, E3 and miniagrin as serial dilutions to plastic-immobilized purified rabbit α-dystroglycan was determined using 96-well assay plates as described [16]. Briefly, each well was coated with 0.1 ml of rabbit muscle α-dystroglycan (3 μg/ml) in ELISA coating buffer, washed, and blocked with 1% BSA in TBS (50 mM Tris–HCl, pH 7.4) containing 0.,05% Tween20. Protein ligands were incubated for 1 h in blocking buffer containing 1 mM CaCl2, washed, and detected with HRP-conjugated to anti-FLAG M2 antibody (LZE3, rE3) or rabbit anti-chick agrin. (b) The indirect competition assay was carried out as follows. Separate 96 well plates were coated with either (a) 10 μg/ml crude rabbit muscle α–dystroglycan [41]), (b) recombinant soluble clasped integrin α7X2β1 [42], or galactosyl-sulfatide [39]. EHS laminin-111 (final concentration 14 nM, constant) was mixed with the indicated decreasing concentrations of LZE3. Bound laminin was detected with a rabbit antibody (1 μg/ml) to laminin fragment E4 (β1LN and adjacent LEa domains) followed by incubation with anti-rabbit IgG HRP (1:1000) and color development with TMB measured in a TECAN Spectrafluor plate reader. Statistical analysis Pairs of variables were measured by the Student t-test using the statistical package in Sigma Plot. Statistical difference was accepted at P b 0.05.

Disclosure The authors have no conflicting financial interests.

Acknowledgements This study was supported by a grant (R01GM081674) to S.L. and a grant (R01-DK36425) to P.D.Y. from the National Institutes of Health. We are indebted to Dr. Reinhardt Fässler (Max Planck Institute, Martinsried, Germany) who kindly provided us with dystroglycan/β1-integrin double fl/fl embryonic stems

†Equal contributors.

References [1] S. Li, D. Edgar, R. Fassler, W. Wadsworth, P.D. Yurchenco, The role of laminin in embryonic cell polarization and tissue organization, Dev. Cell 4 (5) (2003) 613–624. [2] D.G. Wilkinson, S. Bhatt, B.G. Herrmann, Expression pattern of the mouse T gene and its role in mesoderm formation, Nature 343 (6259) (1990) 657–659. [3] E.A. Carver, R. Jiang, Y. Lan, K.F. Oram, T. Gridley, The mouse snail gene encodes a key regulator of the epithelialmesenchymal transition, Mol. Cell. Biol. 21 (23) (2001) 8184–8188. [4] P. Murray, D. Edgar, Regulation of programmed cell death by basement membranes in embryonic development, J. Cell Biol. 150 (5) (2000) 1215–1221. [5] S. Li, D. Harrison, S. Carbonetto, R. Fassler, N. Smyth, D. Edgar, P.D. Yurchenco, Matrix assembly, regulation, and survival functions of laminin and its receptors in embryonic stem cell differentiation, J. Cell Biol. 157 (7) (2002) 1279–1290. [6] X. Li, Y. Chen, S. Scheele, E. Arman, R. Haffner-Krausz, P. Ekblom, P. Lonai, Fibroblast growth factor signaling and basement membrane assembly are connected during epithelial morphogenesis of the embryoid body, J. Cell Biol. 153 (4) (2001) 811–822. [7] R. Fassler, M. Meyer, Consequences of lack of beta 1 integrin gene expression in mice, Genes Dev. 9 (15) (1995) 1896–1908. [8] L.E. Stephens, A.E. Sutherland, I.V. Klimanskaya, A. Andrieux, J. Meneses, R.A. Pedersen, C.H. Damsky, Deletion of beta 1 integrins in mice results in inner cell mass failure and periimplantation lethality, Genes Dev. 9 (15) (1995) 1883–1895. [9] N. Smyth, H.S. Vatansever, P. Murray, M. Meyer, C. Frie, M. Paulsson, D. Edgar, Absence of basement membranes after targeting the LAMC1 gene results in embryonic lethality due to failure of endoderm differentiation, J. Cell Biol. 144 (1) (1999) 151–160. [10] J. Liu, X. He, S.A. Corbett, S.F. Lowry, A.M. Graham, R. Fassler, S. Li, Integrins are required for the differentiation of visceral endoderm, J. Cell Sci. 122 (Pt 2) (2009) 233–242. [11] R. Moore, W. Tao, E.R. Smith, X.X. Xu, The primitive endoderm segregates from the epiblast in beta1 integrin-deficient early mouse embryos, Mol. Cell. Biol. 34 (3) (2014) 560–572.

Please cite this article as: S. Li, et al., Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization, Matrix Biol (2016), http://dx.doi.org/10.1016/j.matbio.2016.07.005

13

Laminin and cell polarity

[12] R.A. Williamson, M.D. Henry, K.J. Daniels, R.F. Hrstka, J.C. Lee, Y. Sunada, O. Ibraghimov-Beskrovnaya, K.P. Campbell, Dystroglycan is essential for early embryonic development: disruption of Reichert's membrane in Dag1-null mice, Hum. Mol. Genet. 6 (6) (1997) 831–841. [13] J. Rossant, Lineage development and polar asymmetries in the peri-implantation mouse blastocyst, Semin. Cell Dev. Biol. 15 (5) (2004) 573–581. [14] S. Kaufhold, B. Bonavida, Central role of Snail1 in the regulation of EMT and resistance in cancer: a target for therapeutic intervention, J. Exp. Clin. Cancer Res.: CR 33 (2014) 62. [15] K. Inamori, T. Yoshida-Moriguchi, Y. Hara, M.E. Anderson, L. Yu, K.P. Campbell, Dystroglycan function requires xylosyland glucuronyltransferase activities of LARGE, Science 335 (6064) (2012) 93–96. [16] D. Harrison, S.A. Hussain, A.C. Combs, J.M. Ervasti, P.D. Yurchenco, E. Hohenester, Crystal structure and cell surface anchorage sites of laminin alpha 1LG4-5, J. Biol. Chem. 282 (2007) 11573–11581. [17] R. Nishiuchi, J. Takagi, M. Hayashi, H. Ido, Y. Yagi, N. Sanzen, T. Tsuji, M. Yamada, K. Sekiguchi, Ligand-binding specificities of laminin-binding integrins: a comprehensive survey of lamininintegrin interactions using recombinant alpha3beta1, alpha6beta1, alpha7beta1 and alpha6beta4 integrins, Matrix Biol. 25 (3) (2006) 189–197. [18] S. Li, P. Liquari, K.K. McKee, D. Harrison, R. Patel, S. Lee, P.D. Yurchenco, Laminin-sulfatide binding initiates basement membrane assembly and enables receptor signaling in Schwann cells and fibroblasts, J. Cell Biol. 169 (1) (2005) 179–189. [19] J.L. Lee, C.H. Streuli, Integrins and epithelial cell polarity, J. Cell Sci. 127 (Pt 15) (2014) 3217–3225. [20] M.R. Clay, D.R. Sherwood, Basement membranes in the worm: a dynamic scaffolding that instructs cellular behaviors and shapes tissues, Curr. Top. Membr. 76 (2015) 337–371. [21] J.P. Rasmussen, S.S. Reddy, J.R. Priess, Laminin is required to orient epithelial polarity in the C. elegans pharynx, Development 139 (11) (2012) 2050–2060. [22] L.E. O'Brien, M.M. Zegers, K.E. Mostov, Opinion: building epithelial architecture: insights from three-dimensional culture models, Nat. Rev. Mol. Cell Biol. 3 (7) (2002) 531–537. [23] J. Yu, A.P. McMahon, M.T. Valerius, Recent genetic studies of mouse kidney development, Curr. Opin. Genet. Dev. 14 (5) (2004) 550–557. [24] X. He, J. Liu, Y. Qi, C. Brakebusch, A. Chrostek-Grashoff, D. Edgar, P.D. Yurchenco, S.A. Corbett, S.F. Lowry, A.M. Graham, Y. Han, S. Li, Rac1 is essential for basement membrane-dependent epiblast survival, Mol. Cell. Biol. 30 (14) (2010) 3569–3581. [25] W. Yu, A. Datta, P. Leroy, L. O'Brien, G. Mak, T.S. Jou, K.S. Matlin, K.E. Mostov, M.M. Zegers, {beta}1-Integrin orients epithelial polarity via Rac1 and laminin, Mol. Biol. Cell 16 (2005) 433–445. [26] T. Gudjonsson, L. Ronnov-Jessen, R. Villadsen, F. Rank, M.J. Bissell, O.W. Petersen, Normal and tumor-derived myoepithelial cells differ in their ability to interact with luminal breast epithelial cells for polarity and basement membrane deposition, J. Cell Sci. 115 (Pt 1) (2002) 39–50. [27] K.K. McKee, D. Harrison, S. Capizzi, P.D. Yurchenco, Role of laminin terminal globular domains in basement membrane assembly, J. Biol. Chem. 282 (29) (2007) 21437–21447. [28] H. Ido, K. Harada, S. Futaki, Y. Hayashi, R. Nishiuchi, Y. Natsuka, S. Li, Y. Wada, A.C. Combs, J.M. Ervasti, K. Sekiguchi, Molecular dissection of the alpha-dystroglycan- and integrin-

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

binding sites within the globular domain of human laminin-10, J. Biol. Chem. 279 (12) (2004) 10946–10954 (Epub 2003 Dec 29). M. Kanagawa, F. Saito, S. Kunz, T. Yoshida-Moriguchi, R. Barresi, Y.M. Kobayashi, J. Muschler, J.P. Dumanski, D.E. Michele, M.B. Oldstone, K.P. Campbell, Molecular recognition by LARGE is essential for expression of functional dystroglycan, Cell 117 (7) (2004) 953–964. K.D. Mathews, D. Rapisarda, H.L. Bailey, J.C. Murray, R.L. Schelper, R. Smith, Phenotypic and pathologic evaluation of the myd mouse. A candidate model for facioscapulohumeral dystrophy, J. Neuropathol. Exp. Neurol. 54 (4) (1995) 601–606. M. Aumailley, M. Pesch, L. Tunggal, F. Gaill, R. Fassler, Altered synthesis of laminin 1 and absence of basement membrane component deposition in beta-1 integrin-deficient embryoid bodies, J. Cell Sci. 113 (Pt 2) (2000) 259–268. S. Li, P.D. Yurchenco, Matrix assembly, cell polarization, and cell survival: analysis of peri-implantation development with cultured embryonic stem cells, Methods Mol. Biol. 329 (2006) 113–125. S. Fukumoto, J.H. Miner, H. Ida, E. Fukumoto, K. Yuasa, H. Miyazaki, M.P. Hoffman, Y. Yamada, Laminin alpha5 is required for dental epithelium growth and polarity and the development of tooth bud and shape, J. Biol. Chem. 281 (8) (2006) 5008–5016. E. Poschl, U. Schlotzer-Schrehardt, B. Brachvogel, K. Saito, Y. Ninomiya, U. Mayer, Collagen IV is essential for basement membrane stability but dispensable for initiation of its assembly during early development, Development 131 (7) (2004) 1619–1628. B.L. Bader, N. Smyth, S. Nedbal, N. Miosge, A. Baranowsky, S. Mokkapati, M. Murshed, R. Nischt, Compound genetic ablation of nidogen 1 and 2 causes basement membrane defects and perinatal lethality in mice, Mol. Cell. Biol. 25 (15) (2005) 6846–6856. M. Costell, E. Gustafsson, A. Aszodi, M. Morgelin, W. Bloch, E. Hunziker, K. Addicks, R. Timpl, F. R., Perlecan maintains the integrity of cartilage and some basement membranes, J. Cell Biol. 147 (5) (1999) 1109–1122. T. Sakai, S. Li, D. Docheva, C. Grashoff, K. Sakai, G. Kostka, A. Braun, A. Pfeifer, P.D. Yurchenco, R. Fassler, Integrinlinked kinase (ILK) is required for polarizing the epiblast, cell adhesion, and controlling actin accumulation, Genes Dev. 17 (7) (2003) 926–940. S. Li, R. Bordoy, F. Stanchi, M. Moser, A. Braun, O. Kudlacek, U.M. Wewer, P.D. Yurchenco, R. Fassler, PINCH1 regulates cell-matrix and cell–cell adhesions, cell polarity and cell survival during the peri-implantation stage, J. Cell Sci. 118 (Pt 13) (2005) 2913–2921. K.K. McKee, S. Capizzi, P.D. Yurchenco, Scaffold-forming and adhesive contributions of synthetic laminin-binding proteins to basement membrane assembly, J. Biol. Chem. 284 (13) (2009) 8984–8994. P.D. Yurchenco, Y.S. Cheng, Self-assembly and calciumbinding sites in laminin. A three-arm interaction model, J. Biol. Chem. 268 (1993) 17286–17299. A.C. Combs, J.M. Ervasti, Enhanced laminin binding by alpha-dystroglycan after enzymatic deglycosylation, Biochem. J. (2005). K.K. McKee, D.H. Yang, R. Patel, Z.L. Chen, S. Strickland, J. Takagi, K. Sekiguchi, P.D. Yurchenco, Schwann cell myelination requires integration of laminin activities, J. Cell Sci. 125 (19) (2012) 4609–4619.

Please cite this article as: S. Li, et al., Integrin and dystroglycan compensate each other to mediate laminin-dependent basement membrane assembly and epiblast polarization, Matrix Biol (2016), http://dx.doi.org/10.1016/j.matbio.2016.07.005