- Email: [email protected]
Integrin laminin receptor profile of pulmonary squamous cell and adenocarcinomas
Integrin Laminin Receptor Profile of Pulmonary Squamous Cell and Adenocarcinomas CARLO PATRIARCA, MD, ROSA MARIA ALFANO, DSc, ARNOUD SONNENBERG, PHD, DANIELA GRAZIANI, DSc, BARBARA CASSANI, DSc, ANNEMIEKE DE MELKER, DSc, PIERGIUSEPPE COLOMBO, MD, LUCIA R. LANGUINO, PHD, MARA FORNARO, DSc, WILLIAM H. WARREN, MD, GUIDO COGGI, MD, AND VICTOR E. GOULD, MD The differential expression of laminin receptors has been shown to modulate the invasive capability of malignant cells. We have investigated the reactivity of human pulmonary squamons carcinomas (SSC, n = 20) and adenocarcinomas (ADC, n = 20) with monoclonal antibodies to the cytoplasmic and extracellular domains of the integrin subunits e~3 and ot6. Integrins containing these subunits are laminin receptors. Monoclonal antibodies to 131 and [34 subtmits, the 131C splice variant of 131, as well as to Ki-67, were also used. Reverse transcription polymerase chain reaction (PCR) single-strand conformational polymorphism analysis was done to detect possible mutations in the cytodomains. All carcinomas expressed c~3 extensively; c~3 expression predominated (40 of 40) over c~6 (25 of 40). In all af-positive carcinomas, c~6Awas expressed, whereas c~6Bwas weakly expressed only in some of them. No mutations of the intracytoplasmic domain A of ~3 and of the A or B intracytoplasmic domains of a6 were shown. Notably, in normal bronchial epithelium, e~6 colocalized with 134,whereas in the tumors, a6A frequently overlapped with 131 in
a circumferential pattern; ~6131 coexpression was also shown by coprecipitation experiments. Strong and extensive 134 reactions were invariably polarized at the cell/stroma interface in SCC and ADC. An inverse correlation was found between the expression of 131C and Ki-67. The prevalence of ~x6A in pulmonary SCC and ADC is in contrast with previous results in colonic ADC in which ~6B prevails, and c~6 predominates over c~3. The absence of mutations of the cytodomains suggests that the integrin subunits of these carcinomas are potentially active. Predominance of ~3 over or6 and of c~6A over e~6B may contribute to explain the aggressive and metastatic behavior of lung carcinomas. HUM PATHOL 29:1208-1215. Copyright © 1998 by W.B. Saunders Company Key words: Lamlnin receptors, integrins, lung carcinomas. Abbreviations.: SSCP, single-strand conformational polymorphism; SCC, squamons cell carcinoma; ADC, adenocarcinoma; RT, reverse transcription; PCR, polymerase chain reaction; MAb, monoclonal antibody.
Interactions between carcinomatous cells and laminin, a major component of basement membranes, play a pivotal role during several steps of the invasionmetastasis cascade. 1 A n u m b e r of different molecules have either laminin receptor or laminin binding functions, 2 and some of these belong to the integrin family.3 Integrins comprise an c~- and a [3-subunit. At least 16 different a and eight [3 subunits have been isolated4; their receptorial function vis fi vis laminin and other extracellular matrix proteins requires the noncovalent linkage of an and a [3subunit. 5 Integrin laminin receptors include od, a2, or3, oL6,and oL7in various combinations with [31 and [34.4 The role of cd in the invasive and metastasizing phenotype of epithelial neoplasms appears limited except for hepatocellular carcinomas, 6 small cell neuroendocrine, and, notably, bronchioloalveolar lung carci-
nomas. 7 Downregulation of a2 has been reported in many different tumors, 8 whereas data about c~7 are still fragmentary. 9 In contrast, o~3 and ¢x6 containing integrin laminin receptors have been consistently reported to be strongly expressed in numerous epithelia and their pertinent carcinomas. 1°-17However, the specificity and affinity of integrins containing 0~3 and or6 differ significantly as laminin receptors. Alpha 6, coupled with either [31 or [34, is a specific laminin receptor, whereas e~3 containing integrins are "promiscuous" receptors capable in vivo of recognizing laminin as well as other extracellular matrix proteins, including cellular fibronectin (s) and collagens.2,4A potentially significant shortcoming of the cfinicopathologic studies on integrins published so far relates to the use of immunocytochemical probes targeted to the ectodomains of the molecules, given that the presence of the latter domains does not invariably imply effective receptor function. 18 Recently, new data have been accrued about the variants of cytoplasmic integrin domains, underscoring their importance in modulating cell migration, influendng ligand affinity, and altering integrincytoskeleton linkage and signal transmission. 19-21In particular, the variants e~6Aand e~6B have a major impact on cell migration, at least when linked with [~1.22-24 It remains undetermined whether mutations of these cytoplasmic domains may occur that might impact on tumor invasion and metastasis in vivo. We now report our immunohistochemical and immunoprecipitation studies as well as mutational analy-
From the II Department of Pathology, University of Milan School of Medicine, Hospital S. Paolo, Milan, Italy; the Division of Cell Biology, The Netherlands Cancer Institute, Amsterdam, The Netherlands; Department of Pathology, Yale University School of Medicine, New Haven, CT; and Department of Pathology, Rush Medical College, Chicago, IL. Accepted for publication April 13, 1998. Supported in part by the AIRC (Associazone Italiana per La Ricerca sul Cancro. Address correspondence and reprint requests to Victor E. Gould, MD, Department of Pathology, Rush Medical College, Chicago, IL 60612. Copyright © 1998 by W.B. Sannders Company 0046-8177/98/2911-000658.00/0
1208
INTEGRINLAMININ RECEPTORSIN LUNG CARCINOMAS(Patriorca et al) sis by s i n g l e - s t r a n d c o n f o r m a t i o n a l p o l y m o r p h i s m (SSCP) f o r t h e c y t o d o m a i n s o f e~3 a n d c~6 o n 20 s q u a m o u s cell c a r c i n o m a s (SCC) a n d 20 a d e n o c a r c i n o m a s (ADC) o f t h e l u n g . T h e e x p r e s s i o n o f [34 a n d [31 was i n v e s t i g a t e d by i m m u n o h i s t o c h e m i s t r y . M o r e o v e r , we s t u d i e d t h e e x p r e s s i o n o f t h e r e c e n t l y d i s c o v e r e d [31C splice variant, r e p o r t e d to b e i n v o l v e d in i n h i b i t i o n o f cell cycle p r o g r e s s i o n . 25,26 F o r c o r r e l a t i o n p u r p o s e s , we also s t u d i e d t h e e x p r e s s i o n o f t h e p r o l i f e r a t i o n r e l a t e d m o l e c u l e Ki-67. 27 We f o u n d t h a t all o f t h e s e c a r c i n o m a s e x p r e s s c~3 extensively a n d or6 less extensively e i t h e r c o p o l a r i z e d with [34 o r with [31, r e f l e c t i n g t h e n o r m a l b r o n c h i a l expression or a de novo pattern of expression. In a d d i t i o n , we n o t e d t h a t t h e c y t o A is t h e p r e d o m i n a n t eL6 variant. We d i d n o t f i n d c y t o d o m a i n m u t a t i o n s in e i t h e r oL3 o r or6. Finally, we f o u n d a n inverse c o r r e l a t i o n b e t w e e n [31C a n d Ki 67. T h i s l a m i n i n r e c e p t o r i n t e g r i n p r o f i l e differs significantly f r o m t h a t o f c a r c i n o m a s o f o t h e r viscera a n d f r o m t h a t o f p u l m o n a r y n e u r o e n d o c r i n e a n d a l v e o l a r cell t u m o r s ] a n d it m a y h e l p e x p l a i n t h e aggressive b e h a v i o r o f p u l m o n a r y SCC a n d ADC.
MATERIALS AND METHODS
Immunohistochemistry Tumors were excised at the Rush-Presbyterian-St Luke's Medical Center, Chicago, IL; samples from the primary site of 40 cases (20 SCC and 20 ADC) were obtained immediately after the surgical procedures. They were immersed in precooled isopentane, snap-frozen in liquid nitrogen, and kept in a deep freezer at - 8 0 ° C until used. Data were available, including the stage and grading of the tumor at the time of removal. The stage of SCC encompassed three T1N0, eight T2N0, two T1N1, three T2N1, two T3N0, and two T2N2. The stages of ADC were T1N0 in 12, T2N0 in three, T3N0 in two, and, respectively, T1N2, T2N2, and T3N2 in one case. Grading encompassed 14 moderately differentiated SCC, six poorly differentiated SCC, eight well-differentiated ADC, six moderately differentiated ADC, and four poorly differentiated ADC. Adjuvant therapy, development of distant metastases, and subsequent follow-up also were known. The diagnoses and grading of SCC and ADC were established on conventional, hematoxylin and eosin-stained sections by widely accepted criteria. ~8,29Most of these tumors have been extensively characterized by electron microscopy and by immunohistochemistry with MAbs and antisera to intermediate filament proteins, glycoproteins associated with exocrine differentiation, and neuroendocrine markers. 2s,3° Five-micron-thick serial cryosections were prepared and fixed in acetone at 4°C for 10 minutes and immunostained with monoclonal antibody (MAb) to extracellular and cytoplasmic domains ofc~3 and a6, as well as to [31, [34, and Ki-67 at the dilutions outlined in Table 1. Likewise, polyclonal anti [31C antibody was applied (Table 1). These monoclonal and polyclonal antibodies have been characterized and extensively tested for specificity and localizations in previous studies. 16,~1,32The immunostaining protocols have been described in detail elsewhere. 33 Briefly, sections were incubated sequentially with biotin-conjugated horse anti-mouse immunoglobulin antibody (30 minutes, 1:200 Dakopatts, Copenhagen, Denmark), followed by an avidin-biotin-peroxidase complex (30 minutes, 1:100 Dakopatts, Copenhagen, Denmark). Finally, the sections were incubated with 0.05% 3-4-3'-4'diaminobenzidine (Aldrich Chemicals Co, Danvers, MA), and
TABLE 1. Antibodies Used in the Present Study Antigen
Clone
e~3 ecto a3 cyto A e~6 ecto e~6cyto A e~6cyto B [31 [31C [34 Ki-67
J143 29A3 GoH3 1A10 6B4 AT 29/12.R38 Polyclonal 64C MIB1
Dilution 1:1000 ]: 100 1:1000 1:800 1:100 1:1000 1:50 1:100 1:50
Source Dr. A. Sonnenberg, NKI Dr. A. Sonnenberg, NKI Dr. A. Sonnenberg, NKI Dr. A. Sonnenberg, NKI Dr. A. Sonnenberg, NKI Janssen Co Dr. L. Languino, Yale Dr. A. Sonnenberg, NKI Dako, Denmark
H20 2 for 5 minutes. Slides were then washed in distilled water, dehydrated in alcohol, and m o u n t e d in Eukitt (O. Kindler GmbH & Co, Freiberg, Germany); no hematoxylin counterstain was applied. Immunostaining was quantified as follows: 1 +: less than 15% to 20% of the neoplastic population immunoreactive; 2+: more than 15% to 20% and less than approximately 50% of the neoplastic population immunoreacfive, and 3+: greater than 50% of the neoplastic population immunoreactive.
Immunoprecipitation Frozen samples of three tumors were homogenized and sonicated at 4°C in 0.5% triton X-100, 20 m m o l / L tris-HC1, p H 7.4, 150 m m o l / L NaC1, 1 m m o l / L CaC12; 1 m m o l / L MgC12, 1 m m o l / L phenylmethylsulfonyl fluoride, 1 m m o l / L benzamidine, and 1 m m o l / L NaF. After centrifugation at 10,000gfor 10 minutes, the supernatant was collected for immunoprecipitation. Fifteen micrograms of biotinylated murine anti-human ecto e~6 (J8H) were b o u n d to 250 laL dynabeads M-280 streptavidin (Dynal, A.S., Oslo, Norway) by incubation for 1 hour at 4°C. The coated beads were incubated with lysates for 2 hours at 4°C. The dynabeads-bound antigens were eluted by boiling the pellets in sodium dodecyl sulfate sample loading buffer with [3-mercaptoethanol. Proteins were separated by 6% sodium dodecyl sulfate-PAGE polyacrylamide gel electrophoresis, then transferred onto a nitrocellulose membrane (Schleichef & Schuelle, Keene, NH) using a semi-dry electroblotting system (Bio-Rad Laboratories, Richmond, CA) for 1 hour at a constant current of 390 mA. After electroblotting, the membrane was blocked in T/Tris-buffered saline (TBS) (0.1% Tween 20, 50 m m o l / L Tris-HC1, 150 m m o l / L NaC1, p H 7.5) containing 5% nonfat milk for 1 hour at room temperature. The blot was probed with murine anti-human /31 (AT29/ 12p38 to 1:1,000; Janssen) for 1 hour at room temperature and was then incubated with horseradish-peroxidase-conjugated anti-mouse IgG (1:1,000 Dako) for 1 hour also at room temperature. Proteins were detected by an enhanced chemiluminescence system (ECL Amersham, Arlington Heights, IL).
Reverse Transcription Polymerase Chain Reaction Single-Strand Conformational Polymorphism To perform RT-PCR, total RNA from tissues was obtained by the Chomczynski and Sacchi method34; synthesis of first
TABLE 2. Upstream Downstream
e~3--cyto Upstream
1209
Downstream
PCR Primers
5'3°17GCGAC.,CCTTCATFGATGTGA31263' A-334bp 5 '3247GAACACTGTCATCGTACCTA32663' B-204bp 5 '3031GGAGCTGCCGGCCGAAAT30483' 5's~95GGTACTTGC,GCATGATCTGAT3S153'
A-297b
HUMAN PATHOLOGY
TABLE 3. Antigen [31 131C
Volume 29, No. 11 (November 1998)
mixture was then directly loaded onto nondenaturating 12% and 15% polyacrylamide gels. Electrophoresis was performed at 100 to 150 V for 15 to 18 hours at room temperature. The gels were silver stained and photographed.
Immunoreactivities of Normal Bronchial Surface Epithelium
Expression
Polarization
3+ 3+ (reserve cell) 3+ 3+ 3+ 1+/2+ 3+ 3+
Cell/cell and cell/stroma interfaces Cell/cell and cell/stroma interfaces
RESULTS
-
~4 c~6ecto c¢6cyto A or6 cyto B c~3ecto a3 cyto A
Cell/stroma interfaces Cell/stroma interfaces Cell/stroma interfaces Cell/stroma interfaces Cell/cell and cell/stroma interfaces Cell/cell and cell/stroma interfaces
NOTE. 3+ = 100% of the cell immunoreactive; 2+ < 100% > 50% of the cell immunoreactive; 1+ < 50% > 10% of the cell immunoreactive. strand cDNAs was based on a Perkin Elmer (Norwalk, CT) kit using 50 pmoles of downstream primer in 20 pL of the following mixture: 5 m m o l / L MgCI2, 10 m m o l / L Tris-HC1 pH 8.3, 50 m m o l / L KC1, 1 m m o l / L dNTPs, 1 U RNase inhibitor, 2.5 U MuLV reverse transcriptase. The reaction was performed at 42°C for 1 hour followed by 99°C for 5 minutes. After the reaction, 80 pL of the following mixture was added: 2 rnmol/L MgC12, 10 m m o l / L Tris-HC1, pH 8.3, 50 m m o l / L KC1, sterile H20, 2.5 U Taq 1 Polymerase (Perkin Elmer). The cycle parameters were denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute, and extension at 72°C for 1 minute for 39 cycles. The products were electrophoresed on a 2% agarose gel, and the DNA was visualized with ethidium bromide. All oligonucleotide primers were made with an Applied Biosystem 392 DNA/RNA synthesizer (Perkin Elmer, Norwalk, CT). Primer sequences are shown in Table 2. For SSCP analysis, 4 pL of each final PCR product was mixed with 10 pL SSCP loading buffer (75% deionized formamide, 12 m m o l / L NaOH, 10% blue dextran [30 m g / mL: 50 m m o l / L ethylene diaminetetra-acetic acid]), denaturated at 95°C for 5 minutes, and cooled rapidly on ice. The
I m m u n o h i s t o c h e m i c a l Expression o f I n t e g r i n s in N o r m a l Tissue
Most sections i n c l u d e d n o r m a l - a p p e a r i n g b r o n c h i or b r o n c h i o l e s that s h o w e d !31 i m m u n o r e a c t i v i t y at the basolateral border of the epithelial cells (Table 3). Conversely, [MC cytoplasmic and m e m b r a n o u s immunostaining was observed at the cell/cell interfaces and at the apical side of all the bronchiolar cells save for the reserve cells (Fig 1A); most of the latter were immunoreactive for Ki-67 (not shown). Reactions for 134 were consistently strong and basally polarized in a continous, linear pattern (Fig 1B). I m m u n o s t a i n i n g for ecto c~6 (Fig 1C) a n d e~6A was similarly p r e s e n t at the basal pole o f the pseudostratifled epithelium in a c o n t i n u o u s linear pattern. Staining for a 6 B was occasional, weak, a n d virtually always basally polarized. Reactions for ecto e~3 (Fig 1D) a n d c~3 cytoplasmic d o m a i n A were also o b s e r v e d in b r o n c h i o lar structures at the basolateral pole o f the epithelial cells. Alveolar septa were i m m u n o r e a c t i v e with m o n o c l o nal antibodies (MAbs) to [31, c¢3 ecto a n d cytodomains, a n d R6 ecto a n d cytodomains. T h e individual cell type i m m u n o r e a c t i v i t y c o u l d n o t be easily resolved by light microscopy; however, e~6 staining a p p e a r e d restricted to endothelial cells. MAb a n d polyclonal antibodies to [34 a n d 131C did n o t react with alveolar septa. Immunostaining of cells other than those of the bronchioalveolar structures was present with all integrin
FIGURE 1. (A) Normal pseudostratifled bronchial epithelium immunostained for ~1C. Note strong and extensive membrane-associated staining of the more superficial cells while the basal, "reserve" cells remain unstained (arrowhead) (original magnification x400); (B) Normal pseudostratified bronchial epithelium immunostained for 134. Note the exclusive, basally polarized linear reaction while remaining epithelial cells are unstained (original magnification ×200); (C) Normal pseudostratified bronchial epithelium immunostained for c~6(deeper section from block as in B). Basally polarized staining par@lels that of previous figure; focal reactions are also noted in endothelial structures (original magnification ×200); (D) Normal pseudostratified bronchial epithelium immunostained for the ectodomain of e3 (deeper section from block as B and C). Note strong, basally polarized reaction, and less strong but extensive cell-cell reactions of entire epithelium. Staining is also evident in endothelium and smooth muscle of the bronchi@ wall. (Original magnification × 200.)
1210
INTEGRIN LAMININ RECEPTORSIN LUNG CARCINOMAS (Patriarca et al)
TABLE4.
Synoptic Table of the Immunohistochemical Results in SCC and A D C
Diagnosis
[31
[34
a6 ecto
a6 cytoA
a6 cytoB
e~3ecto
a3 cytoA
Adenocarcinomas (n = 20)
20/20 3+ 20/20 3+
5/20 1+/2+/3+ 17/20 2+/3+
10/20 1+/2+/3+ 15/20 1+/2+/3+
10/20 1+/2+/3+ 15/20 1+/2+/3+
3/20 1+/2+/3+ 2/20 1+/3+
20/20 3+ 20/20 3+
20/20 1+/2+/3+ 20/20 1+/2+/3+
Squamous cell carcinomas (n = 20)
Note. 1+ < 15%-20%of the neoplastic population immunoreactive;2+ > 15%-20% < 50% of the neoplastic population immunoreactive; 3+ > 50% of the neoplastic population immunoreactive. subunits except for [31C, which was restricted to bronchial epithelium. In particular, [34 was strongly expressed in endothelial cells of capillary vessels, and [31 showed widespread localization in epithelial and mesenchymal elements. Both ot6A and ot6B were expressed in the endothelium of capillaries and large vessels. Bronchial and vascular smooth muscle was strongly stained for or3.
than of ADC (10 of 20) (Fig 6). No convincing correlation was f o u n d between the presence of or6 and grading of tumors. Both types of tumors expressed the ectodomain coupled predominantly with the a6A cytoplasmic domain; however, a minority of SCC and ADC coexpressed et6B (5 of 25).
I m m u n o h i s t o c h e r n i c a l Expression o f Integrins in S C C a n d A D C
Immunohistochemical Colocalizations o f 56 a n d 131 in S C C a n d A D C
T h e main findings are outlined in Table 4. We f o u n d strong and extensive basally polarized [34 immunoreactions in most SCC (17 of 20) (Fig 2), whereas in ADC, similarly polarized staining was p r e s e n t in a minority of cases (5 of 20). T h e r e was no correlations between the presence of this molecule and stage and grading of the tumors. Immunostaining for [31 was consistently and evenly distributed in SCC and ADC in an unpolarized pattern and involved neoplastic cells (40 cases, 3+). Reactions for ecto 0~3 were f o u n d in all SCC and ADC (40 of 40) (Fig 3); the localization of the or3 cytoplasmic domain A paralleled that of its extracellular counterpart (40 of 40) (Fig 4); however, in 30 of 40 cases it appeared restricted to a subset of cells reactive for the ectodomain ( < 3 + of immunoreactive cells). Alpha6 was present in fewer cases (25 of 40) than or3 and showed less extensive and intense immunoreactivity (40 of 40 cases, 3+ for ecto or3 v 14 of 25 cases 3+ for ecto or6). Immunoreactions with anti-or6 MAbs were observed in a higher n u m b e r of SCC (15 of 20) (Fig 5)
In SCC, immunoreactions with anti-ectoe~6 and anti-et6A were polarized in 5 of 20 (Fig 5) and not polarized in 10 of 20 cases (Fig 7A). These molecules were colocalized with [34 (5 of 20) (Fig 7B), paralleling the polarization present in normal bronchial structures, and with both [34 and [31 (10 of 20), at the cell/stroma and at the cell/cell interfaces, respectively (Fig 7C). Thus, the colocalization of or6 and [31 at the cell/cell interface in these carcinomas represents a de novo pattern of expression. In those ADC expressing ecto or6 and cytoc~6A (10 of 20), these were exclusively associated with [31 in five cases that were negative for [34. The remaining five cases expressed ectoot6/cyto ot6A either polarized (two cases) or not polarized (three cases), that is, colocalized with either [34 parallelling the polarization present in normal bronchi, or with both 131 and [34, at the cell~cell and the cell/stroma interface, respectively.
FIGURE 2. Pulmonary SCC immunostained for !84. Strong, basally polarized staining is noted in several adjacent neoplastic clusters. (Original magnification x200.)
FIGURE 3. Pulmonary ADC immunostained for the ectodomain of e3. Basally polarized and cell-cell reactions are evident in multilayered glands but the former are more conspicuous. (Original magnification x200.)
1211
HUMAN PATHOLOGY
Volume29, No. 11 (November 1998)
FIGURE 4. Pulmonary ADC immunostained for the cytodomain A of ~3. Reaction overlaps that of Fig 3; however, fewer luminal cells are stained. (Original magnification ×200.) Correlations Between Ki-67 a n d [31c in SCC a n d A D C
Staining for [31C was heterogeneous (Fig 8); it ranged from scattered cells (1+) to more than 50% of the neoplastic population with a nonpolarized pattern of staining, involving either the cell membrane or membrane and cytoplasm (3 +). In addition, an inverse correlation was found between [31C and Ki-67. Indeed, most tumors showing 30% or more of neoplastic cells positive for Ki-67 were those showing low (-+) [31c expression and vice versa (P = .006, chi-squared test). Moreover, occasional areas showed a distinct, inverse relationship between low Ki67 immunoreactivity and high [31C expression. I m m u n o p r e c i p i t a t i o n of 0~6131 in Neoplastic Tissue
Samples of cases showing immunohistochemical colocalization of et6 and [31 chains underwent immunoprecipitation analysis. Immunoprecipitates of the supernatants with anti-human ecto or6 (J8H) were successfully
FIGURE 5. Pulmonary SCC immunostained for the ectodomain of ~6. Strong, basally polarized reaction is evident. (Original magnification x200.)
FIGURE 6. Pulmonary ADC immunostained for the cytodomain of c~6A. Basally polarized staining of neoplastic glands (and vascular endothelium) is noted. (Original magnification x200,)
probed with anti-J31 (AT29/12p38) monoclonal antibodies, confirming the linkage of the ~6 and [31 chains (Fig 9). RT-PCR SSCP Analysis of c~3 a n d ~6 C y t o p l a s m i c Domains in SCC a n d A D C
Samples of all cases and normal controls subjected to RT-PCR yielded cDNA for the oL6 and ~x3 cytoplasmic domains. The samples under study included small vessels and some bronchial smooth muscle, expressing or6 and cx3 cytoplasmic domains. Taking this factor into account, mutation analysis of 40 tumor samples detected no abnormal electrophoresis mobility shifts on polyacrylamide gels. Typical results of the SSCP band patterns are illustrated in Figure 10.
DISCUSSION The importance of laminin receptors during neoplastic progression has been extensively documented in the last decade, 1,~4-~6and most laminin receptors belong to the integrin family of cell adhesion receptors. 24 A number of reports have outlined variable modulations in integrin laminin receptor profiles in carcinomas of various primary sites, s,10-1~,15-17 However, there are only limited data on the expression of these molecules in lung carcinomas. 7,374° In this study, our aim was to investigate systematically the expression of laminin receptors of the integrin family in lung carcinomas of squamous and glandular differentiation. We found predominance of a3 over e~6 and of e~6A over et6B, ot6[~l cell/cell tumor-specific localization in a subset of cases, and an inverse correlation between the expression of [31C and Ki-67. No mutations of the ~3 and or6 cytoplasmic domains were detected. Preponderance of e~3 over 0~6 was noted in SCC as well as ADC; interestingly, no difference in integrin expression was observed in relation to different clinicopathologic stages. As our data on integrin laminin receptors in lung carcinomas are compared with their counterparts in
1212
INTEGRiN LAMININ RECEPTORS IN LUNG CARCINOMAS (Patriarca et al)
FIGURE 7. (A) Pulmonary SCC immunostained for the ectodomain of G6. Similarly strong, basal, and ceil-cell reactions are noted (Original magnification x200); (B) Pulmonary SCC immunostained for IM (deep section from same block as A). Note exclusively, basally polarized reaction (Original magnification x200); (C) Pulmonary SCC immunostained for 131 (deeper section from same block as A and B), Strong, basally polarized, and cell-cell reactions are evident; staining also involves nonneoplastic stromal elements (S), (Original magnification x200.)
other tumor systems, it would appear that an et3/ot6 balance could play a role in the variable metastatic behavior of neoplastic cells of different primary sites. Particularly notable appears to be the role of ~3 (laminin promiscous receptor) over e~6 (lamininspecific receptor) as it emerges consistently in tumors with m o r e precocious and often widespread metastatic properties, such as lung, 7,37 kidney, 12,16 and ovary.41 Conversely, in tumors with somewhat more restricted or
selective (lymphatic), and often sluggish metastatic proclivities, e¢6 is often p r e d o m i n a n t over et3, for example, c o l o n 11,14,16 and e n d o m e t r i u m carcinomas. 15 Similarly, the ecto ot6/cytoA/[31 p r e d o m i n a n c e over ecto ~6/cytoB/[M underscores the same concept. Indeed, in less aggressive carcinomas, p r e d o m i n a n c e of ot6B was reported. 16 Interestingly, in experiments in vitro, ot6A/[31 was shown to induce a migration capacity twice stronger than that induced by ot6B/[31. 23 In addition, in colon adenocarcinomas, e~6 expression is almost exclusively f o u n d toward the basal pole of the c~6A ¢~6A
a
FIGURE 8. Pulmonary SCC immunostained for 181C. Note heterogeneous reactions involving most cells in a neoplastic cluster. (Original magnification x 100.) 1213
b
FIGURE 9. Immunoblots with antibody to 181 of ~6A immunoprecipitated samples obtained from two SCC that were 184negative (lane a) and 184-positive (lane b), respectively; note virtually indistinguishable 181 reactions in both instances,
HUMAN PATHOLOGY N
N
M or3
T
N
Volume 29, No. 11 (November 1998)
T
~ M
,~6A
c~6B
FIGURE 10. SSCP analysis of a single ADC showing normal migration bands of tumor samples (T) as compared with normal controls (N) of a3, ~6A, and c~6Bcytoplasmic domains. Lack of mutations as noted in these samples were noted in all cases.
glands, 11,14hinting at a function of ot6/[M as a receptor. Conversely, in the tumors under study, we found three different situations: (1) ADC and SCC with c~6 coalignment with 134 (seven cases); (2) ADC and SCC with e~6 coalignment with 131 at the cell/cell interfaces (13 cases); (3) ADC not reactive with anti-[34, that is, with or6 expression exclusively [31 linked (five cases). Coprecipitation analysis performed in cases belonging to groups 2 and 3 confirmed the association of a6 with ~1. Indeed, these cases (68% of the 0t6-positive cases) showed a partial or total switch from the hemidesmosome-associated laminin receptor (0t6/[34) of normal bronchial structures, 7,37 to the less structurally and spatially organized laminin receptor (ot6/131) of neoplastic populations. The notion of a switching p h e n o m e n o n is based also on the or6 preferential association with 134 as compared with [31. 24 This result highlights differences between lung carcinomas and other carcinomas where loss of polarization of [34 were described, s From the structural point of view, e~3 and e~6 seem to be present in an intact and potentially active form. The immunocytochemical analysis for the cytodomains failed to show the presence of truncated forms of these molecules. A weaker immunoreactivity of the e~3A cytoplasmic domain was often noted in our slides, possibly reflecting the low affinity of the MAb. More significantly, SSCP analysis did not show the presence of mutated forms of these molecules, suggesting that the contribution of mRNA coming from the neoplastic tissues to the bands migration was normal. Finally, the inverse correlation between [31C and Ki-67 suggests that integrins might become future parameters of prognostic relevance; notably, a similarly inverse correlation was recently reported in some breast carcinomas. 42 Comparatively few reports deal with integrin expression in lung carcinomas, and until recently none did so in a systematic way (for recent overview, see Koukoulis et a17). Damjanovich et a137 reported prevalence of ~x3 over or6 in some pulmonary carcinomas. Our data underscored that finding in SCC and ADC of the lung, and, most recently, in large cell carcinomas. 7 Notably, small cell and other neuroendocrine tumors of the lung differed significantly in integrin expression profile. 7,3s Integrins also differed significantly in pulmonary alveo-
lar cell carcinomas in which a1131 and c~3131 were consistently found, whereas or6 was consistently absent. 7 Moreover, the functional role of integrin expression in neuroendocrine carcinomas is partly reduced by molecules interfering with adhesive phenomena. 44 With regard to potential clinical impact, initial results on h u m a n neoplasms seemed to indicate that integrins were reduced in malignant tumors, and that this downregulation may partly explain their invasive and metastatic behavior, s,45-gsThis attractive and simple hypothesis may be operative in certain cases; however, subsequent data including our own underscored that the relationships between integrin expression and tumor invasion and metastasis are complex and diverse. This is illustrated by data indicating that "ectopic" subunits may emerge, as is the case with a5 in colloid breast carcinoma cells. 13 Somewhat subtler alterations may occur as exemplified by the topographically variable "switch" from 134 to 131 in the pulmonary SCC and ADC reported herein. Moreover, it has been noted that presumably " n o r m a l " integrin complements may promote rather than hinder invasion, as indicated by the concentration of 0L6 and [31 in "kinetopodia" of highly invasive lobular breast carcinomas, 13 and by in vitro data regarding [31 in gliomas. 49 Nevertheless, helpful differential diagnostic points have been accrued. Examples of the latter comprise the integrin profile shown by pleural mesotheliomas displaying exquisitely developed glands, which nevertheless differs consistently from that of most ADC4~; similarly, the integrin profile of pulmonary alveolar cell carcinomas differs from that of pulmonary and extrapulmonary ADC, indicating that the former are not simply a subset of the latter. 7 These complex and occasionally paradoxical data suggest that, although caution should be exercised in attempting to develop diagnostic criteria, further studies on integrins in tumors are likely to yield important information and improve our understanding of their biology.
Acknowledgment. The authors thank Robert Rey for photographical assistence.
REFERENCES 1. Aznavoorian S, Murphy AN, Stetler-Stevenson WG, et al: Molecular aspects of tumor cell invasion and metastasis. Cancer 71:1368-1383, 1993 2. Castronovo V: Laminin receptors and laminin-binding proteins during tumor invasion and metastasis. Invasion Metastasis 13:1-30, 1993 3. Hynes RO: Integrins: A family o f cell surface receptors. Cell 48:549-554, 1987 4. Sonnenberg A: Integrins and their ligands. Curt Top Microbiol Immunol 184:7-35, 1993 5. Ruoslahti E: Integrins.J Clin Invest 87:1-5, 1991 6. Volpes R, van den Oord.I], Desmet V: Integrins as differential cell lineage markers of primary liver tumors. Am J Pathol 142:14831492, 1993 7, Koukoulis Gig. Warren WH, Virtanen I, et al: Immunolocalization of integrins in the normal lung and in pulmonary carcinomas. HUM PATHOL28:1018-1025, 1997 8. Juliano RL, Varner JA: Adhesion molecules in cancer: The role ofintegrins. Curr Opin Cell Biol 5:812-818, 1993
1214
INTEGRIN LAMININ RECEPTORSIN LUNG CARCINOMAS (Patriarca et al) 9. Kramer RH, Vu MP, Cheng YF, et al: Laminin-binding integrin alpha 7 beta 1: Functional characterization and expression in normal and malignant melanocytes. Cell Regul 2:805-817, 1991 10. Bonkhoff H, Stein U, Remberger K: Differential expression of c~6 and eL2 very late antigen integrins in the normal hyperplastic, and neoplastic prostate: Simultaneous demonstration of cell surface receptors and their extracellular ligands. HUM PATHOL 24:243-248, 1993 11. Koretz K, Schlag P, Boumsell L, et al: Expression of VLA~2, VLA-a6 and VLA-[31 chains in normal mucosa and adenomas of the colon, and in colon carcinomas and their liver metastases. AmJ Pathol 138:741-750, 1991 12. Korhonen M, Laitinen L, Ylanne J, et al: Integrin distributions in renal cell carcinomas of various grades of malignancy. Am J Pathol 141:1161-1171, 1992 13. Koukoulis GK, Virtanen I, Korhonen M, et al: Immunohistochemical localization of integrins in the normal, hyperplastic, and neoplastic breast: Correlations with their functions as receptors and cell adhesion molecules. A m J Pathol 139:787-799, 1991 14. Koukoulis GK, Virtanen I, Moll R, et al: Immunolocalization of integrins in the normal and neoplastic colonic epithelium. Virchows Arch Pathol Anat 63:373-383, 1993 15. Lessey BA, Albelda S, Buck CA, et al: Distribution of integrin cell adhesion molecules in endometrial cancer. Am J Pathol 146:71% 726, 1995 16. Patriarca C, Ivanyi D, Fles D, et al: Distribution of extracellular and cytoplasmic domains of the e~3 and et6 integrin subunits in solid minors. I n t ] Cancer 63:182-189, 1995 17. Pignatelli M, Cardillo MR, HanbyA, et al: Integrins and their accessory adhesion molecules in mammary carcinomas: Loss of polarization in poorly differentiated tumors. HUM PATHOL 23:11591166, 1992 18. Hynes RO: Integrins: Versatility, modulation, and signaling in cell adhesion. Cell 69:11-25, 1992 19. Clark EA, Brugge JS: Integrins and signal transduction pathways: The road taken. Science 268:233-239, 1996 20. Schwartz MA: Signalingbyintegrins: Implications for tumorigenesis. Cancer Res 53:1503-1506, 1993 21. Yamada KM, Miyamoto S: Integrin transmembrane signaling and cytoskeletal control. Curr Opin Cell Biol 7:681-689, 1995 22. Hierk BP, Thorsteinsdottir S, Niessen CM, et al: Variants of the et6131 laminin receptor in early murine development: Distribution, molecular cloning and chromosomal localization of the mouse integrin ct6 subunit. Cell Adhes Commun 1:33-53, 1993 23. Shaw LM, Mercurio AM: Regulation of cellular interactions with laminin by integrin cytoplasmic domains: The A and B structural variants of tile a6131 integrin differentially modulate the adhesive strength, morphology, and migration of macrophages. Mol Biol Cell 5:679-690, 1994 24. Shaw LM, Chao C, Wewer UM, et al: Function of the integrin c~6131 in metastatic breast carcinoma cells assessed by expression of a dominant-negative receptor. Cancer Res 56:959-963, 1996 25. Languino LR, Ruoslahti E: An alternative form of the integrin [31 subunit with a variant cytoplasmic domain. J Biol Chem 267:7116-7120, 1992 26. Meredith J Jr, Takada Y, Fornaro M, et al: Inhibition of cell cycle progression by the alternatively spliced integrin [31C. Science 269:1570-1572, 1995 27. GerdesJ, Lemke H, Baisch H, et al: Cell cycle analysis of a cell proliferation associated human nuclear antigen defined by the monoclonal antibody Ki-67. J Immunol 133:1710-1715, 1984 28. Gould VE, Warren WH: Epithelial neoplasms of the lung, in RothJA, RuckdeschelJC, Weisenburger TH (eds) : Thoracic Oncology (ed 2). Philadelphia, PA, Saunders, 1995, pp 49-67
29. Hammar SP: Common neoplasms of the lung, in Dail DH, Hammar SP (eds): Pulmonary Pathology (ed 2). New York, NY, Springer-Verlag, 1994, pp 1123-1278 30. Koukoulis GK, RadosevichJA, Warren WH, et al: Immunohistochemical analysis of pulmonary and pleural neoplasms with monoclonal antibodies B72.3 and CSLEX-1. Virchows Arch Cell Pathol 58:42%433, 1990 31. de Melker AA, Sterk LMTh, Delwel GO, et al: The A and B a3 variants of the integrin subunit: Tissue distribution and functional characterization. Lab Invest 76:1-17, 1997 32. Fornaro M, Tallini G, Bofetiado CJM, et al: Down-regulation of [31C integrin, an inhibitor of cell proliferation, in prostate carcinoma. AmJ Pathol 149:765-773, 1996 33. Hsu SM, Raine L, Fanger H: Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: A comparison between ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem 29:577-580, 1981 34. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocynate-phenol-chloroform extraction. Anal Biochem 162:156-159, 1987 35. Wewer UM, Taraboletti G, Sobel ME, et al: Role of laminin receptor in tumor cell migration. Cancer Res 47:5691-5698, 1987 36. Zetter BR: Adhesion molecules in tumor metastasis. Cancer Biol 4:219-229, 1993 37. Damjanovich L, Albelda SM, Metre SA, et al: Distribution of integrin cell adhesion receptors in normal and malignant lung tissue. AmJ Respir Cell Mol Biol 6:19%206, 1992 38. Mariani Costantini R, Falcioni R, Battista P, et al: Integrin (e~6134) expression in human lung cancer as monitored by specific monoclonal antibodies. Cancer Res 50:610%6112, 1990 39. Pellegrini R, Martignone S, M~nard S, et al: Laminin receptor expression and function in small-cell lung carcinoma. IntJ Cancer 8:116-120, 1994 40. Smythe WR, LeBel E, BavariaJE, et al: Integrin expression in non-small cell carcinoma of the lung. Cancer Metast Rev 14:229-239, 1995 41. Skubitz APN, Bast RCJr, Wayner EA, et al: Expression of ~6 and [34 integrins in serous ovarian carcinoma correlates with expression of the basement membrane protein laminin. Am J Pathol 148:1445-1461, 1996 42. Di Bacco A, Viale G, Fornaro M, et al: Expression of [31C, an inhibitor of cell proliferation, in invasive breast carcinoma. Mod Patho110:17A, 1997 43. Koukoulis GK, ShenJ, Monson R, et al: Pleural mesotheliomas have an integrin profile distinct from visceral carcinomas. HUM PATHOL28:84-90, 1997 44. Patriarca C, Pruneri G, Alfano RM, et al: Polysialylated N-CAM, chromogranin A and B, and secretogranin II in neuroendocrine tumours of the lung. Virchows Arch 430:455-460, 1997 45. KnoxJD, Cress AE, Clark V, et al: Differential expression of extracellular matrix molecules and c~6-integrins in the normal and neoplastic prostate. AmJ Pathol 145:167-174, 1994 46. Pignatelli M, Smith MEF, Bodmer WF: Low expression of collagen receptors in moderate and poorly differentiated colorectal carcinomas. BrJ Cancer 61:636-638, 1990 47. Roussel E, Gingras MC, RoJY, et al: Loss o f a l b l and reduced expression of other [31 integrins and CAM in lung adenocarcinoma compared with pneumocytes.J Surg Onco156:198-208, 1994 48. Zutter MM, Mazoujian G, Santoro SA: Decreased expression of integrin adhesive protein receptors in adenocarcinoma of the breast. A m J Patho1137:863-870, 1990 49. Paulus W, Baur I, Beutler AS, et al: Diffuse brain invasion of glioma cells require [31 integrins. Lab Invest 75:819-826, 1996
1215
a circumferential pattern; ~6131 coexpression was also shown by coprecipitation experiments. Strong and extensive 134 reactions were invariably polarized at the cell/stroma interface in SCC and ADC. An inverse correlation was found between the expression of 131C and Ki-67. The prevalence of ~x6A in pulmonary SCC and ADC is in contrast with previous results in colonic ADC in which ~6B prevails, and c~6 predominates over c~3. The absence of mutations of the cytodomains suggests that the integrin subunits of these carcinomas are potentially active. Predominance of ~3 over or6 and of c~6A over e~6B may contribute to explain the aggressive and metastatic behavior of lung carcinomas. HUM PATHOL 29:1208-1215. Copyright © 1998 by W.B. Saunders Company Key words: Lamlnin receptors, integrins, lung carcinomas. Abbreviations.: SSCP, single-strand conformational polymorphism; SCC, squamons cell carcinoma; ADC, adenocarcinoma; RT, reverse transcription; PCR, polymerase chain reaction; MAb, monoclonal antibody.
Interactions between carcinomatous cells and laminin, a major component of basement membranes, play a pivotal role during several steps of the invasionmetastasis cascade. 1 A n u m b e r of different molecules have either laminin receptor or laminin binding functions, 2 and some of these belong to the integrin family.3 Integrins comprise an c~- and a [3-subunit. At least 16 different a and eight [3 subunits have been isolated4; their receptorial function vis fi vis laminin and other extracellular matrix proteins requires the noncovalent linkage of an and a [3subunit. 5 Integrin laminin receptors include od, a2, or3, oL6,and oL7in various combinations with [31 and [34.4 The role of cd in the invasive and metastasizing phenotype of epithelial neoplasms appears limited except for hepatocellular carcinomas, 6 small cell neuroendocrine, and, notably, bronchioloalveolar lung carci-
nomas. 7 Downregulation of a2 has been reported in many different tumors, 8 whereas data about c~7 are still fragmentary. 9 In contrast, o~3 and ¢x6 containing integrin laminin receptors have been consistently reported to be strongly expressed in numerous epithelia and their pertinent carcinomas. 1°-17However, the specificity and affinity of integrins containing 0~3 and or6 differ significantly as laminin receptors. Alpha 6, coupled with either [31 or [34, is a specific laminin receptor, whereas e~3 containing integrins are "promiscuous" receptors capable in vivo of recognizing laminin as well as other extracellular matrix proteins, including cellular fibronectin (s) and collagens.2,4A potentially significant shortcoming of the cfinicopathologic studies on integrins published so far relates to the use of immunocytochemical probes targeted to the ectodomains of the molecules, given that the presence of the latter domains does not invariably imply effective receptor function. 18 Recently, new data have been accrued about the variants of cytoplasmic integrin domains, underscoring their importance in modulating cell migration, influendng ligand affinity, and altering integrincytoskeleton linkage and signal transmission. 19-21In particular, the variants e~6Aand e~6B have a major impact on cell migration, at least when linked with [~1.22-24 It remains undetermined whether mutations of these cytoplasmic domains may occur that might impact on tumor invasion and metastasis in vivo. We now report our immunohistochemical and immunoprecipitation studies as well as mutational analy-
From the II Department of Pathology, University of Milan School of Medicine, Hospital S. Paolo, Milan, Italy; the Division of Cell Biology, The Netherlands Cancer Institute, Amsterdam, The Netherlands; Department of Pathology, Yale University School of Medicine, New Haven, CT; and Department of Pathology, Rush Medical College, Chicago, IL. Accepted for publication April 13, 1998. Supported in part by the AIRC (Associazone Italiana per La Ricerca sul Cancro. Address correspondence and reprint requests to Victor E. Gould, MD, Department of Pathology, Rush Medical College, Chicago, IL 60612. Copyright © 1998 by W.B. Sannders Company 0046-8177/98/2911-000658.00/0
1208
INTEGRINLAMININ RECEPTORSIN LUNG CARCINOMAS(Patriorca et al) sis by s i n g l e - s t r a n d c o n f o r m a t i o n a l p o l y m o r p h i s m (SSCP) f o r t h e c y t o d o m a i n s o f e~3 a n d c~6 o n 20 s q u a m o u s cell c a r c i n o m a s (SCC) a n d 20 a d e n o c a r c i n o m a s (ADC) o f t h e l u n g . T h e e x p r e s s i o n o f [34 a n d [31 was i n v e s t i g a t e d by i m m u n o h i s t o c h e m i s t r y . M o r e o v e r , we s t u d i e d t h e e x p r e s s i o n o f t h e r e c e n t l y d i s c o v e r e d [31C splice variant, r e p o r t e d to b e i n v o l v e d in i n h i b i t i o n o f cell cycle p r o g r e s s i o n . 25,26 F o r c o r r e l a t i o n p u r p o s e s , we also s t u d i e d t h e e x p r e s s i o n o f t h e p r o l i f e r a t i o n r e l a t e d m o l e c u l e Ki-67. 27 We f o u n d t h a t all o f t h e s e c a r c i n o m a s e x p r e s s c~3 extensively a n d or6 less extensively e i t h e r c o p o l a r i z e d with [34 o r with [31, r e f l e c t i n g t h e n o r m a l b r o n c h i a l expression or a de novo pattern of expression. In a d d i t i o n , we n o t e d t h a t t h e c y t o A is t h e p r e d o m i n a n t eL6 variant. We d i d n o t f i n d c y t o d o m a i n m u t a t i o n s in e i t h e r oL3 o r or6. Finally, we f o u n d a n inverse c o r r e l a t i o n b e t w e e n [31C a n d Ki 67. T h i s l a m i n i n r e c e p t o r i n t e g r i n p r o f i l e differs significantly f r o m t h a t o f c a r c i n o m a s o f o t h e r viscera a n d f r o m t h a t o f p u l m o n a r y n e u r o e n d o c r i n e a n d a l v e o l a r cell t u m o r s ] a n d it m a y h e l p e x p l a i n t h e aggressive b e h a v i o r o f p u l m o n a r y SCC a n d ADC.
MATERIALS AND METHODS
Immunohistochemistry Tumors were excised at the Rush-Presbyterian-St Luke's Medical Center, Chicago, IL; samples from the primary site of 40 cases (20 SCC and 20 ADC) were obtained immediately after the surgical procedures. They were immersed in precooled isopentane, snap-frozen in liquid nitrogen, and kept in a deep freezer at - 8 0 ° C until used. Data were available, including the stage and grading of the tumor at the time of removal. The stage of SCC encompassed three T1N0, eight T2N0, two T1N1, three T2N1, two T3N0, and two T2N2. The stages of ADC were T1N0 in 12, T2N0 in three, T3N0 in two, and, respectively, T1N2, T2N2, and T3N2 in one case. Grading encompassed 14 moderately differentiated SCC, six poorly differentiated SCC, eight well-differentiated ADC, six moderately differentiated ADC, and four poorly differentiated ADC. Adjuvant therapy, development of distant metastases, and subsequent follow-up also were known. The diagnoses and grading of SCC and ADC were established on conventional, hematoxylin and eosin-stained sections by widely accepted criteria. ~8,29Most of these tumors have been extensively characterized by electron microscopy and by immunohistochemistry with MAbs and antisera to intermediate filament proteins, glycoproteins associated with exocrine differentiation, and neuroendocrine markers. 2s,3° Five-micron-thick serial cryosections were prepared and fixed in acetone at 4°C for 10 minutes and immunostained with monoclonal antibody (MAb) to extracellular and cytoplasmic domains ofc~3 and a6, as well as to [31, [34, and Ki-67 at the dilutions outlined in Table 1. Likewise, polyclonal anti [31C antibody was applied (Table 1). These monoclonal and polyclonal antibodies have been characterized and extensively tested for specificity and localizations in previous studies. 16,~1,32The immunostaining protocols have been described in detail elsewhere. 33 Briefly, sections were incubated sequentially with biotin-conjugated horse anti-mouse immunoglobulin antibody (30 minutes, 1:200 Dakopatts, Copenhagen, Denmark), followed by an avidin-biotin-peroxidase complex (30 minutes, 1:100 Dakopatts, Copenhagen, Denmark). Finally, the sections were incubated with 0.05% 3-4-3'-4'diaminobenzidine (Aldrich Chemicals Co, Danvers, MA), and
TABLE 1. Antibodies Used in the Present Study Antigen
Clone
e~3 ecto a3 cyto A e~6 ecto e~6cyto A e~6cyto B [31 [31C [34 Ki-67
J143 29A3 GoH3 1A10 6B4 AT 29/12.R38 Polyclonal 64C MIB1
Dilution 1:1000 ]: 100 1:1000 1:800 1:100 1:1000 1:50 1:100 1:50
Source Dr. A. Sonnenberg, NKI Dr. A. Sonnenberg, NKI Dr. A. Sonnenberg, NKI Dr. A. Sonnenberg, NKI Dr. A. Sonnenberg, NKI Janssen Co Dr. L. Languino, Yale Dr. A. Sonnenberg, NKI Dako, Denmark
H20 2 for 5 minutes. Slides were then washed in distilled water, dehydrated in alcohol, and m o u n t e d in Eukitt (O. Kindler GmbH & Co, Freiberg, Germany); no hematoxylin counterstain was applied. Immunostaining was quantified as follows: 1 +: less than 15% to 20% of the neoplastic population immunoreactive; 2+: more than 15% to 20% and less than approximately 50% of the neoplastic population immunoreacfive, and 3+: greater than 50% of the neoplastic population immunoreactive.
Immunoprecipitation Frozen samples of three tumors were homogenized and sonicated at 4°C in 0.5% triton X-100, 20 m m o l / L tris-HC1, p H 7.4, 150 m m o l / L NaC1, 1 m m o l / L CaC12; 1 m m o l / L MgC12, 1 m m o l / L phenylmethylsulfonyl fluoride, 1 m m o l / L benzamidine, and 1 m m o l / L NaF. After centrifugation at 10,000gfor 10 minutes, the supernatant was collected for immunoprecipitation. Fifteen micrograms of biotinylated murine anti-human ecto e~6 (J8H) were b o u n d to 250 laL dynabeads M-280 streptavidin (Dynal, A.S., Oslo, Norway) by incubation for 1 hour at 4°C. The coated beads were incubated with lysates for 2 hours at 4°C. The dynabeads-bound antigens were eluted by boiling the pellets in sodium dodecyl sulfate sample loading buffer with [3-mercaptoethanol. Proteins were separated by 6% sodium dodecyl sulfate-PAGE polyacrylamide gel electrophoresis, then transferred onto a nitrocellulose membrane (Schleichef & Schuelle, Keene, NH) using a semi-dry electroblotting system (Bio-Rad Laboratories, Richmond, CA) for 1 hour at a constant current of 390 mA. After electroblotting, the membrane was blocked in T/Tris-buffered saline (TBS) (0.1% Tween 20, 50 m m o l / L Tris-HC1, 150 m m o l / L NaC1, p H 7.5) containing 5% nonfat milk for 1 hour at room temperature. The blot was probed with murine anti-human /31 (AT29/ 12p38 to 1:1,000; Janssen) for 1 hour at room temperature and was then incubated with horseradish-peroxidase-conjugated anti-mouse IgG (1:1,000 Dako) for 1 hour also at room temperature. Proteins were detected by an enhanced chemiluminescence system (ECL Amersham, Arlington Heights, IL).
Reverse Transcription Polymerase Chain Reaction Single-Strand Conformational Polymorphism To perform RT-PCR, total RNA from tissues was obtained by the Chomczynski and Sacchi method34; synthesis of first
TABLE 2. Upstream Downstream
e~3--cyto Upstream
1209
Downstream
PCR Primers
5'3°17GCGAC.,CCTTCATFGATGTGA31263' A-334bp 5 '3247GAACACTGTCATCGTACCTA32663' B-204bp 5 '3031GGAGCTGCCGGCCGAAAT30483' 5's~95GGTACTTGC,GCATGATCTGAT3S153'
A-297b
HUMAN PATHOLOGY
TABLE 3. Antigen [31 131C
Volume 29, No. 11 (November 1998)
mixture was then directly loaded onto nondenaturating 12% and 15% polyacrylamide gels. Electrophoresis was performed at 100 to 150 V for 15 to 18 hours at room temperature. The gels were silver stained and photographed.
Immunoreactivities of Normal Bronchial Surface Epithelium
Expression
Polarization
3+ 3+ (reserve cell) 3+ 3+ 3+ 1+/2+ 3+ 3+
Cell/cell and cell/stroma interfaces Cell/cell and cell/stroma interfaces
RESULTS
-
~4 c~6ecto c¢6cyto A or6 cyto B c~3ecto a3 cyto A
Cell/stroma interfaces Cell/stroma interfaces Cell/stroma interfaces Cell/stroma interfaces Cell/cell and cell/stroma interfaces Cell/cell and cell/stroma interfaces
NOTE. 3+ = 100% of the cell immunoreactive; 2+ < 100% > 50% of the cell immunoreactive; 1+ < 50% > 10% of the cell immunoreactive. strand cDNAs was based on a Perkin Elmer (Norwalk, CT) kit using 50 pmoles of downstream primer in 20 pL of the following mixture: 5 m m o l / L MgCI2, 10 m m o l / L Tris-HC1 pH 8.3, 50 m m o l / L KC1, 1 m m o l / L dNTPs, 1 U RNase inhibitor, 2.5 U MuLV reverse transcriptase. The reaction was performed at 42°C for 1 hour followed by 99°C for 5 minutes. After the reaction, 80 pL of the following mixture was added: 2 rnmol/L MgC12, 10 m m o l / L Tris-HC1, pH 8.3, 50 m m o l / L KC1, sterile H20, 2.5 U Taq 1 Polymerase (Perkin Elmer). The cycle parameters were denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute, and extension at 72°C for 1 minute for 39 cycles. The products were electrophoresed on a 2% agarose gel, and the DNA was visualized with ethidium bromide. All oligonucleotide primers were made with an Applied Biosystem 392 DNA/RNA synthesizer (Perkin Elmer, Norwalk, CT). Primer sequences are shown in Table 2. For SSCP analysis, 4 pL of each final PCR product was mixed with 10 pL SSCP loading buffer (75% deionized formamide, 12 m m o l / L NaOH, 10% blue dextran [30 m g / mL: 50 m m o l / L ethylene diaminetetra-acetic acid]), denaturated at 95°C for 5 minutes, and cooled rapidly on ice. The
I m m u n o h i s t o c h e m i c a l Expression o f I n t e g r i n s in N o r m a l Tissue
Most sections i n c l u d e d n o r m a l - a p p e a r i n g b r o n c h i or b r o n c h i o l e s that s h o w e d !31 i m m u n o r e a c t i v i t y at the basolateral border of the epithelial cells (Table 3). Conversely, [MC cytoplasmic and m e m b r a n o u s immunostaining was observed at the cell/cell interfaces and at the apical side of all the bronchiolar cells save for the reserve cells (Fig 1A); most of the latter were immunoreactive for Ki-67 (not shown). Reactions for 134 were consistently strong and basally polarized in a continous, linear pattern (Fig 1B). I m m u n o s t a i n i n g for ecto c~6 (Fig 1C) a n d e~6A was similarly p r e s e n t at the basal pole o f the pseudostratifled epithelium in a c o n t i n u o u s linear pattern. Staining for a 6 B was occasional, weak, a n d virtually always basally polarized. Reactions for ecto e~3 (Fig 1D) a n d c~3 cytoplasmic d o m a i n A were also o b s e r v e d in b r o n c h i o lar structures at the basolateral pole o f the epithelial cells. Alveolar septa were i m m u n o r e a c t i v e with m o n o c l o nal antibodies (MAbs) to [31, c¢3 ecto a n d cytodomains, a n d R6 ecto a n d cytodomains. T h e individual cell type i m m u n o r e a c t i v i t y c o u l d n o t be easily resolved by light microscopy; however, e~6 staining a p p e a r e d restricted to endothelial cells. MAb a n d polyclonal antibodies to [34 a n d 131C did n o t react with alveolar septa. Immunostaining of cells other than those of the bronchioalveolar structures was present with all integrin
FIGURE 1. (A) Normal pseudostratifled bronchial epithelium immunostained for ~1C. Note strong and extensive membrane-associated staining of the more superficial cells while the basal, "reserve" cells remain unstained (arrowhead) (original magnification x400); (B) Normal pseudostratified bronchial epithelium immunostained for 134. Note the exclusive, basally polarized linear reaction while remaining epithelial cells are unstained (original magnification ×200); (C) Normal pseudostratified bronchial epithelium immunostained for c~6(deeper section from block as in B). Basally polarized staining par@lels that of previous figure; focal reactions are also noted in endothelial structures (original magnification ×200); (D) Normal pseudostratified bronchial epithelium immunostained for the ectodomain of e3 (deeper section from block as B and C). Note strong, basally polarized reaction, and less strong but extensive cell-cell reactions of entire epithelium. Staining is also evident in endothelium and smooth muscle of the bronchi@ wall. (Original magnification × 200.)
1210
INTEGRIN LAMININ RECEPTORSIN LUNG CARCINOMAS (Patriarca et al)
TABLE4.
Synoptic Table of the Immunohistochemical Results in SCC and A D C
Diagnosis
[31
[34
a6 ecto
a6 cytoA
a6 cytoB
e~3ecto
a3 cytoA
Adenocarcinomas (n = 20)
20/20 3+ 20/20 3+
5/20 1+/2+/3+ 17/20 2+/3+
10/20 1+/2+/3+ 15/20 1+/2+/3+
10/20 1+/2+/3+ 15/20 1+/2+/3+
3/20 1+/2+/3+ 2/20 1+/3+
20/20 3+ 20/20 3+
20/20 1+/2+/3+ 20/20 1+/2+/3+
Squamous cell carcinomas (n = 20)
Note. 1+ < 15%-20%of the neoplastic population immunoreactive;2+ > 15%-20% < 50% of the neoplastic population immunoreactive; 3+ > 50% of the neoplastic population immunoreactive. subunits except for [31C, which was restricted to bronchial epithelium. In particular, [34 was strongly expressed in endothelial cells of capillary vessels, and [31 showed widespread localization in epithelial and mesenchymal elements. Both ot6A and ot6B were expressed in the endothelium of capillaries and large vessels. Bronchial and vascular smooth muscle was strongly stained for or3.
than of ADC (10 of 20) (Fig 6). No convincing correlation was f o u n d between the presence of or6 and grading of tumors. Both types of tumors expressed the ectodomain coupled predominantly with the a6A cytoplasmic domain; however, a minority of SCC and ADC coexpressed et6B (5 of 25).
I m m u n o h i s t o c h e r n i c a l Expression o f Integrins in S C C a n d A D C
Immunohistochemical Colocalizations o f 56 a n d 131 in S C C a n d A D C
T h e main findings are outlined in Table 4. We f o u n d strong and extensive basally polarized [34 immunoreactions in most SCC (17 of 20) (Fig 2), whereas in ADC, similarly polarized staining was p r e s e n t in a minority of cases (5 of 20). T h e r e was no correlations between the presence of this molecule and stage and grading of the tumors. Immunostaining for [31 was consistently and evenly distributed in SCC and ADC in an unpolarized pattern and involved neoplastic cells (40 cases, 3+). Reactions for ecto 0~3 were f o u n d in all SCC and ADC (40 of 40) (Fig 3); the localization of the or3 cytoplasmic domain A paralleled that of its extracellular counterpart (40 of 40) (Fig 4); however, in 30 of 40 cases it appeared restricted to a subset of cells reactive for the ectodomain ( < 3 + of immunoreactive cells). Alpha6 was present in fewer cases (25 of 40) than or3 and showed less extensive and intense immunoreactivity (40 of 40 cases, 3+ for ecto or3 v 14 of 25 cases 3+ for ecto or6). Immunoreactions with anti-or6 MAbs were observed in a higher n u m b e r of SCC (15 of 20) (Fig 5)
In SCC, immunoreactions with anti-ectoe~6 and anti-et6A were polarized in 5 of 20 (Fig 5) and not polarized in 10 of 20 cases (Fig 7A). These molecules were colocalized with [34 (5 of 20) (Fig 7B), paralleling the polarization present in normal bronchial structures, and with both [34 and [31 (10 of 20), at the cell/stroma and at the cell/cell interfaces, respectively (Fig 7C). Thus, the colocalization of or6 and [31 at the cell/cell interface in these carcinomas represents a de novo pattern of expression. In those ADC expressing ecto or6 and cytoc~6A (10 of 20), these were exclusively associated with [31 in five cases that were negative for [34. The remaining five cases expressed ectoot6/cyto ot6A either polarized (two cases) or not polarized (three cases), that is, colocalized with either [34 parallelling the polarization present in normal bronchi, or with both 131 and [34, at the cell~cell and the cell/stroma interface, respectively.
FIGURE 2. Pulmonary SCC immunostained for !84. Strong, basally polarized staining is noted in several adjacent neoplastic clusters. (Original magnification x200.)
FIGURE 3. Pulmonary ADC immunostained for the ectodomain of e3. Basally polarized and cell-cell reactions are evident in multilayered glands but the former are more conspicuous. (Original magnification x200.)
1211
HUMAN PATHOLOGY
Volume29, No. 11 (November 1998)
FIGURE 4. Pulmonary ADC immunostained for the cytodomain A of ~3. Reaction overlaps that of Fig 3; however, fewer luminal cells are stained. (Original magnification ×200.) Correlations Between Ki-67 a n d [31c in SCC a n d A D C
Staining for [31C was heterogeneous (Fig 8); it ranged from scattered cells (1+) to more than 50% of the neoplastic population with a nonpolarized pattern of staining, involving either the cell membrane or membrane and cytoplasm (3 +). In addition, an inverse correlation was found between [31C and Ki-67. Indeed, most tumors showing 30% or more of neoplastic cells positive for Ki-67 were those showing low (-+) [31c expression and vice versa (P = .006, chi-squared test). Moreover, occasional areas showed a distinct, inverse relationship between low Ki67 immunoreactivity and high [31C expression. I m m u n o p r e c i p i t a t i o n of 0~6131 in Neoplastic Tissue
Samples of cases showing immunohistochemical colocalization of et6 and [31 chains underwent immunoprecipitation analysis. Immunoprecipitates of the supernatants with anti-human ecto or6 (J8H) were successfully
FIGURE 5. Pulmonary SCC immunostained for the ectodomain of ~6. Strong, basally polarized reaction is evident. (Original magnification x200.)
FIGURE 6. Pulmonary ADC immunostained for the cytodomain of c~6A. Basally polarized staining of neoplastic glands (and vascular endothelium) is noted. (Original magnification x200,)
probed with anti-J31 (AT29/12p38) monoclonal antibodies, confirming the linkage of the ~6 and [31 chains (Fig 9). RT-PCR SSCP Analysis of c~3 a n d ~6 C y t o p l a s m i c Domains in SCC a n d A D C
Samples of all cases and normal controls subjected to RT-PCR yielded cDNA for the oL6 and ~x3 cytoplasmic domains. The samples under study included small vessels and some bronchial smooth muscle, expressing or6 and cx3 cytoplasmic domains. Taking this factor into account, mutation analysis of 40 tumor samples detected no abnormal electrophoresis mobility shifts on polyacrylamide gels. Typical results of the SSCP band patterns are illustrated in Figure 10.
DISCUSSION The importance of laminin receptors during neoplastic progression has been extensively documented in the last decade, 1,~4-~6and most laminin receptors belong to the integrin family of cell adhesion receptors. 24 A number of reports have outlined variable modulations in integrin laminin receptor profiles in carcinomas of various primary sites, s,10-1~,15-17 However, there are only limited data on the expression of these molecules in lung carcinomas. 7,374° In this study, our aim was to investigate systematically the expression of laminin receptors of the integrin family in lung carcinomas of squamous and glandular differentiation. We found predominance of a3 over e~6 and of e~6A over et6B, ot6[~l cell/cell tumor-specific localization in a subset of cases, and an inverse correlation between the expression of [31C and Ki-67. No mutations of the ~3 and or6 cytoplasmic domains were detected. Preponderance of e~3 over 0~6 was noted in SCC as well as ADC; interestingly, no difference in integrin expression was observed in relation to different clinicopathologic stages. As our data on integrin laminin receptors in lung carcinomas are compared with their counterparts in
1212
INTEGRiN LAMININ RECEPTORS IN LUNG CARCINOMAS (Patriarca et al)
FIGURE 7. (A) Pulmonary SCC immunostained for the ectodomain of G6. Similarly strong, basal, and ceil-cell reactions are noted (Original magnification x200); (B) Pulmonary SCC immunostained for IM (deep section from same block as A). Note exclusively, basally polarized reaction (Original magnification x200); (C) Pulmonary SCC immunostained for 131 (deeper section from same block as A and B), Strong, basally polarized, and cell-cell reactions are evident; staining also involves nonneoplastic stromal elements (S), (Original magnification x200.)
other tumor systems, it would appear that an et3/ot6 balance could play a role in the variable metastatic behavior of neoplastic cells of different primary sites. Particularly notable appears to be the role of ~3 (laminin promiscous receptor) over e~6 (lamininspecific receptor) as it emerges consistently in tumors with m o r e precocious and often widespread metastatic properties, such as lung, 7,37 kidney, 12,16 and ovary.41 Conversely, in tumors with somewhat more restricted or
selective (lymphatic), and often sluggish metastatic proclivities, e¢6 is often p r e d o m i n a n t over et3, for example, c o l o n 11,14,16 and e n d o m e t r i u m carcinomas. 15 Similarly, the ecto ot6/cytoA/[31 p r e d o m i n a n c e over ecto ~6/cytoB/[M underscores the same concept. Indeed, in less aggressive carcinomas, p r e d o m i n a n c e of ot6B was reported. 16 Interestingly, in experiments in vitro, ot6A/[31 was shown to induce a migration capacity twice stronger than that induced by ot6B/[31. 23 In addition, in colon adenocarcinomas, e~6 expression is almost exclusively f o u n d toward the basal pole of the c~6A ¢~6A
a
FIGURE 8. Pulmonary SCC immunostained for 181C. Note heterogeneous reactions involving most cells in a neoplastic cluster. (Original magnification x 100.) 1213
b
FIGURE 9. Immunoblots with antibody to 181 of ~6A immunoprecipitated samples obtained from two SCC that were 184negative (lane a) and 184-positive (lane b), respectively; note virtually indistinguishable 181 reactions in both instances,
HUMAN PATHOLOGY N
N
M or3
T
N
Volume 29, No. 11 (November 1998)
T
~ M
,~6A
c~6B
FIGURE 10. SSCP analysis of a single ADC showing normal migration bands of tumor samples (T) as compared with normal controls (N) of a3, ~6A, and c~6Bcytoplasmic domains. Lack of mutations as noted in these samples were noted in all cases.
glands, 11,14hinting at a function of ot6/[M as a receptor. Conversely, in the tumors under study, we found three different situations: (1) ADC and SCC with c~6 coalignment with 134 (seven cases); (2) ADC and SCC with e~6 coalignment with 131 at the cell/cell interfaces (13 cases); (3) ADC not reactive with anti-[34, that is, with or6 expression exclusively [31 linked (five cases). Coprecipitation analysis performed in cases belonging to groups 2 and 3 confirmed the association of a6 with ~1. Indeed, these cases (68% of the 0t6-positive cases) showed a partial or total switch from the hemidesmosome-associated laminin receptor (0t6/[34) of normal bronchial structures, 7,37 to the less structurally and spatially organized laminin receptor (ot6/131) of neoplastic populations. The notion of a switching p h e n o m e n o n is based also on the or6 preferential association with 134 as compared with [31. 24 This result highlights differences between lung carcinomas and other carcinomas where loss of polarization of [34 were described, s From the structural point of view, e~3 and e~6 seem to be present in an intact and potentially active form. The immunocytochemical analysis for the cytodomains failed to show the presence of truncated forms of these molecules. A weaker immunoreactivity of the e~3A cytoplasmic domain was often noted in our slides, possibly reflecting the low affinity of the MAb. More significantly, SSCP analysis did not show the presence of mutated forms of these molecules, suggesting that the contribution of mRNA coming from the neoplastic tissues to the bands migration was normal. Finally, the inverse correlation between [31C and Ki-67 suggests that integrins might become future parameters of prognostic relevance; notably, a similarly inverse correlation was recently reported in some breast carcinomas. 42 Comparatively few reports deal with integrin expression in lung carcinomas, and until recently none did so in a systematic way (for recent overview, see Koukoulis et a17). Damjanovich et a137 reported prevalence of ~x3 over or6 in some pulmonary carcinomas. Our data underscored that finding in SCC and ADC of the lung, and, most recently, in large cell carcinomas. 7 Notably, small cell and other neuroendocrine tumors of the lung differed significantly in integrin expression profile. 7,3s Integrins also differed significantly in pulmonary alveo-
lar cell carcinomas in which a1131 and c~3131 were consistently found, whereas or6 was consistently absent. 7 Moreover, the functional role of integrin expression in neuroendocrine carcinomas is partly reduced by molecules interfering with adhesive phenomena. 44 With regard to potential clinical impact, initial results on h u m a n neoplasms seemed to indicate that integrins were reduced in malignant tumors, and that this downregulation may partly explain their invasive and metastatic behavior, s,45-gsThis attractive and simple hypothesis may be operative in certain cases; however, subsequent data including our own underscored that the relationships between integrin expression and tumor invasion and metastasis are complex and diverse. This is illustrated by data indicating that "ectopic" subunits may emerge, as is the case with a5 in colloid breast carcinoma cells. 13 Somewhat subtler alterations may occur as exemplified by the topographically variable "switch" from 134 to 131 in the pulmonary SCC and ADC reported herein. Moreover, it has been noted that presumably " n o r m a l " integrin complements may promote rather than hinder invasion, as indicated by the concentration of 0L6 and [31 in "kinetopodia" of highly invasive lobular breast carcinomas, 13 and by in vitro data regarding [31 in gliomas. 49 Nevertheless, helpful differential diagnostic points have been accrued. Examples of the latter comprise the integrin profile shown by pleural mesotheliomas displaying exquisitely developed glands, which nevertheless differs consistently from that of most ADC4~; similarly, the integrin profile of pulmonary alveolar cell carcinomas differs from that of pulmonary and extrapulmonary ADC, indicating that the former are not simply a subset of the latter. 7 These complex and occasionally paradoxical data suggest that, although caution should be exercised in attempting to develop diagnostic criteria, further studies on integrins in tumors are likely to yield important information and improve our understanding of their biology.
Acknowledgment. The authors thank Robert Rey for photographical assistence.
REFERENCES 1. Aznavoorian S, Murphy AN, Stetler-Stevenson WG, et al: Molecular aspects of tumor cell invasion and metastasis. Cancer 71:1368-1383, 1993 2. Castronovo V: Laminin receptors and laminin-binding proteins during tumor invasion and metastasis. Invasion Metastasis 13:1-30, 1993 3. Hynes RO: Integrins: A family o f cell surface receptors. Cell 48:549-554, 1987 4. Sonnenberg A: Integrins and their ligands. Curt Top Microbiol Immunol 184:7-35, 1993 5. Ruoslahti E: Integrins.J Clin Invest 87:1-5, 1991 6. Volpes R, van den Oord.I], Desmet V: Integrins as differential cell lineage markers of primary liver tumors. Am J Pathol 142:14831492, 1993 7, Koukoulis Gig. Warren WH, Virtanen I, et al: Immunolocalization of integrins in the normal lung and in pulmonary carcinomas. HUM PATHOL28:1018-1025, 1997 8. Juliano RL, Varner JA: Adhesion molecules in cancer: The role ofintegrins. Curr Opin Cell Biol 5:812-818, 1993
1214
INTEGRIN LAMININ RECEPTORSIN LUNG CARCINOMAS (Patriarca et al) 9. Kramer RH, Vu MP, Cheng YF, et al: Laminin-binding integrin alpha 7 beta 1: Functional characterization and expression in normal and malignant melanocytes. Cell Regul 2:805-817, 1991 10. Bonkhoff H, Stein U, Remberger K: Differential expression of c~6 and eL2 very late antigen integrins in the normal hyperplastic, and neoplastic prostate: Simultaneous demonstration of cell surface receptors and their extracellular ligands. HUM PATHOL 24:243-248, 1993 11. Koretz K, Schlag P, Boumsell L, et al: Expression of VLA~2, VLA-a6 and VLA-[31 chains in normal mucosa and adenomas of the colon, and in colon carcinomas and their liver metastases. AmJ Pathol 138:741-750, 1991 12. Korhonen M, Laitinen L, Ylanne J, et al: Integrin distributions in renal cell carcinomas of various grades of malignancy. Am J Pathol 141:1161-1171, 1992 13. Koukoulis GK, Virtanen I, Korhonen M, et al: Immunohistochemical localization of integrins in the normal, hyperplastic, and neoplastic breast: Correlations with their functions as receptors and cell adhesion molecules. A m J Pathol 139:787-799, 1991 14. Koukoulis GK, Virtanen I, Moll R, et al: Immunolocalization of integrins in the normal and neoplastic colonic epithelium. Virchows Arch Pathol Anat 63:373-383, 1993 15. Lessey BA, Albelda S, Buck CA, et al: Distribution of integrin cell adhesion molecules in endometrial cancer. Am J Pathol 146:71% 726, 1995 16. Patriarca C, Ivanyi D, Fles D, et al: Distribution of extracellular and cytoplasmic domains of the e~3 and et6 integrin subunits in solid minors. I n t ] Cancer 63:182-189, 1995 17. Pignatelli M, Cardillo MR, HanbyA, et al: Integrins and their accessory adhesion molecules in mammary carcinomas: Loss of polarization in poorly differentiated tumors. HUM PATHOL 23:11591166, 1992 18. Hynes RO: Integrins: Versatility, modulation, and signaling in cell adhesion. Cell 69:11-25, 1992 19. Clark EA, Brugge JS: Integrins and signal transduction pathways: The road taken. Science 268:233-239, 1996 20. Schwartz MA: Signalingbyintegrins: Implications for tumorigenesis. Cancer Res 53:1503-1506, 1993 21. Yamada KM, Miyamoto S: Integrin transmembrane signaling and cytoskeletal control. Curr Opin Cell Biol 7:681-689, 1995 22. Hierk BP, Thorsteinsdottir S, Niessen CM, et al: Variants of the et6131 laminin receptor in early murine development: Distribution, molecular cloning and chromosomal localization of the mouse integrin ct6 subunit. Cell Adhes Commun 1:33-53, 1993 23. Shaw LM, Mercurio AM: Regulation of cellular interactions with laminin by integrin cytoplasmic domains: The A and B structural variants of tile a6131 integrin differentially modulate the adhesive strength, morphology, and migration of macrophages. Mol Biol Cell 5:679-690, 1994 24. Shaw LM, Chao C, Wewer UM, et al: Function of the integrin c~6131 in metastatic breast carcinoma cells assessed by expression of a dominant-negative receptor. Cancer Res 56:959-963, 1996 25. Languino LR, Ruoslahti E: An alternative form of the integrin [31 subunit with a variant cytoplasmic domain. J Biol Chem 267:7116-7120, 1992 26. Meredith J Jr, Takada Y, Fornaro M, et al: Inhibition of cell cycle progression by the alternatively spliced integrin [31C. Science 269:1570-1572, 1995 27. GerdesJ, Lemke H, Baisch H, et al: Cell cycle analysis of a cell proliferation associated human nuclear antigen defined by the monoclonal antibody Ki-67. J Immunol 133:1710-1715, 1984 28. Gould VE, Warren WH: Epithelial neoplasms of the lung, in RothJA, RuckdeschelJC, Weisenburger TH (eds) : Thoracic Oncology (ed 2). Philadelphia, PA, Saunders, 1995, pp 49-67
29. Hammar SP: Common neoplasms of the lung, in Dail DH, Hammar SP (eds): Pulmonary Pathology (ed 2). New York, NY, Springer-Verlag, 1994, pp 1123-1278 30. Koukoulis GK, RadosevichJA, Warren WH, et al: Immunohistochemical analysis of pulmonary and pleural neoplasms with monoclonal antibodies B72.3 and CSLEX-1. Virchows Arch Cell Pathol 58:42%433, 1990 31. de Melker AA, Sterk LMTh, Delwel GO, et al: The A and B a3 variants of the integrin subunit: Tissue distribution and functional characterization. Lab Invest 76:1-17, 1997 32. Fornaro M, Tallini G, Bofetiado CJM, et al: Down-regulation of [31C integrin, an inhibitor of cell proliferation, in prostate carcinoma. AmJ Pathol 149:765-773, 1996 33. Hsu SM, Raine L, Fanger H: Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: A comparison between ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem 29:577-580, 1981 34. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocynate-phenol-chloroform extraction. Anal Biochem 162:156-159, 1987 35. Wewer UM, Taraboletti G, Sobel ME, et al: Role of laminin receptor in tumor cell migration. Cancer Res 47:5691-5698, 1987 36. Zetter BR: Adhesion molecules in tumor metastasis. Cancer Biol 4:219-229, 1993 37. Damjanovich L, Albelda SM, Metre SA, et al: Distribution of integrin cell adhesion receptors in normal and malignant lung tissue. AmJ Respir Cell Mol Biol 6:19%206, 1992 38. Mariani Costantini R, Falcioni R, Battista P, et al: Integrin (e~6134) expression in human lung cancer as monitored by specific monoclonal antibodies. Cancer Res 50:610%6112, 1990 39. Pellegrini R, Martignone S, M~nard S, et al: Laminin receptor expression and function in small-cell lung carcinoma. IntJ Cancer 8:116-120, 1994 40. Smythe WR, LeBel E, BavariaJE, et al: Integrin expression in non-small cell carcinoma of the lung. Cancer Metast Rev 14:229-239, 1995 41. Skubitz APN, Bast RCJr, Wayner EA, et al: Expression of ~6 and [34 integrins in serous ovarian carcinoma correlates with expression of the basement membrane protein laminin. Am J Pathol 148:1445-1461, 1996 42. Di Bacco A, Viale G, Fornaro M, et al: Expression of [31C, an inhibitor of cell proliferation, in invasive breast carcinoma. Mod Patho110:17A, 1997 43. Koukoulis GK, ShenJ, Monson R, et al: Pleural mesotheliomas have an integrin profile distinct from visceral carcinomas. HUM PATHOL28:84-90, 1997 44. Patriarca C, Pruneri G, Alfano RM, et al: Polysialylated N-CAM, chromogranin A and B, and secretogranin II in neuroendocrine tumours of the lung. Virchows Arch 430:455-460, 1997 45. KnoxJD, Cress AE, Clark V, et al: Differential expression of extracellular matrix molecules and c~6-integrins in the normal and neoplastic prostate. AmJ Pathol 145:167-174, 1994 46. Pignatelli M, Smith MEF, Bodmer WF: Low expression of collagen receptors in moderate and poorly differentiated colorectal carcinomas. BrJ Cancer 61:636-638, 1990 47. Roussel E, Gingras MC, RoJY, et al: Loss o f a l b l and reduced expression of other [31 integrins and CAM in lung adenocarcinoma compared with pneumocytes.J Surg Onco156:198-208, 1994 48. Zutter MM, Mazoujian G, Santoro SA: Decreased expression of integrin adhesive protein receptors in adenocarcinoma of the breast. A m J Patho1137:863-870, 1990 49. Paulus W, Baur I, Beutler AS, et al: Diffuse brain invasion of glioma cells require [31 integrins. Lab Invest 75:819-826, 1996
1215