- Email: [email protected]
Integrin-linked kinase is dispensable for multiple myeloma cell survival
Leukemia Research 36 (2012) 1165–1171
Contents lists available at SciVerse ScienceDirect
Leukemia Research journal homepage: www.elsevier.com/locate/leukres
Integrin-linked kinase is dispensable for multiple myeloma cell survival Torsten Steinbrunn a , Daniela Siegmund b , Mindaugas Andrulis c , Evelyn Grella a , Martin Kortüm a , Hermann Einsele a , Harald Wajant b , Ralf C. Bargou a , Thorsten Stühmer a,∗ a b c
Department of Internal Medicine II, Comprehensive Cancer Center Mainfranken, University Hospital of Würzburg, Würzburg, Germany Department of Internal Medicine II, Division of Molecular Internal Medicine, University Hospital of Würzburg, Würzburg, Germany Institute of Pathology, University Hospital of Heidelberg, Heidelberg, Germany
a r t i c l e
i n f o
Article history: Received 30 December 2011 Received in revised form 19 April 2012 Accepted 12 May 2012 Available online 1 June 2012 Keywords: Multiple myeloma Integrin-linked kinase QLT0267
a b s t r a c t We investigated the utility of integrin-linked kinase (ILK) as a target for therapeutic intervention in multiple myeloma (MM). ILK (over-)expression was assessed in primary samples and MM cell lines, and the molecular and physiological consequences of siRNA-mediated ILK ablation were compared to treatment with the small molecule inhibitor QLT0267. Whereas ILK expression was ubiquitous, overexpression was only rarely observed in patient biopsies. ILK knockdown had no effect on the viability or survival pathway activity pattern of MM cells. Conversely, QLT0267 induced cell death in MM cell lines and most primary tumor samples via the intrinsic apoptotic pathway. Although this effect was largely tumor cell-specific it is unlikely to have been mediated via ILK. We conclude that ILK does not play a prominent role in the promotion or sustenance of established MM. © 2012 Elsevier Ltd. All rights reserved.
1. Introduction Multiple myeloma is a slow-growing plasma cell cancer situated in the bone marrow for which only few unifying molecular themes (e.g. cyclin D activation) have as yet emerged [1,2]. Extrinsic cues emanating from cells of the bone marrow microenvironment, such as cytokine- or contact-mediated signals, and intrinsic genetic features that lead to oncogenic deregulation provide a suitable backdrop for tumor propagation [3], although considerable heterogeneity exists with respect to the oncogenic pathways activated. Integrin-linked kinase (ILK) is a ubiquitously expressed cytosolic protein that binds to the 1 -integrin cytoplasmic domain [4], and which is involved in the coupling of adhesion- and growth factor receptor-mediated signals to downstream signaling cascades that promote growth and survival [5,6]. The function of ILK as an adaptor/scaffold protein [7] is uncontested. However, pronouncedly conflicting opinions exist regarding the status of ILK as either a serine/threonine kinase for substrates such as Akt and GSK3 or as a non-functional pseudokinase [8,9]. ILK has been implicated in apoptosis inhibition, tumorigenesis and tumor progression [10–12], but it has also been described as tumor suppressor [13,14], and its role may depend on the malignant entity investigated [15]. The role of ILK as a potential nodal signal integrator for microenvironmental
∗ Corresponding author at: Department of Internal Medicine II, Comprehensive Cancer Center Mainfranken, Versbacher Strasse 5, 97078 Würzburg, Germany. Tel.: +49 0 931 20136414; fax: +49 0 931 201636414. E-mail address: stuehmer [email protected] (T. Stühmer). 0145-2126/$ – see front matter © 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.leukres.2012.05.005
cues, as well as its possible function in survival pathway activation, are both of particular interest for its appraisal as therapeutic target in MM – a hitherto incurable disease that relies heavily on the tumor microenvironment for growth support and protection from chemotherapy [16]. Here, we have investigated the expression of ILK in primary MM cells and across a panel of MM cell lines, and tested the functional and molecular consequences of siRNAmediated ILK ablation versus treatment with the small molecule inhibitor QLT0267. Although the drug exerts specific cytotoxic activity against MM cells, the immunohistochemical and molecular ablation experiments do not lend support for an instrumental role of ILK in MM pathobiology. 2. Methods 2.1. Culture of MM cell lines, acquisition and preparation of primary MM cells Culture of MM cell lines and isolation and culture of CD138-positive primary MM cells and of primary bone marrow stromal cells (BMSCs) are detailed in Stühmer et al. [17]. MM cell lines were obtained from the DSMZ (Braunschweig, Germany), from LGC Biolabs ((MM.1s); Wesel, Germany), and from Prof. Martin Gramatzki ((INA-6); Kiel, Germany). Bone marrow aspirates from MM patients were obtained at the Universitätsklinikum Würzburg, Medizinische Klinik und Poliklinik II, after informed consent. Permission by the local ethics committee (Ethik-Kommission der Medizinischen Fakultät der Universität Würzburg; reference number 18/09) has been granted. Peripheral blood mononuclear cells (PBMCs) were purified from leukocyte concentrates freshly obtained from healthy donors at the Institut für Klinische Transfusionsmedizin und Hämotherapie (Würzburg, Germany). 2.2. Treatment with drugs The phenylazopyrazole compound QLT0267 (QLT Inc., Vancouver, Canada) [18] was provided as 40 mM stock solution in DMSO. Experiments with primary MM
1166
T. Steinbrunn et al. / Leukemia Research 36 (2012) 1165–1171
cells were not evaluated if the absolute survival measured for the control wells was below 35% (range: 39–85%; median: 62%). Caspase inactivation was performed with 50 M zVAD-fmk (PeptaNova, Sandhausen, Germany), added 15 min prior to drug addition. For long assays the caspase inhibitor was replenished after 16 h. 2.3. Apoptosis assay Annexin V-FITC- or annexin V-ATTO647-based apoptosis measurements were performed as described in Janz et al. [19]. 2.4. Polymerase chain reaction Amplification of ILK sequences was performed off dT18 -primed first strand cDNA synthesized from total RNA isolated from MM cell lines or CD138-purified primary MM cells as described before [20]. Primers AGCCAGTCATGGACACCGTG (spanning bases 222-241 of human ILK cDNA) and AGACTGGCAGGCACCTAG (spanning bases 777-760 of human ILK cDNA) were used in combination with Taq DNA polymerase in 35 cycles of denaturation at 94 ◦ C, annealing at 60 ◦ C and extension at 72 ◦ C (1 min steps each incl. ramp times) using a Primus 25 thermocycler (Peqlab Biotechnologie GmbH, Erlangen, Germany).
samples (n = 10) tested (Fig. 1A). Amplification of a diagnostic PCRproduct off dT18 -primed first strand cDNA in another 16 primary MM samples always yielded the expected band, confirming that ILK expression is a general feature of MM cells (data not shown). In situ staining for ILK protein in a total of 60 biopsies from the bone marrow of MM patients, however, yielded only a rather limited number of positive samples (6 out of 60; cut off value: 5% of tumor cells; two positive-scoring examples with peripheral staining, as well as two negative-scoring examples, shown in Fig. 1B), indicating that overexpression of ILK is not a prominent feature among primary MM cells. In addition, only one of 6 specimen with anaplastic plasma cells stained weakly positive for ILK, thus giving no indication for a correlation with dedifferentiated plasma cell features or function as progression marker. For good measure, we sequenced the complete coding region of ILK for 6 MM cell lines (AMO-1, INA-6, KMS-12-BM, MOLP-8, RPMI-8226, U266), which was always found to be wild-type.
2.5. Knockdown of ILK and electroporation of MM cell lines Oligonucleotides for RNAi (based on positions 591-611 of human ILK cDNA) [21] were purchased from Biozym Scientific (Hessisch Oldendorf, Germany) and annealed according to standard protocols. MM cells (either AMO-1, INA-6, KMS11, or MM.1s cells) were washed in PBS and resuspended in fresh, pure RPMI-1640 medium. Per electroporation between 1 × 107 and 1.5 × 107 cells were used (500 l volume, electrode distance 4 mm; settings: 950 F and 280 V (300 V for MM.1s)). Concentrations for the ILK siRNA-duplex ranged from 0.5 to 10 M. MM cells were cotransfected with an expression vector for EGFP (pEGFP-N3; 10 g/ml) to permit purification of the strongly transfected fraction by FACS-sorting. 2.6. Western analysis Cell lysis was performed in 30 mM Tris–HCl, 120 mM NaCl, 10% glycerol, 1% Triton X-100 (pH 7.0) supplemented with protease and phosphatase inhibitors (complete tablets (Roche Diagnostics, Mannheim, Germany) and phosphatase inhibitor cocktails I and II (Sigma–Aldrich)). For SDS/polyacrylamide gel electrophoresis the protein concentrations were either adjusted after the concentration was determined by Lowry assay, or, in the case of primary MM samples, which contained between 1 × 105 and 2 × 105 cells per tube, the whole lysate was used. Blotting on nitrocellulose membranes was followed by antibody staining after cutting the blots into appropriate strips for parallel staining of different antigens. Proteins of similar size or phosphorylated/unphosphorylated forms were always stained on blots derived from different gels. Antibodies against the following targets were used: -actin (Sigma–Aldrich; A5316), Akt (Cell Signaling Technology (CST), Frankfurt am Main, Germany; no. 9272), phospho-Akt (CST; no. 4058), Bid (CST; no. 2002), ERK1/2 (CST; no. 9102), phospho-ERK1/2 (CST; no. 9101), ILK (BD Biosciences; no. 611803), PARP-1 (Santa Cruz Biotechnology, Heidelberg, Germany; sc8007), STAT3 (CST; no. 9132), phospho-STAT3 (CST; no. 9131), ␣-tubulin (Biozol, Eching, Germany; no. 03568). Secondary antibodies specific for rabbit (111-036-045), mouse (115-036-003) or rat (112-036-062) were from Jackson ImmunoResearch Laboratories, Newmarket, UK. 2.7. Immunohistochemistry Bone marrow biopsies from 60 MM patients were analyzed for ILK expression by immunohistochemistry. Paraffin-embedded tissue sections were deparaffinized and boiled in a water bath for 20 min in TRS pH6.1 buffer (DakoCytomation) for antigen retrieval. An anti-ILK1 antibody (CST; no. 3862) was applied for 12 h at room temperature. Sections were washed three times in PBS and processed further with the LSAB2 Kit (DakoCytomation). DAB (3,3 -diaminobenzidine) was used as chromogen. The slides were counter-stained with hematoxylin (Merck), mounted with glycerol-gelatin (Merck) and images were collected with a BX51 light microscope (Olympus, Hamburg, Germany) equipped with a DP50 CCD camera (Olympus) and using cell∧ A software version 3.0 (Olympus).
3. Results 3.1. Expression of integrin-linked kinase in multiple myeloma cells Consistent with its purportedly ubiquitous presence in nonmalignant tissue Western blotting showed that ILK was expressed in all human MM cell lines (n = 12) and all purified primary MM
Fig. 1. ILK expression in multiple myeloma. (A) Western blot showing ILK protein expression in MM cell lines (top), and primary MM samples (bottom). (B) Two of the rare (6/60) examples of positive peripheral staining for ILK in areas heavily infiltrated with MM cells in paraffin sections from bone marrow biopsies of MM patients (top), as well as two negative-scoring examples (bottom). The intensely stained cells are megakaryocytes (calibration bar: 23 m).
T. Steinbrunn et al. / Leukemia Research 36 (2012) 1165–1171
1167
Fig. 2. Cytotoxicity of QLT0267. (A) Dose-effect curves (left) and EC50/90 values (right) for QLT0267-mediated cell death in MM cell lines. Annexin V-FITC/PI-staining followed by FACS analysis after 2 days treatment with the drug was used to generate the data for all kill curves. (B) Kill curves for selected primary MM samples (left) and sensitivity of primary MM samples (n = 31; closed circles) or PBMCs (n = 18; open circles) at 20 M QLT0267.
3.2. Treatment of multiple myeloma cells with QLT0267 We next evaluated the effect of QLT0267 – a phenylazopyrazole derivative that has been branded as an inhibitor of ILK – on MM cell viability. With 12 MM cell lines tested, the majority displayed steep kill curves with EC90 and/or EC50 values lower than 10 M, although 3 lines were clearly more resilient (MM.1s, OPM2, U266) and required up to 20 M QLT0267 even to reach EC50 (Fig. 2A). Similarly, kill curves for primary MM cells also reflected heterogeneity in the response toward QLT0267, with some primary samples effectively killed at 10 M and others barely affected even at up to 30 M of the drug (Fig. 2B). Using survival at 20 M as a benchmark to distinguish between sensitive and rather resilient MM cells, a larger cohort of primary samples (n = 31) was tested at this concentration (Fig. 2B). 19 samples (61%) displayed less than 40% survival (i.e. annexin V-negative cells with respect to DMSO-treated controls) whereas the rest was substantially less affected. The survival of PBMCs from healthy donors (n = 18) at 20 M QLT0267 was barely impaired, with decreases of between 5 and 15% in drug- vs DMSO-treated samples (Fig. 2B). The small decline was mostly attributable to the demise of the CD14-positive monocyte lineage (data not shown). Treatment of freshly seeded primary BMSCs (n = 8) for 2 days with 20 M QLT0267 abrogated proliferation, but left the cells viable and capable of resuming normal growth after the drug had been removed, as shown by BrdU incorporation assays (Suppl. Fig. S1A). At concentrations higher than 20 M BMSC adherence was impaired causing the cells to adopt a more globular shape. Such cells regained their flat appearance within hours after careful removal of the drug, indicating that this temporary effect of QLT0267 on BMSC adhesion was, at least initially, reversible (Suppl. Fig. S1B). 3.3. MM cell death induction by QLT0267 To better characterize the mechanism of QLT0267-mediated cell death in MM we recorded its time kinetics and determined the influence of pan-caspase inhibition with zVAD-fmk. Pronounced differences existed between the most sensitive (INA-6) and the most insensitive (MM.1s) cell line tested. INA-6 cells displayed a uniform shift to annexin-V positivity within just 3 h of treatment with 20 M QLT0267 and became PI-positive after about 12 h. Both effects were completely voided by simultaneous treatment with 50 M zVAD-fmk (Fig. 3B, only the pattern for the 6 h timepoints shown). After approximately 24 h the (replenished) caspase inhibitor ceased to be protective, indicating that non-caspasemediated cell death mechanisms prevailed (Fig. 3A). Conversely, treatment with 30 M QLT0267 had little immediate effect on
MM.1s cells, while there was a substantial increase in annexin VFITC- and PI-positive cells after 1 day. Abrogation of caspase activity was barely protective in MM.1s cells, suggesting a predominantly non-apoptotic cytotoxic mechanism of the drug in this cell line (Fig. 3A). Other MM cell lines enjoyed an intermediate protective effect of zVAD-fmk as represented by JJN-3 (Fig. 3A). Molecularly, the fast and coherent apoptosis induction by QLT0267 in INA-6 cells was accompanied by profound changes of proteins involved in the regulation of cell survival. Cleavage of PARP-1 and BID, both early apoptotic indicators, was virtually complete within a few hours (5 h timepoint shown, Fig. 3C). Whereas protein levels of signaling pathway components such as ERK1/2 and ILK remained unaffected, Akt protein (a target of activated caspases) disappeared. In contrast to strong but transient activation of ERK1/2 the signaling through STAT3 was fast and effectively abrogated (Fig. 3C). The phosphorylation levels of GSK3 showed a steady and substantial decline over time (Fig. 3C). With the exception of phospho-STAT3 and phospho-GSK3 depletion, all of these effects were voided by pre-treatment with zVAD-fmk, indicating that they were a consequence rather than a cause of caspase activity. To distinguish between the extrinsic (death receptor-mediated) and intrinsic (Bcl2 family member-mediated, mitochondria associated) apoptotic pathways [22] we compared apoptosis induction via QLT0267 and TRAIL in INA-6 cells stably transfected with either an expression vector for FLIPlong or the corresponding empty vector (pEGZ; Suppl. Fig. S2). The presence of FLIPlong completely blocked TRAIL-mediated cleavage of caspase 8 and thus activation of the extrinsic pathway (as well as, subsequently, of the intrinsic pathway [23]). However, no effect of FLIPlong was seen on apoptosis induction by QLT0267, which despite its fast and concerted course was thus not dependent on the extrinsic pathway. Processing of caspase-8 and BID is not in conflict with this conclusion, because in the course of cell death induction via the intrinsic pathway, caspase-8 is also activated by effector caspases [24]. A broader comparison of the apoptosis induction (PARP-1 cleavage) and phosphorylation patterns of phospho-Akt (Ser473) and phospho-GSK3 in MM cell lines after 6 h treatment with either 20 M or 30 M (MM.1s) QLT0267 (Fig. 3D) largely confirmed the link between PARP-1 cleavage and Akt depletion, which were both virtually complete in cell lines AMO-1 and INA-6 and quite pronounced in L363. The moderate to weak PARP-1 cleavage in cell lines JJN-3 and KMS-11 was not yet mirrored by an equivalent decrease in Akt, whereas both effects were essentially absent in the QLT0267-resilient and zVAD-fmk indifferent cell line MM.1s, which even after prolonged incubation times showed only limited cleavage of PARP-1 (data not shown). Treatment with QLT0267
1168
T. Steinbrunn et al. / Leukemia Research 36 (2012) 1165–1171
Fig. 3. QLT0267-mediated cell death in MM cells. (A) Time courses of QLT0267-induced toxicity. Sensitive cells (INA-6, JJN-3) displayed a fast apoptotic response, which precedes a caspase-independent mode of cell death more generally present in all MM cell lines. The strong initial cytotoxic effect of QLT0267 (20 M) in the sensitive MM cell lines was largely blocked by zVAD-fmk, whereas a higher concentration (30 M) of the drug was required to kill MM.1s cells and caspase inhibition had little effect. (B) Fast and efficient apoptosis induction by QLT0267 in INA-6 cells. After 6 h of treatment with 20 M QLT0267 all cells were positive for annexin V-FITC staining. This effect was strictly caspase-mediated and abrogated by pre-treatment with zVAD-fmk (50 M). Numbers denote the percentage of cells logged in the respective sector. (C) Western blots of survival pathway components and apoptotic markers in INA-6 cells treated with 20 M QLT0267 with or without pretreatment with zVAD-fmk. Composite figure from 3 blots derived from the same lysed samples. A single representative loading control staining for –actin is shown (derived from the blot that also yielded the P-ERK1/2, P-GSK3 and Akt signals). (D) Effects of 6 h treatment with 20 M QLT0267 (30 M for MM.1s cells) on PARP-1 and Akt cleavage, as well as phosphorylation patterns of GSK3 and Akt. Composite figure from 2 blots derived from one batch of lysed samples. The representative actin control shown is derived from the same blot that yielded the PARP-1 and Akt signals. Vertical separation and representation as two blocks for space reasons only.
T. Steinbrunn et al. / Leukemia Research 36 (2012) 1165–1171
entailed higher levels of Akt (Ser473) phosphorylation in the intrinsically phospho-Akt positive cell lines JJN-3, KMS-11 and MM.1s, although the apparent absence of phospho-Akt induction in the other MM cell lines could be a consequence of the partial (L363) or complete (INA-6, AMO-1) depletion of Akt. Phospho-GSK3 on the other hand was strongly (INA-6, JJN-3, KMS-11, MM.1s) or moderately (L363) downregulated after QLT0267 treatment in five MM cell lines, but unaffected in the weakly positive cell line AMO-1. 3.4. ILK knockdown in multiple myeloma cells In order to critically appraise the molecular effects seen with the pharmacological ILK inhibitor in MM cells, we performed RNAimediated ILK knockdown in the four MM cell lines for which our electroporation and purification protocols permit the isolation and analysis of bulk quantities of strongly transfected cells (INA6, AMO-1, KMS-11, MM.1s; exemplarily shown for INA-6 cells in
1169
Fig. 4A). This resulted in efficient ILK knockdown as assessed by Western blotting, with ILK depletion mostly achieved within 2 days and lasting at least until day 5 post-electroporation (Fig. 4C and data not shown). ILK knockdown turned out to be without effect on cell viability and proliferation in all 4 MM cell lines tested (Fig. 4A and B). Furthermore, none of the molecular effects of treatment with QLT0267 in INA-6 cells (such as cleavage of caspase substrates, activation of MAP kinases, decrease of phospho-GSK3) were visible in cells depleted of ILK (Fig. 4C). ILK knockdown also failed to influence (in either a positive or negative way) the level of phospho-Akt (Ser473) or phospho-GSK3 in KMS-11 and MM.1s cells (Fig. 4C and data not shown). Thus, ILK protein was dispensable for the survival of MM cells and did not appear to be the principal molecular mediator for the anti-MM activity of QLT0267. To that end, transient moderate overexpression of recombinant human ILK protein (either 5 -HA-tagged or the untagged version) in INA-6 cells did not change the time or concentration dependence of their apoptotic response to QLT0267 (Supplementary Fig. S3).
Fig. 4. ILK knockdown in MM cells. (A) INA-6 cells transfected with or without an ILK siRNA duplex and an expression vector for EGFP for subsequent FACS sorting of bright green cells. Shown are the transfection efficiency after one night in culture and before purification (left panel), the purified fraction after FACS sorting (middle left panel), the purified fraction after two further days in culture stained with annexin V-ATTO647/PI to mark apoptotic cells (middle right panel), and the GFP signal in the purified fraction after three days in culture (right panel). No differences between the two samples in the extent of apoptosis, nor in the decline of the GFP intensity (mainly a function of dilution through proliferation) is discernible. Double-digit numbers in the lower right quadrant denote the percentage of cells present. Italicized numbers denote the mean GFP intensity of the transfected cells. (B) Lack of apoptosis in MM cells with ILK knockdown, as assessed by staining with annexin V-ATTO647 3 days after transfection. (C) Molecular analysis of survival pathway components in ILK-depleted MM cells. ILK knockdown had no effect on protein or phosphorylation levels in INA-6 cells, nor did it affect Akt phosphorylation at position Ser473 in either MM.1s or KMS-11 cells.
1170
T. Steinbrunn et al. / Leukemia Research 36 (2012) 1165–1171
4. Discussion Multiple myeloma is a tumor entity that strongly relies on microenvironment-derived cues but whose cells often progressively acquire intrinsic features that render them less dependent on external regulation. Because ILK through its adaptor and/or signaling functions could potentially influence both of these aspects of MM tumor biology, we conducted a broader analysis of ILK expression in cells from MM patients and assessed the effects of small molecule ILK inhibitor QLT0267 and ILK knockdown in primary MM cells and MM cell lines. Similar to what has previously been observed in MM cell lines H929 and U266 [25], we observed a strong and fairly specific anti-MM effect of QLT0267 (see discussion further below). However, in marked contrast to the drug, siRNAmediated ILK depletion did not impair growth and survival of MM cell lines, nor did it recapitulate any of the molecular consequences instigated by QLT0267 in MM cell lines. Although the transfection methodology used to introduce the siRNA against ILK results but in transient knockdown, the applied purification protocol ensures selective enrichment of only the strongest transfected cells and results in profound depletion of ILK that lasts for several days. Such an effect is certainly long enough to reproduce drug-induced apoptotic effects that manifest themselves within 2–3 days (as we have shown, for example, in the demise of IL-6 dependent INA-6 cells after treatment with IL-6 receptor antagonist SANT-7 or STAT3 knockdown, respectively, using the same protocol as applied here [26]). Our results therefore indicate that ILK is unlikely to represent a therapeutic target for the treatment of multiple myeloma. It cannot be ruled out that primary MM cells in the context of their microenvironment might depend in a different way on ILK than MM cell lines. However, the rather weak staining for ILK of primary MM cells in situ (interpreted, similar to the situation with other ubiquitously expressed proteins, e.g. Hsp90, as an absence of overexpression), and the lack of correlation of the few positive-staining cases with severity of the disease, argue against such an assumption. It should also be noted that in our hands ILK knockdown in MM cell lines never affected the apparent levels of activity of any growth and survival pathways, as assessed by Western blotting (phosphoAkt, phospho-ERK1/2, phospho-GSK3, phospho-STAT3), nor did moderate overexpression of ILK change the sensitivity of INA-6 cells to QLT0267 in any respect. This complete lack of influence argues against a prominent role of ILK behaving as a potential survival kinase in MM cells. Since the MM cell lines used are at best semiadherent, no firm conclusions about any direct adhesion-mediated contribution via ILK to MM cell viability can be drawn. However, the knockdown experiments render it unlikely that MM cells in suspension (poster children for microenvironment-independent later stage disease forms) employ some intrinsic feature of ILK-mediated signaling that abolishes a need for microenvironment-derived cues, and that ILK is thus instrumental for disease spread or progression. Multiple publications are based on the use of QLT0267 as ILK inhibitor, although it has recently also been implicated as inhibitor of Flt3 [27] or in effects unconnected to ILK [28]. Our assessments would rather support the latter observations, although it is likely that the molecular activity of the drug (or the cellular reaction to the drug) varies considerably between different cancer entities. It is, for example, noteworthy, that in some MM cell lines a fast and comprehensive apoptosis induction via the intrinsic pathway is achieved. Such an action affects many growth and survival pathways, and because the extent to which it happens strongly varies between cell lines of even the same tumor entity it will also vary between different tumors, explaining some of the variability of effects described for this compound. However, whereas the majority of primary MM cells were driven into apoptosis by the drug, little effects on the survival of PBMCs (except for the CD14-positive fraction, which – in our hands – is consistently hit the hardest by a
variety of drugs) or on BMSCs were noted. In addition to the antiproliferative effect of the drug on BMSCs, and their – at least initially – reversible decrease in attachment described here, QLT0267 has been found to attenuate cytokine production from BMSCs [25]. Such effects might be particularly well suited to target the microenvironmental niche conducive for MM propagation. Collectively, these traits therefore offer tentative ideas in which ways phenylazopyrazoles could have an impact on MM therapy if their critical target(s) in MM cells and/or their microenvironmental consorts were identified. Conflict of interest statement The authors have no conflict of interest to report. Acknowledgments This work was supported by grants from the Deutsche Forschungsgemeinschaft (CRU 216), the José Carreras LeukämieStiftung (R/06/17) and the IZKF Würzburg (MD/PhD program). Contributions. T.Ste. performed and analyzed experiments, wrote paper, D.S. performed and analyzed experiments, E.G. performed experiments, M.A. performed and analyzed IHC analysis, M.K., H.E. provided patient samples, H.W. designed and analyzed experiments, wrote paper, R.C.B. designed experiments, T.Stü. designed and performed research, wrote paper. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.leukres. 2012.05.005. References [1] Bergsagel PL, Kuehl WM. Molecular pathogenesis and a consequent classification of multiple myeloma. J Clin Oncol 2005;23:6333–8. [2] Fonseca R, Bergsagel PL, Drach J, Shaughnessy J, Gutierrez N, Stewart AK, et al. International myeloma working group molecular classification of multiple myeloma: spotlight review. Leukemia 2009;23:2210–21. [3] Hideshima T, Mitsiades C, Tonon G, Richardson PG, Anderson KC. Understanding multiple myeloma pathogenesis in the bone marrow to identify new therapeutic targets. Nat Rev Cancer 2007;7:585–98. [4] Hannigan GE, Leung-Hagesteijn C, Fitz-Gibbon L, Coppolino MG, Radeva G, Filmus J, et al. Regulation of cell adhesion and anchorage-dependent growth by a new 1 -integrin-linked protein kinase. Nature 1996;379:91–6. [5] Hannigan G, Troussard AA, Dedhar S. Integrin-linked kinase: a cancer therapeutic target unique among its ILK. Nat Rev Cancer 2005;5:51–63. [6] Hehlgans S, Haase M, Cordes N. Signalling via integrins: implications for cell survival and anticancer strategies. Biochim Biophys Acta 2007; 1775:163–80. [7] Zhang Y, Chen K, Tu Y, Velyvis A, Yang Y, Qin J, et al. Assembly of the PINCH–ILK–CH–ILKBP complex precedes and is essential for localization of each component to cell-matrix adhesion sites. J Cell Sci 2002; 115:4777–86. [8] Hannigan GE, McDonald PC, Walsh MP, Dedhar S. Integrin-linked kinase: not so ‘pseudo’ after all. Oncogene 2011;30:4375–85. [9] Fukuda K, Knight JDR, Piszczek G, Kothary R, Qin J. Biochemical, proteomic, structural, and thermodynamic characterizations of integrin-linked kinase (ILK). J Biol Chem 2011;286:21886–95. [10] McDonald PC, Fielding AB, Dedhar S. Integrin-linked kinase – essential roles in physiology and cancer biology. J Cell Sci 2008;121:3121–32. [11] Sawai H, Okada Y, Funahashi H, Matsuo Y, Takahashi H, Takeyama H, et al. Integrin-linked kinase activity is associated with interleukin-1␣-induced progressive behavior of pancreatic cancer and poor patient survival. Oncogene 2006;25:3237–46. [12] Okamura M, Yamaji S, Nagashima Y, Yoshimoto N, Kido Y, Iemoto Y, et al. Prognostic value of integrin 1-ILK-pAkt signaling pathway in non-small cell lung cancer. Hum Pathol 2007;38:1081–91. [13] Hess F, Estrugo D, Fischer A, Belka C, Cordes N. Integrin-linked kinase interacts with caspase-9 and -8 in an adhesion-dependent manner for promoting radiation-induced apoptosis in human leukemia cells. Oncogene 2006;26:1372–84.
T. Steinbrunn et al. / Leukemia Research 36 (2012) 1165–1171 [14] Chen P, Shen W-Z, Karnik P. Suppression of malignant growth of human breast cancer cells by ectopic expression of integrin-linked kinase. Int J Cancer 2004;111:881–91. [15] Durbin AD, Somers GR, Forrester M, Pienkowska M, Hannigan GE, Malkin D. JNK1 determines the oncogenic or tumor-suppressive activity of the integrinlinked kinase in human rhabdomyosarcoma. J Clin Invest 2009;119:1558–70. [16] Mitsiades CS, Mitsiades NS, Richardson PG, Munshi NC, Anderson KC. Multiple myeloma. A prototypic disease model for the characterization and therapeutic targeting of interactions between tumor cells and their local microenvironment. J Cell Biochem 2007;101:950–68. [17] Stühmer T, Arts J, Chatterjee M, Borawski J, Wolff A, King P, et al. Preclinical antimyeloma activity of the novel HDAC-inhibitor JNJ-26481585. Br J Haematol 2010;149:529–36. [18] Troussard AA, McDonald PC, Wederell ED, Mawji NM, Filipenko NR, Gelmon KA, et al. Preferential dependence of breast cancer cells versus normal cells on integrin-linked kinase for protein kinase B/Akt activation and cell survival. Cancer Res 2006;66:393–403. [19] Janz M, Stühmer T, Vassilev LT, Bargou RC. Pharmacologic activation of p53-dependent and p53-independent apoptotic pathways in Hodgkin/ReedSternberg cells. Leukemia 2007;21:772–9. [20] Steinbrunn T, Stühmer T, Gattenlöhner S, Rosenwald A, Mottok A, Unzicker C, et al. Mutated RAS and constitutively activated Akt delineate distinct oncogenic pathways, which independently contribute to multiple myeloma cell survival. Blood 2011;117:1998–2004.
1171
[21] Troussard AA, Mawji NM, Ong C, Mui A, St. -Arnaud R, Dedhar S. Conditional knock-out of integrin-linked kinase demonstrates an essential role in protein kinase B/Akt activation. J Biol Chem 2003;278:22374–8. [22] Fulda S, Debatin K-M. Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene 2006;25:4798–811. [23] Krueger A, Baumann S, Krammer PH, Kirchhoff S. FLICE-inhibitory proteins: regulators of death receptor-mediated apoptosis. Mol Cell Biol 2001; 21:8247–54. [24] Engels IH, Stepczynska A, Stroh C, Lauber K, Berg C, Schwenzer R, et al. Caspase-8/FLICE functions as an executioner caspase in anticancer druginduced apoptosis. Oncogene 2000;19:4563–73. [25] Wang X, Zhang Z, Yao C. Targeting integrin-linked kinase increases apoptosis and decreases invasion of myeloma cell lines and inhibits IL-6 and VEGF secretion from BMSCs. Med Oncol 2011;28:1596–600. [26] Chatterjee M, Stühmer T, Herrmann P, Bommert K, Dörken B, Bargou RC. Combined disruption of both the MEK/ERK and the IL-6R/STAT3 pathways is required to induce apoptosis of multiple myeloma cells in the presence of bone marrow stromal cells. Blood 2004;104:3712–21. [27] Muranyi AL, Dedhar S, Hogge DE. Combined inhibition of integrin linked kinase and FMS-like tyrosine kinase 3 is cytotoxic to acute myeloid leukemia progenitor cells. Exp Hematol 2009;37:450–60. [28] Eke I, Leonhardt F, Storch K, Hehlgans S, Cordes N. The small molecule inhibitor QLT0267 radiosensitizes squamous cell carcinoma cells of the head and neck. PLoS One 2009;4:e6434.
Contents lists available at SciVerse ScienceDirect
Leukemia Research journal homepage: www.elsevier.com/locate/leukres
Integrin-linked kinase is dispensable for multiple myeloma cell survival Torsten Steinbrunn a , Daniela Siegmund b , Mindaugas Andrulis c , Evelyn Grella a , Martin Kortüm a , Hermann Einsele a , Harald Wajant b , Ralf C. Bargou a , Thorsten Stühmer a,∗ a b c
Department of Internal Medicine II, Comprehensive Cancer Center Mainfranken, University Hospital of Würzburg, Würzburg, Germany Department of Internal Medicine II, Division of Molecular Internal Medicine, University Hospital of Würzburg, Würzburg, Germany Institute of Pathology, University Hospital of Heidelberg, Heidelberg, Germany
a r t i c l e
i n f o
Article history: Received 30 December 2011 Received in revised form 19 April 2012 Accepted 12 May 2012 Available online 1 June 2012 Keywords: Multiple myeloma Integrin-linked kinase QLT0267
a b s t r a c t We investigated the utility of integrin-linked kinase (ILK) as a target for therapeutic intervention in multiple myeloma (MM). ILK (over-)expression was assessed in primary samples and MM cell lines, and the molecular and physiological consequences of siRNA-mediated ILK ablation were compared to treatment with the small molecule inhibitor QLT0267. Whereas ILK expression was ubiquitous, overexpression was only rarely observed in patient biopsies. ILK knockdown had no effect on the viability or survival pathway activity pattern of MM cells. Conversely, QLT0267 induced cell death in MM cell lines and most primary tumor samples via the intrinsic apoptotic pathway. Although this effect was largely tumor cell-specific it is unlikely to have been mediated via ILK. We conclude that ILK does not play a prominent role in the promotion or sustenance of established MM. © 2012 Elsevier Ltd. All rights reserved.
1. Introduction Multiple myeloma is a slow-growing plasma cell cancer situated in the bone marrow for which only few unifying molecular themes (e.g. cyclin D activation) have as yet emerged [1,2]. Extrinsic cues emanating from cells of the bone marrow microenvironment, such as cytokine- or contact-mediated signals, and intrinsic genetic features that lead to oncogenic deregulation provide a suitable backdrop for tumor propagation [3], although considerable heterogeneity exists with respect to the oncogenic pathways activated. Integrin-linked kinase (ILK) is a ubiquitously expressed cytosolic protein that binds to the 1 -integrin cytoplasmic domain [4], and which is involved in the coupling of adhesion- and growth factor receptor-mediated signals to downstream signaling cascades that promote growth and survival [5,6]. The function of ILK as an adaptor/scaffold protein [7] is uncontested. However, pronouncedly conflicting opinions exist regarding the status of ILK as either a serine/threonine kinase for substrates such as Akt and GSK3 or as a non-functional pseudokinase [8,9]. ILK has been implicated in apoptosis inhibition, tumorigenesis and tumor progression [10–12], but it has also been described as tumor suppressor [13,14], and its role may depend on the malignant entity investigated [15]. The role of ILK as a potential nodal signal integrator for microenvironmental
∗ Corresponding author at: Department of Internal Medicine II, Comprehensive Cancer Center Mainfranken, Versbacher Strasse 5, 97078 Würzburg, Germany. Tel.: +49 0 931 20136414; fax: +49 0 931 201636414. E-mail address: stuehmer [email protected] (T. Stühmer). 0145-2126/$ – see front matter © 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.leukres.2012.05.005
cues, as well as its possible function in survival pathway activation, are both of particular interest for its appraisal as therapeutic target in MM – a hitherto incurable disease that relies heavily on the tumor microenvironment for growth support and protection from chemotherapy [16]. Here, we have investigated the expression of ILK in primary MM cells and across a panel of MM cell lines, and tested the functional and molecular consequences of siRNAmediated ILK ablation versus treatment with the small molecule inhibitor QLT0267. Although the drug exerts specific cytotoxic activity against MM cells, the immunohistochemical and molecular ablation experiments do not lend support for an instrumental role of ILK in MM pathobiology. 2. Methods 2.1. Culture of MM cell lines, acquisition and preparation of primary MM cells Culture of MM cell lines and isolation and culture of CD138-positive primary MM cells and of primary bone marrow stromal cells (BMSCs) are detailed in Stühmer et al. [17]. MM cell lines were obtained from the DSMZ (Braunschweig, Germany), from LGC Biolabs ((MM.1s); Wesel, Germany), and from Prof. Martin Gramatzki ((INA-6); Kiel, Germany). Bone marrow aspirates from MM patients were obtained at the Universitätsklinikum Würzburg, Medizinische Klinik und Poliklinik II, after informed consent. Permission by the local ethics committee (Ethik-Kommission der Medizinischen Fakultät der Universität Würzburg; reference number 18/09) has been granted. Peripheral blood mononuclear cells (PBMCs) were purified from leukocyte concentrates freshly obtained from healthy donors at the Institut für Klinische Transfusionsmedizin und Hämotherapie (Würzburg, Germany). 2.2. Treatment with drugs The phenylazopyrazole compound QLT0267 (QLT Inc., Vancouver, Canada) [18] was provided as 40 mM stock solution in DMSO. Experiments with primary MM
1166
T. Steinbrunn et al. / Leukemia Research 36 (2012) 1165–1171
cells were not evaluated if the absolute survival measured for the control wells was below 35% (range: 39–85%; median: 62%). Caspase inactivation was performed with 50 M zVAD-fmk (PeptaNova, Sandhausen, Germany), added 15 min prior to drug addition. For long assays the caspase inhibitor was replenished after 16 h. 2.3. Apoptosis assay Annexin V-FITC- or annexin V-ATTO647-based apoptosis measurements were performed as described in Janz et al. [19]. 2.4. Polymerase chain reaction Amplification of ILK sequences was performed off dT18 -primed first strand cDNA synthesized from total RNA isolated from MM cell lines or CD138-purified primary MM cells as described before [20]. Primers AGCCAGTCATGGACACCGTG (spanning bases 222-241 of human ILK cDNA) and AGACTGGCAGGCACCTAG (spanning bases 777-760 of human ILK cDNA) were used in combination with Taq DNA polymerase in 35 cycles of denaturation at 94 ◦ C, annealing at 60 ◦ C and extension at 72 ◦ C (1 min steps each incl. ramp times) using a Primus 25 thermocycler (Peqlab Biotechnologie GmbH, Erlangen, Germany).
samples (n = 10) tested (Fig. 1A). Amplification of a diagnostic PCRproduct off dT18 -primed first strand cDNA in another 16 primary MM samples always yielded the expected band, confirming that ILK expression is a general feature of MM cells (data not shown). In situ staining for ILK protein in a total of 60 biopsies from the bone marrow of MM patients, however, yielded only a rather limited number of positive samples (6 out of 60; cut off value: 5% of tumor cells; two positive-scoring examples with peripheral staining, as well as two negative-scoring examples, shown in Fig. 1B), indicating that overexpression of ILK is not a prominent feature among primary MM cells. In addition, only one of 6 specimen with anaplastic plasma cells stained weakly positive for ILK, thus giving no indication for a correlation with dedifferentiated plasma cell features or function as progression marker. For good measure, we sequenced the complete coding region of ILK for 6 MM cell lines (AMO-1, INA-6, KMS-12-BM, MOLP-8, RPMI-8226, U266), which was always found to be wild-type.
2.5. Knockdown of ILK and electroporation of MM cell lines Oligonucleotides for RNAi (based on positions 591-611 of human ILK cDNA) [21] were purchased from Biozym Scientific (Hessisch Oldendorf, Germany) and annealed according to standard protocols. MM cells (either AMO-1, INA-6, KMS11, or MM.1s cells) were washed in PBS and resuspended in fresh, pure RPMI-1640 medium. Per electroporation between 1 × 107 and 1.5 × 107 cells were used (500 l volume, electrode distance 4 mm; settings: 950 F and 280 V (300 V for MM.1s)). Concentrations for the ILK siRNA-duplex ranged from 0.5 to 10 M. MM cells were cotransfected with an expression vector for EGFP (pEGFP-N3; 10 g/ml) to permit purification of the strongly transfected fraction by FACS-sorting. 2.6. Western analysis Cell lysis was performed in 30 mM Tris–HCl, 120 mM NaCl, 10% glycerol, 1% Triton X-100 (pH 7.0) supplemented with protease and phosphatase inhibitors (complete tablets (Roche Diagnostics, Mannheim, Germany) and phosphatase inhibitor cocktails I and II (Sigma–Aldrich)). For SDS/polyacrylamide gel electrophoresis the protein concentrations were either adjusted after the concentration was determined by Lowry assay, or, in the case of primary MM samples, which contained between 1 × 105 and 2 × 105 cells per tube, the whole lysate was used. Blotting on nitrocellulose membranes was followed by antibody staining after cutting the blots into appropriate strips for parallel staining of different antigens. Proteins of similar size or phosphorylated/unphosphorylated forms were always stained on blots derived from different gels. Antibodies against the following targets were used: -actin (Sigma–Aldrich; A5316), Akt (Cell Signaling Technology (CST), Frankfurt am Main, Germany; no. 9272), phospho-Akt (CST; no. 4058), Bid (CST; no. 2002), ERK1/2 (CST; no. 9102), phospho-ERK1/2 (CST; no. 9101), ILK (BD Biosciences; no. 611803), PARP-1 (Santa Cruz Biotechnology, Heidelberg, Germany; sc8007), STAT3 (CST; no. 9132), phospho-STAT3 (CST; no. 9131), ␣-tubulin (Biozol, Eching, Germany; no. 03568). Secondary antibodies specific for rabbit (111-036-045), mouse (115-036-003) or rat (112-036-062) were from Jackson ImmunoResearch Laboratories, Newmarket, UK. 2.7. Immunohistochemistry Bone marrow biopsies from 60 MM patients were analyzed for ILK expression by immunohistochemistry. Paraffin-embedded tissue sections were deparaffinized and boiled in a water bath for 20 min in TRS pH6.1 buffer (DakoCytomation) for antigen retrieval. An anti-ILK1 antibody (CST; no. 3862) was applied for 12 h at room temperature. Sections were washed three times in PBS and processed further with the LSAB2 Kit (DakoCytomation). DAB (3,3 -diaminobenzidine) was used as chromogen. The slides were counter-stained with hematoxylin (Merck), mounted with glycerol-gelatin (Merck) and images were collected with a BX51 light microscope (Olympus, Hamburg, Germany) equipped with a DP50 CCD camera (Olympus) and using cell∧ A software version 3.0 (Olympus).
3. Results 3.1. Expression of integrin-linked kinase in multiple myeloma cells Consistent with its purportedly ubiquitous presence in nonmalignant tissue Western blotting showed that ILK was expressed in all human MM cell lines (n = 12) and all purified primary MM
Fig. 1. ILK expression in multiple myeloma. (A) Western blot showing ILK protein expression in MM cell lines (top), and primary MM samples (bottom). (B) Two of the rare (6/60) examples of positive peripheral staining for ILK in areas heavily infiltrated with MM cells in paraffin sections from bone marrow biopsies of MM patients (top), as well as two negative-scoring examples (bottom). The intensely stained cells are megakaryocytes (calibration bar: 23 m).
T. Steinbrunn et al. / Leukemia Research 36 (2012) 1165–1171
1167
Fig. 2. Cytotoxicity of QLT0267. (A) Dose-effect curves (left) and EC50/90 values (right) for QLT0267-mediated cell death in MM cell lines. Annexin V-FITC/PI-staining followed by FACS analysis after 2 days treatment with the drug was used to generate the data for all kill curves. (B) Kill curves for selected primary MM samples (left) and sensitivity of primary MM samples (n = 31; closed circles) or PBMCs (n = 18; open circles) at 20 M QLT0267.
3.2. Treatment of multiple myeloma cells with QLT0267 We next evaluated the effect of QLT0267 – a phenylazopyrazole derivative that has been branded as an inhibitor of ILK – on MM cell viability. With 12 MM cell lines tested, the majority displayed steep kill curves with EC90 and/or EC50 values lower than 10 M, although 3 lines were clearly more resilient (MM.1s, OPM2, U266) and required up to 20 M QLT0267 even to reach EC50 (Fig. 2A). Similarly, kill curves for primary MM cells also reflected heterogeneity in the response toward QLT0267, with some primary samples effectively killed at 10 M and others barely affected even at up to 30 M of the drug (Fig. 2B). Using survival at 20 M as a benchmark to distinguish between sensitive and rather resilient MM cells, a larger cohort of primary samples (n = 31) was tested at this concentration (Fig. 2B). 19 samples (61%) displayed less than 40% survival (i.e. annexin V-negative cells with respect to DMSO-treated controls) whereas the rest was substantially less affected. The survival of PBMCs from healthy donors (n = 18) at 20 M QLT0267 was barely impaired, with decreases of between 5 and 15% in drug- vs DMSO-treated samples (Fig. 2B). The small decline was mostly attributable to the demise of the CD14-positive monocyte lineage (data not shown). Treatment of freshly seeded primary BMSCs (n = 8) for 2 days with 20 M QLT0267 abrogated proliferation, but left the cells viable and capable of resuming normal growth after the drug had been removed, as shown by BrdU incorporation assays (Suppl. Fig. S1A). At concentrations higher than 20 M BMSC adherence was impaired causing the cells to adopt a more globular shape. Such cells regained their flat appearance within hours after careful removal of the drug, indicating that this temporary effect of QLT0267 on BMSC adhesion was, at least initially, reversible (Suppl. Fig. S1B). 3.3. MM cell death induction by QLT0267 To better characterize the mechanism of QLT0267-mediated cell death in MM we recorded its time kinetics and determined the influence of pan-caspase inhibition with zVAD-fmk. Pronounced differences existed between the most sensitive (INA-6) and the most insensitive (MM.1s) cell line tested. INA-6 cells displayed a uniform shift to annexin-V positivity within just 3 h of treatment with 20 M QLT0267 and became PI-positive after about 12 h. Both effects were completely voided by simultaneous treatment with 50 M zVAD-fmk (Fig. 3B, only the pattern for the 6 h timepoints shown). After approximately 24 h the (replenished) caspase inhibitor ceased to be protective, indicating that non-caspasemediated cell death mechanisms prevailed (Fig. 3A). Conversely, treatment with 30 M QLT0267 had little immediate effect on
MM.1s cells, while there was a substantial increase in annexin VFITC- and PI-positive cells after 1 day. Abrogation of caspase activity was barely protective in MM.1s cells, suggesting a predominantly non-apoptotic cytotoxic mechanism of the drug in this cell line (Fig. 3A). Other MM cell lines enjoyed an intermediate protective effect of zVAD-fmk as represented by JJN-3 (Fig. 3A). Molecularly, the fast and coherent apoptosis induction by QLT0267 in INA-6 cells was accompanied by profound changes of proteins involved in the regulation of cell survival. Cleavage of PARP-1 and BID, both early apoptotic indicators, was virtually complete within a few hours (5 h timepoint shown, Fig. 3C). Whereas protein levels of signaling pathway components such as ERK1/2 and ILK remained unaffected, Akt protein (a target of activated caspases) disappeared. In contrast to strong but transient activation of ERK1/2 the signaling through STAT3 was fast and effectively abrogated (Fig. 3C). The phosphorylation levels of GSK3 showed a steady and substantial decline over time (Fig. 3C). With the exception of phospho-STAT3 and phospho-GSK3 depletion, all of these effects were voided by pre-treatment with zVAD-fmk, indicating that they were a consequence rather than a cause of caspase activity. To distinguish between the extrinsic (death receptor-mediated) and intrinsic (Bcl2 family member-mediated, mitochondria associated) apoptotic pathways [22] we compared apoptosis induction via QLT0267 and TRAIL in INA-6 cells stably transfected with either an expression vector for FLIPlong or the corresponding empty vector (pEGZ; Suppl. Fig. S2). The presence of FLIPlong completely blocked TRAIL-mediated cleavage of caspase 8 and thus activation of the extrinsic pathway (as well as, subsequently, of the intrinsic pathway [23]). However, no effect of FLIPlong was seen on apoptosis induction by QLT0267, which despite its fast and concerted course was thus not dependent on the extrinsic pathway. Processing of caspase-8 and BID is not in conflict with this conclusion, because in the course of cell death induction via the intrinsic pathway, caspase-8 is also activated by effector caspases [24]. A broader comparison of the apoptosis induction (PARP-1 cleavage) and phosphorylation patterns of phospho-Akt (Ser473) and phospho-GSK3 in MM cell lines after 6 h treatment with either 20 M or 30 M (MM.1s) QLT0267 (Fig. 3D) largely confirmed the link between PARP-1 cleavage and Akt depletion, which were both virtually complete in cell lines AMO-1 and INA-6 and quite pronounced in L363. The moderate to weak PARP-1 cleavage in cell lines JJN-3 and KMS-11 was not yet mirrored by an equivalent decrease in Akt, whereas both effects were essentially absent in the QLT0267-resilient and zVAD-fmk indifferent cell line MM.1s, which even after prolonged incubation times showed only limited cleavage of PARP-1 (data not shown). Treatment with QLT0267
1168
T. Steinbrunn et al. / Leukemia Research 36 (2012) 1165–1171
Fig. 3. QLT0267-mediated cell death in MM cells. (A) Time courses of QLT0267-induced toxicity. Sensitive cells (INA-6, JJN-3) displayed a fast apoptotic response, which precedes a caspase-independent mode of cell death more generally present in all MM cell lines. The strong initial cytotoxic effect of QLT0267 (20 M) in the sensitive MM cell lines was largely blocked by zVAD-fmk, whereas a higher concentration (30 M) of the drug was required to kill MM.1s cells and caspase inhibition had little effect. (B) Fast and efficient apoptosis induction by QLT0267 in INA-6 cells. After 6 h of treatment with 20 M QLT0267 all cells were positive for annexin V-FITC staining. This effect was strictly caspase-mediated and abrogated by pre-treatment with zVAD-fmk (50 M). Numbers denote the percentage of cells logged in the respective sector. (C) Western blots of survival pathway components and apoptotic markers in INA-6 cells treated with 20 M QLT0267 with or without pretreatment with zVAD-fmk. Composite figure from 3 blots derived from the same lysed samples. A single representative loading control staining for –actin is shown (derived from the blot that also yielded the P-ERK1/2, P-GSK3 and Akt signals). (D) Effects of 6 h treatment with 20 M QLT0267 (30 M for MM.1s cells) on PARP-1 and Akt cleavage, as well as phosphorylation patterns of GSK3 and Akt. Composite figure from 2 blots derived from one batch of lysed samples. The representative actin control shown is derived from the same blot that yielded the PARP-1 and Akt signals. Vertical separation and representation as two blocks for space reasons only.
T. Steinbrunn et al. / Leukemia Research 36 (2012) 1165–1171
entailed higher levels of Akt (Ser473) phosphorylation in the intrinsically phospho-Akt positive cell lines JJN-3, KMS-11 and MM.1s, although the apparent absence of phospho-Akt induction in the other MM cell lines could be a consequence of the partial (L363) or complete (INA-6, AMO-1) depletion of Akt. Phospho-GSK3 on the other hand was strongly (INA-6, JJN-3, KMS-11, MM.1s) or moderately (L363) downregulated after QLT0267 treatment in five MM cell lines, but unaffected in the weakly positive cell line AMO-1. 3.4. ILK knockdown in multiple myeloma cells In order to critically appraise the molecular effects seen with the pharmacological ILK inhibitor in MM cells, we performed RNAimediated ILK knockdown in the four MM cell lines for which our electroporation and purification protocols permit the isolation and analysis of bulk quantities of strongly transfected cells (INA6, AMO-1, KMS-11, MM.1s; exemplarily shown for INA-6 cells in
1169
Fig. 4A). This resulted in efficient ILK knockdown as assessed by Western blotting, with ILK depletion mostly achieved within 2 days and lasting at least until day 5 post-electroporation (Fig. 4C and data not shown). ILK knockdown turned out to be without effect on cell viability and proliferation in all 4 MM cell lines tested (Fig. 4A and B). Furthermore, none of the molecular effects of treatment with QLT0267 in INA-6 cells (such as cleavage of caspase substrates, activation of MAP kinases, decrease of phospho-GSK3) were visible in cells depleted of ILK (Fig. 4C). ILK knockdown also failed to influence (in either a positive or negative way) the level of phospho-Akt (Ser473) or phospho-GSK3 in KMS-11 and MM.1s cells (Fig. 4C and data not shown). Thus, ILK protein was dispensable for the survival of MM cells and did not appear to be the principal molecular mediator for the anti-MM activity of QLT0267. To that end, transient moderate overexpression of recombinant human ILK protein (either 5 -HA-tagged or the untagged version) in INA-6 cells did not change the time or concentration dependence of their apoptotic response to QLT0267 (Supplementary Fig. S3).
Fig. 4. ILK knockdown in MM cells. (A) INA-6 cells transfected with or without an ILK siRNA duplex and an expression vector for EGFP for subsequent FACS sorting of bright green cells. Shown are the transfection efficiency after one night in culture and before purification (left panel), the purified fraction after FACS sorting (middle left panel), the purified fraction after two further days in culture stained with annexin V-ATTO647/PI to mark apoptotic cells (middle right panel), and the GFP signal in the purified fraction after three days in culture (right panel). No differences between the two samples in the extent of apoptosis, nor in the decline of the GFP intensity (mainly a function of dilution through proliferation) is discernible. Double-digit numbers in the lower right quadrant denote the percentage of cells present. Italicized numbers denote the mean GFP intensity of the transfected cells. (B) Lack of apoptosis in MM cells with ILK knockdown, as assessed by staining with annexin V-ATTO647 3 days after transfection. (C) Molecular analysis of survival pathway components in ILK-depleted MM cells. ILK knockdown had no effect on protein or phosphorylation levels in INA-6 cells, nor did it affect Akt phosphorylation at position Ser473 in either MM.1s or KMS-11 cells.
1170
T. Steinbrunn et al. / Leukemia Research 36 (2012) 1165–1171
4. Discussion Multiple myeloma is a tumor entity that strongly relies on microenvironment-derived cues but whose cells often progressively acquire intrinsic features that render them less dependent on external regulation. Because ILK through its adaptor and/or signaling functions could potentially influence both of these aspects of MM tumor biology, we conducted a broader analysis of ILK expression in cells from MM patients and assessed the effects of small molecule ILK inhibitor QLT0267 and ILK knockdown in primary MM cells and MM cell lines. Similar to what has previously been observed in MM cell lines H929 and U266 [25], we observed a strong and fairly specific anti-MM effect of QLT0267 (see discussion further below). However, in marked contrast to the drug, siRNAmediated ILK depletion did not impair growth and survival of MM cell lines, nor did it recapitulate any of the molecular consequences instigated by QLT0267 in MM cell lines. Although the transfection methodology used to introduce the siRNA against ILK results but in transient knockdown, the applied purification protocol ensures selective enrichment of only the strongest transfected cells and results in profound depletion of ILK that lasts for several days. Such an effect is certainly long enough to reproduce drug-induced apoptotic effects that manifest themselves within 2–3 days (as we have shown, for example, in the demise of IL-6 dependent INA-6 cells after treatment with IL-6 receptor antagonist SANT-7 or STAT3 knockdown, respectively, using the same protocol as applied here [26]). Our results therefore indicate that ILK is unlikely to represent a therapeutic target for the treatment of multiple myeloma. It cannot be ruled out that primary MM cells in the context of their microenvironment might depend in a different way on ILK than MM cell lines. However, the rather weak staining for ILK of primary MM cells in situ (interpreted, similar to the situation with other ubiquitously expressed proteins, e.g. Hsp90, as an absence of overexpression), and the lack of correlation of the few positive-staining cases with severity of the disease, argue against such an assumption. It should also be noted that in our hands ILK knockdown in MM cell lines never affected the apparent levels of activity of any growth and survival pathways, as assessed by Western blotting (phosphoAkt, phospho-ERK1/2, phospho-GSK3, phospho-STAT3), nor did moderate overexpression of ILK change the sensitivity of INA-6 cells to QLT0267 in any respect. This complete lack of influence argues against a prominent role of ILK behaving as a potential survival kinase in MM cells. Since the MM cell lines used are at best semiadherent, no firm conclusions about any direct adhesion-mediated contribution via ILK to MM cell viability can be drawn. However, the knockdown experiments render it unlikely that MM cells in suspension (poster children for microenvironment-independent later stage disease forms) employ some intrinsic feature of ILK-mediated signaling that abolishes a need for microenvironment-derived cues, and that ILK is thus instrumental for disease spread or progression. Multiple publications are based on the use of QLT0267 as ILK inhibitor, although it has recently also been implicated as inhibitor of Flt3 [27] or in effects unconnected to ILK [28]. Our assessments would rather support the latter observations, although it is likely that the molecular activity of the drug (or the cellular reaction to the drug) varies considerably between different cancer entities. It is, for example, noteworthy, that in some MM cell lines a fast and comprehensive apoptosis induction via the intrinsic pathway is achieved. Such an action affects many growth and survival pathways, and because the extent to which it happens strongly varies between cell lines of even the same tumor entity it will also vary between different tumors, explaining some of the variability of effects described for this compound. However, whereas the majority of primary MM cells were driven into apoptosis by the drug, little effects on the survival of PBMCs (except for the CD14-positive fraction, which – in our hands – is consistently hit the hardest by a
variety of drugs) or on BMSCs were noted. In addition to the antiproliferative effect of the drug on BMSCs, and their – at least initially – reversible decrease in attachment described here, QLT0267 has been found to attenuate cytokine production from BMSCs [25]. Such effects might be particularly well suited to target the microenvironmental niche conducive for MM propagation. Collectively, these traits therefore offer tentative ideas in which ways phenylazopyrazoles could have an impact on MM therapy if their critical target(s) in MM cells and/or their microenvironmental consorts were identified. Conflict of interest statement The authors have no conflict of interest to report. Acknowledgments This work was supported by grants from the Deutsche Forschungsgemeinschaft (CRU 216), the José Carreras LeukämieStiftung (R/06/17) and the IZKF Würzburg (MD/PhD program). Contributions. T.Ste. performed and analyzed experiments, wrote paper, D.S. performed and analyzed experiments, E.G. performed experiments, M.A. performed and analyzed IHC analysis, M.K., H.E. provided patient samples, H.W. designed and analyzed experiments, wrote paper, R.C.B. designed experiments, T.Stü. designed and performed research, wrote paper. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.leukres. 2012.05.005. References [1] Bergsagel PL, Kuehl WM. Molecular pathogenesis and a consequent classification of multiple myeloma. J Clin Oncol 2005;23:6333–8. [2] Fonseca R, Bergsagel PL, Drach J, Shaughnessy J, Gutierrez N, Stewart AK, et al. International myeloma working group molecular classification of multiple myeloma: spotlight review. Leukemia 2009;23:2210–21. [3] Hideshima T, Mitsiades C, Tonon G, Richardson PG, Anderson KC. Understanding multiple myeloma pathogenesis in the bone marrow to identify new therapeutic targets. Nat Rev Cancer 2007;7:585–98. [4] Hannigan GE, Leung-Hagesteijn C, Fitz-Gibbon L, Coppolino MG, Radeva G, Filmus J, et al. Regulation of cell adhesion and anchorage-dependent growth by a new 1 -integrin-linked protein kinase. Nature 1996;379:91–6. [5] Hannigan G, Troussard AA, Dedhar S. Integrin-linked kinase: a cancer therapeutic target unique among its ILK. Nat Rev Cancer 2005;5:51–63. [6] Hehlgans S, Haase M, Cordes N. Signalling via integrins: implications for cell survival and anticancer strategies. Biochim Biophys Acta 2007; 1775:163–80. [7] Zhang Y, Chen K, Tu Y, Velyvis A, Yang Y, Qin J, et al. Assembly of the PINCH–ILK–CH–ILKBP complex precedes and is essential for localization of each component to cell-matrix adhesion sites. J Cell Sci 2002; 115:4777–86. [8] Hannigan GE, McDonald PC, Walsh MP, Dedhar S. Integrin-linked kinase: not so ‘pseudo’ after all. Oncogene 2011;30:4375–85. [9] Fukuda K, Knight JDR, Piszczek G, Kothary R, Qin J. Biochemical, proteomic, structural, and thermodynamic characterizations of integrin-linked kinase (ILK). J Biol Chem 2011;286:21886–95. [10] McDonald PC, Fielding AB, Dedhar S. Integrin-linked kinase – essential roles in physiology and cancer biology. J Cell Sci 2008;121:3121–32. [11] Sawai H, Okada Y, Funahashi H, Matsuo Y, Takahashi H, Takeyama H, et al. Integrin-linked kinase activity is associated with interleukin-1␣-induced progressive behavior of pancreatic cancer and poor patient survival. Oncogene 2006;25:3237–46. [12] Okamura M, Yamaji S, Nagashima Y, Yoshimoto N, Kido Y, Iemoto Y, et al. Prognostic value of integrin 1-ILK-pAkt signaling pathway in non-small cell lung cancer. Hum Pathol 2007;38:1081–91. [13] Hess F, Estrugo D, Fischer A, Belka C, Cordes N. Integrin-linked kinase interacts with caspase-9 and -8 in an adhesion-dependent manner for promoting radiation-induced apoptosis in human leukemia cells. Oncogene 2006;26:1372–84.
T. Steinbrunn et al. / Leukemia Research 36 (2012) 1165–1171 [14] Chen P, Shen W-Z, Karnik P. Suppression of malignant growth of human breast cancer cells by ectopic expression of integrin-linked kinase. Int J Cancer 2004;111:881–91. [15] Durbin AD, Somers GR, Forrester M, Pienkowska M, Hannigan GE, Malkin D. JNK1 determines the oncogenic or tumor-suppressive activity of the integrinlinked kinase in human rhabdomyosarcoma. J Clin Invest 2009;119:1558–70. [16] Mitsiades CS, Mitsiades NS, Richardson PG, Munshi NC, Anderson KC. Multiple myeloma. A prototypic disease model for the characterization and therapeutic targeting of interactions between tumor cells and their local microenvironment. J Cell Biochem 2007;101:950–68. [17] Stühmer T, Arts J, Chatterjee M, Borawski J, Wolff A, King P, et al. Preclinical antimyeloma activity of the novel HDAC-inhibitor JNJ-26481585. Br J Haematol 2010;149:529–36. [18] Troussard AA, McDonald PC, Wederell ED, Mawji NM, Filipenko NR, Gelmon KA, et al. Preferential dependence of breast cancer cells versus normal cells on integrin-linked kinase for protein kinase B/Akt activation and cell survival. Cancer Res 2006;66:393–403. [19] Janz M, Stühmer T, Vassilev LT, Bargou RC. Pharmacologic activation of p53-dependent and p53-independent apoptotic pathways in Hodgkin/ReedSternberg cells. Leukemia 2007;21:772–9. [20] Steinbrunn T, Stühmer T, Gattenlöhner S, Rosenwald A, Mottok A, Unzicker C, et al. Mutated RAS and constitutively activated Akt delineate distinct oncogenic pathways, which independently contribute to multiple myeloma cell survival. Blood 2011;117:1998–2004.
1171
[21] Troussard AA, Mawji NM, Ong C, Mui A, St. -Arnaud R, Dedhar S. Conditional knock-out of integrin-linked kinase demonstrates an essential role in protein kinase B/Akt activation. J Biol Chem 2003;278:22374–8. [22] Fulda S, Debatin K-M. Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene 2006;25:4798–811. [23] Krueger A, Baumann S, Krammer PH, Kirchhoff S. FLICE-inhibitory proteins: regulators of death receptor-mediated apoptosis. Mol Cell Biol 2001; 21:8247–54. [24] Engels IH, Stepczynska A, Stroh C, Lauber K, Berg C, Schwenzer R, et al. Caspase-8/FLICE functions as an executioner caspase in anticancer druginduced apoptosis. Oncogene 2000;19:4563–73. [25] Wang X, Zhang Z, Yao C. Targeting integrin-linked kinase increases apoptosis and decreases invasion of myeloma cell lines and inhibits IL-6 and VEGF secretion from BMSCs. Med Oncol 2011;28:1596–600. [26] Chatterjee M, Stühmer T, Herrmann P, Bommert K, Dörken B, Bargou RC. Combined disruption of both the MEK/ERK and the IL-6R/STAT3 pathways is required to induce apoptosis of multiple myeloma cells in the presence of bone marrow stromal cells. Blood 2004;104:3712–21. [27] Muranyi AL, Dedhar S, Hogge DE. Combined inhibition of integrin linked kinase and FMS-like tyrosine kinase 3 is cytotoxic to acute myeloid leukemia progenitor cells. Exp Hematol 2009;37:450–60. [28] Eke I, Leonhardt F, Storch K, Hehlgans S, Cordes N. The small molecule inhibitor QLT0267 radiosensitizes squamous cell carcinoma cells of the head and neck. PLoS One 2009;4:e6434.