- Email: [email protected]
Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.elsevier.com/locate/he
Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate Saumya Srivastava a,1, Ashish Kumar a,1, Ashutosh Pandey b,1, Anjana Pandey a,*,1 a
Department of Biotechnology, Motilal Nehru National Institute of Technology Allahabad, Allahabad, 211004, Uttar Pradesh, India b Department of Chemistry, Motilal Nehru National Institute of Technology Allahabad, Allahabad, 211004, Uttar Pradesh, India
article info
abstract
Article history:
Bacillus licheniformis AP1 isolated from dairy waste cheese whey water possess pyruvate
Received 14 March 2017
formate lyase (PFL) and formate hydrogen lyase (FHL) enzyme gene which can hydrolyze
Received in revised form
pyruvate and formate to produce hydrogen under anaerobic conditions. Molecular charac-
14 June 2017
terization of this strain was done using 16rRNA gene sequencing. Phylogenetic tree was
Accepted 18 June 2017
formed on the basis of neighbor-joining method using MEGA5 which showed that no sig-
Available online xxx
nificant change occurred in 16s rRNA during the course of evolution. Biohydrogen production using this laboratory isolate was performed using pre-treated kitchen waste as
Keywords:
substrate at optimized pH 6.5 with yield of 12.29 ± 1.2 mmolH2/gCOD reduced. Effect of
Bacillus licheniformis
macronutrients and micronutrients were studied by varying concentrations on the hydrogen
Biohydrogen
production. Hydrogen production substantially increased from 14.10 ± 1.4 mmolH2/gCOD,
Kitchen waste
17.027 ± 1.7 mmolH2/gCOD, 17.029 ± 1.7 mmolH2/gCOD to 17.62 ± 1.8 mmol/gCOD reduced kitchen waste by B. licheniformis at optimized concentrations of edifferent metals like magnesium (MgCl2) 0.59 g/L, nitrogen (NH4Cl) 7 g/L, nickel (NiCl2) 180 mg/L, and iron (II) (FeSO4) 67 mg/L respectively. The optimized temperature for this process was found to be 34 ± 2 C with the maximal hydrogen yield of 17.62 ± 1.8 mmol/g COD reduced kitchen waste. The end fermentation metabolites detected were acetic acid, isobutyl acid, butyric acid, and pyruvic acid in the proportion of 3.75:1:1:1 under the optimized conditions in batch experiment (30 ml MGY media broth). These are the products of pyruvate-formate lyase enzyme complex that indicates the major electron flux towards formate during hydrogen production by B. licheniformis in hydrolyzed kitchen waste. © 2017 Hydrogen Energy Publications LLC. Published by Elsevier Ltd. All rights reserved.
Introduction Waste disposal is one of the major problems being faced by many nations across the world. In a study it was stated that
about 0.1 million tone of municipal solid waste is generated in India every day which leads to an annual production of approximately 36.5 million tons [1]. About 23% of Municipal solid waste is comprised of kitchen waste. It is a form of carbon rich organic waste (wet waste) composed mainly of
* Corresponding author. E-mail addresses: [email protected], [email protected] (A. Pandey). 1 Equal author contribution. http://dx.doi.org/10.1016/j.ijhydene.2017.06.140 0360-3199/© 2017 Hydrogen Energy Publications LLC. Published by Elsevier Ltd. All rights reserved. Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
2
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
carbohydrate, lipids and protein which can be utilized to produce pure hydrogen by biological route involving microorganisms. Many microbial strains like Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus subtilis and Enterococcus faecium are capable candidates towards the development of industrially relevant hydrogen producing inoculants. H2 is one of the most promising renewable energy resources which can be produced chemically as well as biologically. Chemical processes are very costly so biological methods by manipulating different genetic or environmental parameters of microbial strains are being studied by researchers to enhance yield and rate of biohydrogen production. Global energy consumption is expected to rise 56% by 2040 [2]; China and India driving the rate increase far more than the rest of the world because they are developing countries. Hydrogen can be produced from anaerobic microorganisms through fermentation or by chemical synthesis. Production of sustainable energy by genetically modified microorganism fed on waste material is very promising and novel approach to meet increasing demand of energy and can be a good substitute for non-renewable energy resources which are depleting day by day. Due to its simple operation method and high H2 production rate, fermentative H2 production is advantageous over other methods. Bala-Amutha and Murugesan reported hydrogen production through dark fermentation by using Bacillus licheniformis MSU AGM 2 strain as microorganism and corn stalk as substrate. Bacillus licheniformis MSU AGM 2 strain from alkaline pretreatment of paper mill effluents produced hydrogen under optimized conditions: carbon source 1 g/l, nitrogen source 12.5 g/l, pH (6.0) with 2% NaOH removed lignin by 48% from the corn stalk waste. Kinetic parameters analyzed in 1 L bioreactor showed the maximum hydrogen production and hydrogen yield with 185 ml/l and 82.5 ml/g substrate, respectively [3]. The effect of microwave irradiation pretreated cow dung compost on biohydrogen process from corn stalk by dark fermentation lead to the hydrogen yield of 144.3 ml/g-corn stalk and hydrogen production rate of 3.6 ml/g-corn stalk/h [4]. The ability of Bacillus coagulans strain IIT-BT S1 isolated from anaerobically digested activated sewage sludge has been checked for producing H2 from glucose-based medium in different environmental parameters. H2 production initiated at mid-exponential phase of cell growth and in the stationary phase, production rate reached maximum. At an initial glucose concentration of 2% (w/v), pH 6.5, temperature 37 C, inoculum volume of 10% (v/v) and inoculum age of 14 h, maximal H2 yield i.e. 2.28 mol H2/mol glucose was noted [5]. Lab isolate Bacillus firmus NMBL-03 was estimated for biohydrogen production using carbohydrate rich waste material.1.29 ± 0.11 mol H2/mol reducing sugar was the maximum yield obtained [6]. In another study, enzymatic hydrolysis of food waste was investigated for biohydrogen production. In the batch system, the maximum cumulative hydrogen production of 5850 mL was reached with a yield of 245.7 mL hydrogen/g glucose (1.97 mol hydrogen/mol glucose). The effect of hydraulic retention time (HRT) on biohydrogen production from food waste hydrolysate had been investigated in the continuous system. The optimal HRT that obtained from this study was 6 h with the highest hydrogen
production rate of 8.02 mmol/(h L) [7]. Continuous dark fermentative hydrogen production can be improved by shortening the retention time before wash out of hydrogen producing biomass [8]. B. licheniformis is a soil gram positive, thermophilic bacterium. It can withstand alkaline condition with optimal growth temperature of 30C. Bacillus licheniformis is a facultative anaerobe having pyruvate formate lyase (PFL) and formate hydrogen lyase (FHL) enzyme gene which can hydrolyze pyruvate and formate to produce hydrogen which is a good source of renewable energy because on reaction with oxygen it produces water. In cytoplasm formate is oxidized by FHL complex to produce hydrogen. Hydrogen ion (Hþ) is produced from formate by the formate hydrogenase lyase system (FHL), an intracellular membrane-bound complex. Components of which are produced by the hyc operon. Formate dehydrogenase H(fdhF) converts formate to 2Hþ, 2e, and CO2. Hydrogenase 3(Hyd3), encoded by hycE and hycG, synthesizes molecular hydrogen from 2Hþ and 2e [9]. Electron carriers present in FHL complex reduced by 2e generated by oxidation of HCOO and finally reduces Hþ to generate H2. Two types of hydrogenases (Hyd) are discovered in nature named as Hup and Hox. Hup directs unidirectional uptake of H2 mainly comes under hydrogenase 1 and 2 and genetic modification of Hup which is a H2 uptake gene, enhances biohydrogen production by 4e7 fold [10]. In this study, an effective strategy for the maximized hydrogen production was focused by physicochemical optimization of pretreated kitchen waste suitable for Bacillus licheniformis AP1.
Materials and methods Isolation and enrichment of microorganism from dairy industry waste water The waste water sample was collected from dairy industry. The sample was first serially diluted with distilled water upto 108 dilution to decrease the cell density per unit to get single pure cell colonies. 100 ml of diluted sample was spread over Luria agar plate with the help of sterilized spreader. Single colony from well grown plate was taken and streaked over fresh Luria Bertini agar plate with the help of flame sterilized inoculating loop to get pure culture to be further used as inoculum and named PTH-2-S (Parag dairy Thermophilic Heterotroph -2-Small colony).
16s rRNA gene sequencing and phylogenetic analysis 16s rRNA gene sequence of the purified culture was amplified by using universal primers from genomic DNA of purified culture using modified Marmur's method. Phylogenetic analysis was performed by ClustalW and MEGA5 softwares.
Collection and pre-treatment optimization of kitchen waste The kitchen waste was collected from student mess of Motilal Nehru National Institute of Technology Allahabad (India). 7% v/v, 1.5% v/v, 2% v/v, 2.5% v/v of H2SO4 was used for the
Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
optimization of acid hydrolysis of kitchen waste for maximum hydrogen production. 15 ml of 1% (w/v) kitchen waste was taken in falcon tubes (50 ml) added with 0.7% v/v, 1.5% v/v, 2% v/v, 2.5% v/v concentration of H2SO4 in triplicate and were autoclaved for 1 h 45 min at 121 C and 15 psi pressure. In order to optimize pH, each type of acid hydrolysate of kitchen waste was adjusted at 6, 6.5 and 7.5 pH and used as substrate for hydrogen production in 30 ml working volume. All the four setups were as follows: 0.7% v/v, 1.5% v/v, 2% v/v and 2.5% v/v of H2SO4 at the above mentioned pH.
3
Optimization of various other physicochemical factors i.e. macronutrients, micronutrients and temperature was done. Effect of temperature was studied at 28 C, 34 C, 35 C, 37 C and 40 C. Effect of ammonium chloride and magnesium chloride was assessed at concentrations of 0.59 g/L, 0.88 g/L, 1.18 g/L, 1.47 g/L and 7 g/L, 9 g/L, 10 g/L, 10.5 g/L respectively. Similarly, optimization of iron and nickel concentration were done at 27 mg/L, 53 mg/L, 67 mg/L, 200 mg/L and 88 mg/L, 180 mg/L, 260 mg/L, 350 mg/L, 400 mg/L, 700 mg/L respectively.
Analytical methods Optimization of growth conditions for hydrogen production All the experiments were performed in autoclaved serum bottles (50 ml). The cultures were made anaerobic by sparging nitrogen gas for 1 min (50 ml/min). Modified MGY media was used for hydrogen production by the isolated microorganism and its composition is as follows: hydrolyzed kitchen waste as carbon source, yeast extract 4 g/L, vitamin solution 510 mg/L, Macronutrient composition: NH4Cl (8.1 g/L), KH2PO4 (9.4 g/L), K2HPO4 (19.3 g/L), NaCl (0.4 g/L), CaCl2$2H2O (0.5 g/L), MgCl2$6H2O (0.93 g/L), Micronutrient composition: FeSO4$2H2O (13.9 mg/L), NiCl2$6H2O (60 mg/L), NaMoO4 (90 mg/L), CoCl2$6H2O (200 mg/L), MnCl2$4H2O (300 mg/L).
The bacterial cell concentration was measured at 660 nm by using UVevisible spectrophotometer (Agilent Technologies). Gaseous content was analyzed with gas chromatograph (Agilent 7890) equipped with a thermal conductivity detector and a capillary column (HPPLOT/Q Catalogue No. 19091P-QO4) where nitrogen gas was used as carrier gas at a flow rate of 20 ml/min. The operating temperature of the oven temperature was adjusted at 90 C, while injector and detector temperature were 80 C and 110 C, respectively. GC was also used for measuring end metabolites using nitrogen gas as a mobile phase at a flow rate of 1.3 ml/min while the temperatures for injector, oven, detector were kept at 250 C, 110 C, 250 C
Fig. 1 e Pyruvate formate lyase (PFL) holds a vital role in the anaerobic glucose metabolism of E. coli which catalyses the nonoxidative cleavage of pyruvate to acetyl-CoA and formate and uses a radical mechanism to effect the reversible transformation of pyruvate and Coenzyme A (CoA) to acetyl-CoA and formate. Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
4
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
Table 1 e BLASTn result sequences retrieved from NCBI server. Sequence description Bacillus sp. strain P2316S 16S ribosomal RNA gene, partial sequence Bacillus oryzaecorticis strain WJB61 16S ribosomal RNA gene, partial sequence Bacillus sp. DGG-1-3-F 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain YS65 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain RS12 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain Z11 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain P61 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain L13 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain C73 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain H7 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain FJAT-29133 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain HRBL-15TD17 complete genome Bacillus licheniformis strain 1-a-b-2 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain LOCK 1014 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain RJ48 16S ribosomal RNA gene, partial sequence
Max score
Total score
Query cover
E value
Identity
Accession no
2444
2444
94%
0.0
99%
KY084464.1
2444
2444
94%
0.0
99%
KU877642.1
2444
2444
94%
0.0
99%
KT325595.1
2444
2444
94%
0.0
99%
KU551256.1
2444
2444
94%
0.0
99%
KU551239.1
2444
2444
94%
0.0
99%
KU551215.1
2444
2444
94%
0.0
99%
KU551207.1
2444
2444
94%
0.0
99%
KU551158.1
2444
2444
94%
0.0
99%
KU551135.1
2444
2444
94%
0.0
99%
KX097970.1
2444
2444
94%
0.0
99%
KU983867.1
2444
2444
94%
0.0
99%
CP014781.1
2444
2444
94%
0.0
99%
KT715478.1
2444
2444
94%
0.0
99%
KT728845.1
2444
2444
94%
0.0
99%
KJ831075.1
respectively and sample injection volume of 5 ml. Further COD was estimated by standard APHA protocol (see Fig. 1).
Results and discussion Characterization and homology analysis of hydrogen producing isolates To identify related species, the primary sequence of PTH-2-S (GenBank accession number: SUB2416744 B. licheniformis
AP1KY681147) was searched for sequence similarities using BLASTn and found to be closely related to Bacillius licheniformis P23. All nucleotide sequences were retrieved in FASTA format from the NCBI database (Table 1) and multiple sequence alignments were performed with Clustal W. Three conserved regions are present in the 16s rRNA gene sequence: (GCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAG; CCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCACTAACC; AGAAAGCCACGGCTAACTAC). The phylogenetic tree was constructed by neighbor-joining method using Molecular Evolutionary Genetics Analysis (MEGA) 5 software. (Fig. 2). No
Fig. 2 e Phylogenetic tree constructed on the basis of 16S rRNA gene sequences using MEGA 5 software. Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
5
significant variation was found during the course of evolution. Though they belonged to the same species of microorganism, they differed by their genetic composition due to specific environment.
Optimization of pH and acid hydrolysis of kitchen waste Biohydrogen could be produced from organic wastes: food and beverage processing wastewater, restaurant food waste and raw starch waste. Effect of pH (4.5e7.0) on fermentative hydrogen production from food and beverage processing wastewater by sewage microflora was optimized [11]. The initial pH 6.5, condition favored hydrogen production (0.28 L/L) indicating that such parameters along with the wastewater characteristics were crucial to dark-fermentative hydrogen production. The present study aimed at understanding of the effects of important process attributes for fermentative hydrogen production from pretreated kitchen waste. The effect of extracellular pH on H2 production by B. licheniformis cultures is shown in Fig. 3. Hydrolysis of kitchen waste by 0.7% sulphuric acid released the maximum reducing sugar of 6.194 mmol/L. It is due to the formation of inhibitory products like furfurals and hydroxymethyl furfural which reduces the efficiency of fermentation processes which could inhibit hydrogen production at high concentration of acid treatment. A strong effect was observed on the hydrogen production, due to variation of enzymes activity at acidic pH. The maximum amount of hydrogen collected was 12.29 mmol/gCOD reduced using pretreated kitchen waste by Bacillus licheniformis at pH 6.5. In this study, the maximum yield of hydrogen (2.61 mol H2 per mol of reducing sugar) was observed at pH 6.5 with 0.7% H2SO4 treated kitchen waste (Fig. 3). In other studies pH range from 5.5 to 5.7 was found to give the highest hydrogen production [12].
Optimization of magnesium Magnesium is essential for the formation of Gram complex and cell division of the rod-shaped bacteria like Bacillus. Pretreated kitchen waste contained 268.66 mM concentration of magnesium therefore, addition of macronutrient components
Fig. 3 e Effect of pH and acid hydrolysis on hydrogen yield by Bacillus licheniformis using kitchen waste (1% w/v) as substrate (hold up values Inoculum volume: 12.9% v/v, Inoculum age: 16 h, Temperature: 34 C ± 2 C).
Fig. 4 e Effect of Magnesium chloride on hydrogen yield by Bacillus licheniformis using kitchen waste (1% w/v) as substrate (hold up values Inoculum volume: 12.9% v/v, Inoculum age: 16 h, Temperature: 34 C ± 2 C, pH: 6.5, acid hydrolysis: 0.7%v/v).
is vital for bacterial growth and adequate hydrogen production. Magnesium acts as cofactor for many enzymes in glycolytic pathway. Due to the accumulation of end metabolites, glycolytic pathway gets inhibited. Research results show that when magnesium ions concentration is maintained at 0.3 g/L, the unit volume production of hydrogen reaches at 256 ml/L [13]. The concentrations which were taken for the optimization study of Mg2þ as to improve the hydrogen production were as 0.59 g/L, 0.88 g/L, 1.18 g/L, 1.47 g/L of MgCl2. The maximum hydrogen production 14.1 mmol/gCOD reduced of kitchen waste by B. licheniformis was observed at 0.59 g/L concentration and the corresponding yield was 2.72 mol H2 per mol of reducing sugar (Fig. 4) whereas with at higher concentrations of magnesium the H2 yield decreased and the highest concentration of magnesium (1.47 g/L) used resulted in 2.49 mol H2 per mol of reducing sugar. The variations in the yields of H2 were observed to be concentration dependent thus inferring that 0.59 g/L is the optimized concentration for H2 production.
Optimization of nitrogen Nitrogen helps in synthesis of various essential amino acids. Ethanolamine used as a nitrogen source for the hydrogen production by Rhodobacter capsulatus ST-410, a hydrogenasedeficient mutant of the strain B-100. The ethanolamine supports cell growth as the sole nitrogen source and permits a large amount of hydrogen evolution [14]. However, based on response surface methodology (RSM), an optimized culture medium (OCM) was developed with 11.8 g/L of ammonium sulfate to maximize butanol (12.15 g/L) and hydrogen (3.29 L/L) production [15]. In our studies, NH4Cl was used as the nitrogen source which gave maximum response of hydrogen i.e. 17.02 mmol/g COD reduced of kitchen waste by B. licheniformis at 7 g/L concentration and the corresponding yield was 3.60 mol H2 per mol of reducing sugar (Fig. 5). With increase in concentration of NH4Cl the H2 production yield decreased in a concentration dependent manner, thus acquiring a lowest value of 2.88 mol H2 per mol of reducing sugar at highest concentration of 10.5 g/L.
Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
6
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
been observed in few studies that the effect of iron and nickel on continuous production of hydrogen gas in completely anaerobic stirred tank reactor.
Optimization of iron
Fig. 5 e Effect of Ammonium chloride on hydrogen yield by Bacillus licheniformis using kitchen waste (1% w/v) as substrate (hold up values Inoculum volume: 12.9%v/v, Inoculum age: 16 h, Temperature: 34 C ± 2 C, pH: 6.5, acid hydrolysis: 0.7% v/v Magnesium: 0.59 g/L, Iron: 67 mg/L).
Optimization of nickel Nickel acts as cofactor of various enzymes which helps in their activity. Nickel also affected hydrogen production. At temperature 35 C and initial pH 7.0, Ni2þ was able to enhance the biohydrogen production rate with increasing Ni2þ concentration from 0 to 0.2 mg/L and enhanced hydrogen production potential and hydrogen yield with increasing Ni2þ concentration from 0 to 0.1 mg/L. They found maximum hydrogen production potential of 288.6 ml and the maximum hydrogen yield of 296.1 ml/g glucose at the Ni2þ concentration of 0.1 mg/L. The pretreated substrate contained 2.52 mM concentration of nickel. Even though hydrogen yield was high with increased nickel concentration used in pretreated kitchen waste, however the maximum hydrogen production did not show the same trend on further increase in the nickel concentration due to the shift in metabolic pathway [16]. In current study nickel chloride (NiCl2) was used as nickel source. Maximum hydrogen production of 17.03 ± 1.7 mmol/g COD reduced of kitchen waste was obtained at 180 mg/L concentration of nickel chloride by B. licheniformis. The variations in H2 production at other concentrations of was observed to be concentration dependent and it was lower than the H2 yield at 180 mg/L. The corresponding molar yield was 3.60 mol H2/mol of reducing sugar (Fig. 6). Changes in metabolic products have
Fig. 6 e Effect of Nickel on hydrogen yield by Bacillus licheniformis using kitchen waste (1% w/v) as substrate (hold up values Inoculum volume: 12.9% v/v, Inoculum age: 16 h, Temperature: 34 C ± 2 C, pH: 6.5, acid hydrolysis: 0.7% v/v Magnesium: 0.59 g/L, Iron: 67 mg/L, ammonium chloride: 7 g/L).
Iron is a cofactor which helps in activity of various enzymes involved in hydrogen production process. Iron affects the fermentation pathways significantly increasing butyrate formation on increasing the iron concentrations. At concentration of 100 mg/L of ferrous ions, the production of biohydrogen was maximum (55 ± 0.58 ml with HPR of 5.729 ± 0.06 ml/L/h) during 24 h HRT, and at 48 h HRT 85 ± 0.58 ml of biohydrogen was produced with the HPR of 4.427 ± 0.03 ml/L/h. In our study, initially pretreated kitchen waste contained 133.42 ± 0.84 mM concentration of iron. Ferrous sulfate (FeSO4) was used as an iron source. We observed maximum hydrogen yield i.e. 17.62 mmol/gCOD reduced of kitchen waste at 67 mg/L iron concentration by B. licheniformis. The corresponding molar yield was 3.7360 mol H2 per mol of reducing sugar (Fig. 7). On further, increasing the concentrations of iron hydrogen production remains stable [16,17].
Optimization of temperature Temperature plays a key role in the production of hydrogen. Experimental results showed that increasing temperature from mesophilic (37 C) to thermophilic (55 C) was an effective mean for increasing bio-hydrogen production from food waste. Highest hydrogen yield of 18.78 (mmol/g COD reduced) from kitchen waste was obtained at 34 C (Fig. 8) [18,19].
Analysis of end metabolites End-metabolite production is directly related to the microbial metabolism which influenced the fermentation pathways [20,21]. The proportions of the end fermentation metabolites detected were 3.75:1:1:1 of acetic acid, isobutyl acid, butyric acid and pyruvic acid respectively under the optimized
Fig. 7 e Effect of Iron on hydrogen yield by Bacillus licheniformis using kitchen waste (1% w/v) as substrate (hold up values Inoculum volume: 12.9% v/v, Inoculum age: 16 h, Temperature: 34 C ± 2 C, pH: 6.5, acid hydrolysis: 0.7% v/v Magnesium: 0.59 g/L).
Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
7
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
Fig. 8 e Effect of temperature on hydrogen yield by Bacillus licheniformis using kitchen waste (1% w/v) as substrate (hold up values: Inoculum volume: 12.9% v/v, Inoculum age: 16 h, pH 6.5, acid hydrolysis: 0.7% v/v).
macronutrients nitrogen is more effective that magnesium for hydrogen production while among the micronutrients iron is more effective. For advancement of this field, more optimized physiochemical parameters can be used to see its effect on hydrogen production in the presence of different types of waste substrates. B. licheniformis was found to be the suitable candidate for fermentative hydrogen production using complex pretreated kitchen waste. Pretreatment and metabolism shift in favor of hydrogen generation were established under optimized process conditions. It can be concluded from the analysis of spent media samples that B. licheniformis followed pyruvate formate pathway to produce hydrogen from hydrolyzed kitchen waste because acetate was detected as the major end metabolites in all the batch experiments. These results could be of great significance for deducing the interaction between various influencing factors and for pilot scale studies to increase the hydrogen production using kitchen
Table 2 e Comparison between various microbes for COD reduction of waste. Microorganism(s) Ethanolamines harbinense C. saccharolyticus DSM 8903 Rhodopseudomonas palustris P4 E. coli NCIMB 11943 E. cloacae IIT-BT08 E. aerogenes HU-101 AY2 Citrobacter sp. Y19 C. acetobutylicum ATCC 824 C. bifermentans Thermotogaelfii Enterobacter sp. CN1 Halanaerobiumsenegalensis Escherichia coli (engineered) B. licheniformis MSU AGM 2 Bacillus licheniformis AP1
Substrate
Hydrogen yield
Reference
Activated sludge Grass (switch grass) Glucose Starch hydrolysate Glucose Glucose Glucose Glucose Wastewater sludge Glucose Xylose Glycerol Glucose Corn stalk Kitchen waste
256 ml H2/L glucose 11.2 mmol/g COD reduced 2.74 molH2/mol hexose or glucose 1.8 molH2/mol hexose or glucose 2.2 molH2/mol hexose or glucose 1.2 molH2/mol hexose or glucose 2.49 molH2/mol hexose or glucose 1.79 molH2/mol hexose or glucose 2.1 mmol/g COD reduced 3.33 molH2/mol hexose or glucose 2.0 molH2/mol xylose 1.21 molH2/mol hexose or glucose 1.82 molH2/mol hexose or glucose 82.5 ml/g substrate 17.62 mmol/g COD reduced
[13] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [3] This study
conditions in batch experiment (30 ml MGY media broth), which are the products of pyruvate formate lyase enzyme complex that indicates that the major electron flux was towards formate during hydrogen production in B. licheniformis by hydrolyzed kitchen waste.
waste. Many other types of complex waste can be used as a substrate for hydrogen production using this potent B. licheniformis. Thus the newly isolated B. licheniformis was found to exhibit higher hydrogen yield than the other strains in complex substrate utilization (Table 2). Hence, the results obtained could be used effectively in large scale hydrogen production.
Conclusion and future directions By applying facultative anaerobic Bacillus licheniformis to pretreated kitchen waste was best to be an effective strategy for the hydrogen production. This transpiring microbial pretreatment method accelerated hydrogen release. The optimized physicochemical parameters of the media were reported as pH 6.5, acid hydrolysis (H2SO4) 0.7% (v/v), magnesium chloride 0.59 g/L, ferrous sulfate 67 mg/L, ammonium chloride 7 g/L, nickel chloride 180 mg/L and temperature 34 C, which gives improved hydrogen production of 17.62 ± 1.8 mmol/g COD reduced (equivalent to molar yield of 3.7360 mol H2 per mol of reducing sugar) which is greater than other bacillus strains producing hydrogen from waste. From this finding it can also be concluded that among the
Acknowledgement The authors are highly thankful to Department of Biotechnology (DBT) (Ref. No. BT/PR8674/PBD/26/389/2013) for providing financial assistance.
references
[1] Kapdan IK, Kargi F. Bio-hydrogen production from waste materials. Elsevier Enzyme Microb Technol 2005;38:569e82.
Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
8
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
[2] Cortright RD, Davda RR, Dumesic JA. Hydrogen from catalytic reforming of biomass-derived hydrocarbons in liquid water. Nature 2002;418:964e7. [3] Bala-Amutha K, Murugesan AG. Biohydrogen production using corn stalk employing Bacillus licheniformis MSU AGM 2 strain. Renew energy 2013:621e7. [4] Song ZX, Wang ZY, Wu LY, Wei H. Effect of microwave irradiation pretreatment of cow dung compost on biohydrogen process from corm stalk by dark fermentation. Int J Hydrogen Energy 2012;37(8):6554e61. [5] Kotay SM, Das D. Microbial hydrogen production with Bacillus coagulans IIT-BT S1 isolated from anaerobic sewage sludge. Bioresour Technol 2007;98:1183e90. [6] Pandey A, Sinha P. Biohydrogen production from various feedstocks by Bacillus firmus NMBL-03. Int J Hydrogen Energy 2014;39:7518e25. [7] Wei H, Yan Y, Shi Y, Gu J, Tang J, Zhao H. Biohydrogen production from enzymatic hydrolysis of food waste in batch and continuous systems. Sci Rep 2016;6, 38395. [8] Sivagurunathan P, Kumar G, Bakonyi P, Kim SH, Kobayashi T, Xu KQ, et al. A critical review on issues and overcoming strategies for the enhancement of dark fermentative hydrogen production in continuous systems. Int J Hydrogen Energy 2016;41(6):3820e36. € ck A. The molecular biology of [9] Leonhartsberger S, Korsa I, Bo formate metabolism in Enterobacteria. J Mol Microbiol Biotechnol 2002;4(3):269e76. € hm R, Beier A, Bo € ck A. Characterization of [10] Lutz S, Bo divergent NtrA-dependent promoters in the anaerobically expressed gene cluster coding for hydrogenase 3 components of Escherichia coli. Mol Microbiol 2006:1365e2958. [11] Wongthanate J, Chinnacotpong K, Khumpong M. Impacts of pH, temperature and pretreatment method on biohydrogen production from organic wastes by sewage microflora. Int J Energy Environ Eng 2014;5:76. [12] Fang HHP, Liu H. Effect of pH on hydrogen production from glucose by a mixed culture. Bioresour Technol 2002;82:87e93. [13] Feng Y, Li GH, Mei HY, Zhang LS. The effect of magnesium ions on the hydrogen-producing bacteria in the water during the ecological restoration process. Adv Mater Res 2013;610e613:264e7. [14] Kalil MS, Alshiyab HS, Mohtar W, Yusoff W. Effect of nitrogen source and carbon to nitrogen ratio on hydrogen production using C. acetobutylicum. Am J Biochem Biotechnol 2008;4(4):393e401. [15] Rajagopalan G. Effect of nitrogen salts on butanol and hydrogen production from xylan by using Clostridium strain BOH3. J Appl Biotechnol Bioeng 2016;1:2. [16] Paul JS, Quraishi A, Thakur V, Jadhav SK. Effect of ferrous and nitrate ions on biological hydrogen production from dairy effluent with anaerobic waste water treatment process. Asian J Biol Sci 2014;7:165e71. [17] Yang H, Shen J. Effect of ferrous iron concentration on anaerobic bio-hydrogen production from soluble starch. Int J Hydrogen Energy 2006;31:2137e46. [18] Wang J, Wan W. Effect of temperature on fermentative hydrogen production by mixed cultures. Int J Hydrogen Energy 2008;33:5392e7.
[19] Yokoyama H, Waki M, Moriya N, Yasuda T, Tanaka Y, Haga K. Effect of fermentation temperature on hydrogen production from cow waste slurry by using anaerobic microflora within the slurry. Appl Microbiol Biotechnol 2007;74(2):474e83. [20] Yagi T, Ogata M. Catalytic properties of adenylylsulfate reductase from Desulfovibrio vulgaris Miyazaki. Biochimie 1996;78(10):838e46. [21] Amao Y. Photo induced biohydrogen production from biomass. Int J Mol Sci 2008;9:1156e72. [22] Talluri S, Raj SM, Christopher LP. Consolidated bio processing of untreated switchgrass to hydrogen by the extreme thermophile Caldicellulosiruptorsaccharolyticus DSM 8903. BioresourTechnol 2013;139:272e9. [23] Oh YK, Seol EH, Lee EY, Park S. Fermentative hydrogen production by a new chemoheterotrophic bacterium Rhodopseudomonaspalustris P4. Int J Hydrogen Energy 2002;27(11):1373e9. [24] Perego P, Fabiano B, Ponzano GP, Palazzi E. Experimental study of hydrogen kinetics from agro industrial by-product: optimal conditions for production and fuel cell feeding. Bioprocess Eng 1998:205e11. [25] Kumar N, Das D. Enhancement of hydrogen production by Enterobacter cloacae IIT-BT 08. Process Biochem 2000;35:589e93. [26] Rachman MA, Furutani Y, Nakashimada Y, Kakizono T, Nishio N. Enhanced hydrogen production in altered mixed acid fermentation of glucose by Enterobacteraerogenes. J Ferment Bioeng 1997;83(4):358e63. [27] Oh YK, Seol EH, Kim JR, Park S. Fermentative biohydrogen production by a new chemoheterotrophic bacterium Citrobacter sp. Y19. Int J Hydrogen Energy 2003;28(12):1353e9. [28] Oh SE, Zuo Y, Zhang H, Guiltinan MJ, Logan BE, Regan JM. Hydrogen production by Clostridium acetobutylicum ATCC 824 and megaplasmid-deficient mutant M5 evaluated using a large headspace volume technique. Int J hydrogen energy 2009;34(23):9347e53. [29] Wang CC, Chang CW, Chu CP, Lee DJ, Chang BV, Liao CS. Producing hydrogen from wastewater sludge by Clostridium bifermentans. J Biotechnol 2003;102(1):83e92. [30] Van Niel EWJ, Budde MAW, De Haas GG, Van der Wal FJ, Claassen PAM, Stams AJM. Distinctive properties of high hydrogen producing extreme thermophiles, Caldicellulosiruptorsaccharolyticus and Thermotogaelfii. Int J Hydrogen Energy 2002;27(11):1391e8. [31] Long C, Cui J, Liu Z, Liu Y, Long M, Hu Z. Statistical optimization of fermentative hydrogen production from xylose by newly isolated Enterobacter sp. CN1. Int J hydrogen energy 2010;35(13):6657e64. € A, Santala V, Karp M. Hydrogen production from [32] Kivisto glycerol using halophilic fermentative bacteria. Bioresour Technol 2010;101(22):8671e7. [33] Mathews J, Li Q, Wang G. Characterization of hydrogen production by engineered Escherichia coli strains using rich defined media. Biotechnol Bioprocess Eng 2010;15(4):686e95.
Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.elsevier.com/locate/he
Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate Saumya Srivastava a,1, Ashish Kumar a,1, Ashutosh Pandey b,1, Anjana Pandey a,*,1 a
Department of Biotechnology, Motilal Nehru National Institute of Technology Allahabad, Allahabad, 211004, Uttar Pradesh, India b Department of Chemistry, Motilal Nehru National Institute of Technology Allahabad, Allahabad, 211004, Uttar Pradesh, India
article info
abstract
Article history:
Bacillus licheniformis AP1 isolated from dairy waste cheese whey water possess pyruvate
Received 14 March 2017
formate lyase (PFL) and formate hydrogen lyase (FHL) enzyme gene which can hydrolyze
Received in revised form
pyruvate and formate to produce hydrogen under anaerobic conditions. Molecular charac-
14 June 2017
terization of this strain was done using 16rRNA gene sequencing. Phylogenetic tree was
Accepted 18 June 2017
formed on the basis of neighbor-joining method using MEGA5 which showed that no sig-
Available online xxx
nificant change occurred in 16s rRNA during the course of evolution. Biohydrogen production using this laboratory isolate was performed using pre-treated kitchen waste as
Keywords:
substrate at optimized pH 6.5 with yield of 12.29 ± 1.2 mmolH2/gCOD reduced. Effect of
Bacillus licheniformis
macronutrients and micronutrients were studied by varying concentrations on the hydrogen
Biohydrogen
production. Hydrogen production substantially increased from 14.10 ± 1.4 mmolH2/gCOD,
Kitchen waste
17.027 ± 1.7 mmolH2/gCOD, 17.029 ± 1.7 mmolH2/gCOD to 17.62 ± 1.8 mmol/gCOD reduced kitchen waste by B. licheniformis at optimized concentrations of edifferent metals like magnesium (MgCl2) 0.59 g/L, nitrogen (NH4Cl) 7 g/L, nickel (NiCl2) 180 mg/L, and iron (II) (FeSO4) 67 mg/L respectively. The optimized temperature for this process was found to be 34 ± 2 C with the maximal hydrogen yield of 17.62 ± 1.8 mmol/g COD reduced kitchen waste. The end fermentation metabolites detected were acetic acid, isobutyl acid, butyric acid, and pyruvic acid in the proportion of 3.75:1:1:1 under the optimized conditions in batch experiment (30 ml MGY media broth). These are the products of pyruvate-formate lyase enzyme complex that indicates the major electron flux towards formate during hydrogen production by B. licheniformis in hydrolyzed kitchen waste. © 2017 Hydrogen Energy Publications LLC. Published by Elsevier Ltd. All rights reserved.
Introduction Waste disposal is one of the major problems being faced by many nations across the world. In a study it was stated that
about 0.1 million tone of municipal solid waste is generated in India every day which leads to an annual production of approximately 36.5 million tons [1]. About 23% of Municipal solid waste is comprised of kitchen waste. It is a form of carbon rich organic waste (wet waste) composed mainly of
* Corresponding author. E-mail addresses: [email protected], [email protected] (A. Pandey). 1 Equal author contribution. http://dx.doi.org/10.1016/j.ijhydene.2017.06.140 0360-3199/© 2017 Hydrogen Energy Publications LLC. Published by Elsevier Ltd. All rights reserved. Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
2
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
carbohydrate, lipids and protein which can be utilized to produce pure hydrogen by biological route involving microorganisms. Many microbial strains like Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus subtilis and Enterococcus faecium are capable candidates towards the development of industrially relevant hydrogen producing inoculants. H2 is one of the most promising renewable energy resources which can be produced chemically as well as biologically. Chemical processes are very costly so biological methods by manipulating different genetic or environmental parameters of microbial strains are being studied by researchers to enhance yield and rate of biohydrogen production. Global energy consumption is expected to rise 56% by 2040 [2]; China and India driving the rate increase far more than the rest of the world because they are developing countries. Hydrogen can be produced from anaerobic microorganisms through fermentation or by chemical synthesis. Production of sustainable energy by genetically modified microorganism fed on waste material is very promising and novel approach to meet increasing demand of energy and can be a good substitute for non-renewable energy resources which are depleting day by day. Due to its simple operation method and high H2 production rate, fermentative H2 production is advantageous over other methods. Bala-Amutha and Murugesan reported hydrogen production through dark fermentation by using Bacillus licheniformis MSU AGM 2 strain as microorganism and corn stalk as substrate. Bacillus licheniformis MSU AGM 2 strain from alkaline pretreatment of paper mill effluents produced hydrogen under optimized conditions: carbon source 1 g/l, nitrogen source 12.5 g/l, pH (6.0) with 2% NaOH removed lignin by 48% from the corn stalk waste. Kinetic parameters analyzed in 1 L bioreactor showed the maximum hydrogen production and hydrogen yield with 185 ml/l and 82.5 ml/g substrate, respectively [3]. The effect of microwave irradiation pretreated cow dung compost on biohydrogen process from corn stalk by dark fermentation lead to the hydrogen yield of 144.3 ml/g-corn stalk and hydrogen production rate of 3.6 ml/g-corn stalk/h [4]. The ability of Bacillus coagulans strain IIT-BT S1 isolated from anaerobically digested activated sewage sludge has been checked for producing H2 from glucose-based medium in different environmental parameters. H2 production initiated at mid-exponential phase of cell growth and in the stationary phase, production rate reached maximum. At an initial glucose concentration of 2% (w/v), pH 6.5, temperature 37 C, inoculum volume of 10% (v/v) and inoculum age of 14 h, maximal H2 yield i.e. 2.28 mol H2/mol glucose was noted [5]. Lab isolate Bacillus firmus NMBL-03 was estimated for biohydrogen production using carbohydrate rich waste material.1.29 ± 0.11 mol H2/mol reducing sugar was the maximum yield obtained [6]. In another study, enzymatic hydrolysis of food waste was investigated for biohydrogen production. In the batch system, the maximum cumulative hydrogen production of 5850 mL was reached with a yield of 245.7 mL hydrogen/g glucose (1.97 mol hydrogen/mol glucose). The effect of hydraulic retention time (HRT) on biohydrogen production from food waste hydrolysate had been investigated in the continuous system. The optimal HRT that obtained from this study was 6 h with the highest hydrogen
production rate of 8.02 mmol/(h L) [7]. Continuous dark fermentative hydrogen production can be improved by shortening the retention time before wash out of hydrogen producing biomass [8]. B. licheniformis is a soil gram positive, thermophilic bacterium. It can withstand alkaline condition with optimal growth temperature of 30C. Bacillus licheniformis is a facultative anaerobe having pyruvate formate lyase (PFL) and formate hydrogen lyase (FHL) enzyme gene which can hydrolyze pyruvate and formate to produce hydrogen which is a good source of renewable energy because on reaction with oxygen it produces water. In cytoplasm formate is oxidized by FHL complex to produce hydrogen. Hydrogen ion (Hþ) is produced from formate by the formate hydrogenase lyase system (FHL), an intracellular membrane-bound complex. Components of which are produced by the hyc operon. Formate dehydrogenase H(fdhF) converts formate to 2Hþ, 2e, and CO2. Hydrogenase 3(Hyd3), encoded by hycE and hycG, synthesizes molecular hydrogen from 2Hþ and 2e [9]. Electron carriers present in FHL complex reduced by 2e generated by oxidation of HCOO and finally reduces Hþ to generate H2. Two types of hydrogenases (Hyd) are discovered in nature named as Hup and Hox. Hup directs unidirectional uptake of H2 mainly comes under hydrogenase 1 and 2 and genetic modification of Hup which is a H2 uptake gene, enhances biohydrogen production by 4e7 fold [10]. In this study, an effective strategy for the maximized hydrogen production was focused by physicochemical optimization of pretreated kitchen waste suitable for Bacillus licheniformis AP1.
Materials and methods Isolation and enrichment of microorganism from dairy industry waste water The waste water sample was collected from dairy industry. The sample was first serially diluted with distilled water upto 108 dilution to decrease the cell density per unit to get single pure cell colonies. 100 ml of diluted sample was spread over Luria agar plate with the help of sterilized spreader. Single colony from well grown plate was taken and streaked over fresh Luria Bertini agar plate with the help of flame sterilized inoculating loop to get pure culture to be further used as inoculum and named PTH-2-S (Parag dairy Thermophilic Heterotroph -2-Small colony).
16s rRNA gene sequencing and phylogenetic analysis 16s rRNA gene sequence of the purified culture was amplified by using universal primers from genomic DNA of purified culture using modified Marmur's method. Phylogenetic analysis was performed by ClustalW and MEGA5 softwares.
Collection and pre-treatment optimization of kitchen waste The kitchen waste was collected from student mess of Motilal Nehru National Institute of Technology Allahabad (India). 7% v/v, 1.5% v/v, 2% v/v, 2.5% v/v of H2SO4 was used for the
Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
optimization of acid hydrolysis of kitchen waste for maximum hydrogen production. 15 ml of 1% (w/v) kitchen waste was taken in falcon tubes (50 ml) added with 0.7% v/v, 1.5% v/v, 2% v/v, 2.5% v/v concentration of H2SO4 in triplicate and were autoclaved for 1 h 45 min at 121 C and 15 psi pressure. In order to optimize pH, each type of acid hydrolysate of kitchen waste was adjusted at 6, 6.5 and 7.5 pH and used as substrate for hydrogen production in 30 ml working volume. All the four setups were as follows: 0.7% v/v, 1.5% v/v, 2% v/v and 2.5% v/v of H2SO4 at the above mentioned pH.
3
Optimization of various other physicochemical factors i.e. macronutrients, micronutrients and temperature was done. Effect of temperature was studied at 28 C, 34 C, 35 C, 37 C and 40 C. Effect of ammonium chloride and magnesium chloride was assessed at concentrations of 0.59 g/L, 0.88 g/L, 1.18 g/L, 1.47 g/L and 7 g/L, 9 g/L, 10 g/L, 10.5 g/L respectively. Similarly, optimization of iron and nickel concentration were done at 27 mg/L, 53 mg/L, 67 mg/L, 200 mg/L and 88 mg/L, 180 mg/L, 260 mg/L, 350 mg/L, 400 mg/L, 700 mg/L respectively.
Analytical methods Optimization of growth conditions for hydrogen production All the experiments were performed in autoclaved serum bottles (50 ml). The cultures were made anaerobic by sparging nitrogen gas for 1 min (50 ml/min). Modified MGY media was used for hydrogen production by the isolated microorganism and its composition is as follows: hydrolyzed kitchen waste as carbon source, yeast extract 4 g/L, vitamin solution 510 mg/L, Macronutrient composition: NH4Cl (8.1 g/L), KH2PO4 (9.4 g/L), K2HPO4 (19.3 g/L), NaCl (0.4 g/L), CaCl2$2H2O (0.5 g/L), MgCl2$6H2O (0.93 g/L), Micronutrient composition: FeSO4$2H2O (13.9 mg/L), NiCl2$6H2O (60 mg/L), NaMoO4 (90 mg/L), CoCl2$6H2O (200 mg/L), MnCl2$4H2O (300 mg/L).
The bacterial cell concentration was measured at 660 nm by using UVevisible spectrophotometer (Agilent Technologies). Gaseous content was analyzed with gas chromatograph (Agilent 7890) equipped with a thermal conductivity detector and a capillary column (HPPLOT/Q Catalogue No. 19091P-QO4) where nitrogen gas was used as carrier gas at a flow rate of 20 ml/min. The operating temperature of the oven temperature was adjusted at 90 C, while injector and detector temperature were 80 C and 110 C, respectively. GC was also used for measuring end metabolites using nitrogen gas as a mobile phase at a flow rate of 1.3 ml/min while the temperatures for injector, oven, detector were kept at 250 C, 110 C, 250 C
Fig. 1 e Pyruvate formate lyase (PFL) holds a vital role in the anaerobic glucose metabolism of E. coli which catalyses the nonoxidative cleavage of pyruvate to acetyl-CoA and formate and uses a radical mechanism to effect the reversible transformation of pyruvate and Coenzyme A (CoA) to acetyl-CoA and formate. Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
4
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
Table 1 e BLASTn result sequences retrieved from NCBI server. Sequence description Bacillus sp. strain P2316S 16S ribosomal RNA gene, partial sequence Bacillus oryzaecorticis strain WJB61 16S ribosomal RNA gene, partial sequence Bacillus sp. DGG-1-3-F 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain YS65 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain RS12 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain Z11 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain P61 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain L13 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain C73 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain H7 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain FJAT-29133 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain HRBL-15TD17 complete genome Bacillus licheniformis strain 1-a-b-2 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain LOCK 1014 16S ribosomal RNA gene, partial sequence Bacillus licheniformis strain RJ48 16S ribosomal RNA gene, partial sequence
Max score
Total score
Query cover
E value
Identity
Accession no
2444
2444
94%
0.0
99%
KY084464.1
2444
2444
94%
0.0
99%
KU877642.1
2444
2444
94%
0.0
99%
KT325595.1
2444
2444
94%
0.0
99%
KU551256.1
2444
2444
94%
0.0
99%
KU551239.1
2444
2444
94%
0.0
99%
KU551215.1
2444
2444
94%
0.0
99%
KU551207.1
2444
2444
94%
0.0
99%
KU551158.1
2444
2444
94%
0.0
99%
KU551135.1
2444
2444
94%
0.0
99%
KX097970.1
2444
2444
94%
0.0
99%
KU983867.1
2444
2444
94%
0.0
99%
CP014781.1
2444
2444
94%
0.0
99%
KT715478.1
2444
2444
94%
0.0
99%
KT728845.1
2444
2444
94%
0.0
99%
KJ831075.1
respectively and sample injection volume of 5 ml. Further COD was estimated by standard APHA protocol (see Fig. 1).
Results and discussion Characterization and homology analysis of hydrogen producing isolates To identify related species, the primary sequence of PTH-2-S (GenBank accession number: SUB2416744 B. licheniformis
AP1KY681147) was searched for sequence similarities using BLASTn and found to be closely related to Bacillius licheniformis P23. All nucleotide sequences were retrieved in FASTA format from the NCBI database (Table 1) and multiple sequence alignments were performed with Clustal W. Three conserved regions are present in the 16s rRNA gene sequence: (GCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAG; CCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCACTAACC; AGAAAGCCACGGCTAACTAC). The phylogenetic tree was constructed by neighbor-joining method using Molecular Evolutionary Genetics Analysis (MEGA) 5 software. (Fig. 2). No
Fig. 2 e Phylogenetic tree constructed on the basis of 16S rRNA gene sequences using MEGA 5 software. Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
5
significant variation was found during the course of evolution. Though they belonged to the same species of microorganism, they differed by their genetic composition due to specific environment.
Optimization of pH and acid hydrolysis of kitchen waste Biohydrogen could be produced from organic wastes: food and beverage processing wastewater, restaurant food waste and raw starch waste. Effect of pH (4.5e7.0) on fermentative hydrogen production from food and beverage processing wastewater by sewage microflora was optimized [11]. The initial pH 6.5, condition favored hydrogen production (0.28 L/L) indicating that such parameters along with the wastewater characteristics were crucial to dark-fermentative hydrogen production. The present study aimed at understanding of the effects of important process attributes for fermentative hydrogen production from pretreated kitchen waste. The effect of extracellular pH on H2 production by B. licheniformis cultures is shown in Fig. 3. Hydrolysis of kitchen waste by 0.7% sulphuric acid released the maximum reducing sugar of 6.194 mmol/L. It is due to the formation of inhibitory products like furfurals and hydroxymethyl furfural which reduces the efficiency of fermentation processes which could inhibit hydrogen production at high concentration of acid treatment. A strong effect was observed on the hydrogen production, due to variation of enzymes activity at acidic pH. The maximum amount of hydrogen collected was 12.29 mmol/gCOD reduced using pretreated kitchen waste by Bacillus licheniformis at pH 6.5. In this study, the maximum yield of hydrogen (2.61 mol H2 per mol of reducing sugar) was observed at pH 6.5 with 0.7% H2SO4 treated kitchen waste (Fig. 3). In other studies pH range from 5.5 to 5.7 was found to give the highest hydrogen production [12].
Optimization of magnesium Magnesium is essential for the formation of Gram complex and cell division of the rod-shaped bacteria like Bacillus. Pretreated kitchen waste contained 268.66 mM concentration of magnesium therefore, addition of macronutrient components
Fig. 3 e Effect of pH and acid hydrolysis on hydrogen yield by Bacillus licheniformis using kitchen waste (1% w/v) as substrate (hold up values Inoculum volume: 12.9% v/v, Inoculum age: 16 h, Temperature: 34 C ± 2 C).
Fig. 4 e Effect of Magnesium chloride on hydrogen yield by Bacillus licheniformis using kitchen waste (1% w/v) as substrate (hold up values Inoculum volume: 12.9% v/v, Inoculum age: 16 h, Temperature: 34 C ± 2 C, pH: 6.5, acid hydrolysis: 0.7%v/v).
is vital for bacterial growth and adequate hydrogen production. Magnesium acts as cofactor for many enzymes in glycolytic pathway. Due to the accumulation of end metabolites, glycolytic pathway gets inhibited. Research results show that when magnesium ions concentration is maintained at 0.3 g/L, the unit volume production of hydrogen reaches at 256 ml/L [13]. The concentrations which were taken for the optimization study of Mg2þ as to improve the hydrogen production were as 0.59 g/L, 0.88 g/L, 1.18 g/L, 1.47 g/L of MgCl2. The maximum hydrogen production 14.1 mmol/gCOD reduced of kitchen waste by B. licheniformis was observed at 0.59 g/L concentration and the corresponding yield was 2.72 mol H2 per mol of reducing sugar (Fig. 4) whereas with at higher concentrations of magnesium the H2 yield decreased and the highest concentration of magnesium (1.47 g/L) used resulted in 2.49 mol H2 per mol of reducing sugar. The variations in the yields of H2 were observed to be concentration dependent thus inferring that 0.59 g/L is the optimized concentration for H2 production.
Optimization of nitrogen Nitrogen helps in synthesis of various essential amino acids. Ethanolamine used as a nitrogen source for the hydrogen production by Rhodobacter capsulatus ST-410, a hydrogenasedeficient mutant of the strain B-100. The ethanolamine supports cell growth as the sole nitrogen source and permits a large amount of hydrogen evolution [14]. However, based on response surface methodology (RSM), an optimized culture medium (OCM) was developed with 11.8 g/L of ammonium sulfate to maximize butanol (12.15 g/L) and hydrogen (3.29 L/L) production [15]. In our studies, NH4Cl was used as the nitrogen source which gave maximum response of hydrogen i.e. 17.02 mmol/g COD reduced of kitchen waste by B. licheniformis at 7 g/L concentration and the corresponding yield was 3.60 mol H2 per mol of reducing sugar (Fig. 5). With increase in concentration of NH4Cl the H2 production yield decreased in a concentration dependent manner, thus acquiring a lowest value of 2.88 mol H2 per mol of reducing sugar at highest concentration of 10.5 g/L.
Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
6
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
been observed in few studies that the effect of iron and nickel on continuous production of hydrogen gas in completely anaerobic stirred tank reactor.
Optimization of iron
Fig. 5 e Effect of Ammonium chloride on hydrogen yield by Bacillus licheniformis using kitchen waste (1% w/v) as substrate (hold up values Inoculum volume: 12.9%v/v, Inoculum age: 16 h, Temperature: 34 C ± 2 C, pH: 6.5, acid hydrolysis: 0.7% v/v Magnesium: 0.59 g/L, Iron: 67 mg/L).
Optimization of nickel Nickel acts as cofactor of various enzymes which helps in their activity. Nickel also affected hydrogen production. At temperature 35 C and initial pH 7.0, Ni2þ was able to enhance the biohydrogen production rate with increasing Ni2þ concentration from 0 to 0.2 mg/L and enhanced hydrogen production potential and hydrogen yield with increasing Ni2þ concentration from 0 to 0.1 mg/L. They found maximum hydrogen production potential of 288.6 ml and the maximum hydrogen yield of 296.1 ml/g glucose at the Ni2þ concentration of 0.1 mg/L. The pretreated substrate contained 2.52 mM concentration of nickel. Even though hydrogen yield was high with increased nickel concentration used in pretreated kitchen waste, however the maximum hydrogen production did not show the same trend on further increase in the nickel concentration due to the shift in metabolic pathway [16]. In current study nickel chloride (NiCl2) was used as nickel source. Maximum hydrogen production of 17.03 ± 1.7 mmol/g COD reduced of kitchen waste was obtained at 180 mg/L concentration of nickel chloride by B. licheniformis. The variations in H2 production at other concentrations of was observed to be concentration dependent and it was lower than the H2 yield at 180 mg/L. The corresponding molar yield was 3.60 mol H2/mol of reducing sugar (Fig. 6). Changes in metabolic products have
Fig. 6 e Effect of Nickel on hydrogen yield by Bacillus licheniformis using kitchen waste (1% w/v) as substrate (hold up values Inoculum volume: 12.9% v/v, Inoculum age: 16 h, Temperature: 34 C ± 2 C, pH: 6.5, acid hydrolysis: 0.7% v/v Magnesium: 0.59 g/L, Iron: 67 mg/L, ammonium chloride: 7 g/L).
Iron is a cofactor which helps in activity of various enzymes involved in hydrogen production process. Iron affects the fermentation pathways significantly increasing butyrate formation on increasing the iron concentrations. At concentration of 100 mg/L of ferrous ions, the production of biohydrogen was maximum (55 ± 0.58 ml with HPR of 5.729 ± 0.06 ml/L/h) during 24 h HRT, and at 48 h HRT 85 ± 0.58 ml of biohydrogen was produced with the HPR of 4.427 ± 0.03 ml/L/h. In our study, initially pretreated kitchen waste contained 133.42 ± 0.84 mM concentration of iron. Ferrous sulfate (FeSO4) was used as an iron source. We observed maximum hydrogen yield i.e. 17.62 mmol/gCOD reduced of kitchen waste at 67 mg/L iron concentration by B. licheniformis. The corresponding molar yield was 3.7360 mol H2 per mol of reducing sugar (Fig. 7). On further, increasing the concentrations of iron hydrogen production remains stable [16,17].
Optimization of temperature Temperature plays a key role in the production of hydrogen. Experimental results showed that increasing temperature from mesophilic (37 C) to thermophilic (55 C) was an effective mean for increasing bio-hydrogen production from food waste. Highest hydrogen yield of 18.78 (mmol/g COD reduced) from kitchen waste was obtained at 34 C (Fig. 8) [18,19].
Analysis of end metabolites End-metabolite production is directly related to the microbial metabolism which influenced the fermentation pathways [20,21]. The proportions of the end fermentation metabolites detected were 3.75:1:1:1 of acetic acid, isobutyl acid, butyric acid and pyruvic acid respectively under the optimized
Fig. 7 e Effect of Iron on hydrogen yield by Bacillus licheniformis using kitchen waste (1% w/v) as substrate (hold up values Inoculum volume: 12.9% v/v, Inoculum age: 16 h, Temperature: 34 C ± 2 C, pH: 6.5, acid hydrolysis: 0.7% v/v Magnesium: 0.59 g/L).
Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
7
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
Fig. 8 e Effect of temperature on hydrogen yield by Bacillus licheniformis using kitchen waste (1% w/v) as substrate (hold up values: Inoculum volume: 12.9% v/v, Inoculum age: 16 h, pH 6.5, acid hydrolysis: 0.7% v/v).
macronutrients nitrogen is more effective that magnesium for hydrogen production while among the micronutrients iron is more effective. For advancement of this field, more optimized physiochemical parameters can be used to see its effect on hydrogen production in the presence of different types of waste substrates. B. licheniformis was found to be the suitable candidate for fermentative hydrogen production using complex pretreated kitchen waste. Pretreatment and metabolism shift in favor of hydrogen generation were established under optimized process conditions. It can be concluded from the analysis of spent media samples that B. licheniformis followed pyruvate formate pathway to produce hydrogen from hydrolyzed kitchen waste because acetate was detected as the major end metabolites in all the batch experiments. These results could be of great significance for deducing the interaction between various influencing factors and for pilot scale studies to increase the hydrogen production using kitchen
Table 2 e Comparison between various microbes for COD reduction of waste. Microorganism(s) Ethanolamines harbinense C. saccharolyticus DSM 8903 Rhodopseudomonas palustris P4 E. coli NCIMB 11943 E. cloacae IIT-BT08 E. aerogenes HU-101 AY2 Citrobacter sp. Y19 C. acetobutylicum ATCC 824 C. bifermentans Thermotogaelfii Enterobacter sp. CN1 Halanaerobiumsenegalensis Escherichia coli (engineered) B. licheniformis MSU AGM 2 Bacillus licheniformis AP1
Substrate
Hydrogen yield
Reference
Activated sludge Grass (switch grass) Glucose Starch hydrolysate Glucose Glucose Glucose Glucose Wastewater sludge Glucose Xylose Glycerol Glucose Corn stalk Kitchen waste
256 ml H2/L glucose 11.2 mmol/g COD reduced 2.74 molH2/mol hexose or glucose 1.8 molH2/mol hexose or glucose 2.2 molH2/mol hexose or glucose 1.2 molH2/mol hexose or glucose 2.49 molH2/mol hexose or glucose 1.79 molH2/mol hexose or glucose 2.1 mmol/g COD reduced 3.33 molH2/mol hexose or glucose 2.0 molH2/mol xylose 1.21 molH2/mol hexose or glucose 1.82 molH2/mol hexose or glucose 82.5 ml/g substrate 17.62 mmol/g COD reduced
[13] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [3] This study
conditions in batch experiment (30 ml MGY media broth), which are the products of pyruvate formate lyase enzyme complex that indicates that the major electron flux was towards formate during hydrogen production in B. licheniformis by hydrolyzed kitchen waste.
waste. Many other types of complex waste can be used as a substrate for hydrogen production using this potent B. licheniformis. Thus the newly isolated B. licheniformis was found to exhibit higher hydrogen yield than the other strains in complex substrate utilization (Table 2). Hence, the results obtained could be used effectively in large scale hydrogen production.
Conclusion and future directions By applying facultative anaerobic Bacillus licheniformis to pretreated kitchen waste was best to be an effective strategy for the hydrogen production. This transpiring microbial pretreatment method accelerated hydrogen release. The optimized physicochemical parameters of the media were reported as pH 6.5, acid hydrolysis (H2SO4) 0.7% (v/v), magnesium chloride 0.59 g/L, ferrous sulfate 67 mg/L, ammonium chloride 7 g/L, nickel chloride 180 mg/L and temperature 34 C, which gives improved hydrogen production of 17.62 ± 1.8 mmol/g COD reduced (equivalent to molar yield of 3.7360 mol H2 per mol of reducing sugar) which is greater than other bacillus strains producing hydrogen from waste. From this finding it can also be concluded that among the
Acknowledgement The authors are highly thankful to Department of Biotechnology (DBT) (Ref. No. BT/PR8674/PBD/26/389/2013) for providing financial assistance.
references
[1] Kapdan IK, Kargi F. Bio-hydrogen production from waste materials. Elsevier Enzyme Microb Technol 2005;38:569e82.
Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140
8
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 7 ) 1 e8
[2] Cortright RD, Davda RR, Dumesic JA. Hydrogen from catalytic reforming of biomass-derived hydrocarbons in liquid water. Nature 2002;418:964e7. [3] Bala-Amutha K, Murugesan AG. Biohydrogen production using corn stalk employing Bacillus licheniformis MSU AGM 2 strain. Renew energy 2013:621e7. [4] Song ZX, Wang ZY, Wu LY, Wei H. Effect of microwave irradiation pretreatment of cow dung compost on biohydrogen process from corm stalk by dark fermentation. Int J Hydrogen Energy 2012;37(8):6554e61. [5] Kotay SM, Das D. Microbial hydrogen production with Bacillus coagulans IIT-BT S1 isolated from anaerobic sewage sludge. Bioresour Technol 2007;98:1183e90. [6] Pandey A, Sinha P. Biohydrogen production from various feedstocks by Bacillus firmus NMBL-03. Int J Hydrogen Energy 2014;39:7518e25. [7] Wei H, Yan Y, Shi Y, Gu J, Tang J, Zhao H. Biohydrogen production from enzymatic hydrolysis of food waste in batch and continuous systems. Sci Rep 2016;6, 38395. [8] Sivagurunathan P, Kumar G, Bakonyi P, Kim SH, Kobayashi T, Xu KQ, et al. A critical review on issues and overcoming strategies for the enhancement of dark fermentative hydrogen production in continuous systems. Int J Hydrogen Energy 2016;41(6):3820e36. € ck A. The molecular biology of [9] Leonhartsberger S, Korsa I, Bo formate metabolism in Enterobacteria. J Mol Microbiol Biotechnol 2002;4(3):269e76. € hm R, Beier A, Bo € ck A. Characterization of [10] Lutz S, Bo divergent NtrA-dependent promoters in the anaerobically expressed gene cluster coding for hydrogenase 3 components of Escherichia coli. Mol Microbiol 2006:1365e2958. [11] Wongthanate J, Chinnacotpong K, Khumpong M. Impacts of pH, temperature and pretreatment method on biohydrogen production from organic wastes by sewage microflora. Int J Energy Environ Eng 2014;5:76. [12] Fang HHP, Liu H. Effect of pH on hydrogen production from glucose by a mixed culture. Bioresour Technol 2002;82:87e93. [13] Feng Y, Li GH, Mei HY, Zhang LS. The effect of magnesium ions on the hydrogen-producing bacteria in the water during the ecological restoration process. Adv Mater Res 2013;610e613:264e7. [14] Kalil MS, Alshiyab HS, Mohtar W, Yusoff W. Effect of nitrogen source and carbon to nitrogen ratio on hydrogen production using C. acetobutylicum. Am J Biochem Biotechnol 2008;4(4):393e401. [15] Rajagopalan G. Effect of nitrogen salts on butanol and hydrogen production from xylan by using Clostridium strain BOH3. J Appl Biotechnol Bioeng 2016;1:2. [16] Paul JS, Quraishi A, Thakur V, Jadhav SK. Effect of ferrous and nitrate ions on biological hydrogen production from dairy effluent with anaerobic waste water treatment process. Asian J Biol Sci 2014;7:165e71. [17] Yang H, Shen J. Effect of ferrous iron concentration on anaerobic bio-hydrogen production from soluble starch. Int J Hydrogen Energy 2006;31:2137e46. [18] Wang J, Wan W. Effect of temperature on fermentative hydrogen production by mixed cultures. Int J Hydrogen Energy 2008;33:5392e7.
[19] Yokoyama H, Waki M, Moriya N, Yasuda T, Tanaka Y, Haga K. Effect of fermentation temperature on hydrogen production from cow waste slurry by using anaerobic microflora within the slurry. Appl Microbiol Biotechnol 2007;74(2):474e83. [20] Yagi T, Ogata M. Catalytic properties of adenylylsulfate reductase from Desulfovibrio vulgaris Miyazaki. Biochimie 1996;78(10):838e46. [21] Amao Y. Photo induced biohydrogen production from biomass. Int J Mol Sci 2008;9:1156e72. [22] Talluri S, Raj SM, Christopher LP. Consolidated bio processing of untreated switchgrass to hydrogen by the extreme thermophile Caldicellulosiruptorsaccharolyticus DSM 8903. BioresourTechnol 2013;139:272e9. [23] Oh YK, Seol EH, Lee EY, Park S. Fermentative hydrogen production by a new chemoheterotrophic bacterium Rhodopseudomonaspalustris P4. Int J Hydrogen Energy 2002;27(11):1373e9. [24] Perego P, Fabiano B, Ponzano GP, Palazzi E. Experimental study of hydrogen kinetics from agro industrial by-product: optimal conditions for production and fuel cell feeding. Bioprocess Eng 1998:205e11. [25] Kumar N, Das D. Enhancement of hydrogen production by Enterobacter cloacae IIT-BT 08. Process Biochem 2000;35:589e93. [26] Rachman MA, Furutani Y, Nakashimada Y, Kakizono T, Nishio N. Enhanced hydrogen production in altered mixed acid fermentation of glucose by Enterobacteraerogenes. J Ferment Bioeng 1997;83(4):358e63. [27] Oh YK, Seol EH, Kim JR, Park S. Fermentative biohydrogen production by a new chemoheterotrophic bacterium Citrobacter sp. Y19. Int J Hydrogen Energy 2003;28(12):1353e9. [28] Oh SE, Zuo Y, Zhang H, Guiltinan MJ, Logan BE, Regan JM. Hydrogen production by Clostridium acetobutylicum ATCC 824 and megaplasmid-deficient mutant M5 evaluated using a large headspace volume technique. Int J hydrogen energy 2009;34(23):9347e53. [29] Wang CC, Chang CW, Chu CP, Lee DJ, Chang BV, Liao CS. Producing hydrogen from wastewater sludge by Clostridium bifermentans. J Biotechnol 2003;102(1):83e92. [30] Van Niel EWJ, Budde MAW, De Haas GG, Van der Wal FJ, Claassen PAM, Stams AJM. Distinctive properties of high hydrogen producing extreme thermophiles, Caldicellulosiruptorsaccharolyticus and Thermotogaelfii. Int J Hydrogen Energy 2002;27(11):1391e8. [31] Long C, Cui J, Liu Z, Liu Y, Long M, Hu Z. Statistical optimization of fermentative hydrogen production from xylose by newly isolated Enterobacter sp. CN1. Int J hydrogen energy 2010;35(13):6657e64. € A, Santala V, Karp M. Hydrogen production from [32] Kivisto glycerol using halophilic fermentative bacteria. Bioresour Technol 2010;101(22):8671e7. [33] Mathews J, Li Q, Wang G. Characterization of hydrogen production by engineered Escherichia coli strains using rich defined media. Biotechnol Bioprocess Eng 2010;15(4):686e95.
Please cite this article in press as: Srivastava S, et al., Intensification of hydrogen production by B. licheniformis using kitchen waste as substrate, International Journal of Hydrogen Energy (2017), http://dx.doi.org/10.1016/j.ijhydene.2017.06.140