Inter-Ring Communication Is Dispensable in the Reaction Cycle of Group II Chaperonins

Article IMF

YJMBI-64457; No. of pages: 12; 4C: 3, 4, 5, 6, 7, 8

Inter-Ring Communication Is Dispensable in the Reaction Cycle of Group II Chaperonins

Yohei Y. Yamamoto 1 , Yuki Abe 1 , Kazuki Moriya 1 , Mayuno Arita 1 , Keiichi Noguchi 1 , Noriyuki Ishii 2 , Hiroshi Sekiguchi 3, 4 , Yuji C. Sasaki 4, 5 and Masafumi Yohda 1 1 - Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, Naka, Koganei, Tokyo 184–8588, Japan 2 - Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology, Tsukuba, Ibaraki 305–8566, Japan 3 - Japan Synchrotron Radiation Research Institute, Sayo, Hyogo 679–5198, Japan 4 - CREST Sasaki Team, Japan Science and Technology Agency, Tokyo 102–0076, Japan 5 - Graduate School of Frontier Sciences, The University of Tokyo, Kashiwanoha, Kashiwa, Chiba 277–8561, Japan

Correspondence to Masafumi Yohda: [email protected] http://dx.doi.org/10.1016/j.jmb.2014.05.013 Edited by J. Buchner

Abstract Chaperonins are ubiquitous molecular chaperones with the subunit molecular mass of 60 kDa. They exist as double-ring oligomers with central cavities. An ATP-dependent conformational change of the cavity induces the folding of an unfolded protein that is captured in the cavity. In the group I chaperonins, which are present in eubacteria and eukaryotic organelles, inter-ring communication takes important role for the reaction cycle. However, there has been limited study on the inter-ring communication in the group II chaperonins that exist in archaea and the eukaryotic cytosol. In this study, we have constructed the asymmetric ring complex of a group II chaperonin using circular permutated covalent mutants. Although one ring of the asymmetric ring complex lacks ATPase or ATP binding activity, the other wild-type ring undergoes an ATP-dependent conformational change and maintains protein-folding activity. The results clearly demonstrate that inter-ring communication is dispensable in the reaction cycle of group II chaperonins. © 2014 Elsevier Ltd. All rights reserved.

Introduction Chaperonins are ubiquitous, double-ring-shaped molecular chaperones that capture unfolded proteins in their cavities and assist protein folding in an ATPdependent manner [1]. Chaperonins are subdivided into group I and group II [2]. Group I chaperonins are present in bacteria and in the organelles of eukarya. Group II chaperonins exist in the cytosol of archaea and eukarya. Studies on the reaction cycle of a group I chaperonin have advanced by using Escherichia coli GroEL [3]. The heptameric ring-shaped complex of a co-chaperonin, GroES, acts as a lid for the central cavity. GroES interacts with one or both GroEL rings in an ATP-dependent fashion. In addition to sealing the cavity from the outside, the asymmetric binding of ATP and GroES triggers a major conformational change in the cis-ring, inducing the enlargement of the chamber. The bound non-native polypeptide can then be 0022-2836/© 2014 Elsevier Ltd. All rights reserved.

released into the chamber. These structural changes also induce a hydrophobic to hydrophilic change in the inner surface of the cavity wall, which is conducive to folding the polypeptide into its native state. The archaeal group II chaperonin is thermosome [4], and the eukaryotic ortholog is known as chaperonincontaining t-complex polypeptide-1 or TCP-1 ring complex [5]. The group II chaperonins do not require a co-chaperonin but have a built-in lid that is composed of a helical protrusion in the apical domain [6–8]. The built-in lid seals off the central cavity and induces a conformational change to assist the folding of the trapped substrate. We have been studying the molecular mechanism of group II chaperonins using the chaperonin from the hyperthermophilic archaeon Thermococcus sp. strain KS1 (TKS1-CPN) because of its strong protein-folding activity [9–11]. Recently, we demonstrated the ATPdependent dynamics of a group II chaperonin at the J. Mol. Biol. (2014) xx, xxx–xxx

Please cite this article as: Yamamoto Yohei Y., et al, Inter-Ring Communication Is Dispensable in the Reaction Cycle of Group II Chaperonins, J Mol Biol (2014), http://dx.doi.org/10.1016/j.jmb.2014.05.013

2

Inter-Ring Communication of Group II Chaperonins

single-molecule level with highly accurate rotational axis views by diffracted X-ray tracking (DXT) [12]. The lid partially closed within 1 s of ATP binding. The closed ring subsequently twisted counterclockwise within 2– 6 s, and the twisted ring reverted to the original open state with a clockwise motion. The reaction cycle of group I chaperonins is controlled by inter-ring allosteric communication. The release of a polypeptide substrate from the GroESbound cis-ring into solution requires the binding of ATP to the distal (trans) ring, which triggers the dissociation of GroES [13]. The rate of GroES dissociation from the cis-ring increases with increasing positive cooperativity in ATP binding by the trans-ring [14]. The dissociation of GroES from the cis-ring is therefore accelerated by a non-folded protein substrate binding to the trans-ring to stabilize it in a T-like state [15]. Inter-ring negative cooperativity in ATP binding appears to be conserved in all group I chaperonins [16–19]. GroEL single-ring mutants have been constructed and used for the study of the functional cycle. Among these mutants, the SR1 mutant, which contains amino acid replacements of R452E, E461A, S463A and V464A, has been extensively used [20]. The critical feature of the SR1 mutant was that it could bind but not readily release GroES. In the presence of ATP, the rate of release of GroES from SR1 was extremely slow compared with wild-type GroEL. Consistent with the slow rate of GroES release, GroES was found to inhibit the ATPase activity of SR1 completely, compared to an approximately 50% reduction of the ATPase activity of wild-type GroEL by GroES. A singlering mutant (SR1) and an inter-ring communicationaffected mutant (A126V) have allowed the identification of a conformational change in the apical domains that is strictly dependent on the communication between the two GroEL rings. It can be deduced from these results that the binding of nucleotides to both GroEL rings generates, as a consequence of the inter-ring communication, a functionally and structurally asymmetric particle. This asymmetric particle has one ring with a small conformational change in its apical domains and a high affinity toward unfolded substrates and GroES, whereas the other ring has a larger conformational change in its apical domains and lower affinity toward substrates and GroES [20]. We have to note that there are several reports on the functional single-ring group I chaperonin [21–24]. Especially, mammalian mitochondrial chaperonin exists as single ring. Therefore, the inter-ring communication takes important role but seems to be not indispensable for the reaction cycle of group I chaperonin. Previously, we have shown that TKS1-CPN takes an asymmetric conformation when incubated with ADP and BeFx [25]. However, there have been no data on the inter-ring communication in the group II chaperonin because no group has succeeded in

constructing a stable single-ring mutant of a group II chaperonin. Therefore, to examine the inter-ring communication, we decided to construct an asymmetric ring complex of TKS1-CPN (CPN ASR) that consists of a wild-type ring and a mutant ring by making TKS1-CPN variants that can assemble to form a ring without including the wild-type subunit. For this purpose, we have developed circular permutated covalent TKS1-CPN (CPN CPC). The characterization of CPN ASR, composed of one CPN CPC ring and one wild-type ring, has clearly shown that inter-ring communication is dispensable in the group II chaperonin.

Results Construction and structural characterization of CPN CPC and CPN ASR We hypothesized that the construction of CPN ASR would be possible by using the circular permutated covalent TKS1-CPN (CPN CPC). The circular permutation of proteins is achieved by linking the N- and C-termini of a certain protein with a suitable linker sequence and then reopening this circularized sequence at a different position to relocate the polypeptide ends. Generally, circular permutation is performed for the proteins in which the original Nand C-termini are in close spatial proximity to each other in the native structure. In chaperonin complexes, not only the N- and C-termini are in close spatial proximity to each other but also the C-terminus of a subunit is also located close to the N-terminus of the adjacent subunit. Thus, it is possible to construct covalent chaperonin complexes by connecting Nand C-termini [26]. Previously, we have constructed covalent TKS1-CPN by connecting two, four and eight subunits and used these variants for the study of intra-ring communication [11]. Circular permutated covalent TKS1-CPN (CPN CPC) is constructed by applying circular permutation to the covalent TKS1CPN dimer (Fig. 1a). If it can correctly fold and assemble into a ring, it would assume almost the same conformation and oligomer structure as the wild type. However, we can assume that CPN CPC cannot assemble with the wild-type subunit due to steric hindrance (Fig. 1b). Thus, CPN ASR is obtained by co-expressing CPN CPC and the wild-type subunit in E. coli (Fig. 1b). CPN CPC variants were constructed from the covalent TKS1-CPN dimer (Fig. 2). The two sequences for creating the circular permutated subunit were prepared by PCR from the gene for the covalent TKS1-CPN dimer. One has the initiation codon, and the other contains the termination codon. The CPN CPC construct was prepared by connecting these two sequences in an expression vector.

Please cite this article as: Yamamoto Yohei Y., et al, Inter-Ring Communication Is Dispensable in the Reaction Cycle of Group II Chaperonins, J Mol Biol (2014), http://dx.doi.org/10.1016/j.jmb.2014.05.013

3

Inter-Ring Communication of Group II Chaperonins

(a) CPN Monomer

Covalent CPN Dimer

Circular permutated covalent CPN

Top View

(b)

Assemble to ring structure

CPN

WT

CPN

ASR

Side View

Formation of duble ring structure CPN

CPC

Fig. 1. Schematic image of CPN CPC and CPN ASR. (a) Schematic images of CPN monomer, covalent CPN dimer and circular permutated covalent CPN. The N-terminal region that is replaced to the C-terminus is shown as green. (b) Formation of CPN ASR. When CPN monomer and circular permutated covalent CPN are co-expressed, they assemble homo-oligomeric rings. Finally, they will form double-ring structures of homo-oligomers of CPN monomer and circular permutated covalent CPN and CPN ASR.

At first, we tried to determine the optimal site for the position of circular permutation. We have found that the circular permutated covalent TKS1-CPN dimer that has the deletion of 95 amino acids from its N-terminus and the addition of the same 95 amino acids to its C-terminus can assemble into a doublering structure similar to the wild type. The 95th amino acid residue is located at the loop region between Helix 4 and Helix 5. The complex of the TKS1-CPN variant could be purified by the same procedure as the wild type. This complex appeared as a band of approximately 120 kDa by SDS-PAGE (Fig. 3a). The oligomer formation of CPN CPC was confirmed by analytical gel filtration and electron microscopy (Fig. 3b and c). To construct the asymmetric ring chaperonin (CPN ASR), we employed an ATPase-deficient mutant (D64A/D393A, CPNΔATPase) for the CPN CPC ring. The homo-oligomer ΔATPase is deficient in proteinfolding activity in addition to ATPase activity. Our previous study has shown that ΔATPase can bind ATP but does not exhibit ATP-dependent conformational change [11,27]. The strep-tag sequence was inserted in the helical protrusion region for affinity purification (CPN CPC-ΔATPase-strep). For the wild-type ring, a TKS1-CPN mutant containing a His tag at the C-terminus (CPN WT-His) was used. CPN ASR was

purified by two-step affinity chromatography using a nickel column and a Strep-Tactin column. CPN ASR appeared as two bands of 120 kDa and 60 kDa in SDS-PAGE (Fig. 3a). These bands correspond to CPN CPC-ΔATPase-strep and CPN WT-His, respectively. As the band intensities of these species are almost equal, they should have assembled into rings independently and form CPN ASR as expected. The oligomer formation and the double-ring structure of CPN ASR were confirmed by gel-filtration chromatography (Fig. 3b) and electron microscopy (Fig. 3c). Functional characterization of CPN CPC and CPN ASR We characterized CPN CPC and CPN ASR constructs composed of one ring of CPN CPC-ΔATPase-strep and one ring of CPN WT-His. First, we examined the ATPase activity (Fig. 4a). The ATPase activity of CPN WT-His was reduced compared to that of the wildtype TKS1-CPN (CPN WT). Interestingly, the ATPase activity of CPN CPC constructed from wild-type subunits was less than 10% of CPN WT. The ATPase activity of CPN ASR was half that of the CPN WT-His homo-oligomer. As one ring is the circular permutated covalent ring constructed from the ATPase-deficient mutant, the other ring seems to be fully active as a

Please cite this article as: Yamamoto Yohei Y., et al, Inter-Ring Communication Is Dispensable in the Reaction Cycle of Group II Chaperonins, J Mol Biol (2014), http://dx.doi.org/10.1016/j.jmb.2014.05.013

4

Inter-Ring Communication of Group II Chaperonins

TKS1-CPN Monomer NdeI

BamHI

NdeI

BamHI

ATG

Termination

ATG

Termination

Covalent TKS1-CPN Dimer NdeI

BamHI/BglII

BamHI Termination

ATG PCR Amplification

Circular permutated TKS1-CPN Monomer NdeI

BamHI

BamHI

EcoRI

ATG

Termination

Circular permutated covalent TKS1-CPN NdeI

BamHI

EcoRI

Fig. 2. Scheme for the construction of CPN CPC. The gene for the dimeric covalent TKS1-CPN was used as the template for PCR amplification. Two different PCR fragments for the circular permutated subunit were amplified and ligated into an expression vector. The details are described in Materials and Methods. Structural images of CPN variants were drawn using MacPyMOL based on the crystal structure of TKS1-CPN (accession number: 1Q2V).

CPN WT-His ring. This finding suggested that inter-ring cooperativity did not play an important role in ATP hydrolysis. We next examined the effects of CPN variants on the thermal aggregation of citrate synthase (CS) from porcine heart (Fig. 4b). In the presence of CPN WT and CPN WT-His, CS was protected from thermal aggregation at 50 ºC. In contrast, CPN CPC had a very weak effect on CS aggregation. The effect of CPN ASR was marginal; it protected CS from thermal aggregation, but the effect was weak compared with those of CPN WT or CPN WT-His. It seems reasonable to conclude that only an active ring can capture denatured CS and protect it from thermal aggregation. Protein-folding activity was assessed using GFP (green f luorescent protein) as a substrate. Aciddenatured GFP was supplied for refolding in the neutralization buffer with or without CPN variants (Fig. 4c). The time course of GFP fluorescence recovery was monitored at 60 ºC. CPN WT and CPN WT-His arrested the spontaneous refolding of

acid-denatured GFP and enhanced its refolding in an ATP-dependent manner. CPN CPC also seems to be impaired regarding the interaction with folding intermediates and folding activity. CPN ASR could partially prevent the spontaneous refolding of GFP and refold it in an ATP-dependent manner (Fig. 4c). Thus, in CPN ASR , one homo-octameric ring of CPN WT-His is active, but the other CPN CPC-ΔATPasestrep ring is inactive. The ATP-dependent motion of the ring was assessed by protease digestion (Fig. 4d). In the absence of ATP, TKS1-CPN takes an open conformation and is susceptible to protease digestion. The addition of ATP changes CPN WT and CPN WT-His into the closed conformation, which is resistant to protease digestion. CPN CPC was susceptible to protease digestion even in the presence of ATP. The idea that CPN CPC exists as an open conformation irrespective of the presence of ATP is not plausible because CPN CPC lacks the interaction with unfolded proteins. Therefore, it is reasonable to assume that the CPN CPC is attacked by protease around the

Please cite this article as: Yamamoto Yohei Y., et al, Inter-Ring Communication Is Dispensable in the Reaction Cycle of Group II Chaperonins, J Mol Biol (2014), http://dx.doi.org/10.1016/j.jmb.2014.05.013

5

Inter-Ring Communication of Group II Chaperonins

(a) 200.0

MW CPNCPC

200.0

116.3 97.4

CPNCPC 116.3 97.4

66.2

66.2

45.0

(c)

MW CPNASR

CPNWT

CPNCPC

CPNWT-His

CPNASR

CPNCPC-ΔATPase-strep

CPNWT-His

45.0

(b)

50 nm

Fig. 3. Construction and structural characterization of CPN CPC and CPN ASR. (a) Confirmation of CPN ASR formation by SDS-PAGE. The purified CPN CPC (left) and CPN ASR (right) were analyzed by SDS-PAGE. The bands for the dimeric unit of CPN CPC and TKS1-CPN are indicated by arrows. The details are described in Materials and Methods. (b) Gel-filtration chromatography of CPN variants. The elution profiles of CPN WT (green), CPN-His (blue), CPN CPC (purple) and CPN ASR (red) in gel filtration on HPLC are shown. The details are described in Materials and Methods. (c) Electron microscopic images of CPN variants. The details are described in Materials and Methods.

circular permutation site. In CPN ASR, the band for CPN CPC-ΔATPase-strep disappeared after protease digestion, but the band for CPN WT-His remained in the presence of ATP. Thus, the active ring in CPN ASR exhibits an ATP-dependent conformational change. These results support the idea that the inter-ring communication is dispensable for the functional cycle of group II chaperonins. ATP-dependent rotational motion of CPN ASR The ATP-dependent motion of the active ring in CPN ASR was assessed by DXT (Fig. 5). Previously, we have shown that ATP hydrolysis induces the rotational motion of group II chaperonins that is required for the folding function [12]. Gold nanocrystals were used as tracers of the motion of TKS1-CPN. The twisting and tilting of TKS1-CPN correspond to Laue spots from the gold nanocrystals in the concentric circle (χ) and radial (θ) directions, respectively (Fig. 5a). For DXT, we constructed CPN ASR using CPN D263C/C366S labeled with a gold nanocrystal for the

active ring and a circular permutated covalent TKS1CPN constructed from the ΔATPase mutant with the addition of a histidine tag at the helical protrusion and the replacement of Cys366 with Ser for the inactive ring (CPN CPC-ΔATPase -His). CPN D263C/C366S and CPN CPC-ΔATPase-His were expressed in E. coli simultaneously, purified by affinity chromatography using HisTrap HP (GE Healthcare) and then immobilized on a solid surface modified with nickel-nitrilotriacetic acid (Ni-NTA). Although both the CPN CPC-ΔATPase-His homo-oligomer and CPN ASR-His (asymmetric complex of CPN D263C/C366S and CPN CPC-ΔATPase-His) are immobilized on the solid surface, gold nanocrystals only bind to CPN ASR-His that has Cys residues at the helical protrusion. Therefore, only the motion of CPN ASR-His is observed. Figure 5b shows the typical traces of Laue spots from gold nanocrystals on CPN D263C/C366S and CPN ASR-His in the presence of 1 mM ATP. Both concentric (χ) and radial (θ) movements were observed in the asymmetric ring complex. These traces showed that both CPN D263C/D263C and CPN ASR-His rotate in clockwise and counterclockwise

Please cite this article as: Yamamoto Yohei Y., et al, Inter-Ring Communication Is Dispensable in the Reaction Cycle of Group II Chaperonins, J Mol Biol (2014), http://dx.doi.org/10.1016/j.jmb.2014.05.013

6

Inter-Ring Communication of Group II Chaperonins

(b)

C

(c)

C

PN

A SR

C PC

PN C

PN

C

W

T

PN

-H

W

IS

T

ATPase Activity [µmol/mg/min]

(a)

(d) CPNWT Thermolysin ATP

-

+ -

+ +

CPNHis

-

+ -

CPNCPC

+ +

-

+ -

+ +

CPNASR

-

+ -

+ +

CPNCPC-ΔATPase-strep

CPNWT-His

Fig. 4. Functional characterization of CPN CPC and CPN ASR. (a) ATPase activities of TKS1-CPN variants. The relative values against CPN WT-His were shown at each bar. (b) Effects of CPN variants on thermal aggregation of CS. Thermal aggregation of CS at 50 °C with or without CPN variants was monitored using the light scattering at 500 nm as described in Materials and Methods. Without CPN (black), CPN WT (green), CPN-His (blue), CPN CPC (purple) and CPN ASR (red). (c) GFP refolding activity of CPN variants. The folding mixture was incubated at 60 °C as described in Materials and Methods. The recovery of GFP fluorescence was continuously monitored at 510 nm. At 0 min, acid-denatured GFP (5 μM) was diluted 100-fold in the folding buffer with or without 100 nM CPN variants. ATP was added at 5 min. Without CPN (black), CPN WT (green), CPN WT-His (blue), CPN CPC (purple) and CPN ASR (red). (d) Protease digestion assay for the conformational change of CPN variants. CPN variant incubated with or without ATP (1 mM) was exposed to thermolysin (1 ng/μl) and then analyzed by SDS-PAGE. The arrow indicates the bands for the dimeric unit of CPN CPC and TKS1-CPN.

directions, as viewed from the top to the bottom of the chaperonin, in the presence of ATP. Clockwise and counterclockwise rotations corresponded to opening and closing of the chaperonin ring [12]. Figure 5c shows the frequency to obtain trajectories with an angular displacement greater than 30 mrad in the χ direction in the absence and in the presence of ATP. An angular displacement larger than 30 mrad in the χ direction is rarely observed in the absence of ATP and is equally observed in the presence of ATP for CPN D263C/C366S and CPN ASR-His. Construction and characterization of CPN ASR whose inactive CPN CPC ring is constructed from ATP-binding-deficient mutant Although CPNΔATPase does not exhibit ATPdependent conformational change, it might be possible that ATP binding induces some effect on the other

ring. To exclude the possibility, we constructed and characterized CPN ASR whose inactive CPN CPC ring is constructed from ATP-binding-deficient mutant. In the crystal structure, K165 locates at the ATP binding site and was supposed to interact with phosphate residue of ATP. Thus, the replacement of K165A should result in the loss of ATP binding ability. To confirm it, we constructed a mutant TKS1-CPN containing amino acid replacement of D64A, D393A, K485W and K165A. Previously, we have shown that K485W mutants of CPN WT and CPNΔATPase exhibit ATP/ADP-dependent fluorescence change because K485W locates close to the ATP binding site [27]. We analyzed the ATP-dependent fluorescence change of CPN K485W and CPN ΔATPaseK485W by stopped-flow fluorometry. Trp fluorescence of them increased immediately after mixing with ATP. In case of CPN K485W, further fluorescence change occurred due to the ATP-dependent conformational change.

Please cite this article as: Yamamoto Yohei Y., et al, Inter-Ring Communication Is Dispensable in the Reaction Cycle of Group II Chaperonins, J Mol Biol (2014), http://dx.doi.org/10.1016/j.jmb.2014.05.013

7

Inter-Ring Communication of Group II Chaperonins

2θ χ

white X-ray beam stopper sto to stoppe st oppe per p er χ

2θ

chaperonin gold nanocrystal substrate surfacee diffraction tio ion on image imag im age age diiff diffract ffra r ct ctio

Probability (> 30 mrad)

(c) 0.30

chi direction (mrad)

diffraction spot

chi direction (mrad)

(b)

(a)

40 20

D263C/C366S CCW (Close) D263C/C366S

0 -20

(Open) CW

-40 40 20

CPNASR CCW (Close) CPNASR

0 -20

(Open) CW

-40 500

0.25

1000

1500

time (ms)

0.20 0.15 0.10 0.05 0.00 D263C/C366S D263C/C366S 0 mM ATP 1mM ATP

CPNASR 1mM ATP

Fig. 5. ATP-dependent rotational motion of CPN ASR tracked by DXT. (a) Schematic illustration of rotational motion analysis of CPN by DXT. Gold nanocrystals were used as a tracer of the chaperonin's motion. The rotating and tilting of the chaperonin correspond to Laue spots from the gold nanocrystal in the concentric circle (χ) and radial (θ) directions, respectively. (b) DXT rotational position trajectories of gold nanocrystals immobilized on CPN(D263C/C366S) and CPN ASR in the presence of ATP. The trajectories with an angular displacement greater than 30 mrad in the χ direction were selected for inclusion in these figures. The original diffraction spot's trajectories in time-resolved diffraction images are shown in inset figures. (c) The frequency to obtain trajectories with an angular displacement greater than 30 mrad in the χ direction in the absence and in the presence of ATP. An angular displacement larger than 30 mrad in the χ direction is rarely observed in the absence of ATP and is equally observed in the presence of ATP for CPN D263C/C366S and CPN ASR.

Thus, in the steady-state condition, fluorescence of CPN K485W decreased in the presence of ATP. In CPN ΔATPaseK485W, only the initial rapid increase was observed by both ATP and ADP [27]. Fluorescence of tryptophan residue of CPN ΔATPaseK485W and CPN ΔATPaseK165A/K485W with or without ATP are shown in Fig. 6a. CPN ΔATPaseK165A/K485W does not exhibit any ATP-dependent fluorescence change. This result clearly shows that K165A mutant is deficient in ATP binding. Then, we constructed an asymmetric complex (CPN ASR_ΔATPaseK165A ) composed of CPN-His and CPN CPC_ΔATPaseK165A with strep tag. As shown in Fig. 6b, CPN ASR_ΔATPaseK165A could partially prevent the spontaneous refolding of GFP and refold it in an ATP-dependent manner. Therefore, we concluded that inter-ring communication is dispensable in the reaction cycle of group II chaperonin.

Discussion A recent study has shown that an N-terminal salt bridge is important for the oligomer formation of the

group II chaperonin from Pyrococcus furiosus. The amino acid replacements of several residues resulted in the impairment of oligomer formation. Interestingly, single-ring octamers of all mutants were unstable and dissociated into smaller oligomers [28]. This result suggests that inter-ring interaction is important for the stability of the ring. Thus, it is difficult or almost impossible to construct single-ring mutants of group II chaperonins. Previously, we succeeded in constructing covalent TKS1-CPN by connecting the N- and C-termini and used this for the study of intra-ring cooperation. As a ring is composed of eight subunits, covalent TKS1CPN complexes of two, four or eight subunits (CPN 2, CPN 4 or CPN 8) could be constructed. Interestingly, the flexibility of the N- or C-termini seems to be important for the function of TKS1-CPN. Without the digestion of the covalent links between subunits by thrombin, the ATP-dependent conformational change and the protein-folding activity were impaired. It is possible to construct CPN ASR by co-expressing CPN 8 with wild-type subunits in E. coli. However, we avoided this approach. In our previous study, the

Please cite this article as: Yamamoto Yohei Y., et al, Inter-Ring Communication Is Dispensable in the Reaction Cycle of Group II Chaperonins, J Mol Biol (2014), http://dx.doi.org/10.1016/j.jmb.2014.05.013

8

Inter-Ring Communication of Group II Chaperonins

(a)

CPNΔ ATPaseK485W

CPNΔ ATPaseK165A/K485W

(b)

Fig. 6. ATP-binding-deficient CPN mutant and functional characterization of CPN ASR-ΔATPaseK165A. (a) ATP-dependent fluorescence change of CPN ΔATPaseK485W (left) and CPN ΔATPaseK165A/K485W (right) in the absence of ATP (black circle) and in the presence of 1 mM ATP (red circle). (b) GFP refolding activity of CPN ASR-ΔATPaseK165A. GFP refolding assay was performed as described in Materials and Methods. ATP was added at 5 min. Without CPN (black circle), CPN WT (blue circle) and CPN ASR-ΔATPaseK165A (red circle).

purified CPN 8 did not appear as a single band eight times larger than the single subunit, but after thrombin digestion, a single band corresponding to one chaperonin subunit was detected. Thus, CPN 8 was likely to be digested around the thrombin digestion site by the endogenous proteases in E. coli to the various sizes of connected chaperonins. Therefore, there is a risk that the partially digested subunits are included in the active rings.

Although CPN CPC was constructed from wild-type subunits and could assemble to a double-ring structure like the wild type, it was functionally impaired in its ATPase activity, conformational change ability, interaction with unfolded protein and protein-folding activity. One of the important catalytic residues for ATPase activity (D65) is located in the N-terminal region that is dissected in CPN CPC. Therefore, it is reasonable to think that one subunit in the dimeric

Please cite this article as: Yamamoto Yohei Y., et al, Inter-Ring Communication Is Dispensable in the Reaction Cycle of Group II Chaperonins, J Mol Biol (2014), http://dx.doi.org/10.1016/j.jmb.2014.05.013

9

Inter-Ring Communication of Group II Chaperonins

CPN CPC divided at the 95th amino acid has lost its ATPase activity. The functional activity of the other subunit in the dimeric unit should be impaired by covalent linkage or the lack of intra-ring cooperation. The ATPase activity of isolated subunit is very weak compared with that of the complex. Previously, we constructed and characterized covalent TKS1-CPNs. They exhibit protein-folding activity only after the protease digestion at the linker sites [11]. The interaction with denatured GFP was also impaired in the covalent-linked condition. The success of the construction of CPN CPC is most likely due to the high structural stability of TKS1-CPN. For constructing CPN ASR, an ATPase-deficient mutant was used for the CPN CPC ring. Considering the lack of the activity of CPN CPC and the mutation, the activity of the CPN CPC ring can be disregarded. As CPN ASR exhibited almost half of the activity of CPN WT-His, it is reasonable to think that the wildtype ring is functional even if the other ring is functionally impaired. The ATP hydrolysis-dependent conformational change that correlates with protein folding is observed as the rotation of a ring by DXT. Almost the same rotational motion of CPN ASR was observed by DXT. Therefore, we concluded that interring communication is dispensable for the function of group II chaperonins. The result was further confirmed by the result with CPN ASR whose inactive CPN CPC ring is constructed from ATP-binding-deficient mutant, CPN ΔATPaseK165A. CPN ASR will be a powerful tool for studying the functional mechanism of group II chaperonins as the single-ring mutants for group I chaperonin because the conformational change and protein folding occurs only in one ring.

Materials and Methods Bacterial strains, plasmids, reagents and protein E. coli strains used in this study were DH5α for plasmid preparation and BL21 Star (DE3) pRARE (Life Technologies, Carlsbad, CA) for protein expression. KOD-Plus-Neo DNA polymerase and restriction endonucleases were obtained from Toyobo (Osaka, Japan) and New England Biolabs Japan (Tokyo, Japan), respectively. ATP and thermolysin were purchased from Wako Pure Chemical Industries (Osaka, Japan). CS from porcine heart was obtained from Sigma-Aldrich Japan (Tokyo, Japan). The ammonium sulfate suspension of CS from porcine heart was desalted on an NAP-5 column (GE Healthcare, Buckinghamshire, England) before use, as described previously [25]. The concentrations of chaperonins were determined with the Bio-Rad protein assay (Bio-Rad, Hercules, CA) using bovine serum albumin as the standard, and they are reported as molar concentrations of hexadecamer. The site-directed mutagenesis of TKS1-CPN was performed with the QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA).

Construction and purification of CPN variants CPN WT was expressed and purified as described previously [10]. CPN WT-His was expressed and purified in the same manner using a plasmid, pK1Eα2-His, that was prepared from pK1Eα2 [29] with site-directed mutation to insert a histidine-tag sequence at the C-terminus using the primers, 5′-GGAATGGACATGGGCATGCACCACCACCACCACCACTGACCGAAAGGAAGCTGAG-3′ and 5′-CTCAGCTTCCTTTCGGTCAGTGGTGGTGGTGGTGG TGCATGCCCATGTCCATTCC-3′. K165A mutation was introduced using QuikChange sitedirected mutagenesis kit with the primers 5′-CTCAATCA CAGGAGCGAACGCCGAGAGC-3′ and 5′-GCTCTCGGC GTTCGCTCCTGTGATTGAG-3′. For the construction of CPN CPC, the gene for the covalent TKS1-CPN dimer was used as the template for PCR [11]. Two types of DNA fragments for circular permutated TKS1-CPN that span from the 96th amino acid of the N-terminal subunit to the 95th amino acid of the C-terminal subunit in the covalent TKS1-CPN dimer were prepared by PCR amplification. The N-terminal fragment with an initiation codon at the NdeI site was obtained using the primer pair 5′-GGAATTC-CAT-ATG-GGT-ACT-ACCACT-GCC-GTC-GTC-ATC-G-3′, NdeI site underlined, and 5′-CGC-GGA-TCC-ATC-ACC-GGC-CTC-CTT-GTC-CTG-AGT-C-3′, BamHI site underlined. The C-terminal fragment with a termination codon was obtained with the primer pair 5′-CGCGGATCCGGTACTACCACTGCCGTC GTCATCG-3′, BamHI site underlined, and 5′-CCG GAATTCTCAATCACCGGCCTCCTTGTCCTGAGTC-3′, EcoRI site underlined. The two fragments were ligated into the NdeI/EcoRI site of pET23b (Merck Millipore, Billerica, MA). CPN CPC was expressed and purified in the same manner as CPN WT. The gene for CPN ΔATPase-strep, CPN ΔATPase (D64A/ D393A mutant) with a strep-tag sequence between 256th and 264th amino acid residues in the helical protrusion, was prepared from the gene of CPN ΔATPase as follows. The site-directed nucleotide replacement of T1179G was performed to remove the PstI site without amino acid replacement using the primers 5′-GAGCCCTTGAGGCGGCAGTTAAGGTAG-3′ and 5′-CTCGGGAACTCCGCCGTCAATTCCATC-3′. Then, the strep-tag sequence was inserted using the primers 5′-AAGACCGAGACCGATGCG AAGTGGTCTCATCCTCAATTTGAAAAACTCATGAGCT TCCTTGAGCAG-3′ and 5′-CTGCTCAAGGAAGCTCAT GAGTTTTTCAAATTGAGGATGAGACCACTTCGCA TCGGTCTCGGTCTT-3′. Using this plasmid containing the gene for CPN ΔATPasestrep, we prepared the genes for the N- and C-terminal fragments of covalent CPN ΔATPase-strep dimer by sitedirected mutagenesis. The N-terminal fragment gene was constructed by removing the termination codon and adding a PstI site using the primers 5′-GGACATGGGCATGCTGC AGTCCGGCTGCTAACAAAGCC-3′ and 5′-GGCTTT GTTAGCAGCCGGACTGCAGCATGCCCATGTCC-3′, PstI site underlined. The C-terminal fragment was prepared using the primers 5′-AGAAGGAGATATACTGCAGGCACAGCTTAGTGGACAGC-3′ and 5′-GCTGTCCACTAAG CTGTGCCTGCAGTATATCTCCTTCT-3′, PstI site underlined. The gene for the covalent CPN ΔATPase-strep dimer was constructed by connecting the N-terminal and Cterminal fragment genes using the PstI site.

Please cite this article as: Yamamoto Yohei Y., et al, Inter-Ring Communication Is Dispensable in the Reaction Cycle of Group II Chaperonins, J Mol Biol (2014), http://dx.doi.org/10.1016/j.jmb.2014.05.013

10 This prepared gene for covalent CPN ΔATPase-strep dimer was used for constructing a plasmid to express CPN CPC-ΔATPase-strep, pET23b-CPN CPC-ΔATPase-strep, in the same procedure as used for pET23b-CPN CPC. For the construction of CPN ASR, pET23b-CPN CPC-ΔATPasestrep and pK1Eα2-His were simultaneously transformed into E. coli BL21star (DE3) pRARE cells. The transformed E. coli cells were cultured in 2× YT medium containing ampicillin, kanamycin and chloramphenicol. CPN ASR was purified from the crude extract of E. coli cells by affinity chromatography, StrepTrap HP (GE Healthcare) for the strep tag and HisTrap HP (GE Healthcare) for the histidine tag. Finally, the CPN ASR oligomer was purified by gel-filtration chromatography using HiLoad 26/60 Superdex 200 pg (GE Healthcare). For DXT experiments, the histidine tag was used for immobilizing CPN ASR. The inactive circular permutated covalent ring was constructed from CPN ΔATPase-His, CPN ΔATPase (D64A/D393A mutant) with a histidine-tag sequence between the 256th and 264th amino acid residues in the helical protrusion. The other active ring is made from CPN D263C/C366S, which will bind gold nanocrystals. CPN ΔATPase-His was prepared in the same manner as CPN ΔATPase-strep. The primers for the insertion of the histidine tag are 5′-CCGAGACCGATGCGAAGATCCACC ACCACCACCACCACCAGCTCATGAGCTTCCTTGAG3′ and 5′-CTCAAGGAAGCTCATGAGCTGGTGGTGGTG GTGGTGGTGGATCTTCGCATCGGTCTCGG-3′. The PstI site was removed in the same manner. In addition, a C366S mutation was created to remove cysteine residue using the primers 5′-CTTCGTTGAGGGCTCCAAGAACCCGAAGG-3′ and 5′-CCTTCGGGTTCTTGGAGCC CTCAACGAAG-3′. The plasmid for the expression of CPN CPC-ΔATPase-His (pET23b-CPN CPC-ΔATPase-His) was prepared in the same manner as that of pET23bCPN CPC-ΔATPase-strep. For the construction of CPN ASR -His, pET23bCPN CPC-ΔATPase-His and pK1Eα2-D263C/C366S were simultaneously transformed into E. coli BL21star (DE3) pRARE cells. The transformed E. coli cells were cultured in 2× YT medium containing ampicillin, kanamycin and chloramphenicol. CPN ASR-His and CPN CPC-ΔATPase-His were purified from the crude extract of E. coli cells by HisTrap HP (GE Healthcare), followed by gel-filtration chromatography using HiLoad 26/60 Superdex 200 pg (GE Healthcare). ATPase activity measurement ATPase activities were measured at 60 °C in TKM buffer [50 mM Tris–HCl (pH 7.5), 100 mM KCl and 25 mM MgCl2] containing 1 mM ATP and 10 μg/ml TKS1-CPN variants. Phosphate ion production was measured using the malachite green assay with the BIOMOL GREEN™ reagent (Enzo Life Sciences). Thermal aggregation measurement The thermal aggregation of porcine heart CS was monitored by measuring light scattering at 500 nm with a spectrofluorometer (FP-6500, JASCO, Tokyo, Japan) for 20 min at 50 °C. Native CS was diluted to a final concentration of 100 nM (as a monomer) with or without 100 nM of TKS1-CPN variants in TKM buffer. The reaction mixtures

Inter-Ring Communication of Group II Chaperonins

were preincubated for 10 min at 50 °C and continuously stirred throughout the measurement. Size-exclusion chromatography Size-exclusion chromatography was performed with a column, TSKgelG3000 SWXL (TOSOH), using an HPLC system, PU-1580i, connected to an MD1515 multiwavelength detector (JASCO). Electron microscopy An aliquot of solutions containing TKS1-CPN variants was applied onto specimen grids covered with a thin carbon support film that was made hydrophilic by an ion spattering device (HDT-400; JEOL, Tokyo, Japan) and then negatively stained with 1% uranyl acetate for 30 s. The images were recorded with a slow-scan CCD camera (Gatan retractable MultiScan camera; Gatan, Inc., Pleasanton, CA) under low-electron-dose conditions at a magnification of 50,000× in a transmission electron microscope (Tecnai F20; FEI Company, Eindhoven, The Netherlands) operated at 120 kV. The images were analyzed on computers using DigitalMicrograph (Gatan, Inc.). Protease sensitivity assay TKS1-CPN variants (100 nM) were incubated with or without ATP (1 mM) at 65 °C in TKM buffer with continuous mixing. Digestion with thermolysin (1 ng/μl) was performed for 10 min at 65 °C. Proteins in the reaction mixture were precipitated by the addition of trichloroacetic acid and then analyzed on 10% SDS gels. The gels were stained with Coomassie Brilliant Blue R-250. Protein folding assay GFP (5 μM) was denatured in TKM buffer containing 5 mM dithiothreitol and 0.1 M HCl at room temperature and diluted 100-fold in the preincubated TKM folding buffer with or without TKS1-CPN variants (100 nM) at 60 °C for 10 min. Five minutes after the dilution of denatured GFP, ATP was added to the mixture to a final concentration of 1 mM. The fluorescence of GFP at 510 nm with excitation at 396 nm was continuously monitored for 60 min using a spectrofluorometer (FP-6500). The reaction mixtures were continuously stirred at 60 °C throughout the assays. As a control, native GFP was diluted in the folding buffer without chaperonin. The fluorescence intensity of native GFP was taken as 100%. Diffracted X-ray tracking A 50-μm-thick polyimide film (Kapton, Du Pont-Toray, Tokyo, Japan) coated with chromium (10 nm) and gold (25 nm) by vapor deposition was used as a substrate surface for DXT. For immobilizing His-tagged chaperonin, the gold-coated substrate surface was coated with 3,3′dithiobis [N-(5-amino-5-carboxypentyl) propionamide-N′,N′diacetic acid] dihydrochloride (2 mM in ethanol) (dithiobis C2-NTA; Dojindo, Japan) for 10 h at 4 °C, washed carefully with ethanol and distilled water and immersed into 100 mM

Please cite this article as: Yamamoto Yohei Y., et al, Inter-Ring Communication Is Dispensable in the Reaction Cycle of Group II Chaperonins, J Mol Biol (2014), http://dx.doi.org/10.1016/j.jmb.2014.05.013

11

Inter-Ring Communication of Group II Chaperonins

NiSO4 aqueous solution for 4 h at 4 °C. The resulting Ni-NTA-modified substrate was washed with distilled water and experimental buffer. An aliquot of a mutant chaperonin solution (0.2 mg/ml) in Mops buffer [50 mM Mops, 100 mM KCl and 5 mM MgCl2 (pH 7.0)] was applied to the goldor Ni-NTA-modified substrate for 8 h at 4 °C. The chaperonin-modified surface was rinsed with the same buffer and reacted with gold nanocrystal solution for 8 h at 4 °C. The gold nanocrystal-modified chaperonin surface was rinsed with Mops buffer and stored in the same Mops buffer until use. An experimental chamber was constructed of sample substrate film with a spacer of polyimide film of 50 μm thickness. The chamber was filled with Mops buffer containing no ATP or 1 mM ATP for DXT measurement. The dynamics of chaperonins were monitored through the trajectories of the Laue spots from the gold nanocrystals, which were labeled on the chaperonins. White X-rays, 14.0– 16.5 keV (Undulator ID gap = 31.0 mm), from the beam line BL40XU (SPring-8, Japan) were used to record Laue diffraction spots from the gold nanocrystals on group II chaperonins. The X-ray beams at the sample were 40 μm (vertical) and 250 μm (horizontal). The time-resolved diffraction images were monitored by an X-ray image intensifier (V5445P; Hamamatsu Photonics, Japan) and a CCD camera (C4880-80; Hamamatsu Photonics). The specimen-tosample distance was approximately 100 mm and calibrated by diffraction from gold film. The sample temperature during DXT was controlled by hot air blowers at approximately 60 °C (TRIAC PID, Leister, Switzerland), which is the working temperature for the TKS1-CPN chaperonin. Gold nanocrystals were obtained by epitaxial growth on NaCl (100) substrate and were dissolved with detergent [n-decyl-β-D-maltoside (Dojindo Laboratories, Japan) and 50 mM Mops (pH 7.0)]. The average diameter of the gold nanocrystals was estimated to be 40 nm and confirmed by atomic force microscopy images. Custom software written for IGOR Pro (Wavemetrics, Lake Oswego, OR) was used to analyze the diffracted spot tracks and trajectories. Fluorescence intensity assay The fluorescence spectra of CPN ΔATPaseK485W and CPN ΔATPaseK165A/K485W were measured at 60 °C with a spectrofluorometer (FP-6500). Chaperonin complexes (500 nM) in TKM buffer were preincubated with or without nucleotide (1 mM) at 60 °C. The excitation wavelength was set at 295 nm, and emission was recorded at wavelengths ranging from 305 to 400 nm. All of the fluorescence intensity spectra were independently analyzed three times. The values were normalized to fit the maximum fluorescence with 1 mM ATP to be 100.

Acknowledgments We appreciate Dr. Toshihiko Oka of Shizuoka University for giving important suggestion on the site of circular permutation. This study was supported by Grants-in-Aid for Scientific Research (21370067, 22020011, 24370064 and 26102511) from the Ministry of Education, Culture, Sports, Science and Technology

of Japan to M.Y. DXT experiments were performed at the BL40XU in the SPring-8 with the approval of the Japan Synchrotron Radiation Research Institute (Proposal Nos. 2010B1130, 2011B1368, 2010A1790 and 2013A1353). Received 4 April 2014; Received in revised form 9 May 2014; Accepted 15 May 2014 Available online xxxx Keywords: chaperone; chaperonin; allostery; folding; circular permutation Abbreviations used: DXT, diffracted X-ray tracking; CS, citrate synthase; NiNTA, nickel-nitrilotriacetic acid.

References [1] Yebenes H, Mesa P, Munoz IG, Montoya G, Valpuesta JM. Chaperonins: two rings for folding. Trends Biochem Sci 2011;36:424–32. [2] Horwich AL, Fenton WA, Chapman E, Farr GW. Two families of chaperonin: physiology and mechanism. Annu Rev Cell Dev Biol 2007;23:115–45. [3] Horwich AL, Fenton WA. Chaperonin-mediated protein folding: using a central cavity to kinetically assist polypeptide chain folding. Q Rev Biophys 2009;42:83–116. [4] Phipps BM, Typke D, Hegerl R, Volker S, Hoffmann A, Stetter KO, et al. Structure of a molecular chaperone from a thermophilic archaebacterium. Nature 1993;361:475–7. [5] Gutsche I, Essen LO, Baumeister W. Group II chaperonins: new TRiC(k)s and turns of a protein folding machine. J Mol Biol 1999;293:295–312. [6] Ditzel L, Lowe J, Stock D, Stetter KO, Huber H, Huber R, et al. Crystal structure of the thermosome, the archaeal chaperonin and homolog of CCT. Cell 1998;93:125–38. [7] Klumpp M, Baumeister W, Essen LO. Structure of the substrate binding domain of the thermosome, an archaeal group II chaperonin. Cell 1997;91:263–70. [8] Shomura Y, Yoshida T, Iizuka R, Maruyama T, Yohda M, Miki K. Crystal structures of the group II chaperonin from Thermococcus strain KS-1: steric hindrance by the substituted amino acid, and inter-subunit rearrangement between two crystal forms. J Mol Biol 2004;335:1265–78. [9] Yoshida T, Yohda M, Iida T, Maruyama T, Taguchi H, Yazaki K, et al. Structural and functional characterization of homooligomeric complexes of alpha and beta chaperonin subunits from the hyperthermophilic archaeum Thermococcus strain KS-1. J Mol Biol 1997;273:635–45. [10] Iizuka R, Yoshida T, Shomura Y, Miki K, Maruyama T, Odaka M, et al. ATP binding is critical for the conformational change from an open to closed state in archaeal group II chaperonin. J Biol Chem 2003;278:44959–65. [11] Kanzaki T, Iizuka R, Takahashi K, Maki K, Masuda R, Sahlan M, et al. Sequential action of ATP-dependent subunit

Please cite this article as: Yamamoto Yohei Y., et al, Inter-Ring Communication Is Dispensable in the Reaction Cycle of Group II Chaperonins, J Mol Biol (2014), http://dx.doi.org/10.1016/j.jmb.2014.05.013

12

[12]

[13]

[14]

[15]

[16] [17]

[18]

[19]

[20]

Inter-Ring Communication of Group II Chaperonins

conformational change and interaction between helical protrusions in the closure of the built-in lid of group II chaperonins. J Biol Chem 2008;283:34773–84. Sekiguchi H, Nakagawa A, Moriya K, Makabe K, Ichiyanagi K, Nozawa S, et al. ATP dependent rotational motion of group II chaperonin observed by X-ray single molecule tracking. PLoS One 2013;8:e64176. Rye HS, Burston SG, Fenton WA, Beechem JM, Xu Z, Sigler PB, et al. Distinct actions of cis and trans ATP within the double ring of the chaperonin GroEL. Nature 1997;388:792–8. Fridmann Y, Kafri G, Danziger O, Horovitz A. Dissociation of the GroEL-GroES asymmetric complex is accelerated by increased cooperativity in ATP binding to the GroEL ring distal to GroES. Biochemistry 2002;41:5938–44. Rye HS, Roseman AM, Chen S, Furtak K, Fenton WA, Saibil HR, et al. GroEL-GroES cycling: ATP and nonnative polypeptide direct alternation of folding-active rings. Cell 1999;97:325–38. Bigotti MG, Clarke AR. Cooperativity in the thermosome. J Mol Biol 2005;348:13–26. Kusmierczyk AR, Martin J. Nested cooperativity and salt dependence of the ATPase activity of the archaeal chaperonin Mm-cpn. FEBS Lett 2003;547:201–4. Kafri G, Horovitz A. Transient kinetic analysis of ATP-induced allosteric transitions in the eukaryotic chaperonin containing TCP-1. J Mol Biol 2003;326:981–7. Kafri G, Willison KR, Horovitz A. Nested allosteric interactions in the cytoplasmic chaperonin containing TCP-1. Protein Sci 2001;10:445–9. Weissman JS, Hohl CM, Kovalenko O, Kashi Y, Chen S, Braig K, et al. Mechanism of GroEL action: productive release of polypeptide from a sequestered position under GroES. Cell 1995;83:577–87.

[21] Nielsen KL, Cowan NJ. A single ring is sufficient for productive chaperonin-mediated folding in vivo. Mol Cell 1998;2:93–9. [22] Nielsen KL, McLennan N, Masters M, Cowan NJ. A singlering mitochondrial chaperonin (Hsp60-Hsp10) can substitute for GroEL-GroES in vivo. J Bacteriol 1999;181:5871–5. [23] Sun Z, Scott DJ, Lund PA. Isolation and characterisation of mutants of GroEL that are fully functional as single rings. J Mol Biol 2003;332:715–28. [24] Liu H, Kovacs E, Lund PA. Characterisation of mutations in GroES that allow GroEL to function as a single ring. FEBS Lett 2009;583:2365–71. [25] Iizuka R, Yoshida T, Ishii N, Zako T, Takahashi K, Maki K, et al. Characterization of archaeal group II chaperoninADP-metal fluoride complexes: implications that group II chaperonins operate as a “two-stroke engine”. J Biol Chem 2005;280:40375–83. [26] Farr GW, Furtak K, Rowland MB, Ranson NA, Saibil HR, Kirchhausen T, et al. Multivalent binding of nonnative substrate proteins by the chaperonin GroEL. Cell 2000;100:561–73. [27] Nakagawa A, Moriya K, Arita M, Yamamoto Y, Kitamura K, Ishiguro N, et al. Dissection of the ATP-dependent conformational change cycle of a group II chaperonin. J Mol Biol 2014;426:447–59. [28] Luo H, Zhang P, Robb FT. Oligomerization of an archaeal group II chaperonin is mediated by N-terminal salt bridges. Biochem Biophys Res Commun 2011;413:389–94. [29] Yoshida T, Ideno A, Hiyamuta S, Yohda M, Maruyama T. Natural chaperonin of the hyperthermophilic archaeum, Thermococcus strain KS-1: a hetero-oligomeric chaperonin with variable subunit composition. Mol Microbiol 2001;39:1406–13.

Please cite this article as: Yamamoto Yohei Y., et al, Inter-Ring Communication Is Dispensable in the Reaction Cycle of Group II Chaperonins, J Mol Biol (2014), http://dx.doi.org/10.1016/j.jmb.2014.05.013