Interaction between FMDV Lpro and transcription factor ADNP is required for optimal viral replication

Virology 505 (2017) 12–22

Contents lists available at ScienceDirect

Virology journal homepage: www.elsevier.com/locate/yviro

Interaction between FMDV Lpro and transcription factor ADNP is required for optimal viral replication

MARK

Gisselle N. Medinaa, Giselle M. Knudsenc, Alexander L. Greningerb, Anna Kloca,d, Fayna Díaz⁎ San Segundoa, Elizabeth Riedera, Marvin J. Grubmana, Joseph L. DeRisib, Teresa de los Santosa, a

Plum Island Animal Disease Center (PIADC), North Atlantic Area, Agricultural Research Service US Department of Agriculture, Greenport, NY 11944, USA Howard Hughes Medical Institute and the Department of Biochemistry & Biophysics, University of California, San Francisco, CA 94158, USA c Department of Pharmaceutical Chemistry, University of California, San Francisco, CA 94158, USA d Oak Ridge Institute for Science and Education, PIADC Research Participation Program, Oak Ridge, TN 37831, USA b

A R T I C L E I N F O

A BS T RAC T

Keywords: FMDV ADNP IFN Chromatin remodeling Leader Lpro Innate immunity Transcription Repressor Brg1

The foot-and-mouth disease virus (FMDV) leader protease (Lpro) inhibits host translation and transcription affecting the expression of several factors involved in innate immunity. In this study, we have identified the host transcription factor ADNP (activity dependent neuroprotective protein) as an Lpro interacting protein by mass spectrometry. We show that Lpro can bind to ADNP in vitro and in cell culture. RNAi of ADNP negatively affected virus replication and higher levels of interferon (IFN) and IFN-stimulated gene expression were detected. Importantly, infection with FMDV wild type but not with a virus lacking Lpro (leaderless), induced recruitment of ADNP to IFN-α promoter sites early during infection. Furthermore, we found that Lpro and ADNP are in a protein complex with the ubiquitous chromatin remodeling factor Brg-1. Our results uncover a novel role of FMDV Lpro in targeting ADNP and modulation of its transcription repressive function to decrease the expression of IFN and ISGs.

1. Introduction

(Piccone et al., 1995a) that was found to be highly attenuated in both cattle and swine (Chinsangaram et al., 1998; Mason et al., 1997). In vitro studies showed that the attenuated phenotype of leaderless correlated with higher production of IFNα/β in supernatants from leaderless as compared to wild-type (WT) virus infected cells (Chinsangaram et al., 1999; de los Santos et al., 2006). Lpro has been implicated in a very efficient shut off of capdependent host cellular protein synthesis by cleaving eIF-4G homologues within FMDV infected cells (Devaney et al., 1988; Kirchweger et al., 1994). In addition, Lpro inhibits cellular transcription affecting the function of transcription factors that play key roles in innate immunity such as nuclear factor κB (NF-κB) and interferon regulatory factors 3 and 7 (IRF-3/7) (de los Santos et al., 2007; Wang et al., 2010). Most recently, Lpro has been shown to have deubiquitinase activity, thus removing ubiquitin molecules from components of innate immunity signaling pathways including retinoic acid inducible gene 1 (RIG-1); TANK binding kinase 1 (TBK1); TNF receptor-associated factor 3 (TRAF 3), and TRAF 6 (Wang et al., 2011). Some other cellular factors have been identified as direct interactors and targets of Lpro including Xenopus laevis cyclin B, human cyclin A and Gemin 5 (Pacheco et al., 2009; Piñeiro et al., 2012; Ziegler et al., 1995);

Foot-and-mouth disease virus (FMDV) is a member of the Aphthovirus genus of the Picornaviridae family. It is one of the most contagious viral pathogens of cloven-hoofed animals (Grubman and Baxt, 2004) and is considered a major economic threat worldwide. The genome of FMDV is a single-stranded RNA molecule and encodes a long polyprotein of about 2300 amino-acids that is processed by virusencoded proteases, Lpro and 3Cpro. A third virus-encoded protein, 2A, performs co-translational cleavage of the polyprotein by a non-proteolytic mechanism (de Felipe and Ryan, 2004; Ryan and Drew, 1994). Lpro is the first protein to be translated and translation starts at two alternative AUGs separated by 84 nucleotides giving rise to two L proteins of different length, Lb (Lpro) and Lab, being Lpro the physiologically relevant form (Cao et al., 1995). Lpro is a well characterized cysteine protease that cleaves itself from the nascent polyprotein precursor intra- and inter-molecularly (Kleina and Grubman, 1992; Strebel and Beck, 1986) and serves as a virulence factor by facilitating extensive modifications of host cellular proteins during infection. The discovery of Lpro as a virulence factor was determined by developing a leader-deleted virus (leaderless, LLV)

⁎

Corresponding author. E-mail address: [email protected] (T. de los Santos).

http://dx.doi.org/10.1016/j.virol.2017.02.010 Received 17 December 2016; Received in revised form 12 February 2017; Accepted 13 February 2017 0042-6822/ © 2017 Published by Elsevier Inc.

Virology 505 (2017) 12–22

G.N. Medina et al.

the inflammatory cytokines TNF-α, IL-6 and IL-12 (Quintana et al., 2006) and decreasing the expression of CD69, CD154 and IFN-γ in vitro (Braitch et al., 2010). Based on its domain composition, ADNP can function as a transcription factor and has been found to interact with promoter regions of IFN-α (Qu et al., 2005). In addition, biochemical studies have demonstrated that ADNP has a role in cellular chromatin organization by interacting with the SWI/SNF chromatin-remodeling complex (BAF250a, BAF170 and Brahma-related gene 1 (Brg-1)/Brahma (BRM)) (Helsmoortel et al., 2014; Mandel and Gozes, 2007), heterochromatin regions (Mosch et al., 2011) and histone deacetylases (Joshi et al., 2013). These observations correlated with a transcriptional repressive function when targeted to a reporter gene in vitro (Mosch et al., 2011). In the current study, we demonstrate by AP-MS, as well as by coimmunoprecipitation and immunofluorescence assays, that ADNP physically interacts with the viral protein Lpro and its expression is critical for FMDV replication. We determined that ADNP acts as a repressor of IFN and ISG expression. Most importantly, chromatin immunoprecipitation (ChIP) assays demonstrated that ADNP binds to the IFN-α promoter in cells infected with WT and not with LLV, early in infection. In addition we observed that ADNP is processed during FMDV infection and Lpro catalytic activity is required. Our results suggest that the interaction of Lpro with ADNP provides a novel mechanism by which FMDV further attenuates the innate immune response by rapidly blocking transcription of antiviral host genes.

however, the role of these factors in FMDV pathogenesis is thus far not known. Although the critical role of Lpro in the inhibition of cellular transcription has been studied by several groups, the specific molecular mechanisms of how Lpro blocks or regulates transcription during infection remains elusive. Microarray cDNA technology has provided insights on the ability of Lpro to differentially regulate the transcription of specific target genes that are primarily dependent on the transcription factor NF-κB (Zhu et al., 2010). This study indicated that a number of genes regulated by Lpro were IFN-stimulated (ISGs) and included genes with antiviral activity, cytokines, transcription factors, genes involved in regulation of apoptosis and genes implicated in regulation of IFN signaling (Zhu et al., 2010). Although, regulation of gene transcription in non-infected cells is orchestrated by chromatin remodeling proteins and the covalent modifications of histones (Kouzarides, 2007), little is understood about the interplay between FMDV Lpro and these cellular factors. Given the crucial roles of Lpro in viral pathogenesis and its ability to inhibit the expression of distinct NF-κB-regulated genes, we sought to determine the effect of Lpro on the control of gene transcription by searching for cellular factors that may facilitate this action. By using affinity purification mass spectrometry (AP-MS), a powerful method for identifying viral-host interactions (Greninger et al., 2012; Jäger et al., 2012; Morris et al., 2014), we have now identified the protein activitydependent neuroprotective protein (ADNP) as a novel Lpro binding factor. The gene that encodes ADNP is highly conserved between humans, rats and mice (Zamostiano et al., 2001), and was originally identified as a neuroprotective protein induced by vasoactive intestinal polypeptide (VIP) in astrocytes (Zusev and Gozes, 2004). The predicted structure of the protein contains nine zinc fingers, a proline-rich region, a nuclear bipartite localization signal, cellular export and import signals and a homeobox domain profile (Fig. 1A). Its neuroprotective function is mediated by NAP (NAPVSIPQ), an 8-amino acid fragment of ADNP that targets tubulin in astrocytes after internalization (Gozes and Divinski, 2007). In addition to the neuroprotective effect, ADNP NAP also has shown to have immunomodulatory effects by downregulating

2. Results 2.1. ADNP and Lpro interact in HEK293 and LF-PK cells We have previously shown that during infection, WT FMDV can control cellular gene expression when compared to leaderless virus infection. Specifically, Lpro mostly regulates transcription of genes that are induced by the transcription factor NF-κB (Zhu et al., 2010). To better understand the interactions between Lpro and the host, we searched for candidate Lpro host interactors by affinity-purification with mass spectrometry (AP-MS) (Jäger et al., 2012). Over-expression of Lpro WT enzyme was unsuccessful in this system (Fig. 1B); however, use of the catalytically inactive LproC23A mutant (Piccone et al., 1995c) enabled robust expression of the epitope-tagged Lpro protein (Fig. 1B). A number of Lpro interacting proteins were identified by proteomic analysis (Supplementary Tables 1 and 2), including eIF-4G1, which was the most abundant in the AP-MS samples, and has been previously described (Devaney et al., 1988; Guarne et al., 1998). Several other proteins had highly specific interactions with Lpro C23A (Supplementary Table 3). These proteins included eIF-3 translation factors that form a complex with eIF-4G1, as well as the transcription factor ADNP, and the chromatin remodeling protein CHD8. In order to confirm the mass spectrometry results, we conducted co-immunoprecipitation experiments. Lysates were prepared from HEK293 cells transfected with plasmid DNA encoding LproC23A and/ or ADNP-myc-DDK and pCI-empty vector control. Forty-eight hours post-transfection, samples were incubated with antibodies that recognized DDK. As shown in Fig. 2A anti-DDK antibody recognized Cterminally tagged ADNP in the lysate prepared from ADNP-myc-DDK transfected cells but not in the cells transfected with either pCI-empty vector or pCI-Lpro. Although ADNP has a predicted molecular weight (MW) of 124 kDa, a band of ~150 kDa was detected in the western blot of the total lysate and the immunoprecipitated samples, as previously reported in the literature (Mandel and Gozes, 2007). Also as expected, the anti-Lb antibody recognized Lb in the corresponding transfected samples (Fig. 2A, lanes 2 and 3). Furthermore, Lb was specifically detected in the immunoprecipitate captured by anti-DDK in the sample where both Lb C23A and ADNP were co-transfected (Fig. 2A Co-IP, lane 3). Extracts prepared from cells that were transfected with pCI empty vector, pCI-Lb C23A or ADNP-myc-DDK alone (Fig. 2A, lanes 1,

Fig. 1. AP-MS and domain structure of ADNP. (A) Schematic of the domain structure of ADNP showing nine Zn2+ finger domains (grey), NAP (black) and DNA binding homeobox domain (pattern) drawn to scale. (B) HEK293 cells were transfected with pcDNA4/TO-Lpro WT or C23A. Strep-tagged Lpro and co-associated proteins were captured on Streptactin-agarose resin, then washed and eluted with desthiobiotin (Material and Methods). A portion of each eluate was run on 12% SDS-PAGE, then silver stained to visualize protein abundance, and the major proteins identified are indicated. Protein staining was only detected in samples transfected with pcDNA4/TO Lpro C23A. Affinity purification with FMDV Lpro C23A was repeated with n=5 biological replicate samples.

13

Virology 505 (2017) 12–22

G.N. Medina et al.

Fig. 2. Lpro co-immunoprecipitates with ADNP. (A) Cell lysates were isolated from HEK 293 cells transfected with pCI empty vector (lane1) or with DNA encoding Lb C23A in the absence (lane2) or presence of DNA encoding ADNP-myc-DDK (lane3) or transfected with ADNP-myc-DDK only (lane 4). Co-Immunoprecipitation and Western blotting were carried out with anti-DDK and anti-Lpro antibodies as indicated. Detection of tubulin is used as a loading control. The molecular weight of the proteins, in kDa, is listed on the left side of the panels (B) His-tag pulldown of LF-PK lysates incubated with increasing amounts (5, 10, 15 μg) of His-tag purified Lpro protein (lanes 2, 3 and 4) or from products derived from pET empty vector-control (lane1). Western blotting of eluate fractions purified by Ni-NTA was examined using polyclonal antibodies against ADNP, eIF-4G, and His. Brg-1 was detected with a monoclonal antibody.

endogenous ADNP in cells not expressing Lpro (Fig. 3 panel A and C, indicated by asterisk) showed an immunoreactive signal in the nucleus and a less prominent distribution in the cytoplasm detected with an Alexa Fluor 594 (red) tagged antibody. However, when cells were transfected with pCI-Lpro, a decreased signal for ADNP was detected predominantly in the nucleus of the co-transfected cells (Fig. 3 panels A-D). In this compartment, co-localization between ADNP and Lpro was detected by merging the images captured using the red and green channel and also by determining Pearson's correlation coefficient (R=0.55) in different cells (n=4) (Fig. 3 panels C-D, yellow). To confirm these results we examined LF-PK cells infected with FMDV. Similar to the transfection assays, localization of WT Lpro was visualized in the nucleus and in the cytoplasm at 4 h post-infection (hpi) as previously reported (de los Santos et al., 2007) (Fig. 3 panel G and H, green). Endogenous ADNP was found localized in the nucleus of both, infected and non-infected (indicated by double asterisk) cells but a significantly decreased immunoreactive signal was detected only in infected cells (Fig. 3 panels E-F). Mean intensity fluorescence of the red signal was determined for Lpro positive and mock cells (n=10) as described in Materials and Methods. An overall decrease of 40% in the red fluorescence signal was detected in infected cells when compared to the mock control. As in the transfected HEK 293 experiment, colocalization of ADNP and WT Lpro was observed by IFA mostly in the nucleus of infected LF-PK cells (n=10), with a moderate Pearson correlation coefficient (R=0.56) (Fig. 3 panel H). However, careful examination of individual co-localizing points (52%) within the nucleus, revealed a strong co-localization (R > 0.6) between WT Lpro and ADNP. These results suggest that Lpro and ADNP form a complex primarily localized in the nucleus of FMDV infected cells.

2 and 4) contained no cross-reactive material, indicating that recognition of Lpro was specific. Further examination of this interaction was pursued by His-tag pulldown experiments (Fig. 2B). Increasing amounts of purified His-Lpro pulled down endogenous ADNP from LF-PK cellular extracts as well as eIF-4G (panel B, lanes 2, 3 and 4); however no eIF-4G degradation products were detected indicating that under the experimental conditions, purified Lpro lacked enzymatic activity. His-tagged pulldown fractions were examined using an antibody against tubulin to confirm that detection of Lpro binding proteins were not a contamination product from total lysate (data not shown). ADNP has been previously shown to co-precipitate with the viral protein ICP8 of herpes simplex virus-1 (HSV-1) and the chromatin remodeling protein Brg-1 (Carter, 2011; Taylor and Knipe, 2004). Recent human interactome proteomic data also supports a relationship between ADNP, Brg-1 and CHD8 through a shared interaction (Hein et al., 2015). We therefore examined for the presence of Brg-1 in the same complex. Brg-1 was found in increased abundance with both, ADNP and Lpro in these samples (Fig. 2B). These results indicated that Lpro forms a novel protein complex with the host factors ADNP and Brg-1, at least in the context of co-immunoprecipitation or pulldown assays with the catalytically inactive LproC23A (Piccone et al., 1995c). 2.2. Lpro colocalizes with ADNP in the nucleus If ADNP and Lpro form an intracellular complex, we hypothesized that this interaction would occur in the nucleus, since the majority of endogenous ADNP is nuclear (Furman et al., 2004), and Lpro is known to traffic to the same compartment (de los Santos et al., 2007). To investigate the localization of this interaction we first examined HEK 293 cells transfected with pCI-Lpro by IFA. Indirect detection of Lpro using a mouse anti-L antibody and Alexa Fluor 488 (green)-tagged anti-mouse secondary antibody showed a distinct punctate distribution in the cytoplasm and nucleus (Fig. 3 panels B- D). Detection of

2.3. Depletion of ADNP by RNAi affects FMDV replication To better understand the role, if any, of ADNP during FMDV 14

Virology 505 (2017) 12–22

G.N. Medina et al.

Fig. 3. Nuclear colocalization of Lpro and ADNP. (A-D) Fluorescence microscopy images from HEK 293 cells transfected with DNA encoding pCI-Lpro and fixed 24 h post- transfection. Samples were stained with anti-ADNP (red, panel A), anti-L (green, panel B) and with nuclear stain Hoechst 33258 (blue). Panel C shows the merged images and inset indicates nuclear colocalization. (E-H) Fluorescent microscopy images from LF-PK cells infected with A12 FMDV and fixed at 4 h post-infection. Samples were stained with anti-ADNP (red, panel E and F) and anti-L (green, panel G). Panels D and H are enlargements of the inset regions indicated in panels C and G, respectively. Pearson's values for the co-localization (n=10) were 0.55 (panel D) and 0.56 (panel H). Scale bars =10 µm. (*) denotes cells not expressing Lpro; (**) denotes non-infected cells. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).

2.4. ADNP facilitates FMDV replication by repressing IFN and ISG expression

infection we used RNAi. LF-PK cells were transfected with ADNPtarget siRNA or a nontargeting control siRNA (siAll Star) and at 48 h post-transfection, cells were infected with WT FMDV. As shown in Fig. 4A, treatment with low amounts (5 or 10 nM) of the ADNP specific siRNA (Fig. 4A, lanes 4 and 5), but not with the non-targeting control siAll Star (Fig. 4A, lanes 2 and 3), depleted the pool of ADNP to nearly undetectable levels. WT virus titers were measured and analyzed in the transfected cells (Fig. 4B). Interestingly, siRNA targeted reduction of endogenous ADNP caused an approximate 30-fold decrease in FMDV WT virus yield relative to cells transfected with non-targeting siRNA All Star control. Since, ADNP and Lpro form a cellular complex during infection, we wanted to determine whether the requirement for ADNP during virus replication was dependent upon Lpro. To this end, we infected siAll Star or siADNP treated cells with FMDV WT or leaderless (LLV) for 4 h and/or 24 h at 37 °C. Successful depletion of ADNP was verified by western blot before cells were infected. Consistent with the results obtained in Fig. 4B, analysis of virus titers yielded a 97% reduction for FMDV WT in ADNP depleted samples when compared to the control siAll Star (Fig. 4C, D). Despite the lower end point titers obtained for attenuated LLV only a non-statistically significant reduction of 20% was observed under similar conditions. These results indicate that ADNP and Lpro are required for optimal FMDV replication. We also examined whether depletion of ADNP could affect the growth of FMDV SAP, a mutant virus containing two aminoacid substitutions that affect Lpro deubiquitinase, but not proteinase activity, at least in the context of processing the viral polyprotein or the translation factor eIF-4G (Wang et al., 2011). In contrast to WT and similarly to FMDV LLV, a non-significant reduction of FMDV SAP titers suggested that Lpro deubiquitinase activity is required for ADNP repressive function during viral infection. Our results also confirmed that the decrease in WT FMDV titer correlated with the presence of enzymatically active Lpro and was not due to the nonspecific induction of antiviral pathways by transfection of siRNAs (Sledz et al., 2003).

It has been reported that ADNP contains a homeobox domain that is responsible for its transcription factor function, and several studies indicate that ADNP possesses a transcription repressor activity due to its association with heterochromatin regions and histone deacetylases (Joshi et al., 2013; Mosch et al., 2011). Hence, ADNP could facilitate FMDV replication by inhibiting the expression of actively transcribed genes, such as those induced by viral infection. To test this hypothesis, we first examined the ability of ADNP to bind to chromatin at the IFNα promoter sites during infection in porcine cells by ChIP analysis. LFPK cells were mock infected or infected with WT or LLV FMDV and samples were collected at 2 and 4hpi. Analysis of DNA bound to ADNP revealed that, following infection with WT virus at 2hpi, there was a statistically significant 14-fold enrichment at the IFN-α promoter site. In contrast, the levels of ADNP-bound DNA did not change at IFN-α sites in samples infected with LLV at 2 or 4hpi or with WT virus at 4hpi (Fig. 5A). We next analyzed if the presence of ADNP could affect transcription of IFN and ISGs. We conducted siRNA experiments and analyzed the expression of type I IFN (α/β) and some ISGs including CXCL-10, IRF7, ISG-15, MDA-5, Mx-1, OAS-1 and RIG-I. LF-PK cells were mock transfected or transfected with siAll Star or siADNP. Successful depletion of ADNP in cells was confirmed by immunoblots from lysates generated from the same experimental sample (Fig. 5B). Interestingly, depletion of ADNP resulted in statistically significant induction of IFNα and –β ( > 100 fold increase) transcripts as shown in Fig. 5C. In addition, transcripts for CXCL-10, ISG-15, MDA-5, Mx-1, OAS-1, and RIG-I showed upregulation (≥2 fold increase) when compared to siRNA control (Fig. 5D). With the exception of PKR, induction was observed for all analyzed ISGs with statistical significance for CXCL-10, ISG-15, Mx-1 and OAS-1. Altogether, these results indicated that 15

Virology 505 (2017) 12–22

G.N. Medina et al.

Fig. 4. Depletion of endogenous ADNP inhibits FMDV replication. (A) Lysates were prepared from LF-PK cells mock transfected (lane 1) or transfected with siAll Star (lanes 2–3) or siADNP (lanes 4–5) and ADNP was detected by western blot. Separate bottom panel shows detection of tubulin to ensure that equal amounts of protein were applied to each lane. (B) Effect of ADNP depletion on FMDV replication in LF-PK cells. Cells were transfected with siAll Star (control) or ADNP-specific siRNA molecules (10 nM) and 48 h post-transfection cells were infected (MOI 1) with FMDV and incubated at 37 °C for 7 h. Virus yields were determined by plaque assay on BHK monolayers and are expressed in PFU/ml. The values are presented as the mean ± the standard deviation of four independent experiments. (C and D) Percentage of virus replication of WT, leaderless, or SAP mutant FMDV in ADNP depleted cells. LF-PK cells were transfected with siAll Star or siADNP and infected (MOI 0.1) with WT, leaderless, SAP mutant FMDV, followed by incubation at 37 °C for 4 h (C) or 24 h (D). Virus yields were determined by plaque assay on BHK cells and are expressed in percentage (%) and normalized to the control. Absolute values of end point titers (pfu/ml) at 4 and 24 h are shown (right insets). The values are presented as the mean ± the standard deviation of three independent experiments. Separate panel shows western blot detection of ADNP and tubulin to ensure depletion of ADNP in siRNA transfected and infected LF-PK cells. Statistical analysis was performed using Student's t-test. *, P < 0.05; **, P < 0.01.

tion (Fig. 6A, lanes 3 and 4). These results suggested that ADNP and Brg-1 were processed in an Lpro dependent manner. To confirm the requirement of a catalytically active Lpro for processing of ADNP, we treated HEK 293 cell extracts over-expressing ADNP-myc-DDK with bacterial cell extracts containing WT or catalytically inactive (C23A) Lpro (Piccone et al., 1995b, 1995c). We used whole bacterial cell lysates instead of purified Lpro, because in our hands and under the used experimental conditions, these crude extracts consistently displayed enzymatic activity (Fig. 2B), As seen in Fig. 6B adding increasing amounts of WT Lpro correlated with a decrease in the amount of full length ADNP and the consistent appearance of increasing amounts of a cleavage/processed product of about 120 kDa (Fig. 6B, lanes 5–8). In contrast, no processing of ADNP was detected after incubation of the cell lysates with bacterial extracts containing the inactive LproC23A (Fig. 6B, lanes 9–12). These results indicate that processing of the cellular protein ADNP requires the presence of enzymatically active FMDV Lpro.

ADNP binds to chromatin at IFN-α promoter sites and its depletion by RNAi releases the transcription repressive activity on type I IFNs and ISGs. 2.5. ADNP is processed in the presence of active Lpro during infection The observed reduction of ADNP signal detected by IFA (Fig. 3), and the decrease of specific binding to the IFN-α promoter at 4hpi (Fig. 5) suggested that ADNP protein could be processed/degraded during FMDV infection. LF-PK cells were infected with WT (A12-WT) or leaderless (A12-LLV) virus, or mock infected followed by analysis of host and viral proteins by western blotting. As seen in Fig. 6 by 4 hpi ADNP levels were significantly reduced when compared to mock infected cells and by 6 hpi. Although intact protein was detectable, there was a progressive reduction in signal when compared to mock or earlier time points during infection (Fig. 6A, lanes 1, 3 and 4). Examination at 24 hpi resulted in the lack of detection of ADNP signal (Fig. 6A, lane 5). In contrast, no significant changes in the ADNP levels were detected in cells infected with A12-LLV (Fig. 6A, lanes 6- 9). Notably, whereas a band of about 150 kDa was detected in all, mock, A12-WT and A12-LLV infected cells between 0 and 4 hpi, a discrete faster migrating (smaller than 120 kDa) specific anti-ADNP reactive band was only observed in cells infected with A12-WT (Fig. 6A lanes 3 and 4*). Interestingly, examination of endogenous Brg-1 protein showed a decreased signal in samples infected with A12-WT and not with A12-LLV at 2, 4 and 6 hpi (Fig. 6A lower panels, lanes 2–4 and 6– 8). Similar to the effects observed by A12-WT on ADNP, short and long-term exposure of film revealed the presence of specific Brg-1smaller bands, presumably resulting from protein processing/degrada-

3. Discussion During FMDV infection, translation of the first encoded protein, Lpro, is instrumental in orchestrating and exerting control of innate immunity (de los Santos et al., 2006; Wang et al., 2010). In addition to inhibiting protein synthesis (Chinsangaram et al., 1999; Devaney et al., 1988; Kirchweger et al., 1994), Lpro can interfere with rapid transcription of genes such as IFNs (de los Santos et al., 2007; Zhu et al., 2010). In this study, we identified a novel additional mechanism used by Lpro to downregulate antiviral gene expression primarily relying on IFNs and ISGs. Using AP-MS, we show that Lpro can associate with the 16

Virology 505 (2017) 12–22

G.N. Medina et al.

Fig. 5. ADNP binds to IFN-α promoter and its depletion increases the expression of ISGs transcripts. (A) ChIP assay was conducted in cells infected with WT or LLV FMDV at 2 and 4hpi. The results are expressed as the fold increase in ADNP binding to the IFN-α promoter DNA in infected vs mock infected cells. (B) LF-PK cells were mock transfected or transfected with siAll Star (control) or siRNAs targeting ADNP. 48 h post- transfection lysates were harvested for concurrent protein expression and mRNA analysis. Depletion of ADNP was confirmed by western blotting using rabbit polyclonal anti-ADNP. Loading control tubulin was examined using mouse mAb anti-tubulin-α. (C) Expression of IFN-α or IFN-β mRNA was measured by RT-qPCR. Porcine β-actin was used as an internal control. (D) The expression of CXCL-10, ISG-15, IRF-7, OAS-1, RIG-I, MDA-5, Mx-1 and PKR mRNAs was measured by real-time RT-PCR. Porcine GAPDH was used as an internal control. The results are expressed as the fold increase in gene expression for siAll Star or siADNP transfected with respect to mock transfected cells. Statistical analysis was performed using Student's t-test. *, P < 0.05.

infection thus resulting in a generalized repression of cellular transcription. Therefore, it is possible that ADNP may serve as a bridge for Lpro and other FMDV non-structural proteins such as 3C or 3CD that might also be associated with nuclear DNA. Early during infection we observed that ADNP binds chromatin at IFN-α promoter sites (Fig. 5A). Consistently with its reported repressive activity (Mosch et al., 2011) we observed that ADNP depletion generates a cellular environment with higher basal levels of IFN and ISGs that probably account for the significant reduction in FMDV titer as demonstrated in Fig. 4. The fact that ADNP interacts with the chromatin remodeling machinery offers supportive evidence for its role in gene transcription during virus infection. The presence of FMDV Lpro might facilitate the binding of ADNP to DNA, early post infection, to influence a repressive transcription state at the specific promoters of IFN and ISGs. Mapping of the binding domains between Lpro and ADNP should provide additional details of the specific mechanism involved in this interaction. Interestingly, we found Lpro in the same complex as Brg-1, a protein previously known to be a component of the chromatin remodeling machinery (Mandel and Gozes, 2007), (Fig. 2B) suggesting that Brg-1 may also play a role in FMDV replication. However, RNAi of Brg-1 did not have a clear effect on FMDV replication (data not shown). It is possible that this lack of effect could be attributed to the presence of an alternative core subunit, i.e. BRM,

transcription factor ADNP. Our results suggest that this interaction is critical during infection and may influence ADNP function in transcription, to favor virus replication. Although very little is known about the role of ADNP in virus replication, few studies have shown its interaction with chromatin remodeling proteins and viral proteins from HSV-1 (Taylor and Knipe, 2004) or human immunodeficiency virus (HIV) (Kalpana et al., 1994; Van Lint et al., 1997). Here we report for the first time, the involvement of ADNP and the chromatin remodeling complex during picornavirus infection. Our study elucidates two ADNP activities that might enable efficient virus replication through the control of gene transcription: i) transcriptional repressive activity and ii) biochemical association with components of the chromatin remodeling machinery. Our results indicate that wholesale depletion of ADNP causes the upregulation of ISG transcripts (Fig. 5). Recent reports have shown that ADNP has a silent function in the chromatin since its depletion caused an increase in the level of transcripts that otherwise were found at transcriptionally inactive sites (Mosch et al., 2011). In addition, association of ADNP with HDAC1, which is a well-known histone deacetylase and gene suppressor, further supports a role of ADNP in transcriptional repression (Joshi et al., 2013). Interestingly, studies by Falk et al. (1990) have previously revealed that FMDV 3C cleaves histone H3 during FMDV 17

Virology 505 (2017) 12–22

G.N. Medina et al.

Fig. 6. Lpro mediates processing of endogenous ADNP and Brg-1 during infection. (A) LF-PK cells were mock infected (lane 1) or infected (MOI 10) with FMDV WT (lanes 2–5) or leaderless virus (LLV) (lanes 6–9). At the indicated times after infection, cell extracts were prepared, fractionated by SDS-PAGE, and ADNP and Brg-1 were detected by western blot. Separate bottom panels show detection of tubulin to ensure that equal amounts of protein were applied to each lane. Positions of ADNP (arrow) and a putative processing product (-asterisk) are indicated. The molecular weight of the proteins, in kDa, is listed on the left side of the panels. (B) ADNP-myc-DDK transfected HEK293 cells extracts were treated with increasing amounts of crude lysates of E. coli expressed Lpro or inactive Lpro C23A (0.5–2 μg protein) for 24 h at 30 oC. Proteins were resolved by SDS-PAGE and detected by western blot.

during infection. Our data suggests that early post infection, Lpro may enhance the binding of ADNP, or other transcription factors of the same complex (Helsmoortel et al., 2014) to specific promoter sequences, thus enhancing the repressive activity on IFN and ISGs transcription. Interestingly, ADNP and other transcription factors of the same complex are processed later during viral infection. A schematic of this hypothesis is depicted in Fig. 7. Lpro binding to ADNP may result in a repressive state at specific promoter sites. Interaction with other repressor proteins of the general transcriptional machinery, such as HDAC1 (Joshi et al., 2013) and HP1 (Mosch et al., 2011), could create an environment that blocks expression of IFN and ISGs which consequently would inhibit virus replication. Further experiments are planned to elucidate the details of the molecular mechanisms involved in these specific interactions, and to evaluate whether virus dependent processing of these factors during infection is of biological significance. In summary we have identified a cellular protein, ADNP, which is

which like Brg-1, contains the ATPase activity necessary for efficient chromatin remodeling processes and control of transcription (Mandel and Gozes, 2007). Further studies are required to confirm this hypothesis. Paradoxically, during infection, a ~118–120 kDa ADNP processed/ degraded product was observed only in cells infected with FMDV WT or in vitro, by treating HEK 293 cell lysates with E. coli expressed WT FMDV Lpro (Fig. 6). Moreover, the same product was detected in porcine cells infected with a chimeric Theiler's murine encephalomyelitis virus expressing FMDV Lpro and not the catalytically inactive C23A mutant (Piccone et al., 1996) (data not shown). These results strongly suggest that ADNP is processed in a Lpro dependent fashion, although at this point, we do not know whether the processing is directly performed by Lpro or requires other cellular activities (i.e. proteases, caspases or protein modifying enzymes) that may be induced or activated by Lpro. In fact, we have previously reported that the p65 subunit of the transcription factor NF-κB is degraded in a Lpro dependent manner, but no direct cleavage could ever been demonstrated (de los Santos et al., 2007). Moreover, in the same studies we ruled out the involvement of apoptosis as a degradative pathway that might have been induced during FMDV infection and could be associated with NF-κB degradation. Nevertheless, we cannot exclude that Lpro deubiquitinase activity may play a role in modifying ADNP or Brg-1, as demonstrated for other host factors involved in modulation of the IFN pathway (Wang et al., 2011). Indeed, depletion of ADNP did not significantly affect the growth of SAP FMDV, a mutant virus that decreases Lpro deubiquitinase activity (Wang et al., 2011). Examination of end point titers during SAP FMDV infection only displayed a modest nonsignificant reduction, similarly to the reduction observed after infection with leaderless virus (Fig. 4), suggesting that deubiquitinase activity is also needed for inhibition of FMDV growth in cells depleted of ADNP. The observation that WT FMDV replication is adversely affected when ADNP expression is artificially diminished by RNAi indicates that ADNP is an important host factor, at least in cell culture. The finding that replication of leaderless or SAP mutant viruses were not significantly affected by depletion of ADNP suggests that: a) the observed effect was not dependent on the non-specific induction of ubiquitous antiviral pathways by siADNP (Sledz et al., 2003), and b) Lpro and ADNP proteins, including their functions, are intimately associated

Fig. 7. Schematics of the putative role of ADNP during FMDV infection. Early during infection, ADNP binds to IFN-α promoter and along with other repressor proteins inhibits transcription of IFN and ISGs. Binding of Lpro to ADNP and Brg-1 may facilitate the ADNP suppressive transcriptional activity of antiviral genes to allow optimal FMDV replication.

18

Virology 505 (2017) 12–22

G.N. Medina et al.

linked to Lpro and is required for efficient viral replication. ADNP thus represents another novel host target of the viral machinery and may further illuminate the means by which FMDV subverts and modulates host factors expression by interacting with transcription factors including those involved in chromatin remodeling.

5.3. Viruses FMDV WT (wild type) was generated from the full-length serotype A12 infectious clone, pRMC35 (Rieder et al., 1993). LLV2 (leaderless virus) and SAP viruses were derived from the same infectious clone introducing a deletion of the Lb coding region, pRM-LLV2 (Piccone et al., 1995a) or mutating specific aminoacid residues, pA12#49 (-SAP-, de los Santos et al., 2009). Viruses were propagated in BHK-21 cells and were concentrated by polyethylene glycol precipitation and stored at −70 °C.

4. Conclusions FMD remains one of the most devastating diseases that affect livestock worldwide. Here we report the identification of a novel interaction between the FMDV Lpro and the transcription factor ADNP as part of a general transcription complex. During FMDV infection, interaction of Lpro with ADNP warrants the transcriptional repressive activity on IFN and ISGs, thus allowing optimal virus replication. This interaction uncovers a new novel mechanism by which Lpro counteracts the host innate immune response.

5.4. Viral infections Cultured cell monolayers were infected with FMDV WT, LLV2 or SAP at the indicated multiplicity of infection (MOI) for 1 h at 37 °C. After adsorption, cells were rinsed and incubated with MEM at 37 °C. For indirect immunofluorescence analyses (IFA) of FMDV infected cells, unabsorbed virus was removed by washing the cells with a solution containing 150 mM NaCl in 20 mM morpholino-ethanesulfonic acid (MES) pH=6.0, before adding MEM and proceeding with the incubation. For the examination of the effects of siRNA treatment on virus replication, transfected LF-PK cells were infected with the specified virus at a MOI of 0.1 followed by determination of end point viral titers at 4 or 24 h post-infection (hpi). Virus titers were determined on BHK-21 cells.

5. Materials and methods 5.1. Plasmids and reagents Plasmid pCMV6-ADNP encoding human ADNP C-terminally tagged with myc-DDK was purchased from Origene (Rockville, MD). The gene Lpro was cloned into the T7 promoter expression plasmid pET15b-6X-His (Novagen, Billerica, MA) using the restriction sites NdeI and BamHI. The mammalian expression vector pCI encoding Lpro was constructed by cloning the gene into NheI and BamHI restriction sites contained in the polylinker of pCI vector (pCI-Lpro) (Promega, Madison, WI). Site-directed mutagenesis at the active site C23 of Lpro was used to generate a proteolytically inactive protein (Lpro C23A) in various DNA vectors (Qiagen, Valencia, CA). For affinity-purification of Lpro-interacting proteins, Lpro C23A was cloned into a pcDNA-4TO expression vector containing a C-terminal 2x-StrepTag, as described (Greninger et al., 2012), cloning into the BamHI-XhoI restriction sites. When available, primary antibodies were purchased: polyclonal rabbit anti-ADNP and anti-eIF-4G from Bethyl Laboratories (Montgomery, TX); Mab mouse anti-DDK from Origene (Rockville, MD); polyclonal rabbit anti-His from eBioscience (San Diego, CA); polyclonal rabbit anti-Brg-1 from Santa Cruz Biotechnology (Dallas, TX) and mAb mouse anti-tubulin-alpha from NeoMarkers (Fremont, CA). Mab mouse anti-ADNP was used for ChIP analysis (Santa Cruz Biotechnology). Goat anti-mouse immunoglobulin G (IgG) and goat anti-rabbit IgG secondary antibodies conjugated to horseradish peroxidase (HRP) were obtained from Pierce (Rockford, IL). Sodium butyrate (Sigma, St. Louis, MO) was used when cells were transfected with plasmid pCMV6-ADNP-myc-DDK as recommended by the manufacturer.

5.5. Affinity-purification for Lpro protein-protein interactions AP-MS identification of Lpro-interacting proteins was performed as previously described (Greninger et al., 2012; Morris et al., 2014). Briefly, HEK 293T cells were transiently transfected with the pcDNA4/ TO-Lpro C23A expression vector using Transit LT1 transfection reagent (Mirus Bio, Madison, WI). After 60 h, cells were harvested by adding 10 mM EDTA, washed in cold Ca2+-free PBS and pelleted at 3500g. Cells were lysed in lysis buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA, 0.5% NP40 substitute®) for 30 min on a mixer at 4 °C, and then centrifuged at 13,000g at 4 °C. The supernatant was then applied to a StrepTactin resin (IBA Lifesciences, Olivette, MO), and the Strep-tagged FMDV Lpro C23A protein and its co-associated proteins were captured. After binding, the resin was washed three times in lysis buffer and once in detergent-free lysis buffer. Captured proteins were incubated with 40 µl of 1x desthiobiotin elution buffer (IBA Lifesciences) at room temperature for 1 h with end-over-end mixing. The final eluate was stored at −20 °C for further analysis. 5.6. Protein identification by mass spectrometry Protein identification in the Strep-tag captured eluates was performed using a peptide sequencing by tandem LC-MS/MS of trypsindigested samples as previously reported (Greninger et al., 2012; Morris et al., 2014). Briefly, for in solution trypsin digestion samples were denatured in urea, then reduced and alkylated with DTT and iodoacetamide, respectively before addition of trypsin for digestion. Samples were then acidified with addition of formic acid, and the peptides were desalted using C18 ZipTips (Millipore, Billerica, MA). Peptide samples were analyzed on an LTQ or LTQ-FT mass spectrometer (Thermo Scientific, Waltham, MA), equipped with a NanoAcuity ultra-highperformance liquid chromatography (UPLC) system (Waters, Milford, MA) for reversed-phase C18 chromatography. Data were acquired, processed and analyzed using identical methods to those previously reported (Greninger et al., 2012; Morris et al., 2014).

5.2. Cells Porcine kidney (LF-PK) cell lines were obtained from the Foreign Animal Disease Diagnostic Laboratory (FADDL) at the PIADC. These cells were maintained in minimal essential medium (MEM, GIBCO BRL, Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum (FBS) and supplemented with 1% antibiotics and non-essential amino acids. Human embryonic kidney (HEK) 293 cells lines from the American Type Culture Collection (ATCC; Rockville, MD) were used for co-immunoprecipitation experiments. HEK 293 cells were maintained in MEM containing 10% FBS supplemented with 1% antibiotics (GIBCO BRL), non-essential amino acids and L-Glutamine. BHK-21 cells (baby hamster kidney cells strain 21, clone 13, ATCC CL10), obtained from the American Type Culture Collection (ATCC) were used to propagate virus stocks and to measure virus titers. BHK-21 cells were maintained in MEM containing 10% calf serum and 10% tryptose phosphate broth supplemented with 1% antibiotics and non-essential amino acids. Cell cultures were incubated at 37 °C in 5% CO2.

5.7. Tandem mass spectrometric data analysis and specificity scoring LC-MS/MS data were searched with Protein Prospector v 5.10.17 software (Chalkley et al., 2008), using identical methods reported in 19

Virology 505 (2017) 12–22

G.N. Medina et al.

5.10. In vitro assay to evaluate ADNP processing

Greninger et al. (2012). Briefly, data from AP-MS samples were searched against the Homo sapiens plus Virus subset of the NCBInr RefSeq database (14 January 2012), to which were added our synthetic virus clone sequences, totaling 131,459 entries. This database was concatenated with a fully randomized set of 131,459 entries for estimation of the false discovery rate (Elias and Gygi, 2007). Data were searched using a mass tolerance of 0.8 Da for precursor and fragment masses with LTQ data, or 20 ppm precursor mass and 0.8 Da fragment mass tolerances for the LTQ-FT data. Protein identification data are reported in Supplementary Tables 1 and 2 using standard score thresholds a minimum Protein Prospector score of 22 for proteins and 15 for peptides, and a maximum expectation value of 0.01 for proteins and 0.05 for peptides resulting in an FDR < 1%. The identified frequent background proteins from the 2X-Strep-tag APMS system are reported separately in Supplementary Table 2 (Greninger et al., 2013). A Z-score calculation was used to differentiate specific FMDV Lpro C23A – human protein-protein interactions from background proteins using an AP-MS analysis with Z-scoring method that was previously described (Supplementary Table 3) (Greninger et al., 2013, 2012; Morris et al., 2014). The Z-score was calculated using the FMDV Lpro C23A AP-MS dataset of N=5 biological replicate experiments plus two additional technical replicates, and a background of N=636 unrelated control AP-MS experiments from a larger picornavirus-human proteinprotein interactions data set (Greninger et al., 2012).

HEK 293 cells were transfected with 5 μg of pCMV6-ADNP-mycDDK. At 48 h post-transfection, samples were harvested, rinsed twice with PBS and lysed with 2 ml of lysis buffer (0.5% NP-40 substitute, 50 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA) containing protease inhibitor cocktail tablets (Roche). Lysates were incubated at 4 °C for 20 min and cellular debris was collected by centrifugation at 10,000g for 15 min at 4 °C. Aliquots were incubated for 16 h at 30 °C with increasing concentrations (0.2–2 μg total protein measured by BCA) of crude Bug Buster® (Invitrogen) lysates of E. coli expressing Lb, Lb C23A, or negative control as previously described (Piccone et al., 1995b, 1995c). Proteins were resolved by SDS-PAGE and detected by western blot using anti-ADNP, anti-tubulin and anti-Lb antibodies. 3– 8% gradient NuPage Novex® (Invitrogen) were used for ADNP and tubulin and 10% NuPage BisTris® (Invitrogen) were used for Lpro. 5.11. Indirect immunofluorescence analyses (IFA) LF-PK cells were grown on 12 mm glass coverslips and infected with FMDV at a MOI=10 for the indicated time. Alternatively HEK 293 cells were transfected with pCI-Lpro. The cells were fixed in 4% paraformaldehyde, permeabilized with 0.5% Triton X-100® (Sigma) in PBS, blocked with blocking buffer (PBS, 2% bovine serum albumin [BSA], 5% normal goat serum, 10 mM glycine) and then incubated overnight at 4 °C with the respective primary antibodies. FMDV VP1 was detected with mouse mAb 6HC4 (2), Lpro with a mAb (5D8C5) elicited against bacterially expressed recombinant protein. Alexa Fluor 488 and Alexa Fluor 594 (Molecular Probes, Invitrogen) conjugated secondary Abs were used for detection. Nuclei were visualized by DAPI staining included in ProLong Gold Antifade mounting media (Invitrogen). Cells were examined in a fluorescence microscope and the images were taken with Nikon DS-Qi1 digital camera and NISElements Advance Research v3.00 software (Nikon Instruments, Inc, Melville, NY). To quantify relative co-localization of signal from two (red and green) channels, Pearson correlation coefficients were obtained using NIS-Elements software. The significance level of correlation coefficients was assessed as previously reported (Dunn et al., 2011). Nuclear red fluorescence intensity was also quantified using NIS-Elements software in multiple (n=10) infected and noninfected cells.

5.8. Co-immunoprecipitation assays Culture flasks containing 1×107 HEK 293 cells were transfected with 5 μg of pCI vector alone or pCI-Lb C23A or pCMV6-ADNP-mycDDK. At 48 h post-transfection samples were harvested, rinsed twice with PBS and lysed with 2 ml of lysis buffer (0.5% NP-40 substitute, 50 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA) containing protease inhibitor cocktail tablets (Roche, Indianapolis, IN). Lysates were incubated at 4 °C for 20 min and cellular debris was collected by centrifugation at 10,000g for 15 min at 4 °C. The supernatant was precleared with 20 µl of Protein A agarose (Thermo Scientific) for 1 h at 4 °C with rocking. Proteins were immunoprecipitated by addition of polyclonal anti DDK and protein A sepharose and incubation at 4 °C for 16 h. Immunoprecipitated complexes were washed three times with wash buffer 1 (0.1% NP-40, 50 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA) and once with wash buffer 2 (50 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA), and suspended in 1x LDS sample buffer (Invitrogen). Immunoprecipitates were separated by electrophoresis in 3–8% NuPAGE® Novex® Tris-Acetate gels (Invitrogen) and electroblotted onto PVDF membranes. Following incubation with appropriate primary and secondary antibodies, protein bands were visualized using Immun-Star™ HRP chemiluminescent kit (Biorad, Hercules, CA) according to the manufacturer's directions.

5.12. RNAi LF-PK cells were seeded in 12-well plates one day prior to transfection to reach 50–60% confluency at the day of transfection. 5–10 nM siRNA were transfected using Lipofectamine2000 as described by the manufacturer (Invitrogen). The following siRNAs were used: ADNP-siRNA#1 – [TGGCAGCACCTTACATAGCAA], ADNPsiRNA#2-[AAGAAGCGAAAATTAGATGAA], and siAll Star as a negative control (Qiagen). 5.13. Chromatin Immunoprecipitation (ChIP)

5.9. His-tag pulldown assays T150 culture flasks containing 4×107 LF-PK cells were infected and crosslinked with 1% formaldehyde and mixed thoroughly. Chromatin was sheared by sonication and its efficiency confirmed by agarose gel electrophoresis (DNA fragments in the range 0.5–1.5 kb). 5 μg of antibody and 25 ul of protein-G magnetic Dynabeads (ThermoFisher) were added to sheared chromatin samples. Anti-ADNP (Santa Cruz Biotechnology, sc-393377) antibody was used for the immunoprecipitation and the samples were incubated overnight at 4 °C on a rotating wheel. Following low and high salt washes, DNA was eluted, crosslinking reversed and the DNA was purified before subsequent q-PCR analysis. ChIP DNA was amplified using primers designed specific for the porcine IFN-α (for: 5’-GGCTGAAAAATGTTGCCCTA-3’; rev: 5’-

6

LF-PK or HEK 293 (1×10 ) cell lysates were mixed with 10 µg of His-Lbpro WT, His-Lbpro C23A or negative control purified from E.coli by Ni-NTA resin (Qiagen) and incubated at 4 °C overnight with rocking. Twenty-five microliters of Ni-NTA beads was then added and the samples were incubated for 1 h at 4 °C with rocking. Brief centrifugation (10 s at 1000g) sedimented the resin beads, and samples were washed three times with wash buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole). Proteins were eluted twice with 25 µl of elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole) and analyzed by Western blot with anti-ADNP, anti-eIF-4G or antiBrg-1 antibodies. 20

Virology 505 (2017) 12–22

G.N. Medina et al.

component of the cap-binding protein complex. J. Virol. 62, 4407–4409. Dunn, K.W., Kamocka, M.M., McDonald, J.H., 2011. A practical guide to evaluating colocalization in biological microscopy. AJP Cell Physiol. 300, C723–C742. Elias, J.E., Gygi, S.P., 2007. Target-decoy search strategy for increased confidence in large-scale protein identifications by mass spectrometry. Nat. Methods 4, 207–214. Falk, M.M., Grigera, P.R., Bergmann, I.E., Zibert, A., Multhaup, G., Beck, E., 1990. Footand-mouth disease virus protease 3C induces specific proteolytic cleavage of host cell histone H3. J. Virol. 64, 748–756. Furman, S., Steingart, R.A., Mandel, S., Hauser, J.M., Brenneman, D.E., Gozes, I., 2004. Subcellular localization and secretion of activity-dependent neuroprotective protein in astrocytes. Neuron Glia Biol. 1, 193–199. Gozes, I., Divinski, I., 2007. NAP, a neuroprotective drug candidate in clinical trials, stimulates microtubule assembly in the living cell. Curr. Alzheimer Res. 4, 507–509. Greninger, A.L., Knudsen, G.M., Betegon, M., Burlingame, A.L., Derisi, J.L., 2012. The 3A protein from multiple picornaviruses utilizes the golgi adaptor protein ACBD3 to recruit PI4KIIIbeta. J. Virol. 86, 3605–3616. Greninger, A.L., Knudsen, G.M., Betegon, M., Burlingame, A.L.B., DeRisi, J.L., 2013. ACBD3 interaction with TBC1 domain 22 protein is differentially affected by enteroviral and kobuviral 3A protein binding. MBio 4, e00098–13. Grubman, M., Baxt, B., 2004. Foot-and-mouth disease. Clin. Microbiol. Rev. 17, 465–493. Guarne, A., Tormo, J., Kirchweger, R., Pfistermueller, D., Fita, I., Skern, T., 1998. Structure of the foot and mouth disease virus leader protease: a papain like fold adapted for self processing and eIF4G recognition. EMBO J. 17, 7469–7479. Hein, M.Y., Hubner, N.C., Poser, I., Cox, J., Nagaraj, N., Toyoda, Y., Gak, I.A., Weisswange, I., Mansfeld, J., Buchholz, F., Hyman, A.A., Mann, M., 2015. A human interactome in three quantitative dimensions organized by stoichiometries and abundances. Cell 163, 712–723. Helsmoortel, C., Vulto-van Silfhout, A.T., Coe, B.P., Vandeweyer, G., Rooms, L., van den Ende, J., Schuurs-Hoeijmakers, J.H.M., Marcelis, C.L., Willemsen, M.H., Vissers, L.E.L.M., Yntema, H.G., Bakshi, M., Wilson, M., Witherspoon, K.T., Malmgren, H., Nordgren, A., Annerén, G., Fichera, M., Bosco, P., Romano, C., de Vries, B.B.A., Kleefstra, T., Kooy, R.F., Eichler, E.E., Van der Aa, N., 2014. A SWI/SNF-related autism syndrome caused by de novo mutations in ADNP. Nat. Genet. 46, 380–384. Jäger, S., Cimermancic, P., Gulbahce, N., Johnson, J.R., McGovern, K.E., Clarke, S.C., Shales, M., Mercenne, G., Pache, L., Li, K., Hernandez, H., Jang, G.M., Roth, S.L., Akiva, E., Marlett, J., Stephens, M., D’Orso, I., Fernandes, J., Fahey, M., Mahon, C., O’Donoghue, A.J., Todorovic, A., Morris, J.H., Maltby, D.A., Alber, T., Cagney, G., Bushman, F.D., Young, J.A., Chanda, S.K., Sundquist, W.I., Kortemme, T., Hernandez, R.D., Craik, C.S., Burlingame, A., Sali, A., Frankel, A.D., Krogan, N.J., 2012. Global landscape of HIV-human protein complexes. Nature 481, 365–370. Joshi, P., Greco, T.M., Guise, A.J., Luo, Y., Yu, F., Nesvizhskii, A.I., Cristea, I.M., 2013. The functional interactome landscape of the human histone deacetylase family. Mol. Syst. Biol. 9, 672. Kalpana, G.V., Marmon, S., Wang, W., Crabtree, G.R., Goff, S.P., 1994. Binding and stimulation of HIV-1 integrase by a human homolog of yeast transcription factor SNF5. Science 266, 2002–2006. Kirchweger, R., Ziegler, E., Lamphear, B.J., Waters, D., Liebig, H.D., Sommergruber, W., Sobrino, F., Hohenadl, C., Blaas, D., Rhoads, R.E., 1994. Foot-and-mouth disease virus leader proteinase: purification of the Lb form and determination of its cleavage site on eIF-4 gamma. J. Virol. 68, 5677–5684. Kleina, L.G., Grubman, M.J., 1992. Antiviral effects of a thiol protease inhibitor on footand-mouth disease virus. J. Virol. 66, 7168–7175. Kouzarides, T., 2007. Chromatin Modifications And Their Function. Cell 128, 693–705. Mandel, S., Gozes, I., 2007. Activity-dependent neuroprotective protein constitutes a novel element in the SWI/SNF chromatin remodeling complex. J. Biol. Chem. 282, 34448–34456. Mason, P.W., Piccone, M.E., Mckenna, T.S., Chinsangaram, J., Grubman, M.J., 1997. Evaluation of a live-attenuated foot-and-mouth disease virus as a vaccine candidate. Virology 227, 96–102. Morris, J.H., Knudsen, G.M., Verschueren, E., Johnson, J.R., Cimermancic, P., Greninger, A.L., Pico, A.R., 2014. Affinity purification-mass spectrometry and network analysis to understand protein-protein interactions. Nat. Protoc. 9, 2539–2554. Mosch, K., Franz, H., Soeroes, S., Singh, P.B., Fischle, W., 2011. HP1 recruits activitydependent neuroprotective protein to H3K9me3 marked pericentromeric heterochromatin for silencing of major satellite repeats. PLoS One 6, e.0015894. Pacheco, A., De Quinto, S.L., Ramajo, J., Fernández, N., Martínez-Salas, E., 2009. A novel role for Gemin5 in mRNA translation. Nucleic Acids Res. 37, 582–590. Piccone, M.E., Chen, H.H., Roos, R.P., Grubman, M.J., 1996. Construction of a chimeric Theiler's murine encephalomyelitis virus containing the leader gene of foot-andmouth disease virus. Virology 226, 135–139. Piccone, M.E., Rieder, E., Mason, P.W., Grubman, M.J., 1995a. The foot-and-mouth disease virus leader proteinase gene is not required for viral replication. J. Virol. 69, 5376–5382. Piccone, M.E., Sira, S., Zellner, M., Grubman, M.J., 1995b. Expression in Escherichia coli and purification of biologically active L proteinase of foot-and-mouth disease virus. Virus Res. 35, 263–275. Piccone, M.E., Zellner, M., Kumosinski, T.F., Mason, P.W., Grubman, M.J., 1995c. Identification of the active-site residues of the L proteinase of foot-and-mouth disease virus. J. Virol. 69, 4950–4956. Piñeiro, D., Ramajo, J., Bradrick, S.S., Martínez-Salas, E., 2012. Gemin5 proteolysis reveals a novel motif to identify L protease targets. Nucleic Acids Res. 40, 4942–4953. Qu, J.H., Cheng, J., Zhang, L.X., Zhong, Y.W., Liu, Y., Wang, L., Dai, J.Z., 2005. [Screening of binding proteins to interferon-alpha promoter DNA by phage display

AACCTTGCAGATGCTGCTGT-3’) and GAPDH promoters (for: 5’GTTCCTGGGTCACTACCGAA-3’; rev: 5’-AGCCAGGGACGTTAAAGTTG3’) using UCSC genome browser (http://genome.ucsc.edu/index.html). 5.14. Real-time RT-PCR Total RNA was isolated from siRNA transfected LF-PK cells using an RNeasy Mini Kit (Qiagen) following the manufacturer's instructions. cDNA was synthesized from 1 μg of total RNA treated with DNase I (Sigma) using Moloney murine leukemia virus reverse transcriptase (Invitrogen) and random hexamers following the manufacturer's directions. The relative expression of CXCL-10, IRF-7, ISG-15, OAS1, RIG-I, MDA-5, Mx-1and PKR was determined by quantitative PCR (qPCR) using specific primers and probes (Supplementary Table 4). For IFN-α and β genes, cDNA was diluted 10-fold and used as the template for qPCR with PerfeCTa SYBR green FastMix and carboxy-Xrhodamine (Quanta Biosciences, Gaithersburg, MD). GAPDH or βactin were used as the internal controls. cDNA was amplified for 40 cycles with an ABI Prism 7500 Sequence Detection System (Applied Biosystems, Foster City, CA). Relative gene expression was quantitated using the 2−ΔΔCT method. Acknowledgements This research was supported by U.S. Department of Agriculture CRIS project number 1940-32000-057-00D, the Howard Hughes Medical Institute, and the David and Lucille Packard Foundation. The authors thank Marla J. Koster and Elizabeth Ramirez-Medina for superb technical assistance and Dr. Lu for DNA sequencing. Mass spectrometry was provided by the UCSF Mass Spectrometry Facility (A.L. Burlingame, director), supported by GM103481. JLD is supported by the Howard Hughes Medical Institute. Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at doi:10.1016/j.virol.2017.02.010. References Braitch, M., Kawabe, K., Nyirenda, M., Gilles, L.J., Robins, R.A., Gran, B., Murphy, S., Showe, L., Constantinescu, C.S., 2010. Expression of activity-dependent neuroprotective protein in the immune system: Possible functions and relevance to multiple sclerosis. Neuroimmunomodulation 17, 120–125. Cao, X., Bergmann, I.E., Füllkrug, R., Beck, E., 1995. Functional analysis of the two alternative translation initiation sites of foot-and-mouth disease virus. J. Virol. 69, 560–563. Carter, C.J., 2011. Alzheimer's disease plaques and tangles: cemeteries of a Pyrrhic victory of the immune defence network against herpes simplex infection at the expense of complement and inflammation-mediated neuronal destruction. Neurochem. Int 58, 301–320. Chalkley, R.J., Baker, P.R., Medzihradszky, K.F., Lynn, A.J., Burlingame, L., 2008. Indepth analysis of tandem mass spectrometry data from disparate instrument types. Mol. Cell. Proteom. 7, 2386–2398. Chinsangaram, J., Mason, P.W., Grubman, M.J., 1998. Protection of swine by live and inactivated vaccines prepared from a leader proteinase-deficient serotype A12 footand-mouth disease virus. Vaccine 16, 1516–1522. Chinsangaram, J., Piccone, M.E., Grubman, M.J., 1999. Ability of foot-and-mouth disease virus to form plaques in cell culture is associated with suppression of alpha/ beta interferon. J. Virol. 73, 9891–9898. de Felipe, P., Ryan, M.D., 2004. Targeting of proteins derived from self-processing polyproteins containing multiple signal sequences. Traffic 5, 616–626. de los Santos, T., De Avila Botton, S., Weiblen, R., Grubman, M.J., 2006. The leader proteinase of foot-and-mouth disease virus inhibits the induction of beta interferon mRNA and blocks the host innate immune response. J. Virol. 80, 1906–1914. de los Santos, T., Diaz-San Segundo, F., Grubman, M.J., 2007. Degradation of nuclear factor kappa B during foot-and-mouth disease virus infection. J. Virol. 81, 12803–12815. de los Santos, T., Diaz-San Segundo, F., Zhu, J., Koster, M.J., Dias, C.C., Grubman, M.J., 2009. A conserved domain in the leader proteinase of foot-and-mouth disease virus is required for proper subcellular localization and function. J. Virol. 83, 1800–1810. Devaney, M.A., Vakharia, V.N., Lloyd, R., Ehrenfeld, E., Grubman, M.J., 1988. Leader protein of foot-and-mouth disease virus is required for cleavage of the p220

21

Virology 505 (2017) 12–22

G.N. Medina et al.

Chen, Z., Xiao, S., 2011. The leader proteinase of foot-and-mouth disease virus negatively regulates the type I interferon pathway by acting as a viral deubiquitinase. J. Virol. 85, 3758–3766. Wang, D., Fang, L., Luo, R., Ye, R., Fang, Y., Xie, L., Chen, H., Xiao, S., 2010. Foot-andmouth disease virus leader proteinase inhibits dsRNA-induced type I interferon transcription by decreasing interferon regulatory factor 3/7 in protein levels. Biochem. Biophys. Res. Commun. 399, 72–78. Zamostiano, R., Pinhasov, A., Gelber, E., Steingart, R.A., Seroussi, E., Giladi, E., Bassan, M., Wollman, Y., Eyre, H.J., Mulley, J.C., Brenneman, D.E., Gozes, I., 2001. Cloning and characterazation of the human activity-dependent neuroprotective protein. J. Biol. Chem. 276, 708–714. Zhu, J., Weiss, M., Grubman, M.J., de los Santos, T., 2010. Differential gene expression in bovine cells infected with wild type and leaderless foot-and-mouth disease virus. Virology 404, 32–40. Ziegler, E., Borman, A.M., Kirchweger, R., Skern, T., Kean, K.M., 1995. Foot-and-mouth disease virus Lb proteinase can stimulate rhinovirus and enterovirus IRES-driven translation and cleave several proteins of cellular and viral origin. J. Virol. 69, 3465–3474. Zusev, M., Gozes, I., 2004. Differential regulation of activity-dependent neuroprotective protein in rat astrocytes by VIP and PACAP. Regul. Pept. 123, 33–41.

technique]. Zhonghua Gan Zang. Bing. Za Zhi. 13, 520–523. Quintana, F.J., Zaltzman, R., Fernandez-Montesinos, R., Herrera, J.L., Gozes, I., Cohen, I.R., Pozo, D., 2006. NAP, a peptide derived from the activity-dependent neuroprotective protein, modulates macrophage function. Ann. N. Y. Acad. Sci., 500–506. Rieder, E., Bunch, T., Brown, F., Mason, P.W., 1993. Genetically engineered foot-andmouth disease viruses with poly(C) tracts. J. Virol. 67, 5139–5145. Ryan, M.D., Drew, J., 1994. Foot-and-mouth disease virus 2A oligopeptide mediated cleavage of an artificial polyprotein. EMBO J. 13, 928–933. Sledz, C.A., Holko, M., de Veer, M.J., Silverman, R.H., Williams, B.R., 2003. Activation of the interferon system by short-interfering RNAs. Nat. Cell Biol. 5, 834–839. Strebel, K., Beck, E., 1986. A second protease of foot-and-mouth disease virus. J. Virol. 58, 893–899. Taylor, T.J., Knipe, D.M., 2004. Proteomics of herpes simplex virus replication compartments: association of cellular DNA replication, repair, recombination, and chromatin remodeling proteins with ICP8. J. Virol. 78, 5856–5866. Van Lint, C., Amella, C. a., Emiliani, S., John, M., Jie, T., Verdin, E., 1997. Transcription factor binding sites downstream of the human immunodeficiency virus type 1 transcription start site are important for virus infectivity. J. Virol. 71, 6113–6127. Wang, D., Fang, L., Li, P., Sun, L., Fan, J., Zhang, Q., Luo, R., Liu, X., Li, K., Chen, H.,

22