Interaction of the cardiovascular risk marker asymmetric dimethylarginine (ADMA) with the human cationic amino acid transporter 1 (CAT1)

Journal of Molecular and Cellular Cardiology 53 (2012) 392–400

Contents lists available at SciVerse ScienceDirect

Journal of Molecular and Cellular Cardiology journal homepage: www.elsevier.com/locate/yjmcc

Original article

Interaction of the cardiovascular risk marker asymmetric dimethylarginine (ADMA) with the human cationic amino acid transporter 1 (CAT1) Joachim Strobel, Maren Mieth, Beate Endreß, Daniel Auge, Jörg König, Martin F. Fromm, Renke Maas ⁎ Institute of Experimental and Clinical Pharmacology and Toxicology, Friedrich-Alexander-Universität Erlangen-Nürnberg, Fahrstraße 17, 91054 Erlangen, Germany

a r t i c l e

i n f o

Article history: Received 23 November 2011 Received in revised form 4 June 2012 Accepted 5 June 2012 Available online 15 June 2012 Keywords: Asymmetric dimethylarginine ADMA L-arginine Cationic amino acid transporter 1 CAT1 SLC7A1

a b s t r a c t Elevated plasma concentrations of endogenously formed asymmetric (ADMA) and symmetric dimethyl-L‐arginine (SDMA) are associated with adverse clinical outcomes. Our aim was to investigate the cellular uptake properties of ADMA by the human cationic amino acid transporter 1 (CAT1; SLC7A1). Human embryonic kidney cells (HEK293) stably overexpressing CAT1 (HEK-CAT1) and vector-transfected control cells (HEK-VC) were established to determine cellular uptake of labeled [3H]ADMA and [3H]L-arginine. Uptake of ADMA and L-arginine were significantly (pb 0.001) higher in HEK-CAT1 than in HEK-VC at all investigated concentrations. Apparent Vmax values of cellular ADMA and L-arginine uptake by CAT1 were 26.9±0.8 and 11.0± 0.2 nmol mg protein− 1 min− 1, respectively. Km values were 183±21 μmol l−1 (ADMA) and 519±36 μmol l− 1 (L-arginine). Uptake of ADMA was inhibited by L-arginine and SDMA with IC50 values (95% CI) of 227 (69–742) μmol l− 1 and 273 (191–390) μmol l− 1, respectively. ADMA and SDMA inhibited CAT1-mediated uptake of L-arginine with IC50 values of 758 (460–1251) μmol l− 1 and 789 (481–1295) μmol l− 1, respectively. Efflux of ADMA was significantly increased in HEK-CAT1 cells as compared to HEK-VC (p b 0.05). CAT1 mediates the cellular uptake of ADMA. In its physiological concentration range ADMA is unlikely to impair CAT1-mediated transport of L-arginine. Conversely, high (but still physiological) concentrations of L-arginine can inhibit CAT1-mediated cellular uptake of ADMA. © 2012 Elsevier Ltd. All rights reserved.

1. Introduction Accumulating clinical data indicate that elevated plasma concentrations of asymmetric (ADMA) and symmetric (SDMA) dimethyl-L‐arginine are associated with adverse clinical outcomes [1–6]. Given the structural similarity to L-arginine, interference with L-arginine-dependent pathways and signaling has been proposed as a possible causal link between clinical outcome and plasma concentration at least for ADMA [7]. The pathophysiological role of SDMA is less well defined and may involve L-arginine-independent pathways [8]. ADMA is a potent inhibitor of

Abbreviations: ADMA, asymmetric dimethyl-L‐arginine; CAT, cationic amino acid transporter; CI, confidence interval; HEK, human embryonic kidney cells 293; IMCD, rat renal inner medullary collecting duct; NMMA, monomethyl-L‐arginine; Vmax, maximum transport velocity; nor-NOHA, Nω-hydroxy-nor-L-arginine; PCR, polymerase chain reaction; SDS, sodium dodecyl sulfate; SDMA, symmetric dimethyl-L‐arginine. ⁎ Corresponding author at: Institute of Experimental and Clinical Pharmacology and Toxicology, Emil Fischer Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Fahrstraße 17, 91054 Erlangen, Germany. Tel.: + 49 9131 85 22754; fax: + 49 9131 85 22773. E-mail addresses: [email protected] (J. Strobel), [email protected] (M. Mieth), [email protected] (B. Endreß), [email protected] (D. Auge), [email protected] (J. König), [email protected] (M.F. Fromm), [email protected] (R. Maas). 0022-2828/$ – see front matter © 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.yjmcc.2012.06.002

all three isoforms of nitric oxide synthase (NOS) [9,10]. In line with experimental data, infusion of ADMA in human volunteers can impair endothelium-dependent relaxation and elevate blood pressure [7,8,11,12]. In mice, chronic infusion of ADMA can augment atherosclerosis [13], while reducing ADMA can attenuate it [14]. Therefore, cellular uptake, metabolism, and release of ADMA are important factors to be considered for understanding of pathophysiological mechanisms when investigating therapeutic approaches to lower ADMA levels [15]. So far, research has mainly been focused on metabolism of ADMA while cellular uptake and release of ADMA and related methylarginines are rather poorly understood. In humans, ADMA (but not SDMA) appears to be predominantly metabolized by dimethylarginine dimethylaminohydrolase (DDAH), which is found in two isoforms DDAH1 and DDAH2 with partially distinct tissue distribution [16]. Deletion of DDAH1 [17,18] or DDAH2 [19] in mice leads to an increase in plasma ADMA levels. In addition, experimental data suggest that ADMA and also SDMA can be metabolized by alanine-glyoxylate aminotransferase 2 (AGXT2) [20–22]. The liver as well as the kidney appear to be key tissues involved in the elimination of ADMA [23] and SDMA [24]. In addition, it has also been proposed that the endothelium may account for a substantial part of ADMA metabolism [15,25]. ADMA and SDMA are cations; therefore their uptake as well as their release by cells are likely to require a transport mechanism. Given the structural similarities of ADMA, SDMA and L-arginine, transport systems involved

J. Strobel et al. / Journal of Molecular and Cellular Cardiology 53 (2012) 392–400

in L-arginine transport are candidates for cellular uptake and/or release of ADMA and SDMA as well [26,27]. L-arginine is predominantly but not exclusively taken up by the cationic amino acid transporters 1 (CAT1, SLC7A1), 2A (CAT2A, SLC7A2A) and 2B (CAT2B, SLC7A2B), which are members of the solute carrier family 7 [26,28,29]. CAT1 is considered to be the key component of y + transport; its transport properties include sodium and pH independence as well as preference of cationic amino acids as substrates [26,30–34]. A previously published study demonstrated that ADMA and SDMA can impair CAT2B-mediated uptake of L‐arginine, indicating that transport may constitute a new site of possible interference of methylarginine with L‐arginine metabolism and signaling [34]. In humans CAT2B is mainly expressed in immune cells such as macrophages and CAT2A primarily in the liver [28]. Therefore, distribution and functional interactions involving methylarginine and L-arginine in other tissues must involve further transport mechanisms. Of the known transport systems for cationic amino acids, CAT1 is likely to be the most relevant with regard to quantitative transport of L-arginine (and possibly its analogs?) as it exhibits a high transport capacity and shows an almost ubiquitous tissue distribution (with the exception of the liver). Homozygous deletion of the Slc7a1 gene encoding Cat1 gene in mice is lethal, which suggests that it plays an essential role in the body [35]. In endothelial cells, the y + system works through CAT1, which appears to be responsible for 70-95% of cellular L-arginine uptake [36,37]. In humans a single nucleotide polymorphism in the 3′UTR region of the SLC7A1 gene, which leads to a diminished CAT1 transporter expression and L-arginine transport, has been linked to hypertension [38]. In order to obtain a better understanding of the mechanisms determining cellular ADMA concentrations, it was the aim of the present study to characterize the CAT1mediated transport of ADMA and to elucidate possible interactions with L-arginine and related compounds. 2. Material and methods 2.1. Chemicals [ 3H]‐labeled L-arginine (43 Ci mmol − 1), [ 3H]‐labeled MPP + (80 Ci mmol − 1) and [ 14C]‐labeled metformin (30 mCi mmol − 1) were obtained from American Radiolabeled Chemicals, Inc (St. Louis, MO, USA). [ 3H]‐labeled ADMA (25 Ci mmol − 1) was purchased from BIOTREND Chemikalien GmbH (Cologne, Germany). Unlabeled L‐arginine, ADMA and SDMA were purchased from Enzo Life Sciences GmbH (Lörrach, Germany). Sodium butyrate was obtained from Merck KGaA (Darmstadt, Germany). N ω-hydroxy-nor-L-arginine (nor-NOHA) was purchased from Cayman chemical company (Ann Arbor, MI, USA). Unlabeled MPP-iodide, metformin and poly-D-lysine hydrobromide were purchased from Sigma-Aldrich Chemie GmbH (Taufkirchen, Germany). All other chemicals and reagents, unless stated otherwise, were obtained from Carl Roth GmbH & Co. KG (Karlsruhe, Germany) and were of the highest grade available. Stock solutions of [3H]‐labeled ADMA and L-arginine in water contained 50% and 2% ethanol, respectively. [3H]‐labeled metformin and MPP-iodide were dissolved in ethanol. Final ethanol concentrations in all experiments were below 0.1%. All other substances were dissolved in water. 2.2. Cell culture As previously described [39], HEK293 cells were cultured in minimal essential medium containing 10% heat-inactivated fetal bovine serum, 100 U ml− 1 penicillin, and 100 μg ml− 1 streptomycin at 37 °C and 5% CO2 [40]. The cells were routinely subcultured by trypsinization using trypsin (0.05%)-EDTA (0.02%) solution. All cell culture media supplements were obtained from Invitrogen GmbH (Karlsruhe, Germany).

393

2.3. Generation of a HEK293 cell line stably overexpressing human CAT1 The SLC7A1 cDNA encoding human CAT1 was cloned by an RT-PCRbased approach using renal mRNA and the IScript cDNA Synthesis kit for sscDNA synthesis (Bio-Rad Laboratories GmbH, Munich, Germany) followed by PCR using the GoTaq™ Hot Start Polymerase Kit (Promega GmbH, Mannheim, Germany) and the following primers: (forward 5′‐ GAACAGCAACATGGGGTGCAA‐3′; reverse 5′‐GGCTGTGCGTCACTTGCA CT‐3′). Polymerase chain reaction (PCR) fragments were amplified with an initial denaturation step of 2 min at 95 °C, followed by 45 cycles of denaturation at 95 °C for 30 s, annealing for 30 s at 66 °C, and extension for 2 min at 72 °C. cDNA was cloned into the pCR2.1-TOPO vector and subsequently subcloned into the pcDNA3.1(+) vector (Invitrogen GmbH). Single nucleotide variations identified by sequencing and comparison to the NM_003045.4 reference sequence were corrected using the QuikChange™ Multi Site-Directed Mutagenesis Kit (Agilent Technologies Deutschland GmbH, Waldbronn, Germany). HEK293 cells were transfected with the SLC7A1 containing expression vector using the Effectene™ Transfection Reagent Kit (QIAGEN GmbH, Hilden, Germany). After geneticin (G418; 800 μg ml − 1) treatment, single colonies (HEK‐CAT1) were selected and characterized for CAT1 mRNA, protein expression and protein localization using quantitative real-time PCR, immunoblot analysis and immunofluorescence, respectively. HEK-VC cells were established by the same method using the empty expression vector for transfection. 2.4. Real-time PCR SLC7A1 mRNA expression was measured by quantitative real-time PCR using the LightCycler 2 System (Roche Diagnostics-Applied Science, Mannheim, Germany) and normalized to the housekeeping gene β-actin (expressed as arbitrary units). PCR was performed using Light Cycler FastStart DNA MasterPLUS SYBR Green I reagents (Roche Diagnostics-Applied Science) and the following primers: hCAT1 (forward 5′‐GGCAGCTCACGGAGGAGGAT-3′ and reverse 5′‐ GCCGACACCCCAAAGTAGGC‐3′, amplicon size of 268 base pairs) and β-actin (forward 5′‐TGACGGGGTCACCCACACTGTGCCCATCTA‐3′ and reverse 5′‐CTAGAAGCATTTGCGGTGGACGATGGAGGG‐3′, amplicon size of 661 base pairs). PCR fragments were amplified with an initial denaturation step of 10 min at 95 °C, followed by 40 cycles of denaturation at 95 °C for 10 s, annealing for 10 s at 64 °C, and extension for 30 s at 72 °C. After DNA amplification a melting curve and agarosis gel analysis were performed. 2.5. Immunoblot analysis HEK-CAT1 and HEK-VC cells were seeded in poly-D-lysine-coated cell culture plates (diameter: 10 cm) at an initial density of 3.0 × 10 6 cells/plate. After 24 h incubation at 37 °C and 5% CO2, cells were treated with 10 mmol l − 1 sodium butyrate for additional 24 h to obtain higher levels of the recombinant protein [41]. Pelleted HEK293 cells were resuspended in 0.2% sodium dodecyl sulfate (SDS) containing protease inhibitors (mini-complete protease inhibitor cocktail tablets; Roche Diagnostics-Applied Science). Protein concentrations were determined by the bicinchoninic acid assay (BCA Protein Assay Reagent, Thermo Fisher Scientific Inc, Rockford, IL, USA). Twenty micrograms of total protein were diluted with Laemmli buffer (62 mmol l− 1 Tris– HCl, 2% SDS, 10% glycerol, 0.01% bromphenol blue, and 0.4 mmol l− 1 dithiothreitol) and incubated at 95 °C for 5 min before separation on 10% SDS-polyacrylamide gels. A BenchMark PreStained Protein Ladder (Invitrogen GmbH) was used to estimate the protein molecular weight ranges. The protein was transferred onto a nitrocellulose membrane (PROTRAN; Whatman Schleicher and Schuell, Dassel, Germany) using a tank blotting system (Bio-Rad Laboratories, Munich, Germany). Tris-buffered saline (TBS) containing 0.1% Tween-20 (Sigma-Aldrich Chemie GmbH) and 5% non-fat milk powder was used for blocking

394

J. Strobel et al. / Journal of Molecular and Cellular Cardiology 53 (2012) 392–400

and served as matrix for the antibodies. Polyclonal rabbit anti-human CAT1 (1:250, ab37588, Abcam, Cambridge, UK) and monoclonal rabbit anti-human α-tubuline were used as primary antibodies (1:25,000, ab52866) and horseradish peroxidase-labeled goat anti-rabbit Fab fragments (1:1000, Dianova, Hamburg, Germany) was used as a secondary antibody. HEK-VC cells served as controls. Protein was visualized by ECL Western blotting detection reagents (GE Healthcare UK Ltd., Little Chalfont, UK) and digitally quantified using ChemiDoc XRS detection system (Bio-Rad Laboratories GmbH). 2.6. Immunofluorescence microscopy Cellular localization of the CAT1 protein was analyzed by immunofluorescence staining and confocal microscopy using an Axiovert 100 M microscope (Carl Zeiss GmbH, Jena, Germany) and the Zeiss LSM Image Browser version 4.2.0.121. HEK-CAT1 and HEK-VC cells were seeded on object slides placed in cell culture plates at an initial density of 1 × 10 6 cells/slide, respectively. After 24 h incubation, cells were treated with 10 mmol l − 1 sodium butyrate for further 24 h. The human CAT1 antibody (1:100 in phosphate buffered saline containing 1% bovine serum albumine, Sigma-Aldrich Chemie GmbH) was used followed by incubation with an Alexa Fluor 488 conjugated secondary antibody (1:2000, Molecular Probes, Eugene, OR, USA). Nuclei were counterstained with Sytox orange (1:50,000, Invitrogen GmbH). 2.7. Uptake transport assays HEK-CAT1 and HEK-VC cells were seeded into poly-D-lysine-coated 24-well plates at an initial density of 3.5×105 cells/well, respectively. After 24 h, 10 mmol l− 1 sodium butyrate was added for an additional 24 h to induce CAT1 protein expression. The cells were washed with prewarmed (37 °C) transport buffer (142 mmol l− 1 NaCl, 5 mmol l− 1 KCl, 1 mmol l− 1 K2HPO4, 1.2 mmol l− 1 MgSO4, 1.5 mmol l− 1 CaCl2, 5 mmol l− 1 glucose, and 12.5 mmol l− 1 HEPES, pH 7.3) and incubated with a mixture of radiolabeled and nonradiolabeled L-arginine or ADMA in transport buffer at 37 °C. Time dependence experiments were performed in order to identify the period of linear uptake. Therefore, cells were incubated with the transport buffer (containing 300 μmol l− 1 ADMA and L-arginine, respectively) at 37 °C for 1, 2.5, 5, 10, and 30 min. For determination of kinetic parameters of CAT1-mediated transport, we used increasing concentrations up to 10 mmol l− 1 for L-arginine and 3 mmol l− 1 for ADMA. To analyze inhibition of CAT1-mediated uptake of L-arginine and ADMA by each other and by SDMA, nor-NOHA, −1 −1 L‐citrulline and metformin, 100 μmol l L-arginine or 1 μmol l ADMA, cells were co-incubated with different concentrations of the inhibitors. Subsequently, the cells were cooled to 0 °C, washed three times with ice-cold transport buffer and lysed with 0.2% SDS. After addition of 4 ml of scintillation solution (Ultima Gold XR; PerkinElmer Life and Analytical Sciences, Inc., Rodgau-Jügesheim, Germany), the intracellular accumulation of radioactivity was determined by liquid scintillation counting (TriCarb 2800; PerkinElmer Life and Analytical Sciences, Inc.). The appropriate protein concentration in each well was measured by the bicinchoninic acid assay. Data were combined from at least two single experiments each performed in quadruplicate (n ≥ 2 × 4) on different days. 2.8. Efflux transport assays HEK-CAT1 and HEK-VC cells were seeded into poly-D-lysine-coated 12-well plates at an initial density of 7 × 105 cells/well and cultured for 24 h in standard media. Then, 10 mmol l − 1 sodium butyrate was added for an additional 24 h to induce CAT1 protein expression. The cells were washed with transport buffer and subsequently incubated for 6 h in plain transport buffer (not containing ADMA, SDMA or L-arginine). After 6 h of incubation the concentration of L‐arginine, ADMA, and SDMA was determined by LC-MS/MS as previously described [42]. The

protein concentration in each well was measured by the bicinchoninic acid assay. In complementary, HEK-CAT1 and HEK-VC were preloaded with a mixture of radiolabeled and unlabeled ADMA (300 μmol l − 1) for an incubation period of 45 min to ensure equal loading. Thereafter, cells were quickly washed three times with prewarmed transport buffer and incubated with transport buffer at 37 °C for 0 min (no incubation; baseline), 1 min or 2.5 min. The supernatant was removed and cells were lysed with 0.2% SDS. The accumulation of radioactivity in both the supernatant and cell homogenate was determined by liquid scintillation counting as for the uptake experiments.

2.9. Statistical analysis Net transport data were calculated as the difference of uptake from cells transfected with SLC7A1 and empty control vector. Therefore, the maximum transport velocity (Vmax) values have to be interpreted as “apparent” values. Km values for the uptake transport were calculated using Michaelis–Menten enzyme kinetics in GraphPad Prism (version 5.01, 2007, GraphPad Software, San Diego, CA, USA). The corresponding IC50 values for inhibition were calculated by fitting the data to a sigmoid dose–response regression curve. All data are presented as means ± SEM. Differences in net uptake, net efflux, substrate concentrations, mRNA expression, and protein expression of HEK-CAT1 and HEK-VC were analyzed using an unpaired, two-tailed t-test unless stated otherwise. A p-value b0.05 was considered statistically significant.

3. Results 3.1. Generation of a HEK293 cell line stably overexpressing human CAT1 To investigate the cellular uptake properties and efflux of ADMA, a cell line stably expressing CAT1 (HEK-CAT1) was established. Using real-time PCR and immunoblot analysis, it was verified that the selected clone of the HEK-CAT1 cell line had elevated levels of SLC7A1 mRNA (normalized to β-actin) and CAT1 protein expression as compared to the HEK-VC control cell line (Figs. 1A and B). In Fig. 1B, unglycosylated CAT1 protein could be detected at 68 kDa and glycosylated CAT1 protein appears between 78 and 88 kDa, similar as previously published [43–45]. The cellular localization of CAT1 was further assessed using immunofluorescence microscopy. As expected, CAT1 signal was seen preferentially in the cell membrane. Endogenously expressed CAT1 protein was also observed in the empty-vector control cells, but to a much lower extent (Fig. 1C).

3.2. Optimization of cellular uptake experiments To compare ADMA uptake data with the prototypic CAT1 substrate we investigated the uptake kinetics of both L‐arginine and ADMA. In order to optimize assay conditions, the time dependence of L‐arginine and ADMA uptake was assessed. The cellular uptake of L ‐arginine and ADMA was significantly higher (p b 0.01) in HEK-CAT1 cells than in the control cells (HEK-VC) over a period of 30 min (Figs. 2A and B). For L‐arginine, linearity of net uptake was observed up to 5 min (R2 = 0.997; Fig. 2A). Therefore, an incubation period of 5 min was selected for subsequent kinetics studies with L-arginine. In contrast, ADMA showed a more rapid initial net uptake with a maximum at 2.5 min (Fig. 2B). Therefore, the shortest technically possible incubation period of 1 min was selected for the further investigations of ADMA transport kinetics. CAT1-mediated uptake of ADMA declined over time and reached control levels after 45–100 min (data not shown). L‐arginine,

J. Strobel et al. / Journal of Molecular and Cellular Cardiology 53 (2012) 392–400

395

Fig. 1. Characterization of the human SLC7A1 (CAT1) overexpressing cell line HEK-CAT1. (A) Significantly elevated mRNA expression (*** p b 0.001) in HEK-CAT1 cells as compared to control cells (HEK-VC). (B) Immunoblot analysis of human CAT1 protein in HEK-CAT1 and control cells HEK-VC. The band at approximately 68 kDa represents the unglycosylated form, the signal between 78 and 88 kDa the glycosylated form of CAT1 (20 μg protein per lane). (C) Immunofluorescence analysis of human CAT1 protein (green fluorescence) in HEK-CAT1 and control cells (HEK-VC). The CAT1 signal, preferably localized in the cell membrane, could also be detected in control cells (HEK-VC), but at a markedly lower content.

3.3. Characterization of CAT1-mediated cellular uptake of L‐arginine, ADMA, metformin and MPP + Significantly higher uptake rates of L‐arginine and ADMA (p b 0.001) were observed at all investigated concentrations (L-arginine: 10–10,000 μmol l − 1; ADMA: 0.1–3000 μmol l − 1) in HEK-CAT1 as compared to HEK‐VC (Figs. 3A and B). The CAT1-mediated net uptake was used to calculate the Vmax values, which amount to 11.0 ± 0.2 and 26.9 ± 0.8 nmol mg− 1 total protein per minute for L‐arginine and ADMA, respectively. The Km values were 519 ± 36 μmol l− 1 (L‐arginine) and 183 ± 21 μmol l− 1 (ADMA), respectively. At physiological extracellular concentrations of L‐arginine (100 μmol l− 1) and ADMA (1 μmol l− 1), uptake of HEK-CAT1 cells was 3.1 ± 0.9 times and 8.7 ± 0.8 times higher, respectively, as compared to controls (HEK-VC). Moreover, metformin and MPP + were also studied as potential substrates of CAT1 (Table 1). Metformin, which is widely used in diabetic patients, is a cationic drug with structural similarities to ADMA. MPP + is also a cation and a commonly used model substrate for functional characterizations of cellular transport mediated by cation transporters (e.g. organic cation transporters, OCTs). However, significant CAT1-mediated uptake was not observed for either 10 μmol l − 1 and 100 μmol l − 1 of metformin and 10 μmol l − 1 and 1000 μmol l − 1 MPP +. 3.4. Inhibition studies of CAT1-mediated uptake of L‐arginine and ADMA Following the characterization of CAT1-mediated L‐arginine and ADMA uptake, the inhibition of CAT1-mediated L‐arginine- and ADMAtransport was studied using extracellular substrate concentrations in

the physiological range for L‐arginine (100 μmol l− 1) and ADMA (1 μmol l− 1). CAT1-mediated net uptake of L‐arginine was inhibited by increasing concentrations of ADMA and SDMA with IC50 values of 758 μmol l− 1 (95% confidence interval (CI): 460–1251 μmol l− 1) and 789 μmol l− 1 (95% CI: 481–1295 μmol l− 1), respectively (Figs. 4A and B). CAT1-mediated ADMA uptake was inhibited by L‐arginine and SDMA with IC50 values of 227 μmol l− 1 (95% CI: 69–742 μmol l− 1) and 273 μmol l− 1 (95% CI: 191–390 μmol l− 1), respectively (Figs. 4C and D). Furthermore, we investigated substances structurally or functionally related to L‐arginine or ADMA for their possible influence on CAT1mediated transport (Table 2). L‐citrulline, a key product of L‐arginine and ADMA degradation, did not significantly inhibit CAT1-mediated uptake of 100 μmol l− 1 L‐arginine in concentrations up to 3000 μmol l− 1. Nor-NOHA, which is frequently used in cell culture experiments at concentrations of 1–5 μmol l− 1 to suppress arginase activity, inhibited uptake of 100 μmol l− 1 L‐arginine with an IC50 value of 764 μmol l− 1 (95% CI: 427–1367 μmol l− 1). Metformin was investigated as a possible inhibitor because it is a prototype substrate of other cation transporters and was found to lower plasma ADMA in some clinical studies [46]. However, metformin concentrations up to 300 μmol l− 1 did not have any significant effect on CAT1-mediated L‐arginine uptake (Table 2). 3.5. CAT1 and efflux of ADMA Extracellular concentrations of L-arginine, ADMA and SDMA were also determined after incubation of HEK‐CAT1 and HEK-VC for 6 h in plain transport buffer (not containing ADMA, SDMA or L-arginine). Higher (extracellular) concentrations of L‐arginine, ADMA, and SDMA were observed for HEK-CAT1 cells, as compared to HEK-VC (Fig. 5A).

396

J. Strobel et al. / Journal of Molecular and Cellular Cardiology 53 (2012) 392–400

Fig. 2. Time dependency of (A) L‐arginine uptake and (B) ADMA uptake by HEK-CAT1 and HEK-VC cells. 300 μmol l− 1 of ADMA and L‐arginine were incubated at 37 °C, respectively (Fig. 2A: n = 4; Fig. 2B: n = 8-11 per time point and cell line). Net uptake is defined as the difference of uptake into HEK-CAT1 and uptake into HEK-VC cells. 2 L-arginine net uptake was linear up to 5 min (R = 0.997), ADMA showed a maximum at 2.5 min.

On an explorative basis, time dependence of CAT1-mediated ADMA efflux in cells preloaded with [ 3H]-labeled ADMA until equilibrium was further investigated (Fig. 5B). At baseline, equal loading of HEK-CAT1 and HEK-VC with ADMA was achieved. As compared to baseline, intracellular [ 3H]ADMA concentrations declined faster in HEK-CAT1 than in HEK-VC cells (45 ± 4% vs. 18 ± 2%) at 1 min and (82 ± 2% vs. 51 ± 6%) at 2.5 min, (all p b 0.01), which is compatible with a CAT1-mediated efflux. 4. Discussion In order to characterize CAT1-mediated transport of ADMA and to explore possible interactions of methylarginine compounds with L‐arginine transport, CAT1 was stably overexpressed in human HEK293 cells. Radiolabeled ADMA and L‐arginine were used as substrates to compare transport and inhibition kinetics. Our principal findings are as follows: 1. CAT1 can mediate cellular uptake of ADMA at physiological concentrations. 2. At a high (but still physiological) extracellular concentration, L‐arginine inhibited cellular uptake of ADMA by CAT1. 3. ADMA and SDMA inhibited CAT1-mediated uptake of L‐arginine, but the IC50 values are above the estimated endogenous ADMA and SDMA concentrations. 4. Efflux of ADMA, SDMA and L-arginine is increased in CAT1 overexpressing cells (HEK-CAT1) as compared to vector control cells (HEK-VC). 4.1. Cellular uptake mechanisms involving L-arginine and the “L-arginine paradox” In various experimental settings, addition of extracellular L‐arginine was found to stimulate intracellular NO synthase activity. Considering

Fig. 3. Kinetics of CAT1-mediated cellular uptake of (A) L‐arginine and (B) ADMA. The CAT1-mediated net uptake of L‐arginine or ADMA was used to calculate the maximum transport velocity (Vmax) and Km value. The ratios of uptake by HEK-CAT1 and HEK-VC cells are shown in the tables below the graphs. Incubation periods for L‐arginine and ADMA were 5 min and 1 min, respectively. Experiments were performed at least in quadruplicate on two different days (n ≥ 2 × 4). ***p b 0.001, unpaired, two-tailed t-test.

the Km value of the endothelial nitric oxide synthase (eNOS) for L‐arginine (which ranges between 0.7 and 3.1 μmol l− 1) [47–49], this observation was termed the “L‐arginine paradox” as the enzyme was expected to be already saturated at intracellular L‐arginine concentrations in the range of 100–800 μmol l− 1 [50–52]. Presence of competitive inhibitors and/or impairment of cellular L‐arginine uptake have been proposed as possible mechanisms and it was suggested that ADMA may be the culprit. In vitro ADMA inhibits eNOS activity with Ki values in the range of 0.9 and 21.6 μmol l− 1 [47,48]. In cell based assays Bogle et al. [53] observed that 1 mmol l− 1 ADMA as well as 1 mmol l− 1 SDMA inhibited uptake of 10 μmol l− 1 monomethyl-L‐arginine (NMMA) by human endotheliumderived SGHEC-7 cells by approximately 99%. The time course of NMMA uptake was rapid and attributed to y +-mediated transport. Subsequently, in 1997, Closs et al. showed that ADMA and SDMA inhibited CAT2B-mediated uptake of L‐arginine in Xenopus laevis oocytes and that L‐arginine could be exchanged by SDMA via CAT2B resulting in cellular L‐arginine depletion [34]. Hence, it was proposed that SDMA and also ADMA are likely substrates of all transporters of

Table 1 Kinetics of CAT1-mediated uptake of L-arginine, ADMA, metformin, and MPP+. Substrate

Km ± SEM [μmol l− 1]

Vmax ± SEM [nmol mg protein− 1 min− 1]

L‐arginine ADMA Metformin MPP+

519 ± 36 183 ± 21 No uptake No uptake

11.0 ± 0.2 26.9 ± 0.8

J. Strobel et al. / Journal of Molecular and Cellular Cardiology 53 (2012) 392–400

397

Fig. 4. Inhibition of CAT1-mediated uptake of L‐arginine and ADMA. Influence of (A) ADMA and (B) SDMA on CAT1-mediated L‐arginine uptake (100 μmol l− 1 L‐arginine, incubation time 5 min) and impact of (C) L‐arginine and (D) SDMA on CAT1 mediated ADMA uptake (1 μmol l− 1 ADMA, incubation time 1 min). Net uptake values were used to calculate IC50 values and 95% confidence intervals (CI). Experiments were performed at least in quadruplicate at two different days (n ≥ 2 × 4). ***p b 0.001, unpaired two-tailed t-test.

the y + system including CAT1 [27]. This hypothesis was supported by the observation that uremic plasma appears to contain at least one small molecular component which can inhibit CAT-mediated uptake of 50 μmol l− 1 L‐arginine in human microvascular endothelial cells [54]. In these experiments, an ADMA concentration of 100 μmol l− 1 was required for significant inhibition of L‐arginine uptake.

However, similar to CAT2B [34], the IC50 values for inhibition of CAT1-mediated L‐arginine uptake by ADMA and SDMA (758 and 789 μmol l − 1, respectively) indicate that this is unlikely to be of

4.2. ADMA is a substrate and competitive inhibitor of CAT1 By measuring the uptake of radiolabeled ADMA into HEK293 cells overexpressing human CAT1, we generated the first direct kinetic data for cellular uptake of ADMA by human CAT1. To facilitate comparisons of different substrates as well as comparisons with other investigations, kinetic data for L‐arginine were determined as well. Key measurements were performed with substrate concentrations of ADMA (1 μmol l− 1) and L‐arginine (100 μmol l− 1) that can be observed in vivo. Affinity and transport capacity of CAT1 was higher for ADMA than for L‐arginine (2.4 fold greater Vmax). CAT1-mediated uptake of 1 μmol l − 1 ADMA (i.e. in the physiological range) was 8.7 times higher in CAT1 overexpressing cells as compared to controls. As expected, these data show that ADMA and SDMA can impair CAT1-mediated uptake of L‐arginine.

Table 2 Inhibition kinetics of CAT1-mediated uptake of L-arginine and ADMA. Substrate L‐arginine

a

L‐arginine

a

L‐arginine

a

L‐arginine

a

L‐arginine

a

ADMA ADMA a b

b b

100 μmol l− 1 L‐arginine. 1 μmol l− 1 ADMA.

Inhibitor

IC50 [μmol l− 1]

ADMA SDMA nor-NOHA L‐citrulline Metformin L‐arginine SDMA

758 (95% CI: 460–1251) 789 (95% CI: 481–1295) 764 (95% CI: 427–1367) No inhibition No inhibition 227 (95% CI: 69–742) 273 (95% CI: 191–390)

Fig. 5. CAT1-mediated cellular ADMA efflux. (A) Extracellular concentrations of endogenously formed L‐arginine, ADMA, and SDMA after incubation in transport buffer for 6 h (n = 12 per cell line). (B) ADMA efflux. After equal loading with radiolabeled ADMA, HEK-CAT1 and HEK-VC cells were incubated with transport buffer for 1 min, 2.5 min or analyzed directly (0 min). Intracellular ADMA concentrations are shown in nmol mg− 1 total protein (left scale) and in percent of initial loading (right scale) (n = 5 per cell line). ***p b 0.001, **p b 0.01, unpaired two-tailed t-test.

398

J. Strobel et al. / Journal of Molecular and Cellular Cardiology 53 (2012) 392–400

direct relevance in vivo, since ADMA and SDMA plasma concentrations observed are in the range of 0.3 and 2.0 μmol l − 1. The relevance of CAT1 expression for local cellular concentrations of L‐arginine and methylarginines aside, its expression in the kidney may also affect systemic availability and vascular effects of L‐arginine and its analogs. In a rat model NMMA, ADMA, or SDMA caused a decrease of renal tubular L-arginine reabsorption in the loop of Henle by 29–43% when added to artificial tubular fluid (in a concentration of 1000 μmol l − 1) [55]. Several previous studies regarding the CAT1-mediated L‐arginine uptake used the X. laevis model and differed in major assay conditions including the temperature (e.g. 19–20 °C vs. 37 °C) from our cell system [26,33]. Therefore, comparisons of kinetic data (e.g. of Km and Vmax) require cautious interpretation. The Km value presented here for CAT1-mediated L‐arginine uptake was 519 μmol l − 1 and is thus higher than what has been observed when overexpressing human (or murine) SLC7A1(Slc7a1) in the X. laevis system (110-116 μmol l− 1 [26] and 140–250 μmol l − 1 [56], respectively). Other experiments based on pulmonary artery endothelial cells showed a rapid pH- and sodium-independent L‐arginine uptake with Km values between 140 and 304 μmol l− 1, representative for the y+ system [37,57]. ADMA and L‐arginine are both substrates of CAT1, and the plasma L‐arginine concentration exceeds that of ADMA and SDMA by a factor of 100–200. Thus, considering the Km values (affinities) for ADMA and L‐arginine of 183 ± 21 μmol l − 1 and 519 ± 36 μmol l − 1, respectively, an impairment of ADMA transport by L‐arginine is actually more likely to occur in vivo than any effect of ADMA on L‐arginine transport. L‐arginine concentrations of 100 μmol l− 1 and higher caused a significant (p b 0.001) inhibition of cellular uptake of 1 μmol l− 1 ADMA. The relative Km values of ADMA and SDMA appear high with respect of the average plasma concentrations. However, it has to be considered that a low affinity (high Km value) is accompanied by a high capacity transport over a broad concentration range. Furthermore, in vivo CAT1 has to cope with several chemically similar substrates (including ADMA, NMMA, L-arginine, L-lysine and L-histidine), which differ substantially in their physiological concentration ranges. Significantly lower Km values would most likely result in saturation and augment competition among the substrates.

4.3. CAT1 can mediate efflux of ADMA The primary focus of the present study was CAT1-mediated cellular uptake of ADMA and the experiments were designed accordingly. Still, after an incubation of HEK-CAT1 and HEK-VC cells for up to 6 h in uptake buffer (free of L-arginine, SDMA and ADMA), higher concentrations of unlabeled endogenous L‐arginine, SDMA and ADMA were released from the HEK-CAT1 cell into the buffer as compared to HEK-VC (Fig. 5A). This would be compatible with a CAT1-mediated efflux of ADMA, SDMA and L-arginine, which has already been described for L-arginine in the X. laevis system [26]. We therefore performed an explorative efflux experiment using HEK-CAT1 and HEK-VC cells loaded with equal amounts of ADMA and found that efflux of ADMA from HEK-CAT1 cells was more profound than from HEK-VC cells. Aside from CAT1-mediated efflux, there are further, not necessarily exclusive explanations for this observation that have to be considered. Overexpression of CAT1 may provoke a counter-regulatory increase in expression of efflux-transporters, which increase the release of ADMA, SDMA and L-arginine from the cells. Very recent data suggest that the system y+L may constitute a promising alternative candidate for ADMA efflux [58]. Alternatively, uptake of ADMA, SDMA and L-arginine from the extracellular media may simply be higher in HEK-CAT1 cells as compared to HEK-VC leading to higher intracellular concentrations of these compounds. Hence, the resulting higher concentration gradient may increase the release of ADMA, SDMA and L-arginine from

HEK-CAT1 cells into the extracellular media (free of ADMA, SDMA and L-arginine) as compared to HEK-VC cells. 4.4. CAT1-mediated transport as a site of interactions for L-arginine, ADMA and SDMA The data regarding the CAT1-mediated uptake of ADMA can be viewed from two different perspectives: One has to consider the implications for the uptake and subsequent metabolism of ADMA as well as the implications for the cellular effects of ADMA. An increase of extracellular L‐arginine can competitively impair ADMA uptake (and subsequent degradation). As an acute effect of supplementing high L‐arginine doses, one would expect a rise in plasma ADMA (and SDMA) as well as a fall of intracellular ADMA (and SDMA). Moreover, as the intracellular ADMA-depletion is accompanied by a rise in the intracellular L‐arginine concentration the intracellular L‐arginine/ADMA ratio may rise while the extracellular ratio falls. In the long run the picture may change, however, as uptake of ADMA into degrading tissues is impaired as well and extracellular ADMA may continue to rise leading to a new equilibrium with more and more ADMA competing again with L‐arginine. From a clinical perspective, the consequences may still be limited as the IC50 of 227 μmol l − 1 indicates that a quantitatively relevant inhibition of ADMA uptake requires extracellular L ‐arginine concentrations which are still above the concentration usually reached by diet alone [59]. Likewise, in clinical supplementation studies which typically rise plasma L‐arginine from 70–80 μmol l− 1 to 90–120 μmol l − 1, no significant changes in plasma ADMA were observed, yet [60–62]. From a clinical and dietary perspective, L‐arginine effects on CAT1mediated ADMA uptake are unlikely to be of relevance, while the acute effects of greater (pharmacological) intravenous L‐arginine doses remain to be elucidated. SDMA plasma concentrations are in the range of 0.2 and 0.5 μmol l− 1 in healthy persons and can reach up to 2-4 μmol l− 1 in renal failure [24,63], which is still well below the IC50 of 273 μmol l− 1 that was found for the inhibition of CAT1-mediated uptake of 1 μmol l− 1 ADMA [24], indicating that, in vivo, SDMA will most likely not affect CAT1mediated uptake of ADMA. However, this does not preclude other indirect effects of SDMA on NO synthesis [64]. Bode-Böger et al. [24] could show that SDMA dose-dependently (starting at concentrations as low as 2 μmol l− 1) decreased NO synthesis in human umbilical vein endothelial cells. Since SDMA does not inhibit NOS [9] indirect mechanisms will have to explain this effect on NO synthesis. In addition, with respect to the association of ADMA and clinical outcome the effects of SDMA on various arginine-dependent pathways remain to be investigated. 4.5. CAT1-mediated transport—implications for NO synthesis A closer look at the literature suggests that the direct interplay of CAT-mediated L-arginine and ADMA transport with NO synthesis may be much more complex than commonly assumed. Several studies indicate that CAT1 co-localizes with caveolae and eNOS [64]. Adenovirusmediated overexpression of murine CAT1 in bovine aortic endothelial cells has previously been shown to result in increased L-arginine uptake and increased basal NO release [65]. However, the increase in NO release appeared to be independent of an acute CAT1-mediated L‐arginine uptake because it could not be competitively blocked by the CAT1 substrate L-lysine. Furthermore, CAT1 overexpression also increased NOS activity in cell lysates, i.e. in a setting where uptake of L-arginine plays no role. Data that point in the same direction but differ in a key detail are provided by Wu et al. [66]. They identified the y+ system as the predominant system involved in L-arginine uptake in rat renal inner medullary collecting duct (IMCD) cells with CAT1 as the specific CAT-isoform involved. The CAT1 substrate L-lysine (which is not a NOS inhibitor) dose-dependently reduced L-arginine uptake and NO synthesis

J. Strobel et al. / Journal of Molecular and Cellular Cardiology 53 (2012) 392–400

by IMCD cells, indicating that in this setting NOS activity is indeed depended on CAT1 mediated uptake of L-arginine. Using intact bovine aortic endothelial cells Cardounel et al. observed that the extracellular addition of ADMA dose-dependently inhibited NO generation. In absence of L-arginine 5 μmol l − 1 ADMA already elicited a 38% reduction in NO synthesis, while in presence of 100 μmol l − 1 L-arginine a 12% inhibition was observed. In other words, eNOS activity was already impaired by ADMA concentrations unlikely to significantly affect CAT1-mediated uptake of L-arginine. CAT1 is important for cellular transport of L-arginine and methylarginines, but is not the exclusive transporter of these substrates. Cell culture experiments indicate that in endothelial cells L-arginine transport has two components, a high affinity but low capacity and a low affinity and high capacity component [67]. The relative relevance of these components for NO synthesis may depend on the physiological (or experimental) conditions. A promising candidate for the second component is the y+L system, which under certain experimental conditions may also be required for NO synthesis [68]. ADMA is also a substrate of this system [58]. With regard to this CAT1-independent component the effects of ADMA and SDMA remain to be elucidated. Taken together with the aforementioned effects of ADMA on L ‐arginine (and vice versa) these data indicate that our search for the culprit in the “L‐arginine paradox” has to continue and that further transport proteins need to be investigated. 4.6. Limitations of the study From a physiological point of view primary human endothelial cells may constitute the preferred target for overexpression of CAT1. However, for the present study HEK293 cells were used, because primary cells only allow transient overexpression. In turn, this precludes larger sets of experiments and introduces a further element of variation due to a limited supply of endothelial cells from the same donor, which is technically difficult to address. Attempts to use primary human or porcine endothelial cells and different transient transfection methods (such as lipofection or calcium phosphate transfection) achieved low and too variable overexpression of CAT1 with regard to the high background of endogenous transport activity (data not shown). 5. Conclusions In summary, these data demonstrate that CAT1 significantly (but most likely not exclusively) contributes to the cellular uptake of ADMA. However, pathophysiological effects of ADMA and SDMA are unlikely to be explained by interference with CAT1-mediated L‐arginine transport. Conversely, high levels of extracellular L‐arginine can deplete intracellular ADMA and increase extracellular ADMA by impairing its cellular uptake.

[3]

[4]

[5]

[6]

[7] [8]

[9]

[10]

[11]

[12]

[13]

[14]

[15] [16]

[17]

[18]

[19]

[20]

[21]

[22]

Disclosure statement None. Acknowledgments This work was supported by an intramural grant of the Universität Erlangen-Nürnberg to Renke Maas and in part by a grant of the Deutsche Forschungsgemeinschaft (Fr1298/5-1) to Martin Fromm. Joachim Strobel is supported by a scholarship of the Friedrich-Ebert Foundation. References [1] Böger RH, Sullivan LM, Schwedhelm E, Wang TJ, Maas R, Benjamin EJ, et al. Plasma asymmetric dimethylarginine and incidence of cardiovascular disease and death in the community. Circulation 2009;119:1592–600. [2] Böger RH, Maas R, Schulze F, Schwedhelm E. Asymmetric dimethylarginine (ADMA) as a prospective marker of cardiovascular disease and mortality—an update

[23]

[24]

[25]

[26]

[27] [28] [29]

399

on patient populations with a wide range of cardiovascular risk. Pharmacol Res 2009;60:481–7. Zoccali C, Bode-Böger S, Mallamaci F, Benedetto F, Tripepi G, Malatino L, et al. Plasma concentration of asymmetrical dimethylarginine and mortality in patients with end-stage renal disease: a prospective study. Lancet 2001;358:2113–7. Kiechl S, Lee T, Santer P, Thompson G, Tsimikas S, Egger G, et al. Asymmetric and symmetric dimethylarginines are of similar predictive value for cardiovascular risk in the general population. Atherosclerosis 2009;205:261–5. Schulze F, Carter AM, Schwedhelm E, Ajjan R, Maas R, von Holten RA, et al. Symmetric dimethylarginine predicts all-cause mortality following ischemic stroke. Atherosclerosis 2010;208:518–23. Schnabel R, Blankenberg S, Lubos E, Lackner KJ, Rupprecht HJ, Espinola-Klein C, et al. Asymmetric dimethylarginine and the risk of cardiovascular events and death in patients with coronary artery disease: results from the AtheroGene Study. Circ Res 2005;97:e53–9. Vallance P, Leone A, Calver A, Collier J, Moncada S. Accumulation of an endogenous inhibitor of nitric oxide synthesis in chronic renal failure. Lancet 1992;339:572–5. Schepers E, Glorieux G, Dhondt A, Leybaert L, Vanholder R. Role of symmetric dimethylarginine in vascular damage by increasing ROS via store-operated calcium influx in monocytes. Nephrol Dial Transplant 2009;24:1429–35. Vallance P, Leone A, Calver A, Collier J, Moncada S. Endogenous dimethylarginine as an inhibitor of nitric oxide synthesis. J Cardiovasc Pharmacol 1992;20(Suppl. 12):S60–2. Ueda S, Kato S, Matsuoka H, Kimoto M, Okuda S, Morimatsu M, et al. Regulation of cytokine-induced nitric oxide synthesis by asymmetric dimethylarginine: role of dimethylarginine dimethylaminohydrolase. Circ Res 2003;92:226–33. Achan V, Broadhead M, Malaki M, Whitley G, Leiper J, MacAllister R, et al. Asymmetric dimethylarginine causes hypertension and cardiac dysfunction in humans and is actively metabolized by dimethylarginine dimethylaminohydrolase. Arterioscler Thromb Vasc Biol 2003;23:1455–9. Kielstein JT, Impraim B, Simmel S, Bode-Böger SM, Tsikas D, Frölich JC, et al. Cardiovascular effects of systemic nitric oxide synthase inhibition with asymmetrical dimethylarginine in humans. Circulation 2004;109:172–7. Xiao HB, Yang ZC, Jia SJ, Li NS, Jiang DJ, Zhang XH, et al. Effect of asymmetric dimethylarginine on atherogenesis and erythrocyte deformability in apolipoprotein E deficient mice. Life Sci 2007;81:1–7. Jacobi J, Maas R, Cardounel AJ, Arend M, Pope AJ, Cordasic N, et al. Dimethylarginine dimethylaminohydrolase overexpression ameliorates atherosclerosis in apolipoprotein E-deficient mice by lowering asymmetric dimethylarginine. Am J Pathol 2010;176:2559–70. Maas R. Pharmacotherapies and their influence on asymmetric dimethylargine (ADMA). Vasc Med 2005;10(Suppl. 1):S49–57. Vallance P, Leiper J. Cardiovascular biology of the asymmetric dimethylarginine: dimethylarginine dimethylaminohydrolase pathway. Arterioscler Thromb Vasc Biol 2004;24:1023–30. Leiper J, Nandi M, Torondel B, Murray-Rust J, Malaki M, O'Hara B, et al. Disruption of methylarginine metabolism impairs vascular homeostasis. Nat Med 2007;13: 198–203. Hu XL, Atzler D, Xu X, Zhang P, Guo HP, Lu ZB, et al. Dimethylarginine dimethylaminohydrolase-1 is the critical enzyme for degrading the cardiovascular risk factor asymmetrical dimethylarginine. Arterioscler Thromb Vasc Biol 2011;31: 1540–6. Geldmacher F, Lüneburg N, Bernges I, Jacobi J, König J, Baldus S, et al. A global knock out of the dimethylarginine dimethylaminohydrolase 2 (DDAH2) gene in mice has no impact on aortic endothelial function and viability. Naunyn Schmiedebergs Arch Pharmacol 2011;383:1–112 [Abstract]. Ogawa T, Kimoto M, Sasaoka K. Dimethylarginine:pyruvate aminotransferase in rats. Purification, properties, and identity with alanine:glyoxylate aminotransferase 2. J Biol Chem 1990;265:20938–45. Rodionov RN, Murry DJ, Vaulman SF, Stevens JW, Lentz SR. Human alanine-glyoxylate aminotransferase 2 lowers asymmetric dimethylarginine and protects from inhibition of nitric oxide production. J Biol Chem 2010;285:5385–91. Ogawa T, Kimoto M, Sasaoka K. Purification and properties of a new enzyme, NG, NG-dimethylarginine dimethylaminohydrolase, from rat kidney. J Biol Chem 1989;264:10205–9. Tsikas D, Rode I, Becker T, Nashan B, Klempnauer J, Frölich JC. Elevated plasma and urine levels of ADMA and 15(S)-8-iso-PGF2alpha in end-stage liver disease. Hepatology 2003;38:1063–4. Bode-Böger SM, Scalera F, Kielstein JT, Martens-Lobenhoffer J, Breithardt G, Fobker M, et al. Symmetrical dimethylarginine: a new combined parameter for renal function and extent of coronary artery disease. J Am Soc Nephrol 2006;17: 1128–34. Hu X, Xu X, Zhu G, Atzler D, Kimoto M, Chen J, et al. Vascular endothelial-specific dimethylarginine dimethylaminohydrolase-1-deficient mice reveal that vascular endothelium plays an important role in removing asymmetric dimethylarginine. Circulation 2009;120:2222–9. Closs EI, Gräf P, Habermeier A, Cunningham JM, Förstermann U. Human cationic amino acid transporters hCAT-1, hCAT-2A, and hCAT-2B: three related carriers with distinct transport properties. Biochemistry 1997;36:6462–8. Teerlink T, Luo Z, Palm F, Wilcox CS. Cellular ADMA: regulation and action. Pharmacol Res 2009;60:448–60. Closs EI, Boissel JP, Habermeier A, Rotmann A. Structure and function of cationic amino acid transporters (CATs). J Membr Biol 2006;213:67–77. Mann GE, Yudilevich DL, Sobrevia L. Regulation of amino acid and glucose transporters in endothelial and smooth muscle cells. Physiol Rev 2003;83: 183–252.

400

J. Strobel et al. / Journal of Molecular and Cellular Cardiology 53 (2012) 392–400

[30] Devés R, Boyd CA. Transporters for cationic amino acids in animal cells: discovery, structure, and function. Physiol Rev 1998;78:487–545. [31] White MF, Christensen HN. The two-way flux of cationic amino acids across the plasma membrane of mammalian cells is largely explained by a single transport system. J Biol Chem 1982;257:10069–80. [32] White MF, Gazzola GC, Christensen HN. Cationic amino acid transport into cultured animal cells. I. Influx into cultured human fibroblasts. J Biol Chem 1982;257:4443–9. [33] Kim JW, Closs EI, Albritton LM, Cunningham JM. Transport of cationic amino acids by the mouse ecotropic retrovirus receptor. Nature 1991;352:725–8. [34] Closs EI, Basha FZ, Habermeier A, Förstermann U. Interference of L-arginine analogues with L-arginine transport mediated by the y+ carrier hCAT-2B. Nitric Oxide 1997;1:65–73. [35] Perkins CP, Mar V, Shutter JR, del Castillo J, Danilenko DM, Medlock ES, et al. Anemia and perinatal death result from loss of the murine ecotropic retrovirus receptor mCAT-1. Genes Dev 1997;11:914–25. [36] Zharikov SI, Block ER. Characterization of L-arginine uptake by plasma membrane vesicles isolated from cultured pulmonary artery endothelial cells. Biochim Biophys Acta 1998;1369:173–83. [37] Greene B, Pacitti AJ, Souba WW. Characterization of L-arginine transport by pulmonary artery endothelial cells. Am J Physiol 1993;264:L351–6. [38] Yang Z, Venardos K, Jones E, Morris BJ, Chin-Dusting J, Kaye DM. Identification of a novel polymorphism in the 3′UTR of the L-arginine transporter gene SLC7A1: contribution to hypertension and endothelial dysfunction. Circulation 2007;115:1269–74. [39] Seithel A, Eberl S, Singer K, Auge D, Heinkele G, Wolf NB, et al. The influence of macrolide antibiotics on the uptake of organic anions and drugs mediated by OATP1B1 and OATP1B3. Drug Metab Dispos 2007;35:779–86. [40] Mandery K, Bujok K, Schmidt I, Wex T, Treiber G, Malfertheiner P, et al. Influence of cyclooxygenase inhibitors on the function of the prostaglandin transporter organic anion-transporting polypeptide 2A1 expressed in human gastroduodenal mucosa. J Pharmacol Exp Ther 2010;332:345–51. [41] Cui Y, König J, Buchholz JK, Spring H, Leier I, Keppler D. Drug resistance and ATP-dependent conjugate transport mediated by the apical multidrug resistance protein, MRP2, permanently expressed in human and canine cells. Mol Pharmacol 1999;55:929–37. [42] Maas R, Tan-Andreesen J, Schwedhelm E, Schulze F, Böger RH. A stable-isotope based technique for the determination of dimethylarginine dimethylaminohydrolase (DDAH) activity in mouse tissue. J Chromatogr B Analyt Technol Biomed Life Sci 2007;851:220–8. [43] Closs EI. Expression, regulation and function of carrier proteins for cationic amino acids. Curr Opin Nephrol Hypertens 2002;11:99–107. [44] Dye JF, Vause S, Johnston T, Clark P, Firth JA, D'Souza SW, et al. Characterization of cationic amino acid transporters and expression of endothelial nitric oxide synthase in human placental microvascular endothelial cells. FASEB J 2004;18:125–7. [45] Li C, Huang W, Harris MB, Goolsby JM, Venema RC. Interaction of the endothelial nitric oxide synthase with the CAT-1 arginine transporter enhances NO release by a mechanism not involving arginine transport. Biochem J 2005;386:567–74. [46] Asagami T, Abbasi F, Stuelinger M, Lamendola C, McLaughlin T, Cooke JP, et al. Metformin treatment lowers asymmetric dimethylarginine concentrations in patients with type 2 diabetes. Metabolism 2002;51:843–6. [47] Hingorani AD. Polymorphisms in endothelial nitric oxide synthase and atherogenesis: John French Lecture 2000. Atherosclerosis 2001;154:521–7. [48] Cardounel AJ, Cui H, Samouilov A, Johnson W, Kearns P, Tsai AL, et al. Evidence for the pathophysiological role of endogenous methylarginines in regulation of endothelial NO production and vascular function. J Biol Chem 2007;282: 879–87. [49] Pollock JS, Förstermann U, Mitchell JA, Warner TD, Schmidt HH, Nakane M, et al. Purification and characterization of particulate endothelium-derived relaxing factor synthase from cultured and native bovine aortic endothelial cells. Proc Natl Acad Sci U S A 1991;88:10480–4.

[50] Baydoun AR, Emery PW, Pearson JD, Mann GE. Substrate-dependent regulation of intracellular amino acid concentrations in cultured bovine aortic endothelial cells. Biochem Biophys Res Commun 1990;173:940–8. [51] Hecker M, Mitchell JA, Harris HJ, Katsura M, Thiemermann C, Vane JR. Endothelial cells metabolize NG-monomethyl-L-arginine to L-citrulline and subsequently to L-arginine. Biochem Biophys Res Commun 1990;167:1037–43. [52] Gold ME, Bush PA, Ignarro LJ. Depletion of arterial L‐arginine causes reversible tolerance to endothelium-dependent relaxation. Biochem Biophys Res Commun 1989;164:714–21. [53] Bogle RG, MacAllister RJ, Whitley GS, Vallance P. Induction of NG-monomethylL-arginine uptake: a mechanism for differential inhibition of NO synthases? Am J Physiol 1995;269:C750–6. [54] Xiao S, Wagner L, Mahaney J, Baylis C. Uremic levels of urea inhibit L-arginine transport in cultured endothelial cells. Am J Physiol Renal Physiol 2001;280:F989–95. [55] Tojo A, Welch WJ, Bremer V, Kimoto M, Kimura K, Omata M, et al. Colocalization of demethylating enzymes and NOS and functional effects of methylarginines in rat kidney. Kidney Int 1997;52:1593–601. [56] Closs EI, Albritton LM, Kim JW, Cunningham JM. Identification of a low affinity, high capacity transporter of cationic amino acids in mouse liver. J Biol Chem 1993;268:7538–44. [57] Bogle RG, Baydoun AR, Pearson JD, Mann GE. Regulation of L-arginine transport and nitric oxide release in superfused porcine aortic endothelial cells. J Physiol 1996;490(Pt 1):229–41. [58] Slenzka A, Unger G, Habermeier A, Closs EI. Removal of intracellular asymmetric dimethyl-L-arginine (ADMA) requires system y+L membrane transporter— despite significant activity of the metabolising enzyme dimethylarginine dimethylaminohydrolase (DDAH). Naunyn Schmiedebergs Arch Pharmacol 2011;383:1–112 [Abstract]. [59] Rudolph TK, Ruempler K, Schwedhelm E, Tan-Andresen J, Riederer U, Böger RH, et al. Acute effects of various fast-food meals on vascular function and cardiovascular disease risk markers: the Hamburg Burger Trial. Am J Clin Nutr 2007;86:334–40. [60] Walker HA, McGing E, Fisher I, Böger RH, Bode-Böger SM, Jackson G, et al. Endothelium-dependent vasodilation is independent of the plasma L-arginine/ ADMA ratio in men with stable angina: lack of effect of oral L-arginine on endothelial function, oxidative stress and exercise performance. J Am Coll Cardiol 2001;38: 499–505. [61] Wilson AM, Harada R, Nair N, Balasubramanian N, Cooke JP. L-arginine supplementation in peripheral arterial disease: no benefit and possible harm. Circulation 2007;116:188–95. [62] Schwedhelm E, Maas R, Freese R, Jung D, Lukacs Z, Jambrecina A, et al. Pharmacokinetic and pharmacodynamic properties of oral L-citrulline and L-arginine: impact on nitric oxide metabolism. Br J Clin Pharmacol 2008;65:51–9. [63] Schwedhelm E, Xanthakis V, Maas R, Sullivan LM, Atzler D, Lüneburg N, et al. Plasma symmetric dimethylarginine reference limits from the Framingham offspring cohort. Clin Chem Lab Med 2011;49:1907–10. [64] McDonald KK, Zharikov S, Block ER, Kilberg MS. A caveolar complex between the cationic amino acid transporter 1 and endothelial nitric-oxide synthase may explain the “arginine paradox”. J Biol Chem 1997;272:31213–6. [65] Zani BG, Bohlen HG. Transport of extracellular L-arginine via cationic amino acid transporter is required during in vivo endothelial nitric oxide production. Am J Physiol Heart Circ Physiol 2005;289:H1381–90. [66] Wu F, Cholewa B, Mattson DL. Characterization of L-arginine transporters in rat renal inner medullary collecting duct. Am J Physiol Regul Integr Comp Physiol 2000;278:R1506–12. [67] Preik-Steinhoff H, Zink S, Rösen P, Kelm M. Transport of L-arginine in arginine-deprived endothelial cells. Biochem Biophys Res Commun 1995;213:447–53. [68] Arancibia-Garavilla Y, Toledo F, Casanello P, Sobrevia L. Nitric oxide synthesis requires activity of the cationic and neutral amino acid transport system y+L in human umbilical vein endothelium. Exp Physiol 2003;88:699–710.