Interactions of deoxynivalenol and lipopolysaccharides on cytokine excretion and mRNA expression in porcine hepatocytes and Kupffer cell enriched hepatocyte cultures

Toxicology Letters 190 (2009) 96–105

Contents lists available at ScienceDirect

Toxicology Letters journal homepage: www.elsevier.com/locate/toxlet

Interactions of deoxynivalenol and lipopolysaccharides on cytokine excretion and mRNA expression in porcine hepatocytes and Kupffer cell enriched hepatocyte cultures Susanne Döll a,b,∗ , Jan A. Schrickx a , Sven Dänicke b , Johanna Fink-Gremmels a a b

Division of Veterinary Pharmacology, Pharmacy and Toxicology, Department of Equine Science, Faculty of Veterinary Medicine, Utrecht University, The Netherlands Institute of Animal Nutrition, Friedrich-Loeffler-Institute (FLI) Federal Research Institute for Animal Health, Braunschweig, Germany

a r t i c l e

i n f o

Article history: Received 18 May 2009 Received in revised form 1 July 2009 Accepted 6 July 2009 Available online 14 July 2009 Keywords: Deoxynivalenol Mycotoxin Pig Hepatocytes Kupffer cells Lipopolysaccharide Cytokines

a b s t r a c t The effects of deoxynivalenol (DON) on the mRNA expression of cytokines and inflammation-related genes, as well as the cytokine secretion of porcine hepatocytes and Kupffer cell enriched hepatocyte cultures (co-cultures), were investigated in the absence or presence of LPS. DON and LPS acted in a synergistic manner with regard to a significantly increased mRNA expression of TNF-␣ in hepatocytes exposed to 500 nM or 2000 nM DON, or non-significant increase in co-cultures after 3 h of exposure. TNF-␣ supernatant concentrations were increased due to LPS but did not reflect the synergistic effects with DON as observed at mRNA level. IL-6 mRNA in hepatocyte cultures at 6 h paralleled the TNF-␣ supernatant pattern at this time point. In co-cultures and hepatocytes, a DON dose dependent induction of IL-6 mRNA was detected in cells not exposed to LPS. Supernatant concentrations of LPS-induced IL-6 were significantly decreased by 2000 nM DON in both types of cell cultures. Also the mRNA expression of the anti-inflammatory IL-10 was increased by DON to various degrees depending on DON-dose, stimulation with LPS and time point of measurement. After 6 h, expression of iNOS was only induced by 2000 nM DON, but not in LPS treated cells. Even if mRNA induction was not paralleled by related supernatant concentrations of TNF-␣, IL-6 and IL-10 under the conditions of the present investigations, it was clearly demonstrated that DON has the potential to provoke and modulate immunological reactions of porcine liver cells. © 2009 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Deoxynivalenol (DON) is a frequently occurring mycotoxin produced mainly by fungi of the Fusarium genus which infect maize or small grain cereals (Bottalico and Perrone, 2002; Logrieco et al., 2002). It belongs to the group of trichothecene mycotoxins which are tetracyclic sesquiterpenes sharing a 12–13 epoxy moiety. Via this epoxy group, trichotecenes are able to bind to the large subunit of eukaryotic ribosomes and interfere with the peptidyltransferase, thus impairing initiation or elongation of peptide chains (Ehrlich and Daigle, 1987; Feinberg and McLaughlin, 1989). Modulation of peptidyltransferase activity of ribosomes by xenobiotics including DON has been linked to modulation of mitogen activated protein kinase (MAPK) activities through a process referred to as “ribotoxic stress response” (Laskin et al., 2002). MAPKs are impor-

∗ Corresponding author at: Institute of Animal Nutrition, Federal Research Institute for Animal Health (FLI), Bundesallee 50, 38116 Braunschweig, Germany. Tel.: +49 531 596 3152; fax: +49 531 596 3199. E-mail address: susanne.doell@fli.bund.de (S. Döll). 0378-4274/$ – see front matter © 2009 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.toxlet.2009.07.007

tant transducers of signalling events related to immune response and apoptosis and have been linked to DON mediated induction of pro-inflammatory cytokines which result in immunomodulation in mice in vivo (Pestka, 2008). From numerous studies in laboratory animals and cell lines it was concluded that low dose exposure upregulates expression of cytokines, chemokines and inflammatory genes with concurrent immune stimulation, whereas high dose exposure promotes leukocyte apoptosis with concomitant immune suppression (Pestka et al., 2004). The underlying literature reveals that low concentrations refer to an oral dosing of 5–25 mg DON/kg body weight eliciting cytokine mRNA expression in mice (Zhou et al., 1997), while MAPK phosphorylation was observed at 1 mg DON/kg b.w. with maximal responses at 5–100 mg/kg b.w. (Zhou et al., 2003). Considering the oral LD50 of DON in mice of 46 mg/kg b.w. (Ueno, 1984), or 78 mg/kg b.w (Forsell et al., 1987), especially the latter dose seems rather high as it exceeds the LD50 . Assuming a feed consumption of approximately 10% of the body weight in rapidly growing animals, and 5% in adult animals (EFSA, 2004a), it can be estimated that doses of 1 mg, 5 mg, 25 mg and 100 mg DON/kg b.w. correspond to feed concentrations of 10 mg/kg, 50 mg/kg, 250 mg/kg and

S. Döll et al. / Toxicology Letters 190 (2009) 96–105

1000 mg/kg feed for growing animals, and 20 mg/kg, 100 mg/kg, 500 mg/kg and 2000 mg/kg feed for adult animals. The occurrence of DON is almost exclusively associated with cereals, and the levels of occurrence are in the order of hundreds of ␮g/kg upwards with high concentrations of several mg and the highest levels of more than 30 mg/kg reported in surveys (review at EFSA, 2004b), emphasising the subjective nature of the terms low and high concentrations. Among investigated species the pig reacts most sensitively to DON with reduced feed intake being the most prominent symptom at feedstuff concentrations exceeding 0.9 mg DON/kg feed (EFSA, 2004b). As pro-inflammatory cytokines produced by activated mononuclear myeloid cells, including IL-6 and tumour necrosis factor (TNF)-␣, are known to be involved in reducing feed intake of animals in patho-physiological conditions (Johnson, 1998; Plata-Salaman, 2001), it seems possible that the mechanisms of immunmodulation by DON, derived in studies on mice (Pestka et al., 2004), also represent the underlying mechanisms for the effects observed in pigs. However, with respect to species differences in the structure and function of immune systems (Haley, 2003), and species-specific sensitivities towards DON, it is necessary to conduct fundamental investigations in pigs to assess the significance of the demonstrated pathways. Therefore the present investigation focused on the induction of the pro-inflammatory cytokines TNF-␣ and IL-6 and the antiinflammatory cytokine IL-10 as well as the inducible nitric oxide synthetase (iNOS) in primary cultures of porcine liver cells as this organ is the port of entry of portal blood flow draining the gastrointestinal tract, thus being exposed not only to feed derived toxins but also to gut derived bacterial products like LPS (Jacob et al., 1977; Jiang et al., 1995), which are known to exert synergistic effects with DON (Pestka et al., 2004). Since the Kupffer cell population is known to expand in response to inflammatory agents (reviewed by Wake et al., 1989), Kupffer cell-enriched hepatocyte cultures (co-cultures) were investigated in addition to hepatocyte cultures containing few Kupffer cells to model the liver in state of chronic inflammation as well as under physiological conditions. Effects on cytotoxicity, protein synthesis, and albumin secretion, as well as on metabolism of DON, are presented elsewhere (Döll et al., 2009b). 2. Materials and methods 2.1. Chemicals and reagents DON, LPS (Escherichia coli, 0111:B4), gentamicin, collagenase (type IV), bovine pancreas insulin and bovine serum albumin (BSA) were purchased from Sigma (St. Louis, MO, USA). Williams’ medium E, fetal bovine serum (FBS), glutamine and penicillin/streptomycin were obtained from Gibco Invitrogen (Breda, The Netherlands). Percoll was obtained from Pharmacia (Uppsala, Sweden). Ampicillin was from Dopharma Veterinaire Farmaca BV (Raamsdonksveer, The Netherlands). Pentobarbital-sodium was from Produlab Pharma, Raamsdonksveer, The Netherlands. Quantakine porcine TNF-␣ DuoSet ELISA development system, Quantakine porcine IL-6 DuoSet ELISA development system, and Quantakine porcine IL-10 DuoSet ELISA development system plus ancillary products were obtained from R&D Systems (Minneapolis, MN, USA). The SV-total RNA isolation kit was obtained from Promega (Madison, WI, USA) while iScriptTM cDNA Synthesis kit and IQTM SybrGreen Supermix were from Bio-Rad (Hercules, CA, USA). The primers were manufactured commercially (Isogen, Ijsselstein, The Netherlands). All other chemicals used were of analytical grade and obtained commercially. 2.2. Isolation of hepatocytes and Kupffer cells and preparation of cultures The isolation of the primary porcine hepatocytes and Kupffer cells and the preparation of the hepatocyte cultures and of the co-cultures of hepatocytes and Kupffer cells were previously described (Döll et al., 2009b). Cells were isolated from livers of three healthy castrated male pigs (Large white × Finnish landrace × Yorkshire) of approximately 10 weeks of age with a body weight of 24–27 kg. The animals were obtained from the breeding farm of the Faculty of Veterinary Medicine, Utrecht University. The Ethical

97

Committee of the Faculty approved the use of the animals for the investigations. After euthanization by i.v. injection of pentobarbital-sodium, the livers were quickly dissected and a part of the left medial lobe was flushed with ice cold saline. Hepatocytes were isolated by the method by Seglen (1976) as modified by Monshouwer et al. (1996) by retrograde perfusion via 3–4 cannulas. The resulting cell suspension in modified Hanks buffered salt solution (HBSS) (pH 7.65, 9.2 mM HEPES, 9.91 g/l HBSS, without Ca2+ and Mg2+ , 2% BSA) was centrifuged for 10 min at 200 × g. The supernatant was discarded and the liver cells were resuspended in PBS and centrifuged for 3 min at 50 × g. The supernatant, containing mainly non-parenchymal cells, was collected for isolation of Kupffer cells (see below). The pellet, consisting mainly of hepatocytes, was resuspended in Williams’ medium E and centrifuged at 50 × g for 10 min. This wash was repeated four times. Thereafter cells were resuspended in Williams’ medium E supplemented with 5% (v/v) FBS, glutamine (2 mM), gentamicin (50 ␮g/ml), ampicillin (50 ␮g/ml) and insulin (1 ␮M). The volume was adjusted to yield a concentration of 1 × 106 viable cells/ml. Kupffer cells were isolated according to the method by Smedsrod et al. (1985) as modified by Hoebe et al. (2000). The supernatants, containing mainly nonparenchymal cells, were centrifuged for 2 min at 50 × g twice to remove remaining parenchymal cells. Afterwards, supernatants were centrifuged for 10 min at 200 × g. The cell pellet was resuspended in 40 ml PBS. This cell suspension was layered on a two-step (60% and 25%, v/v) percoll gradient and centrifuged for 15 min at 400 × g at 4 ◦ C. The cells layered between the two layers of percoll were collected and diluted with PBS. The suspension was centrifuged at 200 × g for 10 min and the resulting pellet, consisting mainly of Kupffer cells and endothelial cells, was suspended in Williams’ medium E (without serum) to give a concentration of 106 viable cells/ml. Cells were plated on tissue culture plates (5 × 105 cells/well in 96 well plates for cytotoxicity and 1 × 106 cells/well in 12 well plates) and incubated at 37 ◦ C and 5% CO2 for 30 min, after which the non-adherent endothelial cells were removed by a wash step. For preparation of co-cultures, the same amount of hepatocytes were added to the Kupffer cells. As approximately 50% of the seeded non-parenchymal cells should be Kupffer cells, this should result in a 1:2 mixture of Kupffer cells and hepatocytes.

2.3. Experimental design Twenty-four hours after seeding, the medium was replaced by Williams’ medium E without serum, supplemented with glutamine (2 mM), penicillin (100 U/ml), streptomycine (100 ␮g/ml) and insulin (1 ␮M) containing increasing concentrations of DON with or without 1 ␮g LPS/ml. According to the treatments, the medium was further supplemented with 0 nM, 0.5 nM, 5 nM, 50 nM, 500 nM and 2000 nM DON in absence and presence of 1 ␮g LPS/ml. The cells were incubated for 3 h, 6 h, 12 h, 24 h and 48 h at 37 ◦ C and 5% CO2 . Supernatants were collected for the analysis of cytokines and further investigations (Döll et al., 2009b) and cells were scraped in lysis buffer for the isolation of RNA.

2.4. RNA isolation RNA of hepatocytes and co-cultures was isolated to investigate the mRNA expression of iNOS, TNF-␣, IL-6 and IL-10. Cells were scraped in lysis buffer and total RNA was isolated using the SV-total RNA isolation kit (Promega, Leiden, The Netherlands) according to the manufacturer’s protocol including a DNAse treatment. The RNA was quantified spectrophotometrically at 260 nm (ND-1000, Nanodrop technologies) and stored at −70 ◦ C. 2.5. cDNA synthesis First strand c DNA synthesis was performed with the iScriptTM cDNA Synthesis kit (Bio-Rad, Hercules, CA, USA). A quantity of 1 ␮g total RNA was added to the mixture containing both oligo(dT) and random hexamer primers in a final volume of 20 ␮l. The reaction mixture was incubated at 25 ◦ C for 5 min and 42 ◦ C for 45 min, followed by heat inactivation of the enzyme at 85 ◦ C for 5 min and a subsequent fast cool step to 4 ◦ C. The cDNA was stored at −20 ◦ C. 2.6. Real time quantitative PCR analysis Quantitative PCR analysis was carried out with 50 ng reverse transcribed RNA in a 25 ␮l reaction using IQTM SybrGreen Supermix (Biorad, Hercules, CA, USA) containing SybrGreen I as an intercalating dye for real time detection of double stranded DNA, fluorescein (20 nM) for dynamic well factor collection, iTaq DNA polymerase (50 units/ml), 6 mM MgCl2 and 0.4 mM of each dNTP. According to the gene of interest, the reaction mix contained 7.5 pmol of each specific primer (Table 1). PCR was carried out on a MyIQ single colour real time PCR detection system (BioRad, Hercules, CA, USA). Following an initial hot start for 3 min, 40 cycles of a denaturation step at 95 ◦ C for 20 s, an annealing step at the temperature of the specific primer set (Table 1) for 30 s and an elongation step at 72 ◦ C for 30 s were run. Subsequently, a melting curve was obtained by increasing the temperature with 0.5 ◦ C every 10 s from 65 ◦ C to 95 ◦ C.

98

S. Döll et al. / Toxicology Letters 190 (2009) 96–105

Table 1 Primer sets used for the quantitative PCR analysis with the respective annealing temperatures used. Gene

NCBI accession number

Forward primer 5 → 3

Reverse primer 3 → 5

Ta (◦ C)

Ref.

IL-6 TNF-␣ iNOS IL-10 Cyclophilin ACTB HPRT

NM 214399 NM 214022 SSU59390 NM 214041 NM 214353 AY550069 NM 001032376

CTGGCAGAAAACAACCTGAACC CCAACGGCGTGAAGCTGAAAGAC CTCTTCGAAATCCCTCCTGAC CGGCGCTGTCATCAATTTCTG TGCTTTCACAGAATAATTCCAGGATTTA GCAAATGCTTCTAGGCGGACTGT ATCATTATGCCGAGGATTTGGA

TGATTCTCATCAAGCAGGTCTCC GATGCGGCTGATGGTGTGAGTGA AGCTCCTGGAACCACTCGT CCCCTCTTGGAGCTTGCTA GACTTGCCACCAGTGCCATTA CCAAATAAAGCCATGCCAATCTCA CCTCCCATCTCTTTCATCACATCT

60 60 61.2 56 60 64 63

Duvigneau et al. (2005)

2.7. Cytokine assays

3. Results

Concentrations of IL-6, TNF-␣ and IL-10 in supernatants were measured by enzyme linked immuno-absorbent assays (ELISA) using ELISA development kits for porcine IL-6, TNF and IL-10 (R&D Systems, Minneapolis, MN, USA) according to the manufacturers protocol as described previously (Döll et al., 2009a).

3.1. TNF-˛

2.8. Calculations and statistics The expression of iNOS, TNF-␣, IL-6 and IL-10 was normalized to the geometric mean expression of the housekeeping genes cyclophilin, ␤-actin (ACTB) and hypoxanthine phosphoribosyl-transferase (HPRT) according to Vandesompele et al. (2002): Relative expression of GOI =

QGOI GeoMean(QACTB ; QCyclophilin ; QHPRT )

where GOI = gene of interest; Q (relative quantity) = 2EXPCt ; Ct = Ctmin − Ctsample ; while Ct = threshold cycle; Ctmin = lowest Ct of samples and Ctsample = Ct of sample of interest. The expression before treatment start (t = 0) was adjusted to 1 and all samples were corrected with this factor. The effects of DON and LPS on hepatocytes and Kupffer cell enriched hepatocyte co-cultures were analyzed according to a two by two factorial design of ANOVA accounting for heterogenic variances considering effect of DON concentration (0 nM, 0.5 nM, 5 nM, 50 nM, 500 nM or 2000 nM DON), effect of LPS concentration (0 ␮g/ml or 1 ␮g/ml) and interactions between DON and LPS. Significant mean value differences were evaluated by the Student’s t-test. All statistics were carried out using the SAS package (SAS Institute Inc., 2006).

Duvigneau et al. (2005)

The mRNA expression of TNF-␣ in LPS-stimulated cells reached its peak after 3 h of incubation and declined quickly thereafter (Fig. 1A and B). In both types of cultures, the cells exposed to LPS and 2000 nM DON showed the highest expression, while the induction in co-cultures (894) was 592% of that in hepatocyte cultures (151). The mRNA expression of LPS-stimulated hepatocytes exposed to 500 nM or 2000 nM DON differed significantly from those exposed to lower concentrations of DON or LPS alone, while no dose dependent DON effects were observed in the absence of LPS (Fig. 1C). The effects in co-cultures showed a similar pattern but did not reach the level of significance (Fig. 1D). The concentrations of TNF-␣ in cell culture supernatants reached the highest concentration after 6 h of incubation in LPS-stimulated cultures (Fig. 2A and B). In both culture types, the highest concentration was detected in supernatants of cells incubated with 1 mg/ml LPS and 500 nM DON, even though no dose dependent DON effect was present. The peak concentration in co-cultures (1573 ng/ml) was 314% of that measured in hepatocytes (501 ng/ml). Mean supernatant concentrations in hepatocytes not incubated with LPS increased with 4 ng, 18 ng, 12 ng, 41 ng, 81 ng

Fig. 1. Effects of increasing concentrations of DON (A and B: 0 nM (), 0.5 nM (), 5 nM (䊉), 50 nM (), 500 nM ( ) and 2000 nM ( ) DON) on mRNA expression of TNF-␣ in porcine hepatocytes (A and C) or co-cultures of hepatocytes and Kupffer cells (B and D) cultured in presence or absence of LPS (A and B: — 0 ␮g/ml, - - - 1 ␮g/ml; C and D:  0 ␮g LPS/ml, 1 ␮g LPS/ml) over a time range of 48 h (A and B) and after 3 h (C and D) (values are means ± SEM of three experiments carried out in duplicate for hepatocytes or one experiment carried out in triplicate for co-cultures, (a–e) bars within one graph with different superscripts are significantly different, p > 0.05, Student’s t-test).

S. Döll et al. / Toxicology Letters 190 (2009) 96–105

99

Fig. 2. Effects of increasing concentrations of DON (A and B: 0 nM (), 0.5 nM (), 5 nM (䊉), 50 nM (), 500 nM ( ) and 2000 nM ( ) DON) on TNF-␣ concentrations in supernatants of porcine hepatocytes (A, C and E) or co-cultures of hepatocytes and Kupffer cells (B, D and F) cultured in presence or absence of LPS (A and B: — 0 ␮g/ml, - - 1 ␮g LPS/ml) over a time range of 48 h (A and B), after 6 h (C and D) and after 24 h (E and F) (values are means ± SEM of three experiments 1 ␮g/ml; C–F:  0 ␮g LPS/ml, carried out in duplicate for hepatocytes or one experiment carried out in triplicate for co-cultures, (a–d) bars within one graph with different superscripts are significantly different, p > 0.05, Student’s t-test).

and 90 ng TNF-␣/ml for cells incubated with 0 nM, 0.5 nM, 5 nM, 50 nM, 500 nM and 2000 nM DON after 6 h (Fig. 2C). Unlike the mRNA expression, the supernatant concentrations did not decrease to baseline levels within the 48 h experimental period. After 24 h, supernatant concentrations seemed to be increased due to exposure to DON in a dose-related fashion for hepatocytes cultured in both the absence or presence of LPS (Fig. 2E). The pattern was similar for the LPS exposed co-cultures at this time point, while co-cultures in the absence of LPS did not respond to DON exposure (Fig. 2F). 3.2. IL-6 The mRNA expression of IL-6 in LPS-stimulated cultures reached its peak at 6 h in hepatocyte cultures (Fig. 3A) and at 12 h in cocultures (Fig. 3B), while the exposure to DON did not affect the expression level in those cultures at this time point. In contrast, cultures not stimulated with LPS showed a significant induction of IL-6 mRNA expression when incubated with increasing concentrations of DON at 6 h (Fig. 3C and D). In hepatocytes, the expression in cells exposed to 2000 nM DON was 12-fold of those not exposed to DON, while in co-cultures the increase was 27-fold. At 24 h the expression of hepatocytes not treated with LPS returned to baseline

levels (Fig. 3G). In LPS stimulated hepatocytes, the expression of IL6 mRNA at 24 h was significantly decreased by 500 nM and 2000 nM DON as compared to lower DON concentrations. At the same time point, a significant decrease by 2000 nM DON was observed in cocultures not treated with LPS (Fig. 3H). The supernatant concentrations of IL-6 increased continuously in both hepatocytes and co-cultures during the experimental period (Fig. 4A and B). The exposure to the highest DON concentration lead to significantly reduced IL-6 concentrations in hepatocytes as well as co-cultures stimulated with LPS (Fig. 4C and D). In nonstimulated cells, no clear dose dependent effects of DON on IL-6 supernatant concentrations were detected. 3.3. IL-10 The expression of IL-10 mRNA peaked at 3–6 h in hepatocytes (Fig. 5A) and at 3–12 h in co-cultures (Fig. 5B). After 3 h, the expression was significantly increased by 500 nM and 2000 nM DON in cultures stimulated with LPS while in non-stimulated cells only 2000 nM DON lead to a non-significant increase in IL-10 expression (Fig. 5C and D). In hepatocytes the effects were similar after 6 h and diminished after 12 h (Fig. 5E and G). In co-cultures large variation dominated the IL-10 mRNA expression at the later time

100

S. Döll et al. / Toxicology Letters 190 (2009) 96–105

Fig. 3. Effects of increasing concentrations of DON (A and B: 0 nM (), 0.5 nM (), 5 nM (䊉), 50 nM (), 500 nM ( ) and 2000 nM ( ) DON) on mRNA expression of IL-6 in porcine hepatocytes (A, C, E and G) or co-cultures of hepatocytes and Kupffer cells (B, D, F and H) cultured in presence or absence of LPS (A and B: — 0 ␮g/ml, - - - 1 ␮g/ml; 1 ␮g LPS/ml) over a time range of 48 h (A and B), after 6 h (C and D), after 12 h (E and F) and after 24 h (G and H) (values are means ± SEM of three C–H:  0 ␮g LPS/ml, experiments carried out in duplicate for hepatocytes or one experiment carried out in triplicate for co-cultures, (a–c) bars within one graph with different superscripts are significantly different, p > 0.05, Student’s t-test).

points (Fig. 5F and H). In general, IL-10 mRNA expression was higher in co-cultures than in hepatocytes. IL-10 in supernatants of hepatocytes and co-cultures could not be detected (results not shown). 3.4. iNOS The mRNA expression of iNOS peaked after 6 or 12 h of incubation for all LPS-exposed groups in both, hepatocytes and co-cultures (Fig. 6A and B). In both types of cultures the highest expression

was observed in cells exposed to LPS only. This peak expression in co-cultures (111) was 135% of that in hepatocytes (82). iNOS expression of cells not incubated with LPS remained at baseline levels with the exception of cultures treated with 2000 nM DON which were significantly (in the case of hepatocytes) or numerically (in the case of co-cultures) increased at 6 h (Fig. 6C and D). Treatment group differences in LPS-stimulated hepatocytes due to DON exposure were not significant. Significant differences in LPS exposed co-cultures at 6 h did not show unequivocal dependency on the DON dose. After 12 h of treatment, no signif-

S. Döll et al. / Toxicology Letters 190 (2009) 96–105

101

Fig. 4. Effects of increasing concentrations of DON (A and B: 0 nM (), 0.5 nM (), 5 nM (䊉), 50 nM (), 500 nM ( ) and 2000 nM ( ) DON) on IL-6 concentrations in supernatants of porcine hepatocytes (A and C) or co-cultures of hepatocytes and Kupffer cells (B and D) cultured in presence or absence of LPS (A and B: — 0 ␮g/ml, - - 1 ␮g LPS/ml) over a time range of 48 h (A and B) and after 24 h (C and D) (values are means ± SEM of three experiments carried out in 1 ␮g/ml; C and D:  0 ␮g LPS/ml, duplicate for hepatocytes or one experiment carried out in triplicate for co-cultures, (a–e) bars within one graph with different superscripts are significantly different, p > 0.05, Student’s t-test).

icant differences could be detected due to DON exposure (Fig. 6E and F). 4. Discussion Besides its major metabolic functions, the liver represents a center of defense for the body as it fulfils important immunologic tasks like, e.g., phagocytosis, antigen presentation and acute phase reaction. A close cooperation of the different liver cell populations is necessary in those processes and crosstalk between liver cells results in complex interactions on liver functions (for review see Kmiec, 2001). The high protein turnover of the liver together with its immunologic functions renders this organ as a target for DON in more than one respect. However, little information is available on the effects of DON on liver cells and especially on the immunomodulatory effects. The present investigation demonstrated a rapid induction of TNF-␣ mRNA upon LPS stimulation. This obviously originated from Kupffer cells, as the magnitude of induction in co-cultures was almost 6-fold of that in hepatocyte cultures in which Kupffer cells were present as well, but at lower percentages as in co-cultures (Döll et al., 2009b). The interactions observed between DON and LPS on TNF-␣ mRNA induction are in accordance with studies in the murine macrophage cell line RAW 264.7 (Pestka and Zhou, 2006; Wong et al., 2001), mice (Islam and Pestka, 2006; Zhou et al., 1999) and also porcine alveolar macrophages (Döll et al., 2009a). However, unlike the present study, synergistic effects of DON and LPS in vitro were also demonstrated on TNF-␣ supernatant concentrations of RAW 264.7 cells (Ji et al., 1998) and the porcine alveolar macrophages mentioned previously. The functionality of the cell cultures used to respond to TNF-␣ mRNA induction with increased supernatant concentrations was demonstrated by the TNF-␣ production as a consequence of LPS exposure with peak concentrations after 6 h in both hepatocytes and cocultures. It seems possible that the ability of DON to inhibit protein

synthesis interfered with its own inductive effects on TNF-␣, as total protein synthesis of hepatocytes was significantly decreased by 2000 nM DON, and albumin secretion of hepatocytes and cocultures were significantly decreased by 500 nM and 2000 nM DON, the same concentrations which induced TNF-␣ mRNA, as early as after 3 h of incubation (Döll et al., 2009b). However, considering the synchronous effects observed on TNF-␣ mRNA, and supernatant concentrations in porcine alveolar macrophages (Döll et al., 2009a), this would imply cell type dependent sensitivity towards the effects of DON on protein synthesis. But taking into account the relatively high fractional protein synthesis rate of the liver, of 54% d−1 as compared to 26% d−1 in the lung, 10% d−1 in heart (Dänicke et al., 2006), or 16% d−1 in blood lymphocytes (Goyarts et al., 2006) as determined in pigs, it appears that this might render liver cells more susceptible to effects on protein synthesis. The IL-6 mRNA expression in hepatocytes after 6 h paralleled the TNF-␣ concentrations in supernatants at the same time point. Also the DON related non-significant increase in TNF-␣ supernatant concentrations in the absence of LPS resulted in a significant increase of IL-6 mRNA in those cells. This close relationship of TNF-␣ supernatant concentrations and IL-6 expression is not surprising, as the attenuation of LPS-induced IL-6 response of murine macrophages and mice when anti-TNF antibodies were co-administered, clearly demonstrated that the LPS-induced increase in IL-6 is mediated by TNF-␣ (Ghezzi et al., 2000). Therefore the over-induction of IL-6 mRNA by increasing DON in the hepatocyte enriched co-cultures was unexpected—as it may not be explained by TNF-␣. Despite the absence of a DON effect in LPS-stimulated hepatocytes on the IL-6 mRNA (Fig. 3), supernatant concentrations were significantly reduced when hepatocytes or co-cultures were exposed to 2000 nM DON (Fig. 4). Similar depressing effects on supernatant concentrations of IL-6 were previously reported in porcine alveolar macrophages exposed to 500 nM DON (Döll et al., 2009a) and in U937 cells, a clonal human macrophage model, exposed to 500 ng and 1000 ng DON/ml (1687 nM and 3375 nM)

102

S. Döll et al. / Toxicology Letters 190 (2009) 96–105

Fig. 5. Effects of increasing concentrations of DON (A and B: 0 nM (), 0.5 nM (), 5 nM (䊉), 50 nM (), 500 nM ( ) and 2000 nM ( ) DON) on mRNA expression of IL-10 in porcine hepatocytes (A, C, E and G) or co-cultures of hepatocytes and Kupffer cells (B, D, F and H) cultured in presence or absence of LPS (A and B: — 0 ␮g/ml, - - - 1 ␮g/ml; 1 ␮g LPS/ml) over a time range of 48 h (A and B), after 3 h (C and D), after 6 h (E and F) and after 12 h (G and H) (values are means ± SEM of three C–H:  0 ␮g LPS/ml, experiments carried out in duplicate for hepatocytes or one experiment carried out in triplicate for co-cultures, (a–d) bars within one graph with different superscripts are significantly different, p > 0.05, Student’s t-test).

(Sugita-Konishi and Pestka, 2001). Those findings oppose results in similar investigations using RAW 264.7 cells where exposure of LPS pre- or co-stimulated cells to DON concentrations ranging from 50 ng/ml to 250 ng/ml (169–844 nM) resulted in increased mRNA expression of TNF-␣ and IL-6 accompanied by increased production of the respective cytokines (Ji et al., 1998; Wong et al., 1998). However, the reasons for the differential effects of DON on mRNA and protein level, as observed in the present investigation, remain speculative. Expression of products depends on translational regulation,

post-translational modifications such as proteolytic processing, and expression of inhibitory cytokines, IL-10 and transforming growth factor (TGF)-␤ (Fujiwara and Kobayashi, 2005). In this context, the inhibition of protein synthesis by DON is only one possibility. Another possibility would be the down regulation of TNF-␣ and IL6 by IL-10. IL-10 is the best known and studied anti-inflammatory cytokine. Via signal transducer and activator of transcription (STAT) 3 signalling, it selectively inhibits the transcription of genes activated in inflammation (Murray, 2006). The IL-6 secretion of murine

S. Döll et al. / Toxicology Letters 190 (2009) 96–105

103

Fig. 6. Effects of increasing concentrations of DON (A and B: 0 nM (), 0.5 nM (), 5 nM (䊉), 50 nM (), 500 nM ( ) and 2000 nM ( ) DON) on mRNA expression of TNF-␣ in porcine hepatocytes (A, C and E) or co-cultures of hepatocytes and Kupffer cells (B, D and F) cultured in presence or absence of LPS (A and B: — 0 ␮g/ml, - - - 1 ␮g/ml; 1 ␮g LPS/ml) over a time range of 48 h (A and B), after 6 h (C and D) and after 12 h (E and F) (values are means ± SEM of three experiments carried C–F:  0 ␮g LPS/ml, out in duplicate for hepatocytes or one experiment carried out in triplicate for co-cultures, (a–d) bars within one graph with different superscripts are significantly different, p > 0.05, Student’s t-test).

Kupffer cells was shown to be regulated by endogenous IL-10 as the addition of anti-IL-10 antibodies increased the secretion of IL-6 (Knolle et al., 1997). The present results show a significantly increased induction of IL-10 mRNA in LPS treated hepatocytes and co-cultures exposed to 500 nM or 2000 nM DON already at 3 h (Fig. 5C and D). Investigations in transgenic mice overexpressing IL-10 exclusively in macrophages showed that the deactivation of macrophages by IL-10 occurred in an autocrine manner (Lang et al., 2002). During infection, IL-10 is an important immunoregulatory component required to prevent excessive immune activation, and ablation of IL-10 signalling results in the onset of severe, often fatal, immunopathology in a number of infections. On the other hand, excessive or mistimed IL-10 production can inhibit the proinflammatory response and thereby impede pathogen clearance, resulting in either fulminant and rapidly fatal or chronic infections (reviewed by Couper et al., 2008). Therefore, the overexpression of IL-10 in livers of pigs exposed to DON could have consequences on the resistance of the animals towards pathogens. Another feature of IL-10 is the inhibition of MHC-II, whereas the failure of monocyte derived dendritic cells of pigs, exposed to 3.5–4.4 mg DON/kg diet, to upregulate MHC-II in response to LPS/TNF-␣ ex vivo was previously

reported (Bimczok et al., 2007), supporting an implication of IL-10 in vivo. The mRNA expression of iNOS was significantly induced by LPS in hepatocytes and co-cultures while DON increased the expression at the highest concentration in the absence of LPS (Fig. 6C and D). Hoebe et al. (2001) demonstrated that iNOS is only expressed in hepatocytes and not in Kupffer cells in LPS stimulated porcine liver cell cultures, whereas direct stimulation via LPS in ultrapure hepatocyte cultures was further increased by soluble factors released by Kupffer cells in direct contact or membrane insert separated co-cultures. In porcine alveolar macrophages, DON did not affect the mRNA expression of iNOS in presence or absence of LPS (Döll et al., 2009a), but in RAW 264.7 cells DON dose dependently decreased NO in supernatants of LPS stimulated cells (Ji et al., 1998). The ability to induce iNOS upon inflammatory stimuli, and consequently the ability to produce NO, distinguishes porcine from murine and rat macrophages. Similar to human, caprine and lapine macrophages, porcine macrophages do not respond with the release of high amounts of NO to LPS exposure as murine, rat and bovine macrophages do (Albina, 1995; Jungi et al., 1996; Zelnickova et al., 2008). NO is important as toxic

104

S. Döll et al. / Toxicology Letters 190 (2009) 96–105

defence molecule against infectious pathogens. It also regulates the functional activity, growth and death of many immune cell types including macrophages, as determined in laboratory animals or cell lines derived from them. At high concentrations, NO is rapidly oxidised to reactive nitrogen oxide species (RNOS), which can affect key signalling molecules such as kinases and transcription factors, or inhibit key enzymes in mitochondrial respiration (Albina and Reichner, 1998; Bosca et al., 2005; Coleman, 2001). Therefore the ability of cells used to study immunomodulatory or toxic mechanisms to produce NO by induction of iNOS may have a substantial impact on the outcome of investigations. In addition, as human hepatocytes produce NO directly in response to LPS (Nussler et al., 1995), as also demonstrated for porcine hepatocytes (Hoebe et al., 2001), the cell culture model used in the present investigation may not only serve as a model for pigs but possibly resembles the human situation more closely than investigations on murine cells. In summary, it has to be noted that DON interacted with LPS to over-induce the mRNA expression of TNF-␣, whereas in cultures not exposed to LPS, IL-6 mRNA as well as iNOS mRNA were induced by increasing concentrations of DON. In both LPS-stimulated and notstimulated cells, exposure to high concentrations of DON induced IL-10 mRNA expression. Even if mRNA induction was not paralleled by related supernatant concentrations of TNF-␣, IL-6 and IL-10 under the conditions of the present investigations, it was clearly demonstrated that DON has the potential to provoke and modulate immunological reactions of porcine liver cells. The practical significance of those findings needs to be evaluated in vivo. Conflict of interest The authors declare no conflict of interest. Acknowledgements The financial support of the Deutsche Forschungsgemeinschaft (DFG) (DO 1204/1-1 and DO 1204/2-1) is gratefully acknowledged. We thank Roel F.M. Maas-Bakker and Marjolein A.M. van der Doelen for the excellent technical assistance. References Albina, J.E., 1995. On the expression of nitric oxide synthase by human macrophages. Why no NO? J. Leukoc. Biol. 58, 643–649. Albina, J.E., Reichner, J.S., 1998. Role of nitric oxide in mediation of macrophage cytotoxicity and apoptosis. Cancer Metastasis Rev. 17, 39–53. Bimczok, D., Doll, S., Rau, H., Goyarts, T., Wundrack, N., Naumann, M., Danicke, S., Rothkotter, H.J., 2007. The Fusarium toxin deoxynivalenol disrupts phenotype and function of monocyte-derived dendritic cells in vivo and in vitro. Immunobiology 212, 655–666. Bosca, L., Zeini, M., Traves, P.G., Hortelano, S., 2005. Nitric oxide and cell viability in inflammatory cells: a role for NO in macrophage function and fate. Toxicology 208, 249–258. Bottalico, A., Perrone, G., 2002. Toxigenic Fusarium species and mycotoxins associated with head blight in small-grain cereals in Europe. Eur. J. Plant Pathol. 108, 611–624. Coleman, J.W., 2001. Nitric oxide in immunity and inflammation. Int. Immunopharmacol. 1, 1397–1406. Couper, K.N., Blount, D.G., Riley, E.M., 2008. IL-10: the master regulator of immunity to infection. J. Immunol. 180, 5771–5777. Dänicke, S., Goyarts, T., Döll, S., Grove, N., Spolders, M., Flachowsky, G., 2006. Effects of the Fusarium toxin deoxynivalenol on tissue protein synthesis in pigs. Toxicol. Lett. 165, 297–311. Döll, S., Schrickx, J.A., Dänicke, S., Fink-Gremmels, J., 2009a. Deoxynivalenol induced cytotoxicity, cytokines and related genes in unstimulated or lipopolysaccharide stimulated primary porcine macrophages. Toxicol. Lett. 184, 97–106. Döll, S., Schrickx, J.A., Valenta, H., Dänicke, S., Fink-Gremmels, J., 2009b. Interactions of deoxynivalenol and lipopolysaccharides on cytotoxicity in porcine hepatocytes and Kupffer cell enriched hepatocyte cultures and effects on protein synthesis. Toxicol. Lett. 189, 121–129. Duvigneau, J.C., Hartl, R.T., Groiss, S., Gemeiner, M., 2005. Quantitative simultaneous multiplex real-time PCR for the detection of porcine cytokines. J. Immunol. Methods 306, 16–27.

EFSA, 2004a. Opinion of the scientific panel on contaminants in food chain on a request from the commission related to ochratoxin A (OTA) as undesirable substance in animal feed. EFSA J. 101, 1–36. EFSA, 2004b. Opinion of the scientific panel on contaminants in the food chain on a request from the commission related to deoxynivalenol (DON) as undesirable substance in animal feed. EFSA J. 73, 1–41. Ehrlich, K.C., Daigle, K.W., 1987. Protein synthesis inhibition by 8-oxo-12,13epoxytrichothecenes. Biochim. Biophys. Acta 923, 206–213. Feinberg, B., McLaughlin, C.S., 1989. Biochemical mechanism of action of trichothecene mycotoxins. In: Beasley, V.R. (Ed.), Trichothecene Mycotoxicosis: Pathophysiological Effects, vol. I. CRC Press, Inc., Boca Raton, FL, pp. 27–35. Forsell, J.H., Jensen, R., Tai, J.H., Witt, M., Lin, W.S., Pestka, J.J., 1987. Comparison of acute toxicities of deoxynivalenol (vomitoxin) and 15-acetyldeoxynivalenol in the B6C3F1 mouse. Food Chem. Toxicol. 25, 155–162. Fujiwara, N., Kobayashi, K., 2005. Macrophages in inflammation. Curr. Drug Targets. Inflamm. Allergy 4, 281–286. Ghezzi, P., Sacco, S., Agnello, D., Marullo, A., Caselli, G., Bertini, R., 2000. Lps induces IL-6 in the brain and in serum largely through TNF production. Cytokine 12, 1205–1210. Goyarts, T., Grove, N., Dänicke, S., 2006. Effects of the Fusarium toxin deoxynivalenol from naturally contaminated wheat given subchronically or as one single dose on the in vivo protein synthesis of peripheral blood lymphocytes and plasma proteins in the pig. Food Chem. Toxicol. 44, 1953–1965. Haley, P.J., 2003. Species differences in the structure and function of the immune system. Toxicology 188, 49–71. Hoebe, K.H., Monshouwer, M., Witkamp, R.F., Fink-Gremmels, J., van Miert, A.S., 2000. Cocultures of porcine hepatocytes and Kupffer cells as an improved in vitro model for the study of hepatotoxic compounds. Vet. Q. 22, 21–25. Hoebe, K.H., Witkamp, R.F., Fink-Gremmels, J., van Miert, A.S., Monshouwer, M., 2001. Direct cell-to-cell contact between Kupffer cells and hepatocytes augments endotoxin-induced hepatic injury. Am. J. Physiol. Gastrointest. Liver Physiol. 280, G720–G728. Islam, Z., Pestka, J.J., 2006. LPS priming potentiates and prolongs proinflammatory cytokine response to the trichothecene deoxynivalenol in the mouse. Toxicol. Appl. Pharmacol. 211, 53–63. Jacob, A.I., Goldberg, P.K., Bloom, N., Degenshein, G.A., Kozinn, P.J., 1977. Endotoxin and bacteria in portal blood. Gastroenterology 72, 1268–1270. Ji, G.E., Park, S.Y., Wong, S.S., Pestka, J.J., 1998. Modulation of nitric oxide, hydrogen peroxide and cytokine production in a clonal macrophage model by the trichothecene vomitoxin (deoxynivalenol). Toxicology 125, 203–214. Jiang, J., Bahrami, S., Leichtfried, G., Redl, H., Ohlinger, W., Schlag, G., 1995. Kinetics of endotoxin and tumor necrosis factor appearance in portal and systemic circulation after hemorrhagic shock in rats. Ann. Surg. 221, 100–106. Johnson, R.W., 1998. Immune and endocrine regulation of food intake in sick animals. Domest. Anim. Endocrinol. 15, 309–319. Jungi, T.W., Adler, H., Adler, B., Thony, M., Krampe, M., Peterhans, E., 1996. Inducible nitric oxide synthase of macrophages. Present knowledge and evidence for species-specific regulation. Vet. Immunol. Immunopathol. 54, 323–330. Kmiec, Z., 2001. Cooperation of liver cells in health and disease. Adv. Anat. Embryol. Cell Biol. 161, III-151. Knolle, P.A., Loser, E., Protzer, U., Duchmann, R., Schmitt, E., zum Buschenfelde, K.H., Rose-John, S., Gerken, G., 1997. Regulation of endotoxin-induced IL-6 production in liver sinusoidal endothelial cells and Kupffer cells by IL-10. Clin. Exp. Immunol. 107, 555–561. Lang, R., Rutschman, R.L., Greaves, D.R., Murray, P.J., 2002. Autocrine deactivation of macrophages in transgenic mice constitutively overexpressing IL-10 under control of the human CD68 promoter. J. Immunol. 168, 3402–3411. Laskin, J.D., Heck, D.E., Laskin, D.L., 2002. The ribotoxic stress response as a potential mechanism for MAP kinase activation in xenobiotic toxicity. Toxicol. Sci. 69, 289–291. Logrieco, A., Mule, G., Moretti, A., Bottalico, A., 2002. Toxigenic Fusarium species and mycotoxins associated with maize ear rot in Europe. Eur. J. Plant Pathol. 108, 597–609. Monshouwer, M., Witkamp, R.F., Nujmeijer, S.M., Van Amsterdam, J.G., van Miert, A.S., 1996. Suppression of cytochrome P450- and UDP glucuronosyl transferasedependent enzyme activities by proinflammatory cytokines and possible role of nitric oxide in primary cultures of pig hepatocytes. Toxicol. Appl. Pharmacol. 137, 237–244. Murray, P.J., 2006. Understanding and exploiting the endogenous interleukin10/STAT3-mediated anti-inflammatory response. Curr. Opin. Pharmacol. 6, 379–386. Nussler, A.K., Di, S.M., Liu, Z.Z., Geller, D.A., Freeswick, P., Dorko, K., Bartoli, F., Billiar, T.R., 1995. Further characterization and comparison of inducible nitric oxide synthase in mouse, rat, and human hepatocytes. Hepatology 21, 1552–1560. Pestka, J.J., 2008. Mechanisms of deoxynivalenol-induced gene expression and apoptosis. Food Addit. Contam., 1–13. Pestka, J., Zhou, H.R., 2006. Toll-like receptor priming sensitizes macrophages to proinflammatory cytokine gene induction by deoxynivalenol and other toxicants. Toxicol. Sci. 92, 445–455. Pestka, J.J., Zhou, H.R., Moon, Y., Chung, Y.J., 2004. Cellular and molecular mechanisms for immune modulation by deoxynivalenol and other trichothecenes: unraveling a paradox. Toxicol. Lett. 153, 61–73. Plata-Salaman, C.R., 2001. Cytokines and feeding. Int. J. Obes. Relat. Metab. Disord. 25 (Suppl. 5), S48–S52. SAS Institute Inc., 2006. SAS/Stat® User’s Guide Release 8.02 Edition 2001. SAS Circle, Cary, NC.

S. Döll et al. / Toxicology Letters 190 (2009) 96–105 Seglen, P.O., 1976. Preparation of isolated rat liver cells. Methods Cell Biol. 13, 29–83. Smedsrod, B., Pertoft, H., Eggertsen, G., Sundstrom, C., 1985. Functional and morphological characterization of cultures of Kupffer cells and liver endothelial cells prepared by means of density separation in Percoll, and selective substrate adherence. Cell Tissue Res. 241, 639–649. Sugita-Konishi, Y., Pestka, J.J., 2001. Differential upregulation of TNF-alpha, IL-6, and IL-8 production by deoxynivalenol (vomitoxin) and other 8-ketotrichothecenes in a human macrophage model. J. Toxicol. Environ. Health A 64, 619–636. Ueno, Y., 1984. Toxicological features of T-2 toxin and related trichothecenes. Fundam. Appl. Toxicol. 4, S124–S132. Vandesompele, J., De, P.K., Pattyn, F., Poppe, B., Van, R.N., De, P.A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3, RESEARCH0034. Wake, K., Decker, K., Kirn, A., Knook, D.L., McCuskey, R.S., Bouwens, L., Wisse, E., 1989. Cell biology and kinetics of Kupffer cells in the liver. Int. Rev. Cytol. 118, 173–229. Wong, S.S., Zhou, H.R., Marin-Martinez, M.L., Brooks, K., Pestka, J.J., 1998. Modulation of IL-1 beta, IL-6 and TNF-alpha secretion and mRNA expression by the trichothecene vomitoxin in the RAW 264.7 murine macrophage cell line. Food Chem. Toxicol. 36, 409–419.

105

Wong, S.S., Schwartz, R.C., Pestka, J.J., 2001. Superinduction of TNF-alpha and IL-6 in macrophages by vomitoxin (deoxynivalenol) modulated by mRNA stabilization. Toxicology 161, 139–149. Zelnickova, P., Matiasovic, J., Pavlova, B., Kudlackova, H., Kovaru, F., Faldyna, M., 2008. Quantitative nitric oxide production by rat, bovine and porcine macrophages. Nitric Oxide 19, 36–41. Zhou, H.R., Yan, D., Pestka, J.J., 1997. Differential cytokine mRNA expression in mice after oral exposure to the trichothecene vomitoxin (deoxynivalenol): dose response and time course. Toxicol. Appl. Pharmacol. 144, 294–305. Zhou, H.R., Harkema, J.R., Yan, D., Pestka, J.J., 1999. Amplified proinflammatory cytokine expression and toxicity in mice coexposed to lipopolysaccharide and the trichothecene vomitoxin (deoxynivalenol). J. Toxicol. Environ. Health A 57, 115–136. Zhou, H.R., Islam, Z., Pestka, J.J., 2003. Rapid, sequential activation of mitogenactivated protein kinases and transcription factors precedes proinflammatory cytokine mRNA expression in spleens of mice exposed to the trichothecene vomitoxin. Toxicol. Sci. 72, 130–142.