Interactions of high mobility group box proteins with DNA and chromatin

[71

INTERACTIONSOF HMG Box PROTEINS

99

to the study of nucleosome assembly in living cells. In particular, the ability to genetically manipulate the yeast system, together with the identification of yeast enzymes that acetylate newly synthesized H 4 , 7°'71 will certainly provide exciting new avenues for the investigation of chromatin assembly in vivo.

Acknowledgments We are grateful to Dr. C. David Allis for sharing immunoprecipitation expertise and "penta" antibodies. Work in the authors' laboratory was supported by a grant from the National Institutes of Heath to A.T.A. (GM35837).

67 p. D. Kaufman, R. Kobayashi, and B. Stillman, Genes Dev. 11, 345 (1997). 68 S. Enomoto, P. D. McCunezierath, M. Geraminejad, M. A. Sanders, and J. Berman, Genes Dev. 11, 358 (1997). 69 E. K. Monson, D. Debruin, and V. A. Zakian, Proc. Natl. Acad. Sci. U.S.A. 949 13081 (1997). 70 S. Kleff, E. D. Andrulis, C. W. Anderson, and R. Sternglanz, J. Biol. Chem. 270, 24674 (1995). 71 M. R. Parthun, J. Widom, and D. E. Gottschling, Cell 87, 85 (1996).

[7] I n t e r a c t i o n s o f H i g h M o b i l i t y G r o u p B o x P r o t e i n s w i t h DNA and Chromatin By MAIR E. A. CHURCHILL,ANITA CHANGELA, LINDA K. Dow, and ADAM J. KRIEG

Introduction Relationships between transcriptional regulation and chromatin structure have generated much interest in understanding the interactions and regulation of chromosomal proteins such as core histones, histone H1, and nonhistone chromosomal proteins with D N A . 1-3 The proposed functions for many chromosomal proteins are mediated by moderate affinity "nonsequence-specific" DNA binding. Because of this minimal sequence specificity, techniques that were designed originally to study transcription factors and sequence-specific proteins require modifications to facilitate the quanti1 R. D. Kornberg and Y. Lorch, Annu. Rev. Cell Biol. 8, 563 (1992). z H. E. van Holde, "Chromatin." Springer-Verlag, New York, 1989. 3 A. P. Wolffe, "Chromatin Structure, and Function." Academic Press, London, 1995.

METHODS IN ENZYMOLOGY, VOL. 304

Copyright © 1999 by Academic Press All rights of reproduction in any form reserved. 0076-6879/99 $30.00

100

ASSEMBLY OF NUCLEOSOMES, CHROMATIN, AND NUCLEI

[7]

tative analysis of DNA-binding properties of chromosomal proteins. 4 Electrophoretic methods that can be used effectively to study the nonsequencespecific interactions of the H M G 1 class of chromosomal proteins with D N A and nucleoprotein complexes will be described. High Mobility G r o u p C h r o m o s o m a l Proteins The nonhistone high mobility group ( H M G ) proteins that are abundant in higher eukaryotes have roles in modulating the structure and activity of chromatin. 2,3'5 Of the three distinct families of H M G proteins, the HMG14/ 17 proteins bind to nucleosomes and are known to associate with transcriptionally active regions in chromatin. Another group, the H M G - I / Y proteins, are found in mammals and act as DNA-binding transcriptional coactivators. The third group of H M G proteins, the H M G 1 and 2 (HMG1/2) proteins, function by stabilizing and modulating chromatin structure. 5-7 They may bind to nucleosomes, 8 repress transcription by interacting with the basal level transcriptional machinery, 9 or act as transcriptional coactivators and modifiers of transcription factor specificity. 1° Despite functional differences, the interactions of these three chromosomal protein families in chromatin are all mediated by nonsequence-specific D N A binding. The archetypes of the H M G 1 / 2 chromosomal protein family are the vertebrate HMG1 and 2 proteins, which contain two copies of a conserved 75 residue DNA-binding motif known as the H M G box 5,u32 (Fig. 1A). This domain is also found in a number of sequence-specific transcription factors, such as lymphoid enhancer factor (LEF-1) and the mammalian testis determining factor, SRY. u The chromosomal proteins bind D N A in a "sequence-tolerant" manner (nonsequence specifically). Interestingly, the degree of specificity, which is defined as the affinity for the specific site/ affinity for noncognate D N A ( K s p / K n s p ) , of the site-specific H M G - d o m a i n proteins is only 10 to 50, whereas the specificity for other transcription factors is often considerably greater, approximately 100-1000J 3 Specificity 4 M. Fried and D. M. Crothers, Nucleic Acids Res. 9, 6505 (1981). 5M. Bustin and R. Reeves, Progr. Nucleic Acid Res. Mol. Biol. 54, 35 (1996). 6 C. R. Wagner, K. Hamana and S. Elgin, Mol. Cell. Biol. 12, 1915 (1992). 7 S. S. Net and A. A. Tracers, E M B O J. 13, 1817 (1994). s K. Nightingale, S. Dimitrov, R. Reeves, and A. Wolffe, E M B O J. 15, 548 (1996). 9H. Ge and R. G. Roeder, J. Biol. Chem. 268, 17136 (1994). 10V. Zappavigna, L. Falciola, M. Citterich, F. Mavilio, and M. Bianchi, E M B O J. 15, 4981

(1996). 11R. Grosschedl, K. Giese, and J. Pagel, Trends Genet. 10, 94 (1994). 12A. D. Baxevanis and D. Landsman, Nucleic Acids Res. 23, 1604 (1995). 13T. A. Steitz, Structural Studies of Protein-Nucleic Acid Interaction: The Sources of Sequence-SpecificBinding. Cambridge Univ. Press, Cambridge, UK, 1993.

[7]

INTERACTIONSOF HMG BOX PROTEINS

101

differences between these two families reside in regions of the H M G domain for which there are differences in sequence homology and structure (Fig. lC).5,12,TM The experimental methods described in this article make use of a D r o sophila melanogaster chromosomal protein, HMG-D. H M G - D was isolated as the major HMG-l-like chromosomal protein in D. melanogaster 6 and from a screen of a D r o s o p h i l a a g t l l expression library with a D N A region from the f u s h i tarazu upstream element D N A fragment (fiz-SAR) under conditions that were favorable for the selection of a sequence-specific protein. is H M G - D is a homolog of H M G I that appears to have a role in embryonic chromatin at a time when the chromatin is transcriptionally silent, but is undergoing rapid rounds of replication, v H M G - D contains only a single copy of the DNA-binding domain 6,v followed by a "tail" region that has a basic motif similar to the C-terminal domain of histone H1 and a C-terminal acidic stretch similar to that seen in H M G 1 / 2 proteins. Specificity of HMG-Box Proteins Preliminary analyses of the affinity and specificity of H M G - D were accomplished using electrophoretic mobility shift assays (EMSA) and binding site selection techniques. 4,t6 In E M S A of H M G - D with D N A containing the putative "specific site" D N A or any D N A sequence greater than 20 nucleotides in length, a ladder of bands appears (Fig. 2A). Similar results have been obtained for proteins such as the Escherichia coli chromosomal protein H U J 7 This banding pattern is the hallmark of a nonsequencespecific binding protein. Further analysis of the D N A specificity of H M G - D was accomplished by application of a binding site selection technique, originally developed by Pollock and Treisman 16 for sequence-specific proteins, to H M G - D (see methods below). This procedure confirmed that H M G - D does not have a specific DNA-binding site and revealed an informative selectivity for AT-rich sequences containing a T G dinucleotideJ 8 DNA B e n d i n g b y HMG Proteins The preference for deformable and deformed D N A of H M G - D and other H M G proteins suggests that D N A bending and unwinding are defor14C. M. Read, P. D. Cary, N. S. Preston, M. Lnenicek-Allen,and C. Crane-Robinson,EMBO J. 13, 5639 (1994). 15S. S. Ner, M. E. A. Churchill,S. Searles,and A. A. Travers,Nucleic Acids Res. 21, 4369(1993). 16R. Pollock and R. Treisman, Nucleic Acids Res. 18, 6197 (1990). 17E. Bonnefoy and J. Rouviere-Yaniv,EMBO J. U, 4489 (1992). 18M. E. A. Churchill et al., EMBO J. 14, 1264 (1995).

102

[7]

ASSEMBLY OF NUCLEOSOMES, CHROMATIN, AND NUCLEI

A

*** HMGI,A:

}LMG-D:

***

.

*

*

.

*

*

.

~DPKK~RGKM~ SYAFFVQTCR EE}~KKHPDASV N~SEPSKKCS ZRWKTMSAKEKG KF~DMAKADK A R Y E ~ T ¥

MSDK~KRPL~AYMLWLNSAR ES~RENPG--I K~TEVAKRGG I~LWILKM--KDKSEW~AKAAKAK DDYDI~A~EF 10

20 30 40 50 60 70 i [ ] helix I t~rn helix II turn helix III -GSFPKKPLT PYFRFPMEKR AKYAKL~PE--M SNLDLTKILS KKYKELPEKKKM KYIQDFQREK LEFEKNLARP REEHP-

80

4

xUBF.bI:

xUBF.b2: -GSVPEKPKT P Q Q L W ~ E R

KVYLKLHAD--A STKDVKDALG KQWSQLTDKKRL KWIHKALEQR KQYEGIMREY MQKH-

SRY: -QDRVKKpM~ AFIVWSRDQR ~ L E N P R - - M

R~SE~SKQLG ~QWKMLTEAEKW PF~QEAQKLQ A M H R E ~ h ~

......... ~KXWL~ . . . . . . . . ~ A ~ c . . . . . . ~AA~rTQ~LG ,~RWHALSREEOA K ~ E L ~ K E R Q L H M Q L ~ W SOX-4: - S G ~ K R P ~ AFMVWSQIERRK~MEQSPD--M H~AEISKRLG ~RWKLLKDSDKI PF~QEAERLR L K H M A D ~ D Y I0

20 helix I

30 turn

40 helix II

50 turn

60

70

helix III

B

FIG, 1. Sequence structure of the HMG-box domain. (A) Sequence alignment of HMG-1 box A and B, HMG-D, xUBF box 1 and box 2, SRY, LEF-1, and Sox4 based on HMG-D numbering and published sequence alignments? TM Sequences are grouped based on their sequence specificity; the HMG-1 family is the least specific and the transcription factors are the most sequence specific. UBF proteins contain some residues that are SRY-like, 24, 32, 41, and 53, but the N- and C-terminal residues, which form the secondary hydrophobie core, are more similar to the HMG-1 proteins. Asterisks denote residues that are conserved among the HMG protein families and the shaded sequences are those that differ between HMG1 and SRY-type proteins. (B and C) Diagrams of structure of the HMG-D HMG-box domain determined by NMR. 49 (B) Residues that are conserved among members of the HMG domain superfamily are shown. 12,63 (C) Residues that differ between HMG1 and sequence-specific HMG families. The protein regions that make up the primary and secondary hydrophobic cores are shown by 1° and 2°, respectively.

[7]

INTERACTIONSOF HMG Box PROTEINS

103

C

!53

FIG. 1. (continued)

mations introduced into D N A by chromosomal H M G protein binding.18-21 HMG-box proteins also directly induce bends in DNA. 22'23 In order to study the D N A bending of nonsequence-specific proteins, several methods have emerged that are based on the ability of the protein to circularize D N A . 22'23 Ligase-mediated circularization assays are quite sensitive to the degree of DNA bending and unwinding induced by the bound protein. 22'24 In another version of this assay, short D N A fragments, less than 25 bp in length, multimerize and circularize in the presence of the bending protein and ligase. 25 The size of the circles obtained is indicative of the degree and phase of the protein-induced D N A deformation. When this analysis was applied to oligonucleotides of length 10, 15, and 21 bp, HMG-D induced formation of circles as small as 70 bp. 25 However, the helical repeat of D N A bound by HMG-D is predicted to be closer to 11 bp/turn. 26 Consistent with this prediction, for oligonucleotides of length 11 bp, circles as small 19 D. P. Bazett-Jones, B. Leblanc, M. Herfort, and T. Moss, Science 264, 1134 (1994). 20 L. G. Sheflin and S. W. Spaulding, Biochemistry 28, 5658 (1989). 21 S. A. Wolfe, A. E. Ferentz, V. Grantcharova, M. E. A. Churchill, and G. L. Verdine, Chem. Biol. 2, 213 (1995). 22 T. T. Paull, M. J. Haykinson, and R. C. Johnson, Genes Dev. 7, 1521 (1993). 23 p. Pil and S. J. Lippard, Science 256, 234 (1992). 24 j. D. Kahn and D. M. Crothers, Proc. Natl. Acad. Sci. USA 89, 6343 (1992). 25 D. Payet and A. A. Travers, J. Mol. Biol. 266, 66 (1997). 26 A. Balaeff, M. E. A. Churchill, and K. Schulten, Prot. Struc. Func. Gen. 30, 113 (1998).

104

[7]

ASSEMBLY OF NUCLEOSOMES, CHROMATIN, AND NUCLEI

A

60 bp 1234

157 bp 5678

ii

B

B

13 1

2

3

4

5

6

7

8

9

10 11

12 13 14 15

16

17 18

B F

FIG. 2. DNA-binding properties of HMG-D. (A) EMSA of HMG-D bound to DNA of 60 (lanes 1-4) and 157 (lanes 5-8) bp in length illustrating a length dependence of the affinity of HMG-D for DNA. The protein concentrations are 0 (lanes 1 and 5), 25 (lanes 2 and 6), 50 (lanes 3 and 7), and 100 (lanes 4 and 8) nM. The free DNA is denoted by F, and B refers to the bound DNA that has been numbered according to the protein-DNA ratio for each complex band. (B) EMSA of HMG-D bound to a 90-bp DNA fragment used for multisite DNA-binding analysis. Lanes 1-18 contain binding reactions with 0, 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 190, 220, and 250 nM HMG-D, respectively. The bound DNA is numbered corresponding to the protein-DNA ratio for each complex band, 1, 2, 3 + 4, 5, and 6+ proteins, respectively. (C) Hill plot using data from B. 37'40 (D) Analysis of the fraction of DNA bound as a function of protein concentration for each of the complexes that could be separated by EMSA, 1, 2, 3 + 4, 5, and 6+. (E) Graph of the fractional saturation of the DNA, u, versus u/[P] of data from B and C. The theoretical binding curve was generated

[7]

IrqTE~ACrXOYSOV H M G Box PROXHYS

C

105

4.0

2.0

0 O

/

0

0.0

-2.0

-4.(

-' 8.5

I

I

I

I

I

I

-18

-17.5

-17

-16.5

-16

-15.5

-15

In protein concentration (M)

D

1.0 ¸

0.8

,to,a,/ ./

--e- -2 m 3+4

~

~ i

- ~-5 •

"o ..~ o ..Q c o

0

0.6 ¸

-

, +

+

+

-

+/

6+

'

/

o ~

~ .

0.4

u_ 0.2 °

0.0 10"8

1 0 "~

Protein concentration (M) FIG. 2.

(continued)

using theory describing cooperative ligand binding to an infinite D N A lattice, with a cooperativity factor of 9000, site size of 7 and Kd of 20/zM. (F) Scatchard analysis of the same data illustrates positive cooperativity of binding. 4° The theoretical curve was calculated with Kd of 50 nM and cooperativity of 2.1.

106

ASSEMBLY OF NUCLEOSOMES, CHROMATIN, AND NUCLEI

[7]

E 7xl 0 s 0

6x10 s

,7

~E

5xlO s 4xl 0 s

£ "> 3 x i 0 s 2x10 s lx10 s 0

0.02

0.04

0.06

0.08

O. 1

F 6xl 0z N

5x10 z ©

,7

O

4x107

z;

"~ 3 X 1 0

7

ci. >

2xl 0 z

/o

o

lx107

0

I

I

I

I

I

I

1

2

3

4

5

6

v

FIG. 2.

(continued)

[7]

INTERACTIONSOF HMG BOX PROTEINS

107

as 55 bp were observed for H M G - D and truncated forms of the protein (Fig. 3). The size of the circle also suggests that the bending angle of each H M G - D complex is greater than ~70 °. By sampling a range of different size oligonucleotides, it is possible to estimate the net unwinding angle of the complexed DNA, as well as to define the best range of D N A length to use in ligation rate experiments to refine these values. 24 Use of Electrophoretic Mobility Shift Assay to S t u d y Affinity, Cooperativity, a n d DNA Bending of Nonsequence-Specific C h r o m o s o m a l HMG-Box Proteins The nonsequence specificity of D N A binding by the chromosomal class of H M G - b o x proteins poses a challenge for those interested in determining thermodynamic parameters describing D N A binding. Approaches traditionally used to study site-specific complexes required modifications in order to obtain quantitative information on equilibrium-binding constants and cooperativity. 27 Thus, elegant methods have been developed for the determination of these parameters for D N A binding of nonsequence-specific proteins, 28,29 especially for fluorescent or fluorescently labeled proreins. 3° In the case of H M G proteins, however, the intrinsic tryptophan fluorescence is not sufficient for the success of these approaches. Therefore, electrophoretic methods have been employed to study binding affinity and cooperativity, structure selectivity, reaction rates, and D N A bending. Restricting the length of the D N A fragment to a single binding site facilitates the determination of the intrinsic DNA-binding constant, and multiple site analysis provides information on the cooperativity of the interaction. Intrinsic Affinities a n d DNA-Binding Rates for HMG-D from Single-Site Analysis The information required to model D N A binding of a multisite DNAbinding protein can be simplified by first determining the values of the intrinsic affinity. For the H M G - D - D N A interaction, the intrinsic affinity may be measured directly for a single D N A site using EMSA, which greatly simplifies the interpretation of the binding c u r v e s . 21'31'32 This necessitates the use of short D N A fragments, of 20 bp or less, which bind only one 27j. D. McGhee and P. H. von Hippel, Z MoL Biol. 86, 469 (1974). 28C. P. Woodbury and P. H. von Hippel, Biochemistry 22, 4730 (1983). 29A. Revzin, NonspecificDNA-Protein Interactions. CRC Press, Boca Raton, FL, 1990. 3oT. M. Lohman and D. P. Mascotti, Methods Enzymol. 212, 424 (1992). 31D. F. Senear and M. Brenowitz,J. Biol. Chem. 266, 13661 (1991). 32L. K. Dow, A. Changela, H. E. Hefner, and M. E. A. Churchill, FEBS Lett. 414, 514 (1997).

108

ASSEMBLY OF NUCLEOSOMES, CHROMATIN, AND NUCLEI

~1

lO-mer 2 3 4

i

15

11-mer 6 7

[7]

8 1

FIG. 3. The effect basic and acidic tail regions of HMG-D on DNA bending using a ligasemediated circularization assay with HMG-D and truncation mutants. Experiments in lanes 1-4 and lanes 5-8 were performed with DNA of 10 and 11 bp in length, respectively. The DNA fragments have been multimerized and circularized by T4 DNA ligase in the presence of HMG-D (lanes 4 and 8), HMG-D-100 (lanes 3 and 7), or HMG-D-74 (lanes 2 and 6). Lanes 1 and 5 are control experiments, which lack HMG-D. The smallest DNA circles observed, 55 bp, are generated with DNA of length 11 bp, indicating an optimal helical repeat of approximately 11 bp/turn and a bending angle of at least 72 ° per potential binding site.

[71

INTERACTIONSOF HMG Box PROTEINS

109

TABLE I STRUCTURE-SPECIFIC DNA FRAGMENTSAND RELATIVE AFFINITIES Reported Structured DNA

Protein

gstruct/Kli n

Reference

Holliday junction (17-bp arms) Cisplatin DNA (24 bp) Disulfide cross-linked DNA (20 bp) Bulged DNA (21 bp) Circular DNA (75 bp) Circular DNA (75 bp) Holliday junction (--18-bp arms) Cisplatin DNA (92 bp) Cisplatin DNA (20 bp) Cisplatin DNA (20 bp)

HMG-D-100 HMG-D-100 HMG-D, HMG-D-100 HMG-D HMG-D HMG-D-74 HMG1 HMG1

1 3 10-15 -120 --50 -1000 -100 -100 230 20

18 18 21 25 25 25 64 23 65 65

HMGts HMGts boxA

molecule of HMG-D. The effects of H M G - D and truncated forms of H M G - D binding to two types of D N A fragments, linear and "prebent" D N A fragments, illustrate this approach. The observed preference of H M G - D for AT-rich D N A sequences that contain a TG dinucleotide was used to design a suitable linear DNA-binding site.IS This sequence preference indicated that particular structures of D N A that are bent and/or underwound would also be preferred. 33 Several structured D N A probes that have been used for testing the DNA-binding preferences of the chromosomal HMG-proteins are shown in Table I. E M S A of HMG-D-100 binding to a linear D N A fragment and to a "prebent" disulfide cross-linked D N A fragment are illustrated in Figs. 4A and 4B. The binding curves were fit directly with Eq. (1) describing the Langmuir single-site binding isotherm. 31,34 [P]/Kd Y - 1 + [P]/Kd

(1)

The protein binds to each D N A fragment to form a 1 : 1 complex, and the intrinsic binding affinity, Kd, was calculated to be 11 × 10 -9 and 1.4 +_ 0.4 × 10 9 M for linear D N A and "prebent" D N A , respectively (Fig. 4C). Therefore, HMG-D-100 has a 10-fold preference for synthetic "disulfide cross-linked" (prebent) D N A molecules over the "unbent" control. 2~ H M G - D has preferred binding to other bent D N A fragments such as cisplatin-treated D N A ~s but not synthetic Holliday junction D N A . ls,25,35 33 A. A. Travers, Curt. Opin. Struct. BioL 1, 114 (1991). 34 T. M. Lohman and D. P. Mascotti, Methods Enzymol. 212, 400 (1992). 3s j. R. Wisniewski and E. Schulze. J. Biol. Chem. 269, 10713 (1994).

110

ASSEMBLY OF NUCLEOSOMES, CHROMATIN, AND NUCLEI

A

1

2

3

4

5

6

7

8

9

[7]

10

11

B>

F>

B

1

2

3

4

5

6

7

8

9

10

11

12

FIG. 4. Binding of HMG-D to short linear and structured DNA fragments. (A) EMSA (7% gel) of HMG-D-100 binding to a 20-bp linear DNA fragment. Lanes 1-11 contain binding reactions of DNA with 0, 0.5, 1.0, 5.0, 7.5, 10, 25, 75,100, and 500 nM HMG-D-100, respectively. Free and bound DNA are denoted by F and B, respectively. (B) EMSA (6% gel) of HMGD-100 binding to a 20-bp disulfide cross-linked DNA fragment. 21 Lanes 1-12 contain binding reactions with 0, 0.1, 0.3, 0.5, 1.0, 2.5, 3.5, 5.0, 10, 15, 25, and 35 nM HMG-D-100, respectively. (C) Binding curves for HMG-D-100 with linear and cross-linked DNA. Equilibrium dissociation constants from single-site-binding isotherms are 10.5 - 2.0 and 1.4 +_ 0.4 nM for linear and disulfide cross-linked DNA, respectively. (D) Binding curves illustrating the effect of

[71

INTERACTIONSOV H M G Box PROTE[NS

111

C 1.0 o

x-link linear

b'

0.8

t 0.6 ¸ >,

0.4 ¸ ©

0.2 ¸

©

0.0

7

10-11

10-~o

10-9

10-8

10-7

10-6

Protein concentration (M)

D 10

---o--

0.60.8

~

HMGo

_

HMG-D-100

/

HMG-D-74/°

o. f) 0.2

0.0

,

1 0 11

1 0 1°

1 0 .9

1 0 -a

1 0 .7

1 0 .6

1 0 -5

10

-4

Protein concentration (M) FIG. 4. (continued) basic and acidic regions of HMG-D on binding to the 20-bp disulfide cross-linked DNA. The single-site equilibrium dissociation constants for HMG-D, HMG-D-100, and HMG-D-74 are 24 + 2.5 nM, 1.4 _+ 0.4 nM, and 2.1 _+ 2.5/zM, respectively.

112

ASSEMBLY OF NUCLEOSOMES, CHROMATIN, AND NUCLEI

[7]

Table I illustrates the range of specificities that have been observed for H M G proteins binding to different structured D N A fragments both from single site assays and for structured D N A embedded in longer DNA fragments. The single-site binding assay is also useful for quantitatively determining the effects of mutations and modifications on D N A binding. HMG-D contains an H M G domain, a basic region, and an acidic tail that all may contribute to the DNA-binding affinity of the protein. Binding curves were obtained for HMG-D, HMG-D-100, and the HMG-domain (HMG-D-74) binding to a disulfide cross-linked D N A fragment using EMSA (Fig. 4D). All of the proteins bind to D N A as a 1 : 1 complex with intrinsic binding affinities of 2.4 × 10 -8, 1.4 × 10 -9, and 2.1 × 10 -6 M for HMG-D, HMG100, and HMG-74, respectively. The basic A K motifs (residues 80-100) are important for high-affinity binding. The reduction in affinity of the protein lacking this region is about 1000-fold, equivalent to a free energy difference of - 4 kcal/mol. Full-length HMG-D binds with an affinity between these values, indicating that the acidic and basic regions modulate HMG-D binding affinityY The precision and reproducibility of this assay are ideal for quantitative analysis of proteins that have even smaller differences in affinity than illustrated by this example. Rates of HMG Protein DNA Binding Whether the protein binds to the D N A slowly or rapidly and which rate constant is affected more by differences in the target D N A or protein mutations are properties of the binding kinetics that are particularly useful in the interpretation of binding results obtained for chromosomal proteins. Many elegant methods can be used to obtain quantitative measurement of these rates, such as fluorescence polarization and fast DNase I footprinting. 36 However, a simple electrophoretic method can give values for binding rates that are sufficiently slow (on the order of minutes). This method was developed for the study of transcription factors 4 and is applied here to HMG-D-100 binding to a 16 nucleotide disulfide cross-linked D N A fragment. Figure 5A shows that the association of HMG-D-100 with the D N A fragment is complete within 1 min. Figure 5B shows a measurable dissociation rate of HMG-D-100 from the complex. The first-order dissociation rate constant can be determined from the exponential fit to the plot of the fraction bound as a function of time (Fig. 5C). While the on-rates of HMG-D D N A are too fast to be measured using this method, the highest affinity form of HMG-D, HMG-D-100, has a measurable off-rate and a 36V. Petri, M. Hsieh, and M. Brenowitz,Biochemistry 34, 9977 (1995).

[7]

INTERACTIONSOF HMG Box PROTEINS

113

complex half-life of approximately 14 min. Prebending the DNA increases the off-rate relative to linear DNA (data not shown). These results suggest that HMG-D can bind and dissociate many times during the course of the binding experiment and that the binding constants calculated were obtained at equilibrium.

Cooperative Interactions of HMG-D Using Multisite Analysis The DNA-binding ladders observed in Figs. 2A and 2B show that HMGD binds to multiple sites on DNA. The length dependence of the DNAbinding affinity of HMG-D also suggests a cooperative DNA-binding interaction. Figure 2A illustrates the banding pattern observed for HMG-D bound to two different lengths of DNA derived from the f l z - S A R , which is AT rich and contains several TG dinucleotides. The number of complexes correlates with the length of the DNA, such that five complexes are observed for the complex with the 62-bp DNA, at least seven complexes are visible for a 90-bp DNA fragment (Fig. 2B), and more than eight complexes are observed for the 157-bp DNA. Quantitative analysis of the DNA-binding ladders can be applied in order to determine intrinsic binding affinities and cooperativity. Methods for the study of multiple ligands binding to DNA have been described for the interaction of ligands with specific sites. 37-4° The theory and methodology for determining binding affinity and cooperativity parameters have also been developed for the analysis of large noninteracting and interacting ligands binding to multiple nonspecific sites on an infinite lattice.27,3°,34,41 Both types of analyses have been applied to data obtained from EMSA of HMG-D-100 on the fiz-SAR DNA (Fig. 2B). The Hill plot, the first method of analysis to be discussed, is a standard semiempirical method for analysis of DNA-binding dataY '4° The Hill plot, as applied to HMG-D data in Fig. 2C, is the quantity ln[y/(1-y)] graphed as a function of In[P], where y is the fraction of DNA bound and [P] is the protein concentration. The slope of a straight line from a linear leastsquares analysis of data gave an observed cooperativity of binding of 1.74, and the value of [P] at y = 0.5 gave a value of approximately 40 nM for the apparent equilibrium dissociation constant, Kous. Determining the fraction of DNA bound in this way is similar to analyses of data obtained 37A. V. Hill,J. PhysioL Lond. 40, 4 (1910). 38G. Scatchard,Ann. N.Y. Acad. ScL 51, 660 (1949). 39A. A. Schreier and P. R. Schimmel,J. Mot Biol. 86, 601 (1974). 40C. R. Cantorand P. R. Schimmel,"BiophysicalChemistry."Freeman,San Francisco,1980. 41p. L. deHaseth,T. M. Lohman,and M. T. Record, Biochemistry 16, 4783 (1977).

114

[7]

ASSEMBLY OF NUCLEOSOMES, CHROMATIN, AND NUCLEI

A 1

2

3

4

5

6

7

8

9

10

11 12

13 14 15

6

7

8

9

10

11

12 13

14 15 16

16

8>

F>

B

1

2

3

4

5

17

18

[3>

F>

FIG. 5. Rates of chromosomal H M G - D D N A binding. (A) E M S A illustrating relatively fast association rate of HMG-D-100 with DNA. Lane 1 is a control with no protein added. Lanes 2-16 contain binding reactions of D N A with 10 nM HMG-D-100 incubated for 0 (<15 sec), 1, 3, 5, 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, and 55 min, respectively. (B) E M S A illustrating a measurable off rate for HMG-D-100 D N A binding. Lane 1 is a control with no protein added and lane 2 is a control with no competitor D N A added. Lanes 3-18 contain binding reactions of D N A with 10 nM HMG-D-100 incubated with 100-fold excess of competitor D N A over labeled D N A for 0 (<15 sec), 0.5, 1, 2, 3, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, and 55 rain, respectively. (C) Graph of data obtained from experiments such as B. Curve is fitted with an exponential function describing first-order dissociation kinetics, with a dissociation rate of 5.8 x 10 4 see-1 and a complex half-fife of 14 min.

INTERACTIONS OF HMG BOX PROTEINS

[7]

C

115

1.o 0o

0.75 -

0.50

0

0

0

0.25 0.0

0

1'0

2'0 3'0 Time (minutes) FIG. 5.

4'0

5'0

6'0

(continued)

from filter-binding experiments, 2s which depend on whether the DNA is bound by protein or not and does not take advantage of knowledge about the degree of saturation of the DNA. 42 The ability of EMSA to provide information on the saturation of the DNA fragment can be utilized in a second method of analysis. The ladder of bands in Fig. 2B is composed of DNA fragments with different numbers of HMG-D-100 molecules bound; six distinct bands are observed. The fraction of DNA bound with different numbers of proteins (Yl, Y2, Y3. . . . . Ym) can be extracted easily by determining the amount of DNA present in each type of complex separately during the quantitation of digitized gel images. These values, Yl--Ym, can be used to calculate the fractional saturation or binding density of the DNA (v) using Eq. (2), where i corresponds to the number of the shifted band. For HMG-D, which binds to DNA as a monomer (data not shown), the band number is equal to the number of protein molecules bound to the DNA in band i. The fraction bound (Yi) for each band is plotted as a function of protein concentration in Fig. 2D. m

v = ~ i(yi) i=0

42 M. Stros, J. Stokrova, and J. O. Thomas, Nucleic Acids Res. 22, 1044 (1994).

(2)

116

[71

ASSEMBLY O F N U C L E O S O M E S , C H R O M A T I N , A N D N U C L E I

The experimentally determined binding density described earlier allows theoretical models for H M G - D - D N A binding to be evaluated by analysis of the Scatchard plot, v/[P] graphed as a function of v (Fig. 2E). The plot has a downward curvature, indicative of positive cooperativity of binding. 4° The binding affinity and cooperativity parameters can be extracted from such a curve for large ligands binding cooperatively to an infinite lattice by fitting Eq. (3), derived by McGhee and yon Hippel, 27 to the H M G - D data. The intrinsic association constant is Ki, oJ is the cooperativity, [P] is the total ligand concentration, n is the length of the DNA-binding site and u is the fractional saturation.

v[P] - ~ = K i ( l - n u ) ( ( 2 ° J +2(~o---1--)-~---nv) l ) ( 1 - n v ) + v - R ) ' ~ - l ( ( 1 - ( n + l2---~ ) u +L-R~)V) '))

e

(3)

where R ={[1 - (n + 1)u] 2 + 4 ~0v(1 - nv)} lie. Even for a range of possible site sizes, intrinsic affinity constants, and cooperativity factors, data from the H M G - D DNA-binding experiment do not fit this model well at low binding densities (Fig. 2E). The intrinsic affinity of D N A binding (K/) is underestimated (1 × 10 -s M) and the overall cooperativity is overestimated (9000). Specificially, the calculated curves show that higher v/[P] values are expected at lower binding densities than are observed, whereas at higher binding densities the curve fit is reasonable. Interestingly, the E M S A method is intrinsically better at determining the fractional saturation at lower binding densities due to greater resolution of those complexes. At the highest binding densities the fit is better, but the fractional saturation data are not as reliable (for reasons discussed later). The Scatchard plot can also be analyzed using the theoretical Scatchard model to obtain values of intrinsic affinity and cooperativity. A plot of ln[P] versus ln[(n/v - ) 1 ) ] gave a straight line for these data with a value for a total number of sites (n) of 6 (not shown). The slope of the line is -(1/o~) and the y intercept is lnKou~. A cooperativity factor, w, of 2.0 and a Ka of 66 nM were obtained. The theoretical Scatchard curve shown in Fig. 2G, calculated using Eq. (4) with a Ka = 2 × 107 M -I and cooperativity of 2.1, fits the data quite well:

v

nKa~[P]'°-1 Kao'[P]"

[P] - 1 +

(4)

Although the Scatchard analysis overestimates v/[P] slightly at lower binding densities, it does so less than the infinite lattice model, and the values used to calculate the theoretical curves are comparable to the intrinsic DNA-binding affinity determined from independent methods, described later. For H M G - D data, the value of intrinsic affinity obtained is consistent

[71

INTERACTIONSov HMG Box PROTEINS

117

with the values that have been determined using single-site binding methods under similar conditions (not shown). Interpretation of Single-Site and Cooperative DNA-Binding Analyses Results from single-site quantitative-binding analyses can be useful in identifying complications arising in protein-DNA recognition that may aid in the interpretation of cooperative DNA-binding experiments. When the Hill analysis is applied to binding reactions where a 1 : 1 complex is expected, a cooperativity value greater than 1 may be observed. This phenomenon is not simple to interpret, because by definition a 1 : 1 complex can exhibit no cooperativity. In one case where this cooperativity was observed, the protein sample was not homogeneous, being composed of oxidized and native proteins that bound to the DNA with slightly different affinities. Another possible case involves protein-DNA interactions for which there is internal cooperativity, as defined by Jencks. 43 HMG-box proteins that are composed of two linked HMG-box domains may be modeled by application of this binding theory. Additionally, a complex preequilibrium, such as aggregation or other linked equilibria that could influence the true concentration of free protein available for DNA binding, can also cause unexpected apparent cooperativity. Therefore, single-site analysis is useful even for n o n s e q u e n c e - s p e c i f i c proteins for determining whether a readily physically interpretable binding equilibrium exists before investing effort on cooperative binding analyses. The Scatchard analysis indicated that the intrinsic affinity of HMG-D was consistent with that calculated in the single-site assay. However, the application of the multiple ligand-binding theory 27resulted in high cooperativity values and much lower binding constants than were expected from the single-site analyses. The presence of some cooperativity and the transient nature of HMG-D DNA binding illustrated by the binding rate studies suggest that significant reorganization may occur during the long incubation times used in this study, giving the appearance of specific cooperatively interacting sites, which fit the Scatchard model quite well. 38'39 However, consideration must also be given to the limitations of cooperative binding analysis, as observed in this study. First, there are limitations in the quantitative EMSA method because the resolution of the bands at higher protein:DNA complex ratios decreases. The precise number of proteins capable of binding to a finite length D N A fragment may be difficult to determine accurately at higher binding densities. In this case, seven bands were detectable when the true maximum 43W. P. Jencks, Proc. Natl. Acad. ScL U.S.A. 78, 4046 (1981).

118

ASSEMBLY OF NUCLEOSOMES,CHROMATIN,AND NUCLEI

[7]

number of proteins bound per D N A fragment could be as high as 9 or 10. This introduces errors in determining the magnitude of the fractional saturation by giving a lower value for the maximum number of proteins bound per D N A fragment. Second, an anticipated difference between the HMG-D experiment and the infinite lattice theory is the finite length of the DNA-binding site used in the EMSA. The theoretical models evaluate the statistical distribution of free binding sites accurately when the length of the lattice relative to the site size is large. However, application of this theory to a finite lattice has been used successfully to calculate the binding affinity and cooperativity values of HU for several shorter D N A fragments from EMSA. 44 Third, the mode of binding of HMG-D to multiple sites on D N A may be more complicated than what has currently been modeled theoretically. For example, super structures may be formed by multimers of these proteins with D N A that may require more than one cooperativity factor to describe the binding interaction. 19,42

Procedures: Electrophoretic Methods for S t u d y i n g DNA Recognition by Purified C h r o m o s o m a l Proteins Use o f E M S A f o r C h r o m o s o m a l P r o t e i n - D N A Binding

Several aspects of the experimental protocols appear to be critical to obtain reproducible data of high quality for quantitative analysis using EMSA with H M G proteins. Among the most important components for successful affinity measurements are protein homogeneity and D N A purity. It is becoming evident from studies on HMG-box proteins 32'45,46 and the hyperthermophile chromosomal protein Sac7d that minor groove intercalation is a critical component of the molecular recognition mechanism used by these proteinsJ 7 The intercalating methionine is located on the surface of the concave face of the boomerang shape of HMG-D (Fig. 1B). The oxidation of this residue that may occur during the overexpression of HMG-D in bacteria results in a mixture of oxidized and unoxidized proteins. We have developed a method to obtain homogeneous HMG-D by separating the two forms of the protein. 32 The consequences of oxidation are to decrease D N A binding and add complexity to the single-site binding isotherms so that they are not readily interpretable as 1 : 1 complexes. D N A purity can be as important as protein purity because trace contaminants from D N A preparation and labeling procedures can inhibit D N A binding 44E. Bonnefoy,M. Takahashi, and J. Rouviere-Yaniv,J. Mot BioL 242, 116 (1994). 45C.-Y. King and M. A. Weiss, Proc. Natl. Acad. Sci. U.S.A. 90, 11990 (1993). 46j. j. Love et aL, Nature 376, 791 (1995). 47H. Robinson et al., Nature 392, 202 (1998).

[7]

INTERACTIONSOV HMG 8ox PROTEINS

119

by HMG-D. Commonly used methods to purify D N A are sufficient for this purpose. Extreme care is required to maintain and measure the fraction bound for the weaker complexes, those with affinities in the range of 1-10/xM. This involves minimizing dissociation of the complex in the gel by decreasing the electrophoresis time. The polyacrylamide concentration and ratios of bisacrylamide to acrylamide are tailored for each set of experimental conditions so that electrophoresis for only 1 hr at 125 V (20 × 20-cm gel) gives sufficient separation of the bound and unbound D N A for quantitative analysis. Gels can be loaded quickly or as the gel is running. Some H M G - D mutants have fast on and off rates, leading to dissociation of the complexes during electrophoresis. Under conditions where dissociation of complexes in the gel is observed, a sufficiently high concentration of protein must be used so that a correction factor based on the degree of dissociation observed at saturating amounts of protein can be applied, as described later. 48 Two other important modifications to the DNA-binding reaction procedure include the use of microcentrifuge tubes (natural polypropylene; Eppendorf Scientific, Westbury, NY) and the method of siliconization of the reaction vials. These details can influence the success and reproducibility of the experiment dramatically. HMG-D Protein Purification The gene for H M G - D (full-length 112 amino acids) is subcloned into the N d e I and B a m H I - d i g e s t e d expression vector, pET13a. 49 Use of the T7 expression system 5° and this kanamycin-resistant expression vector results in stringent selective pressure by the antibiotic necessary with a chromosomal protein, which is toxic to the cells. 49 Variants and mutants of H M G - D are made in pET13a using standard subcloning techniques) x H M G - D and its variants are grown in Escherichia coil strain BL-21(DE3) (Novagen, Madison, WI) in LB media with 30/xg/ml kanamycin at 37 ° until an A600 of 0.8-1.0 is reached. Expression is then induced by the addition of isopropylthiogalactopyranoside (IPTG) to 250 ~g/ml. Cells are harvested after 3 - 4 hr of further incubation at 37 ° by centrifugation at 8000 rpm for 10 rain and stored at - 2 0 °. The protein purification proceeds either at 4 ° or on ice with >1.0 mM dithiothreitol (DTT) present until the high-performance liquid chromatog4s B. Hoopes, J. LeBlanc, and D. Hawley, J. Biol. Chem. 267, 11539 (1992). 49D. N. M. Jones et al., Structure 2, 609 (1994). 50F. W. Studier, A. H. Rosenberg, J. J. Dunn, and J. W. Dubendorff, Methods Enzymol. 185, 60 (1990). st j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1959.

120

ASSEMBLY OF NUCLEOSOMES, CHROMATIN, AND NUCLEI

[7]

raphy (HPLC) step. Despite the presence of 1 mM DTT and/or 10 mM methionine included in the buffers, significant oxidation of methionine-13 does occur.32 The cell pellet from I liter of culture is suspended in 15 ml of lysis buffer [50 mM Na-HEPES, pH 7.9, 1.0 mM EDTA, 1.0 mM DTT, 0.6 mM phenylmethylsulfonylfluoride (PMSF), 1.0 mM benzamidine, 2 txg/ ml leupeptin, 2 txg/ml aprotinin, 1/xg/ml pepstatin A, and 500 mM NaC1]. The suspension (on ice) is sonicated for 30 sec, frozen in liquid Nz, and sonicated again. Cell debris is removed by centrifuging the lysate for 15 min at 18,000 rpm at 4°. The supernatant, containing the HMG-D, is dialyzed (two changes) against "HEP" buffer (50 mM Na-HEPES, pH 7.9, 1.0 mM EDTA, 1.0 mM DTT, 0.6 mM PMSF, 1.0 mM benzamidine, and 50 mM NaCl) and then fractionated by precipitation with (NH4)2SO4. Full-length and HMG-D-100 (C-terminal truncation at residue 100) proteins precipitate between 65 and 100% (NH4)2SO4.The HMG-box domain of the protein (HMG-D-74) precipitates between 60 and 70%. Mutant variants of HMG-D have been observed to precipitate at even lower concentrations of (NH4)2SO4.The precipitate is dissolved in and dialyzed against HEP buffer (two changes) and prepared for chromatography. Isocratic chromatography on a DEAE-Sephacel (Pharmacia) or HQ (Poros) column with HEP buffer (without protease inhibitors) separates the protein from DNA and acidic contaminants. The purest fractions elute in the flow through as determined by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) analysis. When only a single band is observed on the gel, the sample is dialyzed against water and concentrated in a Centricon 3 (Amicon, Danvers, MA) microconcentrator for high performance liquid chemotography (HPLC). If additional bands are present, cation-exchange chromatography using the SP-Sepharose (Pharmacia) or Poros HS column is used to purify the fractions further prior to preparation for HPLC; the protein elutes during a gradient between 0.5 and 1 M NaC1. The native and oxidized forms of the protein are separated by reversed-phase (RP)-HPLC (LKB) using a Waters ~Bondapak C18 column. The protein is eluted isocratically at 3.5 ml/min with buffer containing 31% acetonitrile and 69% 0.2 M dibasic sodium phosphate, pH 2.3. Fractions corresponding to the two forms of the protein are pooled separately, loaded onto the SP-Sepharose column (Pharmacia, Piscataway, N J) or Poros HS column (PerSeptive Biosystems, Framingham, MA), and eluted in a gradient of 0.1 to 1 M NaC1. Purified protein is pooled, dialyzed, and concentrated. The total yield of unoxidized HMG-D can be as high as 8 mg per liter of culture. The molecular mass of the protein and the removal of oxidized protein is confirmed by electrospray-ionization mass spectrometry using a Micromass Quattro triple quadrupole mass spectrometer equipped with a Megaflow

[7]

INTERACTIONSOV HMG BOXPROTEINS

121

electrospray ion source. This shows only one species, with the appropriate molecular mass for HMG-D or its variants. The concentration of the protein is determined carefully by ultraviolet (UV) absorption using the extinction coefficient (19.1 A28o/mM) based on the amino acid content; the UV absorption of the proteins is the same in TE as 6 M guanidine hydrochloride. 5~ The proteins are then diluted in protein dilution buffer, PDB [50 mM HEPES, pH 7.5, 0.1 M KC1, 1 mM EDTA, 1 mM DTT, 100/zg/ml bovine serum albumin (BSA), and 50% glycerol] and stored at - 2 0 °. Binding Site Selection A polyclonal antiserum against the HMG-D protein (gift from Sarb Ner) 7 is used to immunoprecipitate complexes of 200 nM HMG-D with a DNA fragment containing a 26-bp stretch of randomized DNA sequence flanked by fixed ends for polymerase chain reaction (PCR) priming and subsequent subcloning. 16,18 CAGGTCAGTTCAGCGGATCCTGT-CG(N)e2_e6GA-GGCGAAT1 ~ CAGTGCTGCAGC The immunoprecipitated material is then amplified using PCR and purified by polyacrylamide gel electrophoresis using the crush and soak procedure of Maxam and Gilbert. 53 An excess of poly[d(IC)] (Pharmacia), 1/~g per reaction, is used as a competitor DNA in the binding reactions to ensure the selection of preferred DNA fragments. This process is repeated three times and the amount of DNA precipitated during each cycle increases steadily. After four cycles of precipitation and amplification, the selected fragments are electrophoresed in the presence of the HMG-D on a 4% polyacrylamide gel (40:1; acrylamide : bisacrylamide; Bio-Rad, Richmond, CA) for 90 min at 150 V in 0.5x TBE [ix: 100 mM Trizma base (Sigma), 100 mM boric acid, 2 mM ethylenediaminetetraacetic acid (EDTA); electrophoresis grade]. Inserts that retard the mobility of the D N A are isolated, gel purified using the crush and soak procedure, 53 subcloned into the BamHI/ EcoRI site of a Blue Scribe SK- vector, and sequenced using standard procedures. 5a Statistical analysis of the probability of occurrence of dinucleotides shows a strand bias and preferences for TG sequences) 8 Binding Site DNA Preparation An important aspect of DNA preparation is the final purification of the DNA. DNA fragments, including restriction fragments purified from gels 52T. M. Lohman and W. Bujalowski,Methods Enzymol. 208, 258 (1992). 53A. M. Maxam and W. Gilbert, Methods Enzymol. 65, 499 (1980).

122

ASSEMBLY OF NUCLEOSOMES, CHROMATIN, AND NUCLEI

[7]

and short DNA duplexes constructed from purified synthetic oligonucleotides, frequently contain contaminants either from the labeling procedure or purification by gel or chromatographic fractionation that can interfere with the high-affinity binding of some chromosomal proteins. In order to remove trace contaminants, we typically extract the labeled DNA samples with phenol : chloroform: isoamyl alcohol (25 : 24 : 1, v/v) (PCI) and remove the residual phenol using two ether extractions. The DNA is then ethanol precipitated and centrifuged, and the pellet is rinsed with 80% (v/v) ethanol and dried before redissolving the DNA in TE buffer (50 mM Tris-HC1, pH 7.9, 1 mM EDTA) for storage at -20 °.

Restriction Fragments The probe DNA fragments, 62, 90, and 157 bp, come from the region "400-455" of the Drosophila fushi tarazu (flz) upstream element/scaffold associated region (USE/SAR) in plasmids pBSSNP12 and pl9Sall2 (gift of Sarb Ner; described previously). I5 The 62- and 90-bp fragments are excised from the pl9Sall2 plasmid using SalI and BamHI/HindlII digests, respectively. The 157-bp fragment is obtained from AvaI/HindlII digests of pBSSNPI2. The resulting restriction digests are dephosphorylated using calf intestinal alkaline phosphatase (Promega) and are purified by PCI and ether extraction, ethanol-precipitated, and stored at -20 ° until use. The quantitated probe DNA (1-3 pmol) is labeled at the 5' end using [y-32p]ATP (3000 Ci/mmol; Amersham, Piscataway, NJ) and T4 polynucleotide kinase (GIBCO-BRL, Gaithersburg, MD) and gel purified as described earlier to separate it from the remaining plasmid fragments.53

Oligonucleotides Single-stranded oligonucleotides (AGTTACTGAAT-I'ACGCTCAT and TAGAGCGTAATTCAGTAACT) are synthesized commercially. The DNA is purified by Sep-Pak (Waters C18) chromatographic or ionexchange methods or by polyacrylamide gel purification followed by PCI extraction, ether extraction, and ethanol precipitation. Palindromic sequences are annealed at 90° in 0.1 M NaC1 and then cooled. The single strands of nonpalindromic sequences are quantitated carefully using UV absorption and electrophoresis techniques to ensure correct duplex formation and to minimize single-stranded DNA. 18 The strands are annealed in a 1 : 1 molar ratio at - 1 / x M concentration in TE buffer by heating at 90° for 2 rain followed by slow cooling to room temperature. The DNA is then stored at -20 ° in TE buffer until use. A 20-bp disulfide cross-linked DNA fragment (kindly provided by Wolfe and Verdine) was labeled as described

[7]

INTERACTIONS OF HMG Box PROTEINS

123

previously. 54 Other D N A fragments were 5' end labeled using [y-32p]ATP and gel purified as described earlier. Electrophoretic Mobility Shift Assay Band shift assays are conducted using siliconized Eppendorf vials. To siliconize the reaction vials, the tubes are dipped into a solution of 2% dimethyldichlorosilane (Sigma) in heptane (Sigma) and rinsed immediately with 95% ethanol. The vials are then rinsed three times using deionized water (Milli-Q; Millipore, Bedford, MA) and baked overnight at 100°. Protein dilutions are made from 10/xM or more concentrated stocks of HMG-D in PDB (as required). One microliter of HMG-D (diluted as described earlier) is added to a 9-/zl binding reaction composed of between 0.1 and 1 nM radiolabeled DNA, 200/xg/ml BSA, and binding buffer (20 mM HEPES, pH 7.5, 50 mM KCI, 2 mM MgClt) to give final HMG-D concentrations ranging from 0 to 20/zM. Reactions are incubated at 22 ° for 45 min. The samples contain 5% glycerol and no added dye. The samples are loaded on prerun (at least 45 min, until constant current is reached) polyacrylamide gels (30: 1; acrylamide : bisacrylamide) and electrophoresed for 45 min to 1.5 hr at 125 V in 0.33× TBE, dried, and then exposed to film. Ligase-Mediated Circularization Assay The DNA oligonucleotides (GCCTATTGAA, GCTTCAATAG, GCCATATTGAA, GCTTCAATATG) used in the circularization assays are synthesized commercially (Operon Technologies, Inc., Alameda, CA) arid purified using RP chromatography (Waters Sep-Pak, Waters Corp., Milford, MA). One nanomole of each ¢'top strand" is phosphorylated at the 5' end using T4 polynucleotide kinase (GIBCO-BRL) with [~F-P]ATP (3000 Ci/mmol, Amersham) and unlabeled ATP, and 1 nmol of each ¢'bottom strand" is phosphorylated with unlabeled ATP to generate ligatable DNA ends. After purification by PCI extraction and two ether extractions, the D N A is ethanol precipitated, rinsed, and dried before redissolving the DNA in TE buffer. The hot and cold DNA strands are annealed at a 1 : 1 molar ratio at 1 mM concentration in TE buffer by heating at 90° for 2 min followed by slow cooling to room temperature and storage at - 2 0 °. For the cireularization assay, 1/.d of 10/zM HMG-D is added to 8 txl of 1 ~M double-stranded DNA in ligase buffer (50 mM Tris-C1, pH 8.0, 5 mM MgCI2, 1 mM DTT) and allowed to incubate for approximately 4 min. One unit of T4 DNA ligase (GIBCO-BRL) is then added and the 54H. A. Saroff, Biopolymers 33, 1327 (1993).

124

ASSEMBLY OF NUCLEOSOMES, CHROMATIN, AND NUCLEI

[71

reaction is allowed to proceed for 1 hr at 22 °. The reactions are quenched by PCI extraction after which the DNA is extracted with ether, ethanol precipitated, dried, and redissolved in 10 /xl of water. The samples are digested for 20 rain at 37° with exonuclease III (GIBCO-BRL) in 50 mM Tris-C1, pH 8.0, 5 mM MgC12, 1 mM DTT to remove linear DNA fragments and subsequently extracted with ether, ethanol precipitated, dried, and redissolved in water and loading buffer (50% glycerol, 1% xylene cyanol, 1% bromphenol blue, w/v). The samples are loaded on a 40-cm 8% (w/v, 30:1 acrylamide:bisacrylamide; 1× TBE) native polyacrylamide gel and are electrophoresed for 4.0 hr at 400 V. The gel is dried and exposed to Kodak (Rochester, NY) X A R film and phosphorimaging plates. Control experiments (data not shown) are performed to verify the gel position of the monomer circles. Time Course of Protein-DNA Binding Time course experiments are conducted using the same D N A fragments and binding conditions as described earlier for equilibrium binding analysis with a few exceptions. For the on-rate experiments, 20/zl of 100 nM HMGD-100 in PDB is added to a 180-/,1 solution, which contains 1 nM radiolabeled DNA, 200/xg/ml BSA, and binding buffer (20 mM HEPES, pH 7.5, 50 mM KCI, 2 mM MgC12). At times varying from 0 sec to 60 min, a 10/zl aliquot is removed and loaded directly onto the running gel to capture the protein-DNA complexes formed at that time. For off-rate assays, the reactants (180/zl of 10 nM HMG-D-100, 1 nM radiolabeled DNA, 200/zg/ ml BSA in binding buffer) are incubated for 45 rain before the addition of the 20-/zl unlabeled competitor DNA, poly[d(IC)], to a concentration of 160 nM. At a series of time points after addition of the competitor DNA, aliquots are removed from the vial and loaded directly onto a prerun bandshift gel (8%, w/v, 30:1; acrylamide:bisacrylamide in 0.33× TBE) while running. The gels are electrophoresed for 60-75 rain at 125 V, dried, and exposed to film. Data Extraction and Analysis The dried gels are exposed to a phosphorimaging screen between 10 and 24 hr and subsequently scanned using the Molecular Dynamics Phosphorimager. The integrated areas and background values for individual bands are obtained using the ImageQuant program and manipulated using the Excel (Microsoft) and Kaleidagraph (Abelbeck Software) programs. First, the background value corresponding to the area of each band is

[7]

INTERACTIONS OF HMG Box PROTEINS

125

subtracted. Then the amounts of D N A bound, DNAb, and free, DNAf, are determined, and the fraction bound y = DNAb/(DNAf + DNAb) is calculated and plotted for each protein concentration. The shape of the binding curve is assessed to ensure that a plateau indicative of saturation is observed. The p r o t e i n - D N A complexes dissociate somewhat during electrophoresis. In cases of weak binding or where 100% binding is not observed in the gel, but a plateau in the binding curve is reached, data are normalized to give a maximum saturation of approximately 95%. This correction is equivalent to determining and applying the rate of dissociation of the HMGD - D N A complex within the gel matrix as described previously. 4s Where kobs is the dissociation rate of the complexes in the gel and t is the time of electrophoresis, the correction is given by y .... = Yobs(1 -- e tko~s).4s Because the amount of complex dissociation is not constant from gel to gel, the correction is applied to each gel based on the plateau value of Yobs, which is typically between 60 and 90%. In cases where no plateau is reached initially, the experiments are repeated using higher protein concentrations until a plateau is observed. For complexes with an affinity as weak as 7 /xM, it was possible to obtain saturation with about 50% of the D N A shifted at the binding curve plateau. For the kinetics experiments, a rate of gel dissociation curve can be generated and applied. 48 Typically, a minimum of three data sets are averaged and fitted using nonlinear least-squares refinement methods implemented in Kaleidagraph with the binding equations described earlier. The curve-fitting errors for single-site binding isotherms are _+15%. The errors for cooperative binding analysis are not estimated as easily, but are in the same range of _+15-20%.

Use of C h r o m a t i n Western Blot to Examine Interaction of HMG-D with C h r o m a t i n HMG-D is the most abundant HMG-box protein expressed during D. melanogaster embryogenesis. 6 Although numerous functions have been ascribed to HMG-box proteins, little is known about the function or interactions of HMG-D or other HMG-box proteins with D N A and chromatin in vivo. HMG-D may associate with nucleosomes in competition with H1 during syncytial nuclear division or may bind to linker D N A in the precellular embryo to facilitate the formation of easily replicated chromatin structures. 7 To address these questions, we used a method that would directly reveal the association of the protein with nucleosomes. It is possible to separate nucleosome oligomers generated by micrococ-

126

ASSEMBLY OF NUCLEOSOMES, CHROMATIN, AND NUCLEI

[7]

cal nuclease digestion of chromatin by native gel electrophoresis. 55-57 The length of the DNA is the primary determinant of migratory distance. Mononucleosomes migrate faster than dinucleosomes, etc. However, for a given length of DNA, the molecular weight of the complex is altered by the quantity of protein bound. This is particularly evident for mononucleosomes, which appear as several species, each containing a different complement of proteins and DNA lengths associated with the histone octamerY -57 If HMG-D associates with nucleosomes in Drosophila chromatin, then its binding may be detected using native gel electrophoresis because a nucleosome bound to HMG-D may migrate differently than nucleosomes bound to histone H1 or other proteins. At the developmental stage of the embryos used in this example (6 to 12 hr), HMG-D is found at a basal level of about 1 molecule per 50 nucleosomes while H1 has already reached a protein to nucleosome ratio of 1 : 1. The elegant techniques used to analyze the association of major chromosomal protein-DNA complexes using electrophoretic techniques would fail to show HMG-D-nucleosome complexes because they would be obscured by the more abundant HI-containing chromatosome complexes. If the method is altered, as suggested by Kornberg, 58 to include a Western blot step, then the association of even minor chromosomal proteins with nucleosomes can be detected. We have developed and applied the chromatin Western blot technique to identify which species of nucleosomes contain HMG-D, using conditions that are as close to the in vivo conditions as currently possible. The scheme in Fig. 6 illustrates the procedure for performing the chromatin Western blot on native chromatin. The nuclei are isolated quickly from Drosophila embryos of particular ages (6 to 12 hr illustrated here) and are lightly digested with micrococcal nuclease (MNase). The chromatin is extracted directly from the digested nuclei and electrophoresed on a native polyacrylamide gel. The gels are stained, blotted, and probed with various antibodies as described later. To test the method, antibodies against histone H1 and HMG-D are used to probe Western blots made from chromatin containing both proteins. Figure 7 illustrates results for this procedure as applied to HMG-D and histone H1. The blot for histone H1 clearly shows that histone H1 associates with nucleosome particles. The blot for HMG-D shows that HMG-D also colocalizes with the mononucleosome region of the gel, but the complexes 55R. Todd and W. T. Garrard, J. Biol. Chem. 252,4729 (1977). 56A. J. Varshavsky,V. V. Bakayev,and G. P. Georgiev,Nucleic Acids Res. 3, 477 (1976). 57S. Huang and W. T. Garrard, Methods Enzymol. 170, 117 (1989). 58R. Kornberg,J. W. LaPointe,and Y. Lorch,Methods Enzymol. 170, 3 (1989).

[7]

INTERACTIONSOF HMG s o x PROTEINS

127

3-4 grams 6-12 hr Drosophilamelanogasterembryos

~

omogenizeembryos

and isolate nuclei

Nuclei I

icrococcalnucleasedigestion(variableamounts) Centrifuge 5 min at 700g

Supernatant (Discard)

Nuclearpellet I Lysenuclei in 10 mM EDTA, Centrifuge 10 min at 10,000g

I

Supernatant I Load 2-3A2s0 units chromatin/lane(approx. 10-15 pg DNA) and electrophoreseat 75V for 12 hr (Digestionseries is loaded in quadruplicate)Purified r nucleosomecores are run as a mobility marker (C)

Pellet (Keep for other experiments or discard)

MCNase

~

c

~

c

~

c ~

c

Trinucleosomes and larger Dinucleosomes

Mononucleosomes

omi oil oJ| oll

Core

j

",..

Transfer 3/4 of gel to Nitrocellulose Stain with PonceauS Cut blot into three parts ~ . "~

Stain 1/4 of gel for DNA with SYBR-GOLD

Probe with Ab against histone H1

Probewith Ab against histones Probe with Ab against HMG-D

F1o. 6. Scheme for chromatin Western blot analysis of native chromatin samples.

it forms migrate slightly faster and slightly slower than those formed with histone H1. Two-dimensional D N A analysis (not shown) shows that the D N A length in the HMG-D-binding regions was intermediate between nucleosome cores and chromatosomes. This approach is particularly useful

128

[7]

ASSEMBLY OF NUCLEOSOMES, CHROMATIN, AND NUCLEI

~_

o~

I .~_

00

E

c~J

o "r

o

GO

co

(D o o

._i

o E: rn >-

c~

+ Z

Z co

Z cM

Z .,--

m o (9

[7]

INTERACTIONSOF H M G BOX PROTEINS

129

for a p r o t e i n such as H M G - D , which is d e t e c t e d m o r e easily by W e s t e r n b l o t t i n g t h a n b y gel staining b e c a u s e H M G - D stains very p o o r l y with silver. I n c o n j u n c t i o n with o t h e r in vitro c o n t r o l e x p e r i m e n t s , this a p p r o a c h is p o w e r f u l b e c a u s e it can reveal associations of e v e n m i n o r c h r o m o s o m a l p r o t e i n s in a n a t i v e c h r o m a t i n e n v i r o n m e n t w i t h o u t prior d i s r u p t i o n a n d r e c o n s t i t u t i o n of the c h r o m a t i n . 8

C h r o m a t i n W e s t e r n Blot P r o c e d u r e s

Collection of Drosophila Embryos E m b r y o s are collected using s t a n d a r d m e t h o d s 59 from p o p u l a t i o n cages c o n t a i n i n g O r e g o n R wild-type flies. Fresh grape plates s m e a r e d with yeast paste are placed i n t o p o p u l a t i o n cages for 6 hr, r e m o v e d , a n d i n c u b a t e d for 6 hr at 25 °. E m b r y o s are washed off the plate o n t o a Nitex filter, washed with w a t e r to r e m o v e yeast, weighed, frozen in liquid n i t r o g e n , a n d stored at - 8 0 ° until n e e d e d for use.

59C. D. Shaffer, J. M. Wuller, and S. C. R. Elgin, Methods CellBiol. 44, 99 (1994).

FIG. 7. Colocalization of histone H1 and HMG-D with nucleosomes using chromatin Western blot analysis of 6- to 12-hr Drosophila embryo chromatin. All samples were digested with micrococcal nuclease and electrophoresed, as described in the methods section. The separated gel sections were subjected to different treatments as follow. Lanes 1-4: Nucleoprotein complexes stained with 1x SYBR-GOLD and visualized under UV. Lanes 5-8: Ponceau S-stained nitrocellulose with electrotransferred nucleoprotein complexes. Positions of nucleosome migration were marked, and the stained blot was scanned for visual record. Positions of nucleosome species, mononucleosomes, dinucleosomes, and so on are denoted IN, 2N, and so on. Lanes 9-12: Western blot using antibody specific for histones. After transfer to nitrocellulose, the blot was probed with 5/~g/ml antihistone (mouse monoclonal) antibody (Boehringer Mannheim). Lanes 13-16: Western blot for HMG-D. After transfer to nitrocellulose, the blot was probed with a 1 : 2000 dilution of anti-HMG-D polyclonal (rabbit polyclonal; 1 : 2000 dilution) antibody (gift of Dr. S. Ner). Lanes 17-19: Western blot using histone HI antibody. Samples were transferred to nitrocellulose and probed with a 1 : 10,000 dilution of anti-Drosophila histone H1 polyclonal (rabbit) antibody (gift of Dr. J. Kadonaga). Lanes 1, 5, 9, 13, and 17 contain approximately 5/zg purified chicken erythrocyte nucleosome cores (CEN) as migration standards. Each lane in the sets of lanes 2-4, 6-8, and 10-12 contains approximately 8/zg DNA as soluble chromatin digested with 0.1, 0.03, and 0.01 units/A260of micrococcal nuclease, respectively. Lanes 18 and 19 (from a different experiment) contain approximately 12/xg of digested chromatin digested with 0.1 and 0.03 units/A260of micrococcal nuclease, respectively.

130

ASSEMBLY OF NUCLEOSOMES, CHROMAT1N, AND NUCLEI

[7]

Nuclear Isolation Nuclei are isolated on ice using a modification of a protocol published by Shaffer et al. 6° Three to four grams of frozen 6- to 12-hr D. melanogaster embryos are ground in liquid nitrogen with a ceramic mortar and pestle. The resulting embryo powder is saturated in 3 ml/g of MLB + NP-40 (magnesium lysis buffer + Nonidet P-40:15 mM HEPES, pH 7.3, 60 mM KC1, 15 mM NaC1, 2 mM MgC12, 0.5% Nonidet P-40, 5 mM DTT, 10 mM PMSF, 2/xg/ml leupeptin, 2/zg/ml aprotinin, 1/xg/ml pepstatin A). This slurry is homogenized with five strokes of a ground glass homogenizer. The homogenate is transferred to a Dounce homogenizer, disrupted with 10 strokes of pestle B, filtered through two layers of Miracloth (Calbiochem), rinsed with 2 ml MLB + NP-40, overlaid on 1/4 volume of MLBS (MLB with 0.3 M sucrose; sucrose cushion), and centrifuged at 1500g for 5 rain. The nuclear pellet is resuspended in 3 ml MLB + NP-40, homogenized with five strokes of pestle A in the Dounce, and then centrifuged through a sucrose cushion as before. The resulting nuclear pellet is resuspended in 3 ml MLB, transferred to a Dounce homogenizer, and disrupted with five strokes of pestle B. Nuclei are then centrifuged at 700g and used in subsequent experiments. If the supernatant remains cloudy, the pellet can be resuspended in MLB and centrifuged through the sucrose cushion again.

Micrococcal Nuclease Digestion of Drosophila Chromatin Nuclei from Drosophila embryos are suspended in 1 ml micrococcal nuclease digestion buffer (15 mM HEPES, pH 7.3, 60 mM KC1, 15 mM NaC1, 1 mM CaCI2, 0.25 M sucrose). 6° The amount of micrococcal nuclease required for optimal digestion is calibrated by first diluting 0.25-1 /~1 of nuclear suspension to 100 t~l in 0.1 M NaOH and then measuring the absorbance at 260 nm. Correction for dilution yielded the absorbance of the solution in units of Az60/ml. After the A260 determination, the nuclear suspension is divided into four 250-/xl aliquots and equilibrated to 15°, and MNase is added according to Table II. For example, if the A26o of a 0.25/xl aliquot of nuclei diluted 400;< is 0.59, the undiluted nuclei would have an absorbanee of 236 A260units/ml; 250 t~l of nuclei would thus contain 59 A260units. An intermediate level of digestion can be obtained using 0.03 units MNase/A260. The addition of 1.8 units of MNase would achieve the intended extent of digestion. Nuclei are then digested for 10 rain at 15° with intermittent mixing by gentle agitation of the reaction tubes. Reactions are quenched by the addition of 5 /xl of 0.5 M EDTA (final concentration of 10 raM) followed 60 C. D. Shaffer, J. M. Wuller, and S. C. R. Elgin, Methods Cell Biol, 44, 185 (1994).

[71

INTERACTIONSOF HMG Box PROTEINS

131

TABLE II CALIBRATION OF MNase DIGESTION CONDITIONS

Reaction

A260/250/xl

Units MNase/Az60

/zl MNase/A260 (0.1 U//zl)

Total MNase (/zl)

1

59 59 59 59

0.01 0.03 0.1 0.3

0.1 0.3 1.0 3.0

5.9 17.7 59.0 177.0

2 3 4

immediately by the chilling of reaction tubes on ice. After the reaction, nuclei are centrifuged at 700g for 5 min at 4 °. After the supernatant is discarded, nuclei are lysed by rapidly resuspending the pellet in 50/zl 10 mM Tris, 10 mM E D T A (pH 8). Nuclear debris is removed by centrifuging at 10,000g for 10 rain at 4 °. The supernatant is saved and 1 /xl of each reaction is diluted 100x in 0.1 M NaOH, and the A260 is measured to determine the concentration of chromatin in micrograms per milliliter of DNA. Increasing the lysis volume to 100/zl yields equivalent concentrations of soluble chromatin in the supernatant.

Electrophoresis of Digested Chromatin Electrophoresis is carried out on a 1 mm x 20 cm x 20 cm 4% (w/v, 19:1) polyacrylamide gel in 0.33x TBE. Only one of the glass plates is siliconized prior to gel casting to ensure adhesion to the second plate. The gel is prerun at 125 V at room temperature until constant current is reached and is then transferred to a 4 ° cold room for equilibration prior to sample loading. Approximately 5-8 /zg D N A as chromatin is loaded per lane. Samples are prepared by adding glycerol to a final concentration of 5% and are loaded as rapidly as possible. Approximately 5 /xg of purified chicken erythrocyte nucleosome cores, purified according to Lutter, 61 is loaded as a mobility standard, and marker dyes (Promega) are loaded in the outer lanes, flanking the digestion lanes. Gels are electrophoresed at 75 V until the xylene cyanol marker dye migrates approximately threefourths of the length of the gel (approximately 12 hr). Provided that the gels are made from the same mixture and electrophoresed at the same time on the same power supply, identical mobility of nucleosomes is observed.

Immunoblotting of Chromatin Gels The experiment can be performed on multiple gels so that one set of lanes can be stained for DNA. A second set can be blotted and stained 61 L. C. Lutter, J. Mol. Biol. 124, 391 (1978).

132

A S S E M B L OF Y NUCLEOSOMES, CHROMATIN, AND NUCLEI

[7]

for protein using Ponceau S and then probed with an antibody; the remaining sets of lanes can be blotted to nitrocellulose and probed with various antibodies. Used here are antihistone, anti-HMG-D, and anti-H1 antibodies. After the gels are removed from the electrophoresis apparatus, the boundaries between each set of reactions are traced on the outside of both glass plates. Cut 0.45/zm supported nitrocellulose (MSI) to fit all but one set of reactions and soak in transfer buffer (25 mM Tris, 200 mM glycine, 0.01% SDS, 20% (v/v) methanol.62 The gel plates are separated, leaving the gel adhered to the unsiliconized plate, providing a solid surface with which to manipulate the gel without stretching to tearing it. One set of reactions is separated from the others with a razor blade. This gel piece is stained for DNA using 1 × SYBR gold stain (Molecular Probes, Eugene, OR) according to the manufacturer's instructions and visualized by UV transillumination. The remainder of the gel is transferred to nitrocellulose. Whatman (Clifton, NJ) filter paper, soaked in transfer buffer, is placed on top of the part of the gel to be transferred until three layers of buffer-soaked filter paper cover the gel. To remove bubbles, a glass rod or Pasteur pipette is rolled over the gel as each new layer is added. The layers of gel and filter paper are lifted carefully from the glass plate and turned over. The uncovered face of the gel is soaked with additional buffer to ensure equilibration, preventing the gel from adhering to the nitrocellulose after transfer. 62 The precut, preequilibrated nitrocellulose is placed over the gel and the bubbles rolled out. Three layers of buffer-soaked Whatman filter paper are placed over the nitrocellulose as before. The gel sandwich is assembled in a semidry transfer apparatus with the gel on the cathode side and the nitrocellulose on the anode side according to manufacturer's instructions. The transfer is performed at 400 mA for 1 hr at 4°. After transfer, the sandwich is disassembled, taking care to separate the gel from the nitrocellulose. This process is facilitated by streaming transfer buffer between the gel and nitrocellulose with a Pasteur pipette while plying the layers apart. The blotted nitrocellulose is rinsed in water to remove SDS and then covered in Ponceau S solution (0.1% Ponceau S in 5% acetic acid, w/v) and incubated approximately 10 min with minor agitation. The blot is destained in water. The position at which the chicken erythrocyte nucleosome cores migrated is marked on the blot with a lead pencil. The remaining experi62 G. Jacobsen, in "Protein Blotting: A Practical Approach" (D. Rickwood and B. D. Hames, eds.), pp. 53-64. Oxford Univ. Press, New York, 1994. 63 D. Landsman and M. Bustin, Bioessays 15, 539 (1993). 64 M. E. Bianchi, M. Beltrame, and G. Paonessa, Science 243, 1056 (1989). 65 U. Ohndorf, J. P. Whitehead, N. L. Raju, and S. J. Lippard, Biochemistry 36, 14807 (1997).

[8]

R E C O N S T I T U T I O N OF H M G

1 4 / 1 7 PROTEINS

133

ments are separated and blocked separately in 100 ml TBS containing 10% nonfat dried milk. The blots are probed according to standard techniques 62 using the appropriate HRP-conjugated secondary antibody under the same incubation conditions. Proteins are detected by chemiluminescence (Super Signal Substrate, Pierce, Rockford, IL).

Acknowledgments We are grateful to Drs. Scot Wolfe and Greg Verdine for samples of disulfide cross-linked DNA and to Drs. James Kadonaga and Sarb Ner for gifts of antibodies. We appreciate the assistance of Drs. Lori Wallrath, Sarah Elgin, and Chris Doe and his laboratory members in the implementation of the chromatin Western blot experiments. We also thank Frank Murphy and Rebecca Bachmann for contributions and helpful comments on the manuscript and the contributions of past laboratory members, especially Heidi Hefner and Per Jambeck. This work was supported by the Illinois Division of the American Cancer Society, by American Heart Association grants to M.E.A.C., and by Molecular Biophysics N1H Training Grant support of L.K.D. and Cell and Molecular Biology NIH Training Grant support of A.J.K.

[8] R e c o n s t i t u t i o n o f H i g h M o b i l i t y G r o u p 1 4 / 1 7 into Nucleosomes and Chromatin

Proteins

B y YURI V. POSTNIKOV a n d MICHAEL BUSTIN

High mobility group (HMG) proteins are a ubiquitous and heterogeneous class of nonhistones, which serve as "architectural elements" that modify the structure of DNA and chromatin, thereby facilitating a variety of DNA-related activities in the nucleus of the cell. 1 The HMG14/17 subgroup is the only class of nuclear proteins known to bind specifically to the 146-bp core particle. These proteins bind to the nucleosome core cooperatively and form homodimeric complexes containing either two molecules of HMG14 or two molecules of HMG17. 2 Both HMG14 and HMG17 contact the nucleosomal DNA 25 bp from the end of the core particle and in the two major grooves flanking the nucleosomal dyad axis? Additional specific contacts are made with the amino termini of the core histones. 4 The proteins stimulate various DNA-dependent activities such as transcrip1 M. Bustin and R. Reeves, in "Progress in Nucleic Acid Research and Molecular Biology" (W. E. Cohn and K. Moldave, eds.), pp. 35-100. Academic Press, San Diego, 1996. 2 y. V. Postnikov, L. Trieschmann, A. Rickers, and M. Bustin, J. Mot Biol. 252, 423 (1995) 3 p. j. Alfonso, M. P. Crippa, J. J. Hayes, and M. Bustin, J. Mol. Biol. 236, 189 (1994). 4 M. P. Crippa, P. J. Alfonso, and M. Bustin, J. Mol. Biol. 228, 442 (1992).

METHODS IN ENZYMOLOGY, VOL. 304

Copyright © 1999 by Academic Press All rights of reproduction in any form reserved. 0076-6879/99 $30.00