Interactions of Qβ replicase with Qβ RNA

J. Mol.

Biol.

(1981)

153, 631-660

Interactions FRANCOIS

of Q/? Replicase with Q/? RNA

MEYER?,

HANS

WEBER

AND CHARLES

Institut fiir Molekularbiologie Universittit Ziirich, 8093 Ziirich, (Received

5 February

WEISSMANN

I Switzerland

1981, and in revised form

8 April

1981)

The interactions of Q/3 replicase with Q/3 RNA were investigated by treating replicase-Q/l RNA complexes under various conditions with ribonuclease T,, and by characterizing enzyme-bound RNA fragments recovered by a filter binding technique. Evidence for replicase binding at two internal regions of Q/3 RNA was obtained. One region (at about 1250 to 1350 nucleotides from the 5’ end) overlaps with the initiation site for coat protein synthesis; this interaction is thought to be inessential for template activity but rather to be involved in the regulation of protein synthesis. Binding to this site (called the S-site) requires moderate concentrations of salt but no magnesium ions. The other region (at about 2550 to 2870 nucleotides from the 5’ end) is probably essential for template activity; binding to this site (called the M-site) is dependent on the presence of magnesium ions. The nucleotide sequences of the RNA fragments from the two sites were determined and found to have no common features. Under the conditions tested, replicate binding at the 3’ end of Qj3 RNA could not be demonstrated, except when initiation of RNA synthesis was allowed to occur in the presence of GTP and host factor. If instead of intact Q/3 RNA, a complete RNAase T, digest of Q/3 RNA was allowed to bind to replicase, oligonucleotides from the S-site and the M-site, an?l oligonucleotides from a region close to the 3’ end, were found to have the highest affinity to the enzyme. The RNA fragments recovered in highest yield, M-2 and S-3 from the M and Ssite, respectively, were isolated on a preparative scale and their enzyme binding properties were studied. In competition assays with random RNA fragments of the same size, selective binding was observed both for the M and the S-site fragment. Partial competition for replicase binding was found if M-2 and S-3 were presented simultaneously to the enzyme. Either fragment, if preincubated caused a specific inhibition of initiation of Q,5 RNA-directed

with RNA

replicase, synthesis,

without inhibiting the poly(rC)-directed reaction. The results are discussed in terms of a model of replicase-Qfl RNA recognition. Template specificity is attributed to binding of internal RNA regions to replicase, resulting in a specific spatial orientation of the RNA by which the inherently weak, but essential, interaction at the 3’ end is allowed to occur and to lead to the initiation of RNA synthesis.

1. Introduction Replicase, the RNA-dependent number of unusual properties, t Present

address : Ciba-Geigy,

0922%2836/81/350631-30

$02.00/O

RNA polymerase prominent among

4000 Basel,

of bacteriophage Q/3, has a which are its complex subunit

Switzerland 631

0

1981 Academic

Press Inc. (London)

Ltd.

632

F.

MEYER,

H.

WEBER

AND

C. WEISSMANN

structure (Kondo et al., 1970; Kamen, 1970) and its template specificity (for reviews, see Weissmann, 1974; Kamen, 1975; Blumenthal & Carmichael, 1979). The mechanism of this highly specific recognition process between replicase and RNA, as for most nucleic acid-protein interactions, is still incompletely understood. One approach to this problem is to characterize regions on the Qp genome that interact directly with the replicating enzyme. In an earlier paper (Weber et al., 1972), we reported the isolation and nucleotide sequence of a fragment of Q/3 RNA that remained attached to Qp replicase after degradation of a Q/I RNA-replicase complex by ribonuclease T,. The sequence of the 3’-terminal portion of this 106 nucleotide fragment was found to be identical with the 5’.terminal half of the ribosomal binding site at the coat cistron (Hindley & Staples, 1969). It was concluded that the interaction thus characterized represented the molecular basis for the &/3specific repression of translation by Qp replicase described earlier (Kolakofsky & Weissmann, 1971a,b). Later studies revealed that the binding of replicase at this RNA site was dependent on the presence of monovalent cations ; it was therefore called the saltdependent binding site or S-site. On the other hand, T, nuclease treatment of Q/l RNA-replicase complexes in the presence of Mg’ + ions and absence of monovalent cations, yielded a completely different set of RNA fragments, suggesting the existence of a (or possibly more than one) Mg’+ -dependent binding site (M-site : Weber et al., 1974; Meyer et al., 1975). In this paper we describe the interaction between Qfi replicase and Qj3 RNA under different reaction conditions. We report on the isolation of the major S and M-site fragments, their location on the Q/3 genome and their nucleotide sequences. We show that isolated S and M-site fragments bind to Q/I replicase and inhibit initiation of RNA synthesis, and that even shorter oligonucleotides (total RNAaseT, digestion products derived from the M and S-sites) are selectively bound to the enzyme. We propose a two-tier model of recognition. The enzyme recognizes certain sequences of an RNA, but productive binding results only if the RNA is bound in the proper orientation on the enzyme : namely, so that its 3’ terminus comes to lie in the initiation site. Thus, both certain nucleotide sequences and a defined three-dimensional structure of the RNA are required for recognition by the enzyme.

2. Materials

and Methods

(a) Materials

Q/3 replicase and host factor HF were prepared as described earlier (Kamen et al., 1972). specific activity of the replicase preparations varied between 1200 U/mg (used for the preparation of binding fragments) and about 2000 U/mg (used for fragment binding studies). The

1 Unit is defined as 1 nmol of GMP incorporation in 20 min at 37°C. Replicase lacking the asubunit was prepared by W. Riimer (Kamen et al., 1972) and protein Sl was a gift from Dr 3H-labeled and uniformly 32P-labeled Q/3 RNA were prepared R. Kamen. Unlabeled, according to published procedures (Weissmann et al., 1968; Escarmis et aZ., 1978). The preparation of ribonucleoside [II- ‘*P]triphosphates was described by Billeter (1978). Ribosomal RNA from Escherichia coli was a gift from Dr M. A. Billeter. Synthetic homopolynucleotides were purchased from Calbiochem. Extracellular ribonuclease from Physarum polycephlum was a gift from Dr J. P. Bargetzi, University of Geneva.

INTERACTIONS

OF

Qj3 REPLICASE

WITH

Qfl

Carboxymethylated RNAase A was a gift from Dr W. Biers, University materials were as described by Schaffner et al. (1977).

RNA

633

of Ghent. All other

(b) Methods (i) Determination

of nucleotide

sequences

The techniques used were essentially those described by Barrel1 (1971) with modifications according to Escarmis et al. (1978). Partial digestions of [j2P]RNA fragments with RNAase T, were carried out at 0°C for 50 to 55 min in 20 ~1 of 20 m&r-Tris . HCl (pH 7.5), 2 mM-EDTA in presence of 50 pg of yeast carrier RNA and 605 to 023 units of RNAase T,. Partial digestions with carboxymethylated RNAase A (Contreras & Fiers, 1971) were done in 20 ~1 of 50 mnr-sodium acetate (pH 40), 2 mM-EDTA, 004~~ (w/v) gelatine in the presence of 25 pg of carrier RNA and 08 pg of RNAase for 33 min at 10°C. All partial degradations were stopped by addition of 0.4 ml of 20 m&r-Tris. HCI (pH 7.5), 2 mM-EDTA, 05% (w/v) sodium dodecyl sulfate. The mixtures were twice extracted with phenol and the RNA was recovered by precipitation with ethanol. The fragment mixtures were fractionated by polyacrylamide gel electrophoresis as described below or, in the case of fragment S-3, by homochromatography using homomixture B (Barrell, 1971). Use was also made of “nearest neighbor” information, as outlined by Billeter et al. (1969). For this purpose, purified replicase binding fragments were prepared from 4 preparations of Q/l RNA synthesized in vitro, each of which was labeled with a different nucleoside [a-32P]triphosphatet. (ii)

Synthesis

triphosphates

of

&p RNA in

in vitro using

(w3’P)-labeled

one

of the four

ribonucleoside

,form

Four preparations were carried out, each with a different [a-32P]triphosphate. The following is a description of the preparation for which [a-32P]GTP was used. The incubation mixture (1 ml) contained: Q/l replicase (30 units), Qfl RNA (32 rg), host factor HP (30 units), 0.14 mM-[a-32P]GTP (spec. act. 10’ cts min-’ nmol -‘), 08 mM each of CTP, UTP and ATP, 0.16 M-KC], 80 m&r-Tris .HCl (pH 75), 12 mmMgCl,, 1 m&r-EDTA. The mixture was incubated at 37°C for 45 min. At this time, the amount of radioactivity incorporated into acid-insoluble material corresponded to 28 nmol of [32P]GMP (4Opg of [32P]RNA). The reaction mixture was made 20 mM in EDTA and treated with 400 pg of Pronase in the presence of 02% (w/v) sodium dodecyl sulfate for 15 min at 37°C. The solution was extracted twice with an equal volume of phenol (saturated with 61 M-NaCl, 50 mivr-Tris.HCl (pH 7.5) 5 m&r-EDTA) and the RNA was precipitated by addition of 2 vol. cold absolute ethanol. After 2 h at - 25°C the RNA precipitate was collected by centrifugation and dried in mew). It was dissolved in 025 ml of 61 M-NaCl, 50 mru-Tris HCl (pH 7.5), 5 mM-EDTA and filtered at 4°C through a column (i.d. 8 mm) consisting of Chelex-100 (Na+) (bed vol. 63 ml) overlayered with Sephadex G-50 (bed vol. 9 ml). Fractions corresponding to the excluded peak were identified by Cerenkov counting, pooled, and the RNA was precipitated with 2 vol. ethanol. The recovery corresponded to 23 nmol of incorporated [32P]GMP, i.e. 32 pg of [32P]RNA. Most preparations were purified by sedimentation through a 5% to 23% sucrose density gradient in 50 mM-Tris HCl (pH 7.5), 5 m&r-EDTA for 2 h at 60,000 revs/min and 15°C in a Spinco SW65 rotor: 20 to 25 fractions were collected and the fractions containing full-size RNA (sedimentation constant about 30 S) were pooled, adjusted to 61 M-Nacl and mixed with 2 vol. cold ethanol to precipitate the RNA. The final preparations consisted of 60 to 65% plus strand and 35 to 40% minus strand RNA, as determined by an annealing assay (Weissmann et al., 1968). Since the presence of minus strands was found not to interfere with the isolation of the replicase-bound plus strand RNA fragments under the conditions used, the minus strand RNA was not removed from the preparation. t Detailed data of RNA sequence determinations are contained in supplementary material deposited with the British Library, Lending Division, Boston Spa, Wetherby, Weat Yorkshire LS237BQ, England. and copies can be obtained from them by quoting No. SUP 40014.

634

F.

(iii) Preparation binding

MEYER,

H.

of Q/3 L3’P]RNA

WEBER

fragments

AND containing

C. WEISSMANN replicase

sites

Binding complexes were prepared by incubating Q/I [32P]RNA (01 to 0.2 mg/ml) with replicase (605 to 61 mg/ml) in an appropriate binding buffer for 3 to 8 min at 37°C. For most experiments, one of the following binding buffers was used: (1) S-buffer: 10 mw-Tris.HCl (pH 7.5), 0.15 iv-NaCl, 2 mM-dithiothreitol, 62 mg bovine serum albumin/ml. (2) M-buffer: 10 mlcl-Tris.HCl (pH 7.5), 10 mM-MgCl,, 2 miw-dithiothreitol, 62 mg bovine serum albumin/ml. (3) I-buffer: 80 mM-Tris.HCl (pH 7.5), 12 miw-MgCl,, 1 mM-EDTA, 2 mw-dithiothreitol, 0.2 mg bovine serum albumin/ml. The complexes were cooled to 25°C and diluted 5 to 20.fold with the same binding buffer (without dithiothreitol or albumin) containing a 5 to 20-fold excess of unlabeled Q/l RNA over the labeled RNA, pre-equilibrated at 25°C. RNAase T, (05 unit/pg RNA in S-buffer, 1 unit/pg RNA in M or I-buffer) was added immediately and the mixtures were incubated at 25°C for 2 min (S-buffer) or 10 min (M or I-buffer). The digested samples were filtered under mild suction through Millipore filter discs (HAWP, 0.45 pm) presoaked in binding buffer (without dithiothreitol or albumin), and the filters were rinsed with 3 x 1 ml of the same buffer. The 32P radioactivity retained on the filter (determined by measuring the Cerenkov radiation of the moist filters) comprised about 1% of the added F3*P]RNA when S-conditions were used ; under M or I-conditions, about 3 to 3.5% were found. Background values measured in the absence of replicase usually did not exceed 92%. The RNA fragments were extracted by shaking the filters in 2.5 to 5 ml of a 1 : 1 (v/v) mixture of extraction buffer (20 mM-Tris. HCl (pH 7.5) 2 mM-EDTA, 65% (w/v) sodium dodecyl sulfate) and buffer-saturated phenol. In preparative experiments, up to 5 identical filters were extracted in the same tube. In most analytical experiments, the extraction was performed in the presence of 20 pg of yeast carrier RNA. The tubes were heated to 50°C for 3 to 5 min with intermittent shaking, then cooled to 0°C and centrifuged for 5 min in a clinical centrifuge at room temperature or at 10,OOOrevs/min and 4°C. The aqueous phase was removed, adjusted to 61 M-NaCl and the RNA collected by precipitation with ethanol as described above. The recovery was 80 to 90% of the filter-bound [32P]RNA. The separation of the Q/3 [32P]RNA fragments was carried out by electrophoresis on polyacrylamide gel slabs using conditions similar to those described by Peacock & Dingman (1968) but without agarose. The concentration of acrylamide was 20% (w/v), and of methylene bisacrylamide, 08 or 1% (w/v). The size of the gel slabs was either 20 cm x 17 cm or 20 cm x 40 cm, the thickness either 2 or 4 mm. RNA samples were dissolved in 30 to 50 ~1 of 12oj (w/v) sucrose, 605% (w/v) bromophenol blue and layered into gel slots of 1 to 2 cm width. Electrophoresis was carried out at 60 to 70 mA and 4”C, until the dye had migrated about 314 of the gel length. For autoradiography the moist gels were wrapped in Saran foil and exposed to Fuji RX Xray film. When required, RNA was extracted from gel slices by incubating the finely crushed gel pieces in 94 iw-NaCl for 20 min at 37°C. In cases where the use of carrier RNA was possible (e.g. for sequencing), 25 to 50 pg of yeast carrier RNA was added to the extraction mixture. After centrifugation the supernatant was collected and the extraction was repeated twice. The combined extracts were filtered through Sephadex G-10 (about 61 ml in a small column) and the RNA was precipitated with ethanol as described above. (iv) Total

RNAase 2-dimensional

T, digestion .wpara.tion

of [32P]RNA

fragments

and

of the products

32P-labeled RNA fragments (recovered from replicase binding experiments) were digested by RNAase T, (0.5 units/pg RNA) in 8 ~1 of 20 mw-Tris . HCl (pH 7.5), 2 mM-EDTA for 30 min at 37°C. The digestion products were fractionated by 2-dimensional polyacrylamide

INTERACTIONS gel electrophoresis as described characterization of the radioactive

OF Qp REPLICASE

WITH

Qp RNA

635

by DeWachter & Fiers (1972). Quantitetion and spots were as described by Coffin & Billeter (1976).

(v) Preparation of random RNA fragments and homopolymers of discrete size ranges Random RNA and homopolymer fragments of a size of 100 to 200 nucleotides were prepared by mild alkali digestion of high molecular weight materials. Unlabeled and 32Plabeled &,!I RNA (65 mg/ml) was fragmented by incubation in 50 m&r-sodium carbonate at 50°C for 50 t,o 80 min, E. coli ribosomal RNA was treated similarly for 20 to 30 min. Poly(rC) (2 mg/ml) was treated with 61 M-ammonium bicarbonate (pH 10) at 50°C for 1 min, poly(rU) (1.4 mg/ml) with 0.3 M-ammonium bicarbonate (pH 10) at 50°C for 5 min. Degradations were stopped by cooling to 0°C and addition of 0.25 vol. 0% M-NaCl, 05 M-Tris ’ HCl (pH 75) and the polynucleotides were recovered by precipitation with ethanol. The fragments were fractionated by preparative polyacrylamide gel electrophoresis as described above. 32P-labeled fragm ents M-2a (164 nucleotides) and S-3 (100 nucleotides) were coelectrophoresed in neighboring slots as markers. Random RNA fragments with mobilities similar to the marker fragments were obtained by extracting the appropriate gel slices as described above. In the case of the homopolymers, a broader size range of polynucleotides (130+ 20 nucleotides) was isolated. For the experiment described in Fig. 8, unlabeled random Q/? RNA fragments, prepared as described above, were fractionated by 2 successive sucrose gradient centrifugations. Fractions corresponding to the positions of the marker fragments M-2a and S-3 were recovered.

3. Results (a) Isolation,

location and nucleotide S and M-site fragments

(i) Isolation of RNA fragments

T,

treatment

following RNAase of Qfi [32P]RNA-replicase complexes

sequence of

Incubation of replicase with Qfl RNA under a variety of conditions leads to the formation of complexes that can be isolated by filtration on nitrocellulose filters (August et al., 1968). Using Q/l [32P]RNA, we prepared such complexes either in a buffer containing 0.15 M-Nacl, 0.01 M-Tris. HCl (pH 7.5) (S-buffer), or in a buffer containing 0.01 M-MgCl,, 601 ivr-Tris .HCl (pH 75) (M-buffer). In most experiments, the weight ratio of Qfl [32P]RNA to replicase was about 15 : 1. Increasing this ratio tenfold did not result in a substantial increase of RNA bound per unit weight of replicase (usually about 64 to 0% pg/pg replicase), nor did it produce any significant change in the RNA fragment patterns obtained after degradation (data not shown). The complexes were degraded by incubation of the diluted binding mixtures with ribonuclease T, A five- to 20-fold excessof unlabeled Q,!? RNA was present during digestion to minimize the binding of released [32P]RNA fragments to replicase. The reaction mixtures were filtered through Millipore filters and the bound [32P]RNA was recovered by extraction with a phenol/buffer mixture. The conditions of digestion of the complexes by ribonuclease T, were chosen arbitrarily to yield an amount of filter-bound [32P]RNA fragments corresponding to about 1% to 4% of the initially added Q,Y [32P]RNA. Under these conditions, Q/l RNA is not digested completely, even in the absenceof replicase. The RNA fragments obtained from the complexes are isolated

INTERACTIONS

OF

Qfl

REPLICASE

WITH

Q/i

RNA

637

because they remain attached to replicase; they may or may not have been partially protected from the RNAase in the complex. Figure 1 shows autoradiographs of such fragment mixtures, obtained by carrying out the binding and degradation reactions in S-buffer (Fig. l(a) and (b)) or M-buffer (Fig. l(c)), after separation by electrophoresis in 20% (w/v) polyacrylamide gels. Two very different fragment patterns were reproducibly observed. Control experiments done in the absence of replicase under otherwise identical conditions yielded only small amounts of unresolved labeled material (not shown). (ii) Fingerprint determination

and nucleotide sequence of S and M-site fragments

analysis

All the major RNA fragments revealed by the two band patterns were extracted from the gels and analyzed by fingerprinting according to Sanger & Brownlee (1967). With one exception (M-5), all the major bands of the S-pattern were found to represent fragments of related sequences, the smaller fragments giving rise to subsets of the spots of the longer ones (data not shown). The sequences of most of these fragments have been reported (Weber et al., 1972), along with an outline of the sequencing procedures used. In Figure 2(a) these sequencesare reproduced in a completed form. Fragments S-3, S-4a, S-4b, S-6, S-7a and S7b are identical with fragments 3,4a, 4b, 6,7a and 7b described by Weber et al. (1972). Fragments S-3, S4a, S-6 and S-7b all have their 3’ end at the same position in the middle of the coat cistron ribosomal binding site (Hindley & Staples, 1969). Fragment S-3, which appears in the highest yield, has a chain length of 100 nucleotides. The minor fragment S-3a extends 12 nucleotides further on the 3’ side and includes most of the nucleotides of the ribosomal binding site?. The probable secondary structure of fragment S-3 was deduced according to Tinoco et al. (1973) and is shown in Figure 2(b). In contrast to the S-fragments, the M-fragments were unrelated to each other, with the exception of bands 2a to d, which had sequencesin common. None of the fingerprints showed any similarity to those of the S-type fragments. Fragments M2a to d, M-5 and M-l 1 were consistently obtained in high yield and in a sufficiently pure form to allow their sequencedeterminationt. The nucleotide sequencesof the three fragments are presented in Figure 2(c), (d) and (e), which also depict their putative secondary structure. Fragment M-2b (the longest of the M-2 group) has a chain length of 173 nucleotides, M-5 is 60 nucleotides and M-11 21 nucleotides long. We could not discern any structural feature common to the different fragments, t See footnote

to p. 633.

FIG. 1. Electrophoretic analysis of Qp [32P]RNA fragments remaining bound to Qp replicase after digestion with RNAase T1. 32P-labeled Q/7 RNA (160 pg, spec. act. 3.8 x lo3 cts min-’ pg-‘) and Q,¶ replicase (45 M) were incubated for 8 min at 37°C in 05 ml of binding buffer. The binding complex was digested by RNAase T,, replicase-bound RNA fragments were retained on Millipore filters, extracted, fractionated by 20% polyaorylamide gel electrophoresis, and an autoradiograph was prepared. The detailed procedure is described in Materials and Methods. (a) and (b) Fragment pattern obtained after binding in S-buffer. The 2 patterns resulted from2 similar experiments but using different exposure times for autoradiography. (c) Fragment pattern obtained after binding in M-buffer.

AC

AC-GCCGAGAUCAUGUCG*CAGCCUAG,.

AU.AG G*C A-U A-U

uG

UA c

u

(e) F:E s”A’UCCUUCAAG3,

G-C

CA

G’CUUUUUAUUAA’UCAAUUUGAUCAUG,.

;‘$JCAA . C-G C.G C-G

E:hUGA

GC.GA

UAA

U.A G.C U.A A.U C.G U-G G.C A.U G.C C.G G~UAGAAAAAUAGCCAAGCUAAUAGGAGAUGUUCCGUCCGUUGAGGGUAUGUUGCGUCACUGCCG,,

A

u

5,AUCUU

(b)

FIG. 2. Nucleotide sequences of Qfl RNA fragments obtained by RNAase T, degradation of replicaseQj3 RNA complexes using 9 and M-conditions. Hyphens have been omitted for clarity. (a) Sequence of the Qfi RNA region defined by the fragments of the S-series and the ribosomal binding site of the coat cistron. The termination codon for the maturation protein (M. Billeter, personal communication) is also indicated. Fragments t5 and t10 were products of partial RNAase T, digestion, p9 and pll products of partial RNAase A digestion of fragment S-3. Fragments SP-I and SP-2 were identified as products of mild RNAase A digestion of replicase-Qb RNA complexes using S-conditions. (b) Possible secondary structure of fragment S-3. The free energy dG of formation of the larger loop is about -7 to -8 kcal, of the smaller loop about - 15 kcal (Tinoco et al., 1973). The bulge loop in the latter is drawn arbitrarily in 1 of 4 energetically equivalent positions. (c) Nucleotide sequence and possible secondary structure of fragment M-2b. Fragment M-2a lacks 9 nucleotides from the 3’ end. Nevertheless, for unknown reasons it has a lower mobility than M-2b in the electrophoretic system used, AC (loop) = -9.6 kcal. (d) Nucleotide sequence and possible secqndary structure of fragment M-5. AC (larger loop) = -44 kcal: AG (smaller loop) = -2.8 kcal. (e) Nucleotidc sequence and possible secondary structure of fragment M-11. AC (loop) = -5.4 kcal.

,JJUCCUGGCAGCAWGGCUUAUGUGCUUUAACG~CGCUCGUCUCUAUAGGCCUGACUACAGU~GGAUUUCAAUUUCUCACUGG

w

5’

(d) frf

AU .A’ A.U E-C G-U A.U

AAU

CA.UAGUUCU U.A C.G A-U U-A A-U

uG.U” A-U U.A U-A U-A cu. ACACGU

UcG

INTERACTIONS

OF

Qfi

REPLICASE

WITH

Qfi

RNA

639

either within the M-family or between the M and the S-families. A conspicuous property of fragment S-3 is its high U-content (39%) ; the M-2 fragments have exceptionally low self-complementarity (M-2b : 13%). The sequences reported here have recently been confirmed by sequence determination of Qfi DNA-containing hybrid plasmids (Taniguchi et al., 1978) by the Maxam-Gilbert procedure (Maxam & Gilbert, 1977; M. Billeter, personal communication). (iii) Location

of S and M-site

sequences on the Q/3 genome

The S-site fragments were previously shown to originate from a region about 900 to 1500 nucleotides from the 5’ end of the Qfl RNA (Weber et al., 1972). These results were confirmed by the complete sequencedetermination of the Qp genome recently completed in our laboratory. According to this work, fragment S-3 originates from nucleotide positions 1248 to 1347 from the 5’ end (M. Billeter, personal communication). The origin of the M-site fragments was first determined by a synchronized pulsechase, in vitro experiment analogous to those described by Hindley et al. (1970) and by Weber et aZ. (1972). Six different samplesof partially 32P-labeled Q/3RNA were prepared in vitro, with labeled portions extending from the 5’ end to approximate distances of: A. 1190; B, 1640; C, 2250; D, 2660; E, 3110; and F, >3200 nucleotides. The six RNA preparations, along with uniformly labeled Q/3RNA as a control, were bound to replicase and the complexes were degraded using the conditions described above for the M-fragment pattern. Autoradiography of the electrophoretic separation of the fragment mixtures revealed that none of the Mfragments of Figure 1 appeared in a labeled form in preparations A, B and C, but all were fully labeled in preparations D, E and F (detailed data given by Meyer, 1978). It was therefore concluded that all the fragments of the M-family originate from a restricted region of the Q/3 genome, the M-site, located approximately between nucleotides 2250 and 2660 from the 5’ end. From the complete nucleotide sequence of the Qfi genome (M. Billeter, personal communication), the M-fragments were located at the following nucleotide positions from the 5’ end: M-5, 2546 to 2605; M-2b, 2638 to 2810; and M-11, 2848 to 2868. Thus, the values obtained by the pulse-chasetechnique are about 10% too low. The difference is probably due to the inaccuracy of the size estimation for the pulse segments: which was obtained from sedimentation rates in a non-denaturing solvent. Figure 3 presents a map of the Q/3genome with the locations of the S and M-site fragments. (b) The replicase-Q/3 different

(i) Analysis by one-dimensional

RNA interaction reaction conditions

under

gel electrophoresis

The finding that the use of two different, arbitrarily selected ionic conditions for the binding and degradation reaction resulted in two completely different sets of

640

0

F.

MEYER,

H.

WEBER

1000 Length

FIG. 3. Map indicated. Map communication).

of the genome of bacteriophage distances are based on sequence

AND

2000 (nucleotides)

C. WEISSMANN

3000

Q,9. The positions of S-site determinations by M. Billeter

4000

and M-site sequences are and co-worker8 (personal

bound [32P]RNA fragments prompted us to test a number of other variations in the reaction conditions. In a first set of experiments, analysis of the fragments was carried out by one-dimensional polyacrylamide gel electrophoresis as described for the isolation of the M and S-fragments (Table 1). Under M and S-conditions, the same results were obtained whether the labeled RNA was intact or not (Table 1, lines 5 and 6). Moreover, omission of competing unlabeled RNA led to only a minor increase in non-specific binding (Table 1, lines 3 and 4). Complex formation at 0°C occurred readily under M-conditions but only very weakly under S-conditions (Table 1, lines 7 and 8; Fig. 4(a) to (d)). On the other hand, addition of polyethylene sulfonate, an inhibitor of initiation by replicase (Kondo & Weissmann, 1972a), before or after complex formation prevented binding in the M mode, but left the Ssite binding relatively unaffected (Table 1, lines 9 and 10). Several experiments showed (Table 1, lines 11, 12, 13 and 15) that the fragment pattern depended on the ionic conditions prevailing during the digestion step rather than on those during complex formation ; i.e. the interaction between RNA and the enzyme appeared to respond rapidly to changes in the ionic environment. Furthermore, if both Mg2+ and higher concentrations of monovalent cations were used (Table 1, lines 13, 14 and 16), patterns showing both S and M fragments in various ratios were obtained. Thus, the buffer commonly used for replicase activity tests (Table 1, line 14) gave a pattern consisting of strong M-bands and a weak but significant band S-3. Another buffer, often used for ribosome binding experiments, resulted in a more even mixture of M and S-fragments, as shown in Figure 4(e) (Table 1, line 16). In the presence of manganese ions, an essentially new band pattern was observed; however, analyses described below suggest that the fragments are derived from the S and M, as well as the 3’ regions. The addition of host factor (Franze de Fernandez et al., 1968), GTP and ATP to the binding mixture did not produce any new bands under either S or M-conditions, although in the latter case initiation was expected to occur involving the 3’ end of the bound template (see below). Finally, binding experiments were carried out with replicase lacking subunit cx(alessreplicase, Kamen et al., 1972). Under the ionic conditions indicated in Table 1, line 15 (previously used by Weber et al., 1972), where normal replicase or the

INTERACTIONS

OF

Q/9 REPLICASE

TABLE

WITH

Qp

641

RNA

1

Types of fragment patterns obtained by using various conditions for the formation and the degradation of replicase-Q/l RNA complexes Expt no.

Conditions of complex formation

Conditions of complex degradation

Type

1 2 3

6 M qL

4

M

5

RNA

8 M 8 ( + some diffuse background) M (+ some diffuse background) s

RNA

M

M

7 8 9 10

S, using 20 S Q/I fragments M, using 20 S Qp fragments s, 0°C M. 0°C S + polyethylene M + polyethylene

S M S, omitting RNA M, omitting RNA S

S M S M

I1 12

M M

(Very weak S) M S Strongly reduced binding, no M bands S (+ weakM) S (+ weakM)

13

M

14

0.012 M-M@&, @Of3 M-TTis . HCI , 0001 M-EDTA 0.012 M-MgCl,, 0.08 M-Tris . HCI, 0001 M-EDTA 0906 M-M&& 012 M-NH&~, 0.06 M-Tris HCl 001 M-MnCi,, other components like M-conditions S + GTP + ATP + host factor M + GTP + ATP + host factor

6

15

16

17

18 19

sulfonate sulfonate

competing competing

8 0.15 M-Kcl, 0.01 M-Tris HCl 0.15 ~-&cl, 0.01 M-MgCi,, 0.01 M-Tris HCI 0.012 M-M@&, @OS M-Tris HCl, 0001 M-EDTA @15M-Nacl, 0.015 M-Na citrate 0906 M-M&I,, 0.12 M-NH&I, 0% M-Tris 001 M-MnCl,, 0.01 M-Tris

of pattern

M+S M (+

weak

S (+

weakM)

S)

M+S HCl New pattern HCl

S

S

M

M

All experiments were carried out as described in Materials and Methods section (b), with the following modifications : expts 3 and 4, no unlabeled Q/I RNA was added to the digestion mixture; expts 5 and 6, slightly fragmented Q,3 [“P]RNA sedimenting at approx. 20 S (instead of 30 S for intact Qfl RNA) was used; expts 9 and 10, polyethylene sulfonate (50 pg/ml) was added to the binding mixtures, either before or after the addition of Qfi [“P]RNA; expts 18 and 19, GTP and ATP (each 0.4 mM) and host factor HF (100 units/ml) were added to the binding mixture. The composition of S, M and I-buffer is given in Materials and Methods. Tris . HCI was always at pH 7.5.

642

F. MEYER,

H.

WEBER

AND

C. WEISSMANN

S-3a t. s-3 -

-S-6

S-6 -

-M-l1 -BPB

M-ll_----_

BPB-

(a)

(b)

(cl

Id)

(e)

FIG. 4. Electrophoretic analysis of [32P]RNA fragments obtained using several of the conditions the formation and the degradation of replicas+&/3 RNA complexes listed in Table 1. The experiments were carried nut as described in Materials and Methods, with modifications as indicated in Table (a) S-conditions (Table 1, expt 1) ; (b) S-conditions, formation of complex at 0°C (Table 1, expt 7) ; (c) conditions (Table 1, expt 2); (d) M-conditions, formation of complex at 0°C (Table 1, expt 8); ribosome binding buffer: 60 mw-Tris HCl (pH 75), 6 mM-MgCl,, O-12 M-NH&I (Table 1. expt 16).

for 1. M(e)

enzyme reconstituted from n-less replicase and purified cy yielded a band pattern consisting mostly of S-fragments (Fig. 5(a) and (b)), a-less replicase retained only a small amount of RNA which, after RNAase T, digestion, gave no resolvable fragments (Fig. 5(c)). Completely analogous results were obtained when Mconditions were used for binding and degradation (Fig. 5(d) to (f): subunit OL appeared to be essential for binding in the M mode as well. Under our experimental conditions, subunit a by itself did not bind Q/3 RNA to membrane filters, at least not in M-buffer (R. Kamen, data not shown; see Discussion for results of Senear & Steitz (1976) and Goelz & Steitz (1977)). (ii) Analysis complete

of replicase-bound degradation with

[32P]RNA fragments by RNAase T, and jingerprinting

An unexpected aspect of the results presented so far was the failure to find fragments from the 3’ end of Qj3 RNA among those bound to replicase. Since RNA synthesis is initiated at the 3’ end of the template chain (at the penultimate

INTERACTIONS

OF

&Is

REPLICASE

WITH

Qp

RNA

O-

s-3 -

s-4;:

S-6 -

BPB(0)

lb)

(c)

(d)

(e)

(f)

FIG. 5. Electrophoretic analysis of Q/l [32P]RNA fragments obtained by RNAase T, digestion of binding complexes using replicase lacking the a-subunit. The experiments were carried out as described in Materials and Methods and in the legend to Table 1. For experiments (a) to (c), ionic conditions were as indicated in Table 1, expt 15. M-conditions were used in experiments (d) to (f). (a) and (d) Normal replicase (2.2 pg) and Qfi [32P]RNA (35 pg) in @l ml of binding buffer were used to form the binding complex. (b) and (e) As for (a), but a mixture of replicase lacking the a-subunit (2% rg) and Sl protein (2 rg) was used instead of replicase. (c) and (f) As for (b), but Sl protein was omitted.

nucleotide; Rensing & August, 1969; Weber & Weissmann, 1970), this terminus has obviously to interact with replicase at some time before or during initiation of synthesis. However, even under conditions allowing initiation (Table 1, line 19), no specific RNA fragment was observed that originated from the 3’ end. To clarify whether this failure was due to the limited resolution of the one-dimensional electrophoretic analysis or to a real absence of material from the 3’ region, further binding and digestion experiments were carried out as before, but the mixture of [32P]RNA fragments extracted from the filters was now digested completely by RNAase T, and the products were separated by two-dimensional polyacrylamide electrophoresis as described by DeWachter & Fiers (1972). Characteristic large RNAase T, oligonucleotides of known sequence and location (Billeter, 1978) from most regions of the Q/3 genome can be resolved by this method, which therefore allows the quantitation of a particular sequence even if it occurs as a minor component or in polydisperse form. Thus, oligonucleotide T4a provides a sensitive marker for the presence of S-site fragments, Tll for fragment M-2 and TlOa for M-5 (oligonucleotide numbers are as used by Billeter (1978)). Binding at the 3’ end is

F. MEYER,

644

H.

WEBER

Approx. 0 r ,

I I

2 I

3 I

mop

AND

C. WEISSMANN

pos~imn

(IO+

bases)

4 T:

5(o) 50

-

a

FIG. 6. Histograms of the relative molar yields of RNAase T, oligonucleotides from replicase-bound [‘*P]RNA fragments, plotted against the approximate map positions. The procedures used in these experiments are described in Materials and Methods and in the text. In experiments (a) to (e), binding complexes were formed using 92 rg of Qp [3ZP]RNA and 45 rg of replicase in 61 ml of binding buffer. (a) S-conditions; (b) M-conditions; (c) I-conditions; (d) I-conditions in the presenoe of host factor HF (100 units/ml) ; (e) I-conditions in the presence of host factor HF (100 units/ml) and GTP (64 mM) ; (f) Iconditions in the presence of host factor HF and GTP (empty columns) and polyethylene sulfonate (filled columns; both filled and empty columns were plotted from the zero line, not additively). Mixtures (40 ~1) containing I-buffer, 22 pg of replicase and (in 1 of the 2 tubes) polyethylene sulfonate (120 &ml) were preincubated for 30 min at 37°C. I-buffer (10 ~1) containing Qp [“P]RNA (5.2 pg), host factor HF (5 units) and GTP (4-8 mM) was added and the incubation continued for 20 s. Further treatment of the samples was as described above. (g) Binding in the presence of Mn a’. Binding complexes were made by incubating Qp[“‘P]RNA (46pg) and repliosse (225pg) in 0.5 ml of a solution containing SOrnMTris.HCl (pH 75), 8 mM-MnCl,, 2 mre-dithiothreitol, 0.2 mg of bovine serum albumin/ml for 8 min at 37°C. Dilution and RNAase T, degradation was as described for M-conditions (see Materials and Methods), except that 80 mnl-Tris’ HCl (pH 7.5), 8 mM-MnCl, was used as buffer. (h) As for (g), except that GTP (64 mM) was added to the binding mixture.

monitored by recovery from replicase complexes of the 3’-terminal oligonucleotide T18, and oligonucleotides Tl and T5 derive from a region close by. In the histograms presented in Figure 6, the relative molar yields of the resolved T, oligonucleotides were plotted against their position on the Q/l genome, for several conditions of complex formation and degradation. For S and M-conditions (Fig. 6(a) and (b)), th e results essentially confirmed the previous findings : the only oligonucleotides appearing with significant intensity under S-conditions were those contained in the S-fragment sequences. Under M-conditions, TlOa and Tll were obtained in high yield, as expected ; in addition, three unidentified spots as well as a small amount of T4a were also found. Significantly, neither under S nor under M-

INTERACTIONS

OF

Q/3 REPLICASE

WITH

Qf3 RNA

645

conditions could more than trace amounts of the 3’-terminal markers T18 and Tl be detected. The same was true for the ionic conditions routinely used in replicate activity assays (80 mM-Tris.HCl (pH 7*5), 12 m&r-MgCl,, 1 mM-EDTA; Iconditions), which gave a pattern very similar to the M-pattern (Fig. 6(c)). If, however, the complex under I-conditions was supplemented with host factor and GTP, allowing RNA synthesis to initiate, significant amounts of T18 and Tl were observed (Fig. 6(e)), whereas the single addition of either GTP (not shown) or host factor (Fig. 6(d)) alone resulted in the appearance of only traces of these spots. Thus, binding at the 3’ end of Q/l RNA by replicase could be demonstrated in this assay only under conditions allowing RNA synthesis, indicating that in the uninitiated binding complex, the interaction of replicate with the 3’ end, if it occurs at all, must be much weaker than with the S and M-regions of the RNA. It has not been determined whether initiation of RNA synthesis is required for binding of the 3’ terminus, or whether the simultaneous presence of HF, GTP and replicase suffices ; this could be examined using non-cleavable GTP analogs. Figure 6(f) demonstrates the effect of polyethylene sulfonate on the formation of initiated complexes. Incubations similar to that in the experiment shown in Figure 6(e) were carried out (however, the time allowed for initiation to take place was limited to 20 s). The control incubation done in the absence of polyethylene sulfonate (empty columns) gave a pattern similar to Figure 6(e), containing oligonucleotide spots from the S-site, the M-site and the 3’ end. If, however, the enzyme was preincubated with polyethylene sulfonate before the addition of Qj3 [32P]RNA, GTP and host factor (filled columns), the 3’-terminal and the M-site oligonucleotides disappeared almost completely, but the S-site oligonucleotide T-4a was enhanced. Similar results (not shown) were obtained if polyethylene sulfonate was added after the initiation period, except that under these conditions the 3’.terminal oligonucleotides were still present. These findings agree with those of Table 1 (lines 9 and lo), and suggest that polyethylene sulfonate stabilizes the S-interaction and destabilizes the M-interaction, both on initiated and on non-initiated complexes. As shown previously (Palmenberg & Kaesberg, 1974), manganese facilitates the initiation of RNA synthesis such that (1) the activity of replicase is extended to other RNA templates and (2) the initiation of synthesis on Q/3 plus strands no longer requires the presence of host factor. With manganese in the reaction mixture (Fig. 6(g)), the same oligonucleotides were observed after degradation as when M or l-conditions were used, but their yields were generally much enhanced and their relative proportions changed. Addition of GTP to such a reaction mixture (Fig. 6(h)), increased the yield of oligonucleotide T18 fivefold. (c) Spec@city

of replicase binding to RNAase Q/3 [32P]RNA

T,-digested

It was of interest to investigate whether the affinity of replicase to defined regions on Q/l RNA was due to specific nucleotide sequences within those regions or whether the essential feature was the occurrence (or absence of) some secondary or tertiary structure. Qfi [32P]RNA was degraded to completion by RNAase T, and

646

F.

MEYER,

H.

WEBER

Approx. 0

map

I

6

2 4A15

AND positlon

C. WEISSMANN (iOm3

2

bases) 3

12

IIIOA

4

21 I7

5

I I6

FIG. 7. Histograms of the relative molar yields of oligonucleotides obtained by binding replicase to Q,¶ [“P]RNA degraded totally by RNAase T,. Q/3 [32P]RNA (26Opg) was treated with RNAase T, (160 units) in 20 mn-Tris. HCl (pH 7.5), 2 mM-EDTA (25 ~1) for 30 min at 37°C. The mixture was diluted and extracted with phenol 3 times. The oligonucleotides were recovered from the aqueous phase by precipitation with ethanol. (a) [32P]oligonucleotide mixture (10 yg) and replicate (9 pg) were incubated in I-buffer (50 ~1) for 5 min at 37°C. The mixture was filtered through Millipore filters pretreated with a solution of 95 mg yeast carrier RNA/ml in I-buffer (without dithiothreitol or albumin). Filters were washed 3 times with 1 ml of I-buffer (without dithiothreitol or albumin). Extraction of the filters and 2dimensional gel electrophoresis are described in Materials and Methods. (b) As for (a) but in the presence of host factor HF (10 units). (c) As for (b), but in the presence of 94 mM-GTP.

the resulting oligonucleotide mixture was incubated with replicase using various ionic conditions, as in the previous experiments. Binding was detected by filtration of the mixtures through nitrocellulose filters, extraction and two-dimensional gel electrophoresis as before. The results obtained using I-conditions are presented in Figure 7(a); essentially identical patterns were obtained using S or M-conditions (Meyer, 1978). Strikingly, the oligonucleotides with high affinity to the enzyme all originate from the same RNA regions that were previously implicated in replicase binding: the S-site (T4a), the M-site (TlOa, Tll) and the 3’-terminal region (Tl, T5, small amounts of T18). In the presence ofhost factor and GTP (Fig. 7(b) and (c)) no significant change was observed except for the strong appearance of spot T17, which had been shown before to have a high affinity to host factor (Senear & Steitz, 1976). It was also present, albeit in smaller amounts, in the previous experiments with intact Q/3 [32P]RNA and host factor (see Fig. 6(e) and (f)). We conclude that the interaction of specific regions of Qfl RNA with replicase is due, at least in part, to the affinity of the enzyme to certain short nucleotide sequences. This intrinsic affinity is not sensitive to changes in the ionic environment. The observed changes in binding patterns of high molecular weight Q/3 RNA under

INTERACTIONS

different ionic conditions and tertiary structure.

OF

must

(d) Binding

Qp

therefore

of the

REPLICASE

reflect

isolated

WITH

molecular

fragments

Qfi

RNA

transitions

M-2

647

in secondary

and

S-3 to replicase (i) Binding

competition

experiments

In view of the findings described above, it seemed likely that the M and Sfragments characterized previously would also bind specifically to replicase. The fragments occurring in highest yields, S-3 and the mixture of M-2a and M-2b (M2(a/b) for short) were prepared both in 32P-labeled and in unlabeled form for binding competition studies. Randomly fragmented, 32P-labeled and unlabeled Q/3 RNA of the same approximate size as M-S(a/b) and S-3 (about 170 and 100 nucleotides, respectively) were also prepared for use in control experiments and as competing RNA. Figure 8(a) shows that if 32P-labeled RNA fragments M-2(a/b) were mixed with an equimolar amount of unlabeled, randomly fragmented Q/3 RNA of the same size under M-conditions, the bound radioactivity was diminished by only 15%, and even with 40.fold molar excess unlabeled RNA, the reduction was at most 50% (it should be borne in mind that the randomly fragmented Q/I RNA also contains about 4 mol “/b of the sequence corresponding to the M-site). In a control experiment using 32P-labeled random Q/3 RNA fragments, at the same ratios of unlabeled to labeled fragments as used above, 5O”/b and 93% competition were found, respectively. Similarly, under S-conditions (Fig. 8(b)), 32P-labeled RNA fragment S-3 was competed to only about 5% at equimolar amounts and to about 200/, at a 3%fold molar excess of unlabeled RNA fragments. Again, 32Plabeled random QjI fragments were efficiently competed by their unlabeled counterparts : at a 3%fold molar excess the competition was 84%. However, in the presence of equimolar amounts of unlabeled fragments, the reduction of radioactivity was only 25O/b instead of the 500/b expected. The reason for the nonideal isotopic dilution behavior in the control assay under S-conditions is not clear. Nevertheless, the results of these binding experiments show unambiguously that fragments M-S(a/b) and S-3 interact preferentially with the enzyme. A further question was whether the fragments from the two sites bind to replicase independently or whether they compete with each other for the binding site(s) on the enzyme. Binding experiments were therefore carried out in which labeled fragment M-2(a/b) was bound to replicase in the presence of increasing amounts of unlabeled fragment S-3 and vice versa. In order to eliminate non-specific binding and competition effects, these assays were done in the presence of an excess of unlabeled yeast carrier RNA. The amount of labeled fragments needed to reach saturation in binding to a given amount of enzyme (about 66 mol/mol enzyme) was determined in preliminary experiments. The results of the competition assays are presented in Figure 9. They show that competition of 32P-labeled M-S(a/b) by unlabeled S-3 was about equally efficient as by unlabeled M-2 (Fig. 9(a)). In the converse reaction, labeled M-2 was almost (but not quite) as effective in diluting 32P-labeled S-3 out of the complex as was unlabeled S-3. In both cases, control

648

F.

MEYER,

H.

WEBER

AND

C. WEISSMANN

I

40

20 Unlabeled 32P-labeled

fragment fragment

(molar

ratio)

FIG. 8. Binding of replicase to binding site fragments M-Z(a/b) and S-3 in the presence of competing random fragments. (a) Binding to 3*P-labeled fragment M-2(a/b) in the presence of unlabeled random Qp RNA fragments of similar size (in M-buffer). Binding mixtures (7 ~1) contained M-buffer, “P-labeled fragment M-$(a/b) or 32P-labeled random Q,¶ RNA fragments of similar size (26 pmol/ml, spec. act. 7.7 x lo4 eta min-’ pmol-‘), replicase (167 pmol/ml), and unlabeled random Q,9 RNA fragments (of similar size) as indicated. After 10 min incubation at 37”C, the mixtures were diluted with @2 ml of Mbuffer (lacking dithiothreitol or albumin) and filtered through Millipore filters. Filters were washed 3 times with 1 ml of buffer, dried and the bound radioactivity was determined by scintillation counting. In the absence of competing fragments, 0% pmol of “P-labeled M-B(a/b) and @06 pmol of 32P-labeled random fragments were bound per pmol of enzyme (lOOo/, values). (m) Binding to [32P]M-2(a/%); (@) binding to ‘P-labeled random fragments. (b) Binding to “P-labeled fragment S-3 in the presence of unlabeled random Qp RNA fragments of similar size (in S-buffer). Experiment exactly analogous to (a), but using S-buffer, 32P-labeled fragment S-3 or “P-labeled random Qfi RNA fragments of similar size pmol - I) and unlabeled Q/l RNA fragments of similar size as (43 pmol/ml; spec. act. 4% x lo4 cts min-’ indicated. 100% values were, for [32P]S-3, 096 pmol/pmol replicase, for “P-labeled random fragments, 09.5 pmol/pmol replicase. (m) Binding of [32P]S-3; (0) binding of 32P-labeled random fragments. Radioactivity bound in the absence of replicase (1.0 to 15%) was subtracted from each point.

showed that random ribosomal RNA or Q,B RNA fragments competed less, poly(rC) slightly more and poly(rU) much more efficiently than the specific fragments. These results argue that the binding of the M and S-fragment to replicase is mutually exclusive, perhaps due to competition between the fragments for the same binding site(s). Unfortunately, since the efficiency of binding of the fragments to the enzyme was quite low (in different assays only 2 to 20% of the

experiments

INTERACTIONS

= ;e 8

OF

1

I I

5

REPLICASE

WITH

I

3

2

Unlabeled 32p-labelad

8

a 4

Qfi

froqmeni

4

Qp

RNA

649

5

(molar

ratio)

100 ‘. ‘\ ‘O._ --__

-.

‘o-e-

---

--

co

\ \ \

--/ \\\;X \ =.n if+--

1

\

j&----------------x I

2

3

4

5

FIG. 9. Replicase binding to 3ZP-labeled fragment M-2(a/b) or S-3 in the presence of unlabeled fragments S-3, M-$(a/b) and other polynucleotides. mixtures (10 ~1) contained I-buffer, yeast Bindi 92[ P]M-2(a/b) carrier RNA (lOpg/ml), replicase (lOOpmol/ml), ((a) 38 pmol/ml, spec. act. 66 x lo4 cts min-’ pmol-i), or [32P]S-3 ((b) 60 pmol/ml, spec. act. 2 x IO4 cts min-’ pmol-i). Incubation and determination of bound radioactivity was as described in the legend to Fig. 8. The 100% values correspond to 902 pmol of [32P]M-2(a/b) and 91 pmol of [32P]S-3 per pmol of replicase. Backgrounds (92 to 937” of the radioactivity added) were subtracted. Unlabeled RNA fragments used as competitors were as follows : (m) M-2(+) ; (A) S-3 ; random Qfl RNA fragments of a size similar to (-a-+-) M-2 or (-O-O-) S-3; E. coli ribosomal RNA fragments of a size similar to (--m---e---) M-2 or (--O---O--) S-3, (-x-x-) poly(rC) and ( - - x - - - x - - ) poly(rU) both of a size of about 130 nucleotides.

enzyme molecules bound a 32P-labeled fragmen t at saturation), it was not possible to determine the absolute number of RNA fragments bound per enzyme molecule by such binding experiments. In this context it should be considered that only about 100/b of the enzyme molecules in our replicase preparations were capable of initiating on Qp RNA (M. Billeter, personal communication).

650

F. MEYER,

H.

WEBER

AND

C. WEISSMANN

IOC

50

100 fL ; 8 -6 8 z) 5 2 a 2

50

Cc)

100

50

L -

OP

IO

5

Fragment

(molar

ratio)

RNA

FIG. 10. Inhibition of initiation of Q6 RNA-directed RNA synthesis by replicate in the presence of fragments M-P(a/b) and S-3 or other polynucleotides. Mixtures (14 ~1) containing 80 mM-Tris.HCI 1 mM-EDTA, 1 unit of replicase (spec. act. 15OOunim/mg) and increasing (pH 75), 12 mM-MgCl,, amounts of unlabeled fragments M-B(a/b), S-3 or other polynucleotides were preincubated for 3 min at 37°C. Synthesis was initiated by adding a solution (10 ~1) of 80 mna-Tris’ HCI (pH 7.5) 12 mM-MgCl,, 1 mM-EDTA, 916 mM-[a-32P]ATP (spec. act. 3 x 10’ cts min-’ nmol-I), 1 mM-GTP, host factor HF (1 unit) and Qfi RNA (0.8 pg; 0.5 pmol), previously warmed to 37°C. After 20 s at 37”C, further initiation was blocked and elongation was started by addition of a solution (1 ~1) of 25 mmr-CTP, 2.5 m&r-DTP and 1.25 mg polyethylene sulfonate/ml. Incubation was continued for 5 mm and the amount of RNA synthesized was determined by measuring the acid-precipitable radioactivity. The radioactivity incorporated in the absence of inhibitors corresponded to 903 nmol of [“*PIAMP (looO/, value). A background value of 1.9%, obtained in the absence of template Q6 RNA, was subtracted from each

INTERACTIONS

(ii) Inhibition

of initiation

OF

of RNA

Q/l

REPLICASE

synthesis

WITH

by fragments

Qfl

M-2

RNA

651

and S-3

If the binding of fragments M-2 and S-3 to replicase occurs at the same enzyme site(s) that are involved in M and S-site binding in the intact Q/3 RNA-replicase complex, one could expect a specific inhibition of initiation of RNA synthesis by prebinding these fragments to the enzyme. In order to demonstrate such an inhibition, account had to be taken of the fact that’ prebound fragments are displaced rapidly by full-size Q/l RNA, with a half-time of six to eight seconds (Meyer, 1978). Therefore, the initial rate of initiation of RNA synthesis had to be determined at very short time-points. For this purpose, a procedure described by Schwyzer (1973) was used, which measures the kinetics of formation of an initiation complex in the presence of GTP and ATP. Further initiation is then inhibited by the addition of polyethylene sulfonate (Kondo & Weissmann, 1972a) and elongation is allowed to proceed by the addition of CTP and UTP. Thus the amount of initiation that has taken place in the presence of GTP and ATP can be measured very accurately, since every initiation event results, in the elongation phase, in the synthesis of a full-size Q@ minus strand. In the present experiment, the RNA fragments M-2(a/b) and S-3 were first bound to Q/3 replicase and then initiation was allowed to occur for a very short period of time (20 s) in the presence of GTP and [a32P]ATP. Completion of the initiated chains was achieved by addition of the two missing ribonucleoside triphosphates (CTP and UTP) in the presence of polyethylene sulfonate. The results are shown in Figure 10. It can be seen that both fragment M-2(a/b) (Fig. 10(a)) and S-3 (Fig. 10(b)) inhibit the initiation of replication : when present in amounts equimolar with Q/3 RNA, inhibition is about 409/A and SOY&, respectively. Q/3 RNA fragmented to an average size of 170 and 100 nucleotides in length causes a three to four times smaller inhibition than fragment M-B(a/b) and S-3, respectively. This inhibition is probably due to the presence of Msite and S-site sequences among the random Q,9 fragments. E. coli ribosomal RNA fragmented to the same size as M-2(a/b) or S-3 does not show any effect. Earlier studies had shown that synthetic polynucleotides such as poly(rU): poly(rC) and, to a lesser extent, poly(rA) are strong inhibitors of both the plus strand and the minus strand-directed synthesis (Kondo & Weissmann, 19726). Poly(rU) and poly(rC) fragmented to an average size of about 130 nucleotides showed also a strong inhibitory effect on initiation (see Fig. 8(c)). It should be noted that all these different RNA fragments were isolated in parallel and from the same polyacrylamide gel in order to get) RNA preparations of similar size and the same degree of purity. The inhibitory effect of these RNA fragments is thus not due to different amounts of extraneous substances present in the preparations. This claim is further supported by the finding that an extract of a gel piece, devoid of RNA, did not affect the reaction (data not shown).

point. For the calculation of the molar ratios plotted on the abscissa, the following molecular weights were used: Qfi RNA, 1.5 x 106; M-2(a/b), 60,000; S-3, 35,000; poly(rU) and poly(rC), 43,000. The following RNA fragments were used as inhibitors : (a) M-B(a/b) ( n ) ; random Q,4 RNA fragments (A) ; and random ribosomal RNA fragments (a) of similar size. (b) S-3 (0); random Q/3 RNA fragments (A); and random ribosomal RNA fragments (0) of similar size. (c) Poly(rU) (0) and poly(rC) (a), both of a size of about 130 nucleotides.

652

F.

MEYER,

H.

WEBER

AND

C. WEISSMANN

It was also of interest to know whether the fragments M-2(a/b) and S-3 would interfere with the poly(rC)-directed synthesis. If these fragments inhibit initiation by binding to the enzyme site or sites involved in substrate binding and/or the condensation reaction, one would expect them to inhibit the poly(rC)-directed synthesis as well. However, if their binding occurs at another site on the enzyme that does not interfere with chain initiation and elongation per se, one might expect the fragments not to show any effect on the poly(rC)-directed synthesis. TABLE

2

Effect of fragments M-2(aJb), S-3 and other polynucleotides on poly(rC)-directed poly(rG) synthesis by replicase Molar ratio fragment/poly(rC)

Fragment

-

None M-2(a/b) s-3 Random

Q/7 (170)

Random

Qj3 (100)

Poly(rU) Random

rRNA

(170)

Random

rRNA

(100)

2.5 5 4 8 2.5 5 4 8 3 6 2.5 5 4 8

[3H]GMP (pm4 28.1 24.1 251 21.6 206 22.1 24.6 35.6 21.6 0.0 0.0 22.6 22.1 246 20.1

incorporated (%) 100 86 89 77 73 79 88 127 75 0 0 80 79 88 72

Mixtures (15 ~1) containing 80 mar-Tris.HCl (pH 75), 12mM-MgCl,, 1 mM-EDTA, 05units of replicate (spec. act. 1500 units/mg) and RNA fragments as indicated (length in nucleotides given in parentheses) were preincubated for 3 min at 37°C. Poly(rC)-directed synthesis wa8 started by adding a solution (10 ~1) of 80 mhi-Tris.HCl (pH 75), 12 mM-M&l,, 1 mM-EDTA, 3OOrg of poly(rC)/ml and 668 mM-[“HIGTP (spec. act. 6.4 x 10’ cm min-’ nmol-’ ) previously warmed to 37°C. Incubation was continued for 2 min at 37°C and the amount of synthesis was determined by measuring the acidprecipitable radioactivity. A background of 64 pmol, measured in the absence of replicase, was subtracted from all values.

The various fragments were incubated with Q/3 replicase without substrates and poly(rC) was added subsequently to allow synthesis to occur for two minutes in the presence of [3H]GTP. At a molar ratio of fragment to template of 5 (for M-Ba/b) or 8 (for S-3), at which Qj3 RNA-directed synthesis was inhibited to 80% (M-2a/b) or 96% (S-3), the poly(rC)-directed synthesis was reduced only 117; and 27%, respectively (Table 2). However, poly(rU) inhibited the reaction completely. From these results it can be concluded that, in order to form a productive initiation complex, QB RNA must bind to a site on the enzyme from which it can be excluded specifically by the RNA fragments M-2(a/b) and S-3, whereas poly(rC) can act without binding in a similar fashion.

INTERACTIONS

(e) Binding

OF

Qp

REPLICASE

of MS2

RNA

WITH

Qfi

RNA

653

to Q/3 replicuse

In RNAase T, degradation experiments similar to those described for the homologous complexes, the interaction between MS2 RNA and Qp replicase was investigated. Under S-conditions a relatively simple fragment pattern was obtained, whose main component was a 43-nucleotide fragment (nucleotides 1708 to 1750 from the 5’ end) containing the termination site of the coat cistron (H. J. Vollenweider, H. Weber & W. Fiers, unpublished results). The sequence shows no recognizable similarity to either an S-site or M-site Qj3 RNA sequence.However, it is identical (except for one basechange) to the 5’-terminal43 nucleotides of the coat protein-binding R17 RNA fragment (59 nucleotides) observed by Bernardi & Spahr (1972). A very complex pattern was observed when the experiment was done under M-conditions. While the outcome of this experiment does not allow any conclusions regarding the structural features recognized by replicase, it clearly shows that even a heterologous RNA without template activity contains internal regions that are bound highly preferentially by Q/3 replicase. 4. Discussion (a) Template

speei$city

of phage replicases

RNA phage replicasesare the only enzyme systems known that allow the specific and accurate replication of a viral genome in vitro (Haruna & Spiegelman, 1965). All three replicases studied so far, the Q/I, f2 and SP enzymes, have a similar foursubunit structure, consisting of one phage-specific subunit p and three subunits, CX, y and 6, supplied by the host cell (Kondo et al., 1970; Kamen, 1970; Blumenthal et al., 1972; Wahba et al., 1974; Federoff, 1975; Mori et al., 1978). In the case of the Q,3 enzyme, an additional host protein, called host factor (HF) is required for the synthesis of a complementary (minus) strand from a Q/3RNA template (Franze de Fernandez et al., 1968), but not for the opposite process. Q/l replicase shows a high selectivity with respect to the RNAs it will replicate (“replication templates”). These include Q/l RNA (plus and minus strand) as well as a number of smaller “variant RNAs” or “6 S RNAs” (Banerjee et al., 1969), which arise in &p-infected cells and in incubations in the absence of added template. On the other hand, replicase can synthesize a complementary strand (and no more) on a large variety of polynucleotides (“copy templates”), comprising poly(rC) (Hori et al., 1967; Eikhom & Spiegelman, 1967), polynucleotides containing terminal oligo(rC) blocks (Feix & Sano, 1975; Kiippers & Sumper, 1975), and even statistical copolymers rich in cytidylic acid residues (Hori et al., 1967). These synthetic polynucleotides are copied but not replicated, most likely because the complementary product strand does not have template activity and/or becausethe product is double-stranded. No template activity was observed for ribosomal RNA, tRNA or heterologous viral RNAs with any of the replicases tested (with the exception of the RNAs of the very related phages Q/I, SP and FI; Miyake et al.? 1971). Attempts have been made to attribute template recognition to the 3’-terminal sequenceof the RNA. Figure 11 illustrates, however, that the only feature common

22

654

F. MEYER, Template

H.

WEBER

AND

C. WEISSMANN

RNAs

,,GGGGGAUC~JGC~J~J~JGCCCUCUCUCCUCCCA~H(+) ,.GUGAGGUGACCCCCUAAAGGGGGGUCCCCAOH (-) , .GACACACCCGGAUCUAGCCGGGUCAACCCAOH (+I ,.CCCCGUUAUCCUGGUAACAGGAUUUCCCCAOH (-1 . .CGCGAGGUGACCCCCGAAGGGGGGUUCCCCOH (+) ,,GCACCUCGUCCCCCCUUCCGGGGGGUCCCCOH (-) ~.CCAAAGCUUUUAAAGCUGAGGUUUUAACCCOH (+) ,.UCGCGCUGCACUCCACGUGCGCCAACUCCCOH (-)

ae

WSI

MDV-

I

Microvariant

Poly(rC)

Non-template

RNAs

..GUAACUAGCUGCUUGGCUAGUUACCACCCAOH (+) ..UGAGCAGGACCCCGAAAGGGGUCCCACCCAOH (-1

MS2

, .CCGCCCCUCUUCCGAGGGUCAUCGGAACC(A)oH

TYIW

. .CGAAUCCCCCGUUACCCCGGUAGGGGCCCAOH

TMV

.,AGGGG:CCUGCGGUUGGAUCACCUCCUUAOH

16 S rRNA

FIG. 11.3’.Terminal sequences of various RNAs with or without template activity for Q@ replicase. Q/3 RNA, Weissmann et al. (1973); nanovariant (WSI) RNA, Schaffner el aE. (1977); midivariant (MDV-I) RNA, Mills et al. (1973) ; microvariant RNA, Mills et al. (1975) ; MS2 RNA, Fiers (1975); tobacco mosaic virus RNA (TMV RNA), Guilley et al. (1975); turnip yellow mosaic virus RNA (TYMV RNA), Briand et al. (1977); E. coli 16 S ribosomal RNA (16s rRNA), Ehresmann et al. (1975). An asterisk indicates a methylated base. Hyphens have been omitted for clarity.

to all RNAs active as templates with Q/3 replicase is a cluster of cytidylic acid residues near the 3’ end ; this feature is found also on various non-template RNAs (e.g. MS2 or TMV RNA). This seems to suggest that the C-cluster may well be a necessary, but not a sufficient determinant for template recognition. The proposal by Kiippers & Sumper (1975), that two C-clusters in a defined spatial relationship close to the 3’ end constitute the recognition site, is not supported by the sequences of the Qj3 plus strand and of several active variant RNAs (Schaffner et al., 1977 ; Mills et al., 1975). The template specificity of Qp replicase can be overcome by a number of methods. The presence of Mn ‘+ (Palmenberg & Kaesberg, 1974), glycerol, and a high concentration of GTP (Blumenthal, 1980) has been shown to relax the discrimination of heterologous templates. Non-template RNAs could be converted into copy templates by the covalent addition of polycytidylic acid tails (Feix & Sano, 1975). In addition, all specificity can apparently be abolished by the use of a

INTERACTIONS

primer oligonucleotide bypassing the initiation

OF

Q/3 REPLICASE

WITH

capable of base-pairing with step (Feix & Hake, 1975).

(b) Interaction

of Qp replicase

the

Qfi

655

RNA

template

RNA,

thus

with Q/3 RNA

Preliminary experiments showed that no interaction between Qfl replicase and the 3’ end of Q/3 RNA could be detected, but that strong binding to internal regions occurred. To study the involvement of internal sites in the recognition of Q,9 RNA by replicase, the sites of interaction between RNA and enzyme were investigated in binding complexes. The formation of such complexes had first been demonstrated by August et al. (1968), using a filter binding technique; under competitive conditions the binding of Q/3 RNA to Q/l replicase was found to be about ten times stronger than the binding of various heterologous RNAs. In the present work, binding complexes containing 32P-labeled Qj3 RNA were mildly digested with ribonuclease T, under a variety of conditions. Replicase-bound RNA fragments of various sizes were recovered by filter binding, eluted and characterized. Two internal regions of Qfi RNA were found to be involved in the binding process. Interaction at the S-site was favored by moderate concentrations of salt and did at the M-site required Mg2+, but not NaCl. The Snot require Mg 2+ : interaction site is located at nucleotides 1248 to 1347 from the 5’ end (fragment S-3). It overlaps with the ribosome binding site at the coat protein cistron (Weber et al., 1972) and is thought to be involved in the translational control of coat protein synthesis by replicase (Kolakofsky & Weissmann, 1971a,b). On the other hand, the M-site corresponds to a region of about 320 nucleotides in the 5’ portion of the replicase cistron, 2546 to 2868 nucleotides from the 5’ end. The sequences of M and S-site fragments reveal no homology, complementarity or any other relatedness. Evidence for the binding of the 3’ end of the Q/3 RNA to Q/? replicase was found only in experiments allowing initiation of RNA synthesis. The present findings are in excellent agreement with those of Vollenweider et al. (1976), who mapped Qp replicase binding sites on Q/3 RNA by electron microscopy. Their map locations for the S-site (29.5% +25%) and for the M-site (65% +3.5%) are practically identical to those derived from the fragment isolation and sequencing results: 29*6o/o to 32% for the S-site and 604% to 68o/o for the M-site, using as genome length the value of 4220 nucleotides as determined by sequencing (M. Billeter, personal communication). Moreover, 3’-terminal binding could not be observed by electron microscopy. More recent results (V. Meyer & T. Koller, personal communication) have indicated that spreading under S-conditions results in complexes in which only the S-site is bound by the enzyme. Work by Steitz and co-workers (Senear & Steitz, 1976; Goelz & Steitz, 1977) has demonstrated that the a-subunit of Q/l replicase, i.e. protein Sl, is able to bind to specific sites on Q/3 RNA in the absence of the other subunits. The interactions found were at the S-site and at a region close to, but not including, the 3’ end. An important role for the a-subunit in Q/? RNA replicase binding follows from our finding that replicase lacking a is not able to form binding complexes that yield any specific enzyme-bound RNA fragments on RNAase T, digestion. Subunit n must therefore be involved in the binding of the S-site, in agreement with Goelz & Steitz

656

F.

MEYER,

H.

WEBER

AND

C. WEISSMANN

(1977), and of the M-site, although no direct interaction between protein Sl and the M-site was reported. On the other hand, binding of Sl near the 3’ end seems to be suppressed if Sl is part of the four-subunit replicase complex. Preliminary experiments suggested that, at least under S-conditions, subunits (Yand fi are solely responsible for the observed binding interaction, since a replicase lacking subunits y and 6 (which cannot initiate Q/3 RNA synthesis) produced a fragment pattern indistinguishable from that obtained with the normal enzyme (R. Kamen & H. Weber, unpublished results). Under the conditions used in our experiments, addition of host factor (HF) to the binding mixture containing &/!I RNA and replicase did not result in a significant alteration of the fragment pattern. However, when the mixture of &p-derived T, oligonucleotides was bound to replicase (see below), the presence of HF resulted in strongly increased binding of one specific oligonucleotide, T17. Host factor was previously described to bind to oligonucleotide T17 as well as to the 3’-terminal region of Q/3 RNA (Senear & Steitz, 1976). It may be that these binding sites are partly masked in the intact Qfl RNA-replicase complex. Binding of Q/3 replicase to internal &es was also found for RNAs other than the Q/3 plus strand. Preliminary experiments with Q/I minus strand RNA indicated several internal binding sites (W. Miiller & H. Weber, unpublished results). Both complexes with “nanovariant” RNA (Schaffner et al., 1977) and “midivariant” RNA (Mills et al., 1977) were found to involve binding sites in the interior of the RNA. (c) Binding

of RNA fragments

to Qfl replicase

More information on the nature of the interaction of replicase with the S and Msites was obtained by studying the binding properties of the purified major S and M-site fragments. Assays in which the binding of these specific fragments was tested in competition with random Qp fragments of similar size revealed that replicase has indeed a higher affinity for both the S and the M-site fragments than for any other sequences of similar length occurring in Q/3 RNA. Considerable competition was observed, however, if mixtures of the major S and M-fragments were presented to the enzyme, suggesting that the binding of the two fragments is mutually exclusive, perhaps because they interact, at least in part, with the same binding site(s) on the enzyme. How can these results be reconciled with the findings of Vollenweider et al. (1976), who in their electron microscope study found a large fraction of complexes in the form of loops, with both the S and M-site bound simultaneously to the same enzyme molecule? As pointed out by these authors, the looped structures were observed with complexes stabilized by chemical crosslinking, so that even if there was only a single enzyme site, which, depending on conditions, bound strongly to either the M or the S-site, it would still be possible that the non-bound site (either S or M) was located in close spatial proximity (due to the conformation of the RNA) and thus be crosslinked to the protein. Alternatively, the enzyme could carry two sites involved in M and S-binding. The stability of the complex would be considerably enhanced by the double interaction; binding of the M-site and the S-

INTERACTIONS

OF

Q/3 REPLICASE

WITH

Q/3 RNA

657

site could be simultaneous and specific, due to sequence recognition and due to the steric requirements of the complex. Nonetheless, the isolated M and S-fragments might exhibit competitive binding behavior either because only one of the sites could afford strong enough binding at any one time, or because the two sites were not able to discriminate between M and S-fragments (while preferring them over most other nat’ural RNA sequences). Of the homopolymers tested, poly(rU) competed much more, but poly(rC) barely more efficiently with M and S-fragment binding than the fragments among themselves. Prebinding of both S and M-site fragments to Q/3 replicase efficiently inhibited initiation of minus strand synthesis on a Q/3 RNA template. This inhibition was not observed with other fragments of similar size (e.g. from ribosomal RNA), and it does not occur with poly(rC) as a template. These results argue strongly for a role of the S or the M-site (or both) in the recognition of Q/3 RNA by replicase. The fact that the poly(rG)-synthesizing activity of the enzyme is not blocked at a fragment to poly(C) ratio of 5 to 8 (where fragments are not displaced by poly(C) (Fig. 9)) suggests that the fragments inhibit by occupying specific replicase site(s) essential for productive Qp RNA binding, rather than by blocking the catalytic activity of the enzyme. Poly(rC) inhibited initiation on a Q/3 RNA template with a similar efficiency to the S and M-site fragments, while poly(rU) had a very strong inhibitory effect on both the Q/3 RNA and the poly(rC)-directed reactions. Are both S and M-sites required for recognition of Q/3 RNA as template? Previous evidence suggested that the S-site may not be essential for template activity of Q/I RNA. Kolakofsky & Weissmann (1971a) showed that a 70 S ribosome-Q/3 RNA initiation complex (in which most of the ribosomes are bound at the start of the coat cistron, i.e. the S-site) is used as a template by replicase at a significant rate. Furthermore, according to work carried out by Schwyzer (1973), replicase is able to initiate minus strand synthesis on fragments of Qfl RNA, provided they are at least about half the size of Q/I RNA and contain an intact 3’ terminus. Evidence was provided that such active fragments contained the M-site, but not the S-site. Sabo et al. (1977) isolated a non-infectious variant of Qp RNA after extensive replication of Qfi RNA by replicase in vitro. It was found to have full template activity, despite the fact that it carried an extensive deletion comprising the whole coat/Al cistron, including some of the adjacent sequences and therefore had lost the S-site. The variant also contained an alteration of the 3’ end ; however the M-site was completely conserved. The results suggest that, while the M-site may well have an essential role in template recognition, the S-site most probably has not. The inhibition of initiation by the S-site fragment must then be explained by assuming that the S-fragment prevents both the S-site and the M-site on the Q/3 RNA template from binding, in agreement with the fragment binding competition data. In order to determine whether the specific binding interactions observed were due to recognition of nucleotide sequence rather than secondary or tertiary structure features, binding of replicase to an oligonucleotide mixture, obtained by RNAase T, digestion of Q/3 RNA, was investigated. The results were quite unequivocal. Among the oligonucleotides bound most strongly by replicase were those derived from the S and M-sites. Only a few additional oligonucleotides were

658

F.

MEYER,

H.

WEBER

AND

C. WEISSMANN

found to bind, most prominent among them being 3’-terminal region, which together with oligonucleotide earlier been found to bind to protein Sl (Senear & 1977). The affinity of replicase for the S and M-regions specific binding of RNA fragments from these sites based on a recognition of nucleotide sequences that the oligonucleotide level. (d) A tentative

model for Q/3 RN&replicase

oligonucleotide Tl from the T4a from the S-site had Steitz, 1976; Goelz & Steitz, on Q/l RNA, as well as the is therefore. at least in part; can be demonstrated even at

recognition

In an attempt to incorporate all the different data discussed above, a model emerges that is basically similar to that proposed earlier (Weissmann, 1974); however, it contains some additional details, while leaving some questions unsolved. (1) Like all other polymerases, replicase is assumed to possess a site where the chemical reaction of internucleotide bond formation from nucleoside triphosphates takes place, instructed by the nucleotide sequence of the template RNA. Close to this catalytic site there must be a site where the 3’ end of the template RNA can be bound for initiation to take place. The specificity requirements for the 3’-terminal binding site seem to be fulfilled by the presence of three or more consecutive C residues at or near the 3’ end. This binding may be relatively weak, since it cannot be demonstrated in digestion assays or in the electron microscope. Actually, strong binding may not be advantageous, since the 3’ end of the template has probably to be displaced from this site once the first polymerization steps have taken place. For templates like poly(rC) or other poly- and oligonucleotides containing C-tracts, no further requirement may be necessary, except that they should not have any strong affinity to other parts of the enzyme. The presence of manganese ions, glycerol, or high concentrations of GTP may increase the affinity at this site to a point where any competing interactions (see below) are overridden. (2) Discrimination against heterologous high molecular weight RNAs may be achieved by the presence of one or more enzyme sites possessing a high affinity for certain, probably fairly ubiquitous, RNA structures. These sites are able to discriminate to some degree between different nucleotide sequences, as evidenced by selective oligonucleotide binding. One (or two) evolved such as to bind the S and M-regions of Q/? RNA. However, the binding capacity of these and perhaps further enzyme sites would allow most RNAs to be bound, as illustrated by the results of the MS2 RNA binding experiments. Most RNAs tested have been found to bind to replicase, albeit with lower affinity than Q,5 RNA (August et al., 1968). On the other hand, these heterologous RNAs would then have an extremely low probability of being oriented in such a way on the enzyme that their 3’ end enters the initiation site correctly. Even the Qfi RNA plus strand by itself appears not to achieve this fit directly; a further RNA binding protein, host factor, which is required for initiation, may impart the appropriate conformation to Q/3 RNA. We are grateful for communication

to Dr M. Billeter for nucleoside of results prior to publication.

[a-32P]triphosphates, for discussions and We thank Dr R. Kamen for discussions

INTERACTIONS

OF

QB REPLICASE

WITH

Q,¶ RNA

659

and preliminary experiments. We acknowledge the excellent technical assistance by Katharina Jung and Sylvia Schmidlin. This work was supported by the Schweizerische Nationalfonds and the Kanton Zurich.

REFERENCES August, J. T., Banerjee, A. K., Eoyang, L., Franze de Fernandez, M. T., Hori, K., Kuo, C. H., Rensing, U. & Shapiro, L. (1968). Cold Spring Harbor Symp. &ant. Biol. 33,73~ 81. Banerjee, A. K., Rensing, U. & August, J. T. (1969). J. Mol. Biol. 45, 181-193. Barrell, B. G. (1971). In Procedures in Nucleic Acid Research (Cantoni, G. L. & Davies, D. R., eds), vol. 2, pp. 751-779, Harper & Row, New York. Bernardi, A. & Spahr, P. F. (1972). Proc. Nat. Acad. Sci., U.S.A. 69, 3033-3037. Billeter, M. A. (1978). J. Biol. Chem. 253, 8381-8389. Billeter, M. A., Dahlberg, J. E., Goodman, H. M., Hindley, J. & Weissmann, C. (1969). Cold Spring Harbor Symp. Quant. Biol. 34, 635-646. Blumenthal, T. (1980). Proc. Nat. Acad. Sk., U.S.A. 77, 2601-2605. Blumenthal, T. & Carmichael, G. G. (1979). Annu. Rev. Biochem. 48, 525-548. Blumenthal, T., Landers, T. A. & Weber, K. (1972). Proc. Nat. Acad. Sci., U.S.A. 69, 1313~ 1317. Briand, J. P., Jonard, G., Guilley, H., Richards, K. E. & Hirth, L. (1977). Eur. J. Biochem. 72, 453-463. Coffin, J. M. & Billeter, M. A. (1976). J. Mol. BioZ. 100, 293-318. Contreras, R. & Fiers, W. (1971). FEBS Letters, 16, 281-283. DeWachter, R. & Piers, W. (1972). Anal. Biochem. 49, 184-197. Ehresmann, C., Stiegler, P., Mackie, G. A., Zimmermann, R. A., Ebel, J. P. & Fellner, P. (1975). Nucl. Acids Res. 2, 265-278. Eikhom, T. S. & Spiegelman, S. (1967). Proc. Nat. Acad. Sci., U.S.A. 57, 1833-1840. Escarmis, C.. Sastry, P. A. & Billeter, M. A. (1978). J. Biol. Chem. 253, 8390-8399. Fedoroff, N. (1975). In RNA Phages (Zinder, N. D., ed.), pp. 235-258, Cold Spring Harbor Laboratory Press, New York. Feix, G. & Hake, H. (1975). B&hem. Biophys. Res. Commun. 65, 503309. Feix, G. & Sano, H. (1975). Eur. J. Biochem. 58, 59-64. Fiers, W. (1975). In RNA Phages (Z. m d er, N. D., ed.), pp. 353-396, Cold Spring Harbor Laboratory Press, New York. Franze de Fernandez, M. T., Eoyang, L. & August, J. T. (1968). Nature (London), 219,588590. Goelz, S. & Steitz, J. A. (1977). J. Biol. Chem. 252, 5177-5179. Guilley, H., Jonard, G. & Hirth, L. (1975). Proc. Nat. Acad. Sci., U.S.A. 72, 864-868. Haruna, I. & Spiegelman, S. (1965). Proc. Nat. Acad. Sci., U.S.A. 54, 579-587. Hindley, J. & Staples, D. H. (1969). Nature (London), 224, 964-967. Hindley, J., Staples, D. H., Billeter, M. A. & Weissmann, C. (1970). Proc. Nat. Acud. Sci.. U.S.A. 67, 1180-1187. Hori, K., Eoyang, L., Banerjee, A. K. & August, J. T. (1967). Proc. Nat. Acad. Sci., U.S.A. 57, 179+1797. Kamen, R. (1970). Nature (London), 228, 527-533. Kamen, R. I. (1975). In RNA Phages (Z’ m d er, N. D., ed.), pp. 203-234, Cold Spring Harbor Laboratory Press, New York. Kamen, R., Kondo, M., Riimer, W. & Weissmann, C. (1972). Eur. J. Biochem. 31, 44-51. Kolakofsky, D. & Weissmann, C. (1971a). Nature New Biol. 231, 42-46. Kolakofsky, D. & Weissmann, C. (19716). Biochim. Biophys. Acta, 246, 596-599. Kondo, M. & Weissmann, C. (1972a). Biochim. Biophys. Acta, 259, 41-49. Kondo, M. & Weissmann, C. (19723). Eur. J. Biochem. 24, 530-537. Kondo, M., Gallerani, R. & Weissmann, C. (1970). Nature (London), 228, 525-527.

660

F.

MEYER,

H.

WEBER

AND

C. WEISSMANN

Kiippers, B. & Sumper, M. (1975). Proc. Nut. Acud. Sci., U.S.A. 72, 2640-2643. Maxam, A. M. & Gilbert, W. (1977). Proc. Nat. Acad. Sci., U.S.A. 74, 560-564. Meyer, F. (1978). Ph.D. thesis, University of Zurich. Meyer, F., Weber, H., Vollenweider, H. J. & Weissmann, C. (1975). Experientia, 31, 743. Mills, D. R., Kramer, F. R. & Spiegelman, S. (1973). Science, 180, 916-927. Mills, D. R., Kramer, F. R., Dobkin, C., Nishihara, T. & Spiegelman, S. (1975). Proc. Nat. Acud.

Sci.,

U.S.A.

72, 4252-4256.

Mills, D. R., Nishihara, T., Dobkin, C., Kramer, F. R., Cole, P. E. & Spiegelman, S. (1977). In Nucleic Acid-Protein Recognition (Vogel, H. J., ed.), pp. 533-547, Academic Press, New York. Miyake, T., Haruna, I., Shiba, T., Itoh, Y. H., Yamane, K. & Watanabe, I. (1971). Proc. Nat.

Acad.

Sci.,

U.S.A.

68, 2022-2024.

Mori, H., Fukami, Y. 8: Haruna, I. (1978). J. B&hem. (Japan), 84, 681-686. Palmenberg, A. & Kaesberg, P. (1974). Proc. Nut. Acud. Sci., U.S.A. 71, 1371-1375. Peacock, A. C. & Dingman, C. W. (1968). Biochemistry, 7, 668-674. Rensing, U. & August, J. T. (1969). Nature (London), 224, 853-856. Sabo, D. L., Domingo, E., Brtndle, E. F., Flsvell, R. A. & Weissmann, C. (1977). J. Mol. Biol. 111, 235-252. Sanger, F. & Brownlee, G. G. (1967). In Methods in Enzymology, vol. 12A, pp. 361-381, Academic Press, New York and London. Schaffner, W., Riiegg, K. J. & Weissmann, C. (1977). J. Mol. Biol. 117, 877-907. Schwyzer, M. (1973). Ph.D. thesis, University of Zurich. Senear, A. W. & Steitz, J. A. (1976). J. Biol. Chem. 251, 1902-1912. Taniguchi, T., Palmieri, M. & Weissmann, C. (1978). Nature (London), 274, 223-228. Tinoco, I., Jr, Borer, P. N.. Dengler, B., Levine, M. D., Uhlenbeck, 0. C., Crothers, D. M. & Gralla, J. (1973). Nature New Biol. 246, 40-41. Vollenweider, H. J., Keller, Th., Weber, H. & Weissmann, C. (1976). J. MoZ. Biol. 101, 367377.

Wahba, A. J., Miller, M. J., Niveleau, A., Landers, T. A., Carmichael, G. G., Weber, K., Hawley, D. A. & Slobin, L. I. (1974). J. Biol. Chem. 249, 3314-3316. Weber, H. & Weissmann, C. (1970). J. Mol. Biol. 51, 215-224. Weber, H., Billeter, M. A., Kahane, S., Hindley. J., Porter, A. & Weissmann, C. (1972). Nature New Biol. 237, 166-170. Weber, H., Kamen, R., Meyer, F. & Weissmann, C. (1974). Experientia, 30, 711. Weissmann, C. (1974). FEBS Letter?7 (Suppl.), 40, SlCM18. Weissmann, C., Colthart, L. 8: Libonati, M. (1968). Biochemistry, 7, 865-874. Weissmann, C., Billeter, M. A., Goodman, H. M., Hindley, J. & Weber, H. (1973). Annu. Rev. Biochem.

42, 303-328. Edited

by

S. Rrenner