1. Introduction Plants in their natural environment have to withstand multiple abiotic and biotic stress factors, usually acting in combination. Thus, they evolved unique stress signalling pathways mediated by reactive oxygen species (ROS), phytohormones as well as other signalling molecules to minimize damage simultaneously conserving valuable resources for growth and reproduction (Cabello et al., 2014; Jayakannan et al., 2015a; Verma et al., 2016). Abiotic and biotic stresses in combination influence each other and recent studies have identified many nodes of convergence between ROS and stress-responsive hormonal pathways which could play a pivotal role in regulating plant response to multiple stress (Glombitza et al., 2004; Sewelam et al., 2016). Both salicylic acid (SA) and abscisic acid (ABA) can accumulate in plants under abiotic and biotic stress conditions and similar to ROS, they function as signals in plant responses to stress (Rivas-San Vicente and Plasencia, 2011; Mittler and Blumwald, 2015; Suzuki et al., 2016). ROS, including superoxide anion radical (O2-) and hydrogen peroxide (H2O2), are highly integrated with the hormone network and O2-/H2O2 producing and scavenging enzymes contribute to ABA- and SA-mediated stress signalling (Baxter et al., 2013; Xia et al., 2015). However, complex interactions between ROS, SA and ABA signalling are still debated, especially with respect to combined stress. The most established role of SA in plants is that of a signalling molecule in both local and systemic plant defence mainly against biotrophic and hemibiotrophic pathogens (Rivas-San Vicente and Plasencia, 2011). Arabidopsis sid (salicylic acid induction-deficient) mutants which do not 1

accumulate SA are more susceptible to pathogens (Wildermuth et al., 2001). One of the proposed models of SA action is the inhibition of catalase (CAT), a major H2O2-scavenging enzyme, which results in elevated H2O2 levels (Chen et al., 1993). ROS in turn can activate SA synthesis stimulating the activity of benzoic acid-2-hydroxylase which converts benzoic acid into SA (Leon et al., 1995). Thus, ROS and SA function in a regulatory loop in which ROS induce SA synthesis and SA enhances their accumulation, which was argued to induce antioxidants, eventually leading to decrease in ROS concentration (Khokon et al., 2011; Herrera-Vásquez et al., 2015; Khan et al., 2015). SA-mediated resistance is related to the expression of pathogenesis-related (PR) genes (Rivas-San Vicente and Plasencia, 2011) which is partially controlled by redox-regulated NPR1 (non-expresser of pathogenesis-related 1) protein, a positive regulator of SA signalling acting downstream of SA (Mou et al., 2003). NPR1 has also been shown to serve as a SA receptor (Wu et al., 2012). In npr1 mutants which failed to express PR1 gene, a typical indicator of SA-mediated systemic acquired resistance (SAR) in plants, resistance to pathogens was abolished (Fan and Dong, 2002). Recently, it has been shown that accumulation of H2O2 in the cytosol reduced the NPR1-dependent PR gene expression (Peleg-Grossman et al., 2012). Besides an important role in biotic stress response, the NPR1-dependent SA signalling pathway is also pivotal for enhanced salt and oxidative stress tolerance in Arabidopsis (Jayakannan et al., 2015b). However, SA appears to play a dual role in plant response to abiotic stress as exogenously applied SA can either alleviate the negative effects of abiotic stressors or impair plant response to them, depending on SA concentration, duration of treatment and plant species (Barba-Espín et al., 2011; Khan et al., 2015). ABA is a key hormone regulating plant response to adverse environmental conditions resulting in osmotic imbalance and tissue desiccation. During water stress, ABA serves as a primary chemical signal that induces stomatal closure (Osakabe et al., 2014). Under biotic stress, ABA plays a positive role in pre-invasive stomatal immunity by induction of stomatal closure which restricts bacterial and fungal pathogens entry to a plant (Lee and Luan, 2012). Some pathogens, including Pseudomonas syringae, are able to modify ABA biosynthesis and signalling in plants, which indicates that ABA functions as a virulence factor for them (de Torres-Zabala et al., 2007; Zeng and He, 2010; Xu et al., 2013). ABA interacts with SA signalling pathway in a complex manner. ABA can promote the biosynthesis of SA and SA can increase the concentration of ABA (Seo and Park, 2010). It has been shown that ABA interacts with SA signalling mainly antagonistically by inhibiting SA-induced gene expression, and abiotic stress-induced ABA accumulation is known to influence the outcome of plant–pathogen interactions (Xu et al., 2013; Osakabe et al., 2014). However, the mechanism of SA/ABA interaction in plants responding to combined stress remains unclear. It varies with a plant species, a type of abiotic stressor, a stress level and a phase of plant-pathogen interaction (Flors et al., 2009; Cao et al., 2011; Lee and Luan, 2012). In Arabidopsis, drought stress increased susceptibility to avirulent bacteria (Mohr and Cahill, 2007; Kim et al., 2012) whereas drought pretreatment of tomato plants before inoculation with Botrytis cinerea or Oidium neolycopersici resulted in elevated resistance against these pathogens (Achuo et al., 2006). In Arabidopsis– Pseudomonas interaction, stomatal immunity was positively regulated by ABA and SA crosstalk (Zeng and He, 2010). Moreover, involvement of ROS in ABA-mediated stomatal closure has also been reported (Kwak et al., 2006). Elevated ROS levels correlated with ABA accumulation whereas increased ABA level resulted in ROS overproduction in guard cells, creating a positive feedback loop to mediate stomatal closure (Mittler and Blumwald, 2015). In the signalling network involved in combined abiotic and biotic stress response, ABA was proposed to be positioned between ROS and SA (Kissoudis et al., 2014). Under combined stress, which frequently occurs in natural environments, the sequential or simultaneous action of abiotic and biotic stressors can modify the plant response pattern predicted on the basis of single-stress studies (Mittler, 2006). They can interact in antagonistic or synergistic manner, increasing the stress impact or stress tolerance (Glombitza et al., 2004). While the effects 2

of abiotic stress factor interactions have been characterized, the knowledge on abiotic and biotic stress combinations is limited and only few studies have yet documented the molecular mechanisms underlying the combined stress response (Prasch and Sonnewald, 2015). It is still not clear why some interactions of abiotic-stressed plants with pathogens resulted in tolerance while other in susceptibility to infection (Ramegowda and Senthil-Kumar, 2015). Elucidation of the specificity of combined stress responses is essential to develop plants tolerant towards multiple stresses, which is a breeding target in crops. Salt stress is one of the major environmental abiotic stresses limiting plant productivity in open fields and greenhouse (Munns and Tester, 2008). The greenhouse crops can experience salt stress due to frequent fertilization and irrigation (Yi et al., 2015) or when grown in recirculated hydroponic growth systems. Cucumber, an important vegetable crop, is sensitive to salinity and to angular leaf spot caused by the hemibiotrophic bacterium P. syringae pv. lachrymans (Psl). This destructive disease is the second most severe cucumber disease, following Pseudoperonospora cubensis (Olczak-Woltman et al., 2009) and contributes to fruit yield losses ranging from 30 to 60% worldwide (Bhat et al., 2010). Despite its potential implications for agriculture, the interaction of salinity and Psl infection remains largely unknown. In order to elucidate how response of plants to salinity affects the bacterial pathogen infection, we exposed cucumber plants to sequentially applied salt stress and Psl. We monitored cucumber growth and infection development and measured Na+ and K+ contents, tissue hydration, membrane injury, accumulation of ROS, antioxidant enzyme activities as well as SA and ABA contents and PR1 gene expression.

2. Materials and methods

2.1. Plant material Cucumber plants cv. ‘Cezar F1’ (W. Legutko) were grown in plastic pots (400 ml) filled with a peat-based substrate, in a growth chamber under irradiance of about 350 μE m-2·s-1, photoperiod 16/8h (day/night) and temperature 23ºC.

2.2. Experimental design Three-week-old plants were first exposed to salt stress and irrigated for seven days with 50 mM or 100 mM NaCl and thereafter infected with Psl (strain No IOR 1990 obtained from the Bank of Plant Pathogens of the Institute of Plant Protection in Poznań, Poland). The reference NaCl-free plants were irrigated with water. The bacteria for inoculation were cultured for 48 h in King B liquid medium at 28ºC and centrifuged at 3500 g for 10 min. The bacterial pellet was washed twice, resuspended in sterile water and the bacteria suspension was adjusted to 107 CFU ml-1. Three fully expanded leaves from the bottom of NaCl-treated and of NaCl-free cucumber plants were inoculated by infiltrating the bacterial suspension (infected plants) or sterile distilled water (mockinoculated plants) using a needleless hypodermic syringe (Chojak et al., 2012). Starting from inoculation, the salt stress was ceased and all plants were irrigated with water until the end of the experiment. Six experimental variants were obtained: Control (NaCl-free and mock-inoculated plants); Psl (NaCl-free and infected plants); 50 mM NaCl and 100 mM NaCl (salt-treated and mock-inoculated plants); 50 mM NaCl + Psl and 100 mM + Psl (salt-treated and infected plants). Analyses were performed seven days after salt treatment, at the time point of inoculation (T0) and 2, 5, 7 days after Psl inoculation (T2, T5, T7, respectively), unless stated otherwise.

2.3. Measurements

2.3.1 Plants under stress conditions Cucumber leaf surface and disease severity, given as the average size of bacteria-induced necrotic spots, were quantified by a software run in MATLAB (Gocławski et al., 2012). To calculate the root/shoot ratio, plant height and the primary root length were measured with a metric ruler. The 3

roots were carefully removed from soil, cleaned with tap water, spread along the ruler and the length of the root system of each plant was measured along the primary root. Relative water content (RWC) was analysed according to the standard method described by Bandurska et al. (2013). Na+ and K+ concentrations (mg g-1 DW) in cucumber leaves and roots were determined at T0 and T7 by atomic absorption spectrometry (SpektrAA 300, Varian, Mulgrave, Australia) following wet digestion of 50 mg of oven dried plant tissue samples in 5 ml of 69% HNO3 at 140 °C. The population size of Psl (CFU g-1 FW) in the inoculated leaves was assessed by the plate count method as described by Libik-Konieczny et al. (2011). For homogenization, 5 leaf discs (1 cm in diameter) from the areas adjacent to the necrotic spots were taken from each leaf. The results obtained for Psl were treated as 100%, and the data for 50 mM NaCl + Psl or 100 mM + Psl were expressed as percentage of Psl. The bacterial population size was determined at T7. Loss of membrane integrity was recognized by Evans blue staining (Yamamoto et al., 2001). Leaves were stained with Evans blue solution (0.025 g Evans blue in 100 ml of 100 µM CaCl2, pH 5.6) for 10 minutes, thereafter incubated in warm ethanol (96%) to remove chlorophyll and visualised afterwards. Stomatal pore width was measured using epi-fluorescent microscope (Nikon, Optiphot-2) equipped with DMX-1200 camera and Act 1 software (Precoptic, Poland). Five leaf fragments (1x3 cm) were cut from two different plants per experimental variant. The fragments were taken from leaf areas adjacent to the sites of water infiltration (mock-inoculated plants) or to the lesions (Psl-infected plants). Images of 50 stomata randomly chosen within the leaf fragment (10 stomata per 1 leaf fragment) were analyzed by using ImageJ program (version 1.50 b, Wayne Rasband, National Institute of Health, USA). Stomatal pore width was measured in pixels and converted to µm, taking into account the magnification of the microscope. Analyses were made at T0, T2 and T7.

2.3.2 Histochemical detection of hydrogen peroxide and superoxide anion radical The presence of H2O2 or O2-. in the leaves was detected using 3,3’-diaminobenzidine (DAB, Thordal-Christensen et al., 1997) and nitroblue tetrazolium staining method (NBT, Unger et al., 2005), respectively. The third leaf from the bottom of cucumber plant was cut off and used for staining. Five leaves from different plants per experimental variant were analysed. To detect H2O2, the leaves were placed in 0.3 mM DAB-HCl, pH 3.8, and incubated in the growth chamber for 12 h. In the presence of endogenous peroxidase, polymerization of DAB at the sites of H2O2 formation generates a reddish-brown product that is macroscopically visible. After staining, the leaves were cleaned in 96% ethanol and visualised. To detect O2-., the leaves were placed in NBT solution (10 mM potassium phosphate buffer, pH 7.8, containing 0.1 mM NBT and 10 mM NaN3) for 15 min, under increased pressure (8MPa). NBT reacts with O2-. and forms a dark blue insoluble formazan compound. The stained leaves were transferred into warm 96% ethanol and visualised. DAB- or NBT-stained areas, given as a percentage of the total leaf area, were automatically quantified by an algorithm run in MATLAB (Gocławski et al., 2009). H2O2 and O2-. were detected at 0 and 6, 24, 72 h after Psl inoculation (hai).

2.3.3 Analysis of superoxide dismutase by native PAGE For superoxide dismutase (SOD, EC 1.15.1.1) analysis, the leaf material (1g fresh weight) was homogenized at 4°C in a mortar, in 2.5ml Tris-HCL buffer pH 8.0, containing 3 mM EDTA, 1 mM DTT, 1 mM MgCl2 and 2% polyvinylpyrrolidone (PVP) and centrifuged (3min at 10000×g). Equal amounts of soluble proteins (10 µg) were loaded into each well to carry out the native PAGE. The protein concentration was determined according to Bradford (1976). SOD activity was analysed by native PAGE at 4°C, 180V, using 10 mM Tris-HCL buffer pH 8.3, containing 80 mM glycine without sodium dodecyl sulphate. SOD bands were visualized on 12% polyacrylamide gels using the activity staining procedure described by Beauchamp and Fridovich (1971): the gels were incubated in the staining buffer (50 mM potassium phosphate buffer pH 7.8, containing 28 mM EDTA, 28 mM TEMED, 0.028 mM riboflavin and 2.45 mM NBT) for 20 min in the dark at room 4

temperature and then exposed to white light until SOD activity bands became visible. SOD isoforms were identified by 15-min preincubation with selective inhibitors, 5 mM KCN for CuZnSOD and 10 mM H2O2 for both CuZnSOD and FeSOD. Activities of SOD isoform bands were calculated by determining band volume using Image Lab software (version 5.1, build 8, BioRad Laboratories).

2.3.4 Catalase activity assay Catalase (CAT, EC 1.11.1.6) activity in the cucumber leaves was assayed spectrophotometrically according to Dhindsa et al. (1981). Fresh samples (0.5 g) were homogenized in 2.5 ml of 50 mM sodium phosphate buffer pH 7.0, containing 1 mM EDTA, 1% PVP and 1 M NaCl. After centrifugation the supernatant was used to determine CAT activity. The assay mixture contained 50 mM sodium phosphate buffer pH 7.0, the extract and 15 mM H2O2. Decomposition of H2O2 was measured at 240 nm (ε240H2O2 = 36 M−1 cm−1). CAT activity was expressed in µmol H2O2 min -1 mg 1 protein.

2.3.5 Determination of SA concentration SA extraction was performed according to Molina et al. (2002). Briefly, frozen leaves were used for triple extraction, twice with 90% (v/v) MeOH and then with 100% MeOH. After centrifugation, supernatants were combined and evaporated to dryness under vacuum at 40 °C. The residue was redissolved in water at 80°C, centrifuged out and incubated at 37 °C overnight with 0.2 M sodium acetate buffer pH 5.0 for free SA determination, or with the buffer containing β-glucosidase (16 U for each sample) for SAGC determination. After incubation, the samples were acidified to pH 1.5-2.0 with HCl, centrifuged out and then SA was extracted three times into three volumes of cyclopentane:ethylacetate:2-propanol (50:50:1, v/v/v). The organic extracts were dried under vacuum and re-suspended in 70% MeOH with 0.5% formic acid. Quantification of free SA and SAGC via HPLC method was carried out as described by Kuźniak et al. (2014).

2.3.6 Determination of ABA concentration For ABA determination, samples were purified and quantified as described by Szepesi et al. (2009) with some modifications. The leaf samples (0.5 g) were powdered and extracted overnight at 4°C in 5 ml of ABA extraction buffer (80% methanol containing 10 mg l-1 butylated hydroxytoluene). Extracts were dried under vacuum. The samples were re-suspended in 1.5 ml PBS, adjusted to pH 8.5 with 1N NaOH and extracted two times with equal volumes of ethyl acetate. The remaining aqueous phase was adjusted to pH 2.5 with 1N HCl and extracted two times with equal volumes of ethyl acetate. The samples were dried under vacuum and dissolved in 200 µl of 100% methanol and 3600 µl of TBS buffer. After centrifugation (4°C, 8800 g, 3 min) ABA content was measured using the Phytodetek competitive ELISA kit (Agdia Inc.) following the manufacturer’s instructions.

2.3.7 Gene expression analysis Total RNA was extracted using Renozol TRI RNA Extraction Reagent (Genoplast Biochemicals) following the manufacturer’s instructions. RNA precipitation step was modified to remove polysaccharide contamination and 0.25 ml of isopropanol followed by 0.25 ml of a high salt precipitation solution (0.8 M sodium citrate and 1.2 M NaCl) per 1 ml of TRI RNA Extraction Reagent was added to the aqueous phase. The total RNA was quantified by spectrophotometric assay and the quality of isolated RNA was evaluated by gel electrophoresis. Intact rRNA subunits of 28S and 18S were observed on the gel which indicated minimal degradation of the RNA. Thereafter, 1 μg of total RNA was reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following manufacturer's recommendations. Quantitative Real-time PCR assays were performed on the 7500 Real Time PCR System (Applied Biosystems). Each 10 µl reaction was carried out in reaction mixture containing: 1x concentrated Real-Time 2xHS-PCR Master Mix SYBR A (A&A Biotechnology) including LoROX fluorochrome internal control, 2.5 μM specific primers (Table 1), cDNA template (in three 5

concentrations, each in duplicate) and water. The cycling profile consisted of an initial cycle at 95 °C for 5 min, followed by 45 cycles of denaturation (95 °C for 15 s) and primer annealingextension (60 °C for 1 min). After PCR cycling, melting curve analysis was performed in the range of 60 – 95 °C. Relative quantification of RT-qPCR was used to detect changes in expression of the PR1 gene normalized to a reference housekeeping genes. Serial dilutions of the analyzed cDNA samples were used to determine the amplification efficiencies from the increase in the Cq/Ct value with decreasing cDNA input (Rasmussen, 2001). Three concentrations of cDNA allowed to calculate individual PCR efficiencies for each gene and normalize all results accordingly. Rare outliers were omitted in calculations. Relative PR1 gene expression was calculated by ΔCt method with geometric mean of two reference genes: UBI-1 and UBI-ep using Relative Expression Software Tool (REST 2009).

2.3.9 Protein determination Protein content was determined according to Bradford (1976) with bovine serum albumin used as a standard.

2.3.7 Statistics Unless stated otherwise, each data point is the mean of five independent experiments (n=5) and one plant per treatment was analysed in each experiment. The data were analysed by multi-factor analysis of variance (ANOVA; see Tables S1 and S2 in the electronic supplementary material) and the mean differences were compared by least significant difference (LSD) test at P≤0.05 level using Statistica 12 software.

3. Results

3.1 Plants under stress conditions Salinity caused accumulation of Na+ and decrease in K+ concentration (Fig. 1A, B). At T0, the accumulation of Na+ in the leaves of plants treated with 50 and 100 mM NaCl was 6- and 20-fold higher compared to the control, respectively. In the roots, Na+ accumulation was about 3-fold stronger than in the control for both variants of NaCl treatment and reached several fold higher levels than in the leaves. Seven days after rewatering (T7), accumulation of Na+ in the leaves was slightly reduced in relation to T0, but it remained 4-fold and 15-fold higher than in the control for 50 mM NaCl and 100 mM NaCl, respectively. In the roots, Na+ content was about 1.5-fold higher than in the control (Fig 1A). Regardless of NaCl concentration, at T0 K+ level in the leaves was reduced by about 35% and in the roots by 65%, comparing to the control. At T7, K+ concentration in the leaves was similar to the control, but in the roots it remained about 2-fold lower in both NaCltreated variants (Fig. 1B). RWC in the cucumber leaves was decreased by about 57% after salt treatment (T0), regardless of NaCl concentration (Fig. 1C). At T7, the NaCl-pretreated plants improved their water status although RWC in the leaves was still lower than in the control. Biotic stress applied individually did not change leaf RWC when compared with the control plants. The effects of pathogen and salt stress in combination were apparently determined by abiotic stress as no significant changes between the NaCl-treated and NaCl-treated and infected plants were found (Fig. 1C). Salt stress negatively affected the functioning of stomata (Fig. 1D). After 7 days of NaCl treatment, the 50 mM NaCl and 100 mM NaCl plants showed reduction in stomatal opening by about 50% and 70% compared to the control, respectively. Stomatal pore width after Psl infection was about 60% smaller than in the control throughout the experiment. There was no difference in stomata opening between plants sequentially exposed to salinity and infection and those treated with NaCl only. However, the stomatal pore width in plants under combined stress tended to be smaller than in those infected without salt treatment. 6

In terms of growth, leaf cell water status and stomata functioning, the combination of salinity and pathogen infection had a greater impact on plants than the individual biotic stress. Although plant elongation growth and RWC were gradually recovered upon rewatering, the stomata opening and leaf expansion under combined stress remained heavily impaired throughout the experiment (Fig. 2). The first symptoms of angular leaf spot of cucumber in the form of chlorotic spots on the leaves were observed at T2, in both NaCl-treated and non-treated plants. Salt stress intensified the disease symptoms and at T7 distinct chlorotic halos around the necrotic spots were noted only on the salttreated plants, especially those previously exposed to 100 mM NaCl (Fig. 3A). Moreover, at T7 the average necrotic spot surface on the leaves of plants pretreated with 50 mM and 100 mM NaCl was around 40 mm2 while on Psl-infected plants it was 24.7 mm2 (Fig. 3C). Salt stress promoted the bacterial growth in cucumber leaves as in 50 mM NaCl + Psl and 100 mM NaCl + Psl, the Psl population size at T7 was 2.2-fold and 3.4-fold higher than in Psl, respectively. Evans blue staining confirmed that salinity and Psl infection damaged cell membranes in cucumber leaves. Moreover, in NaCl+Psl plants, loss of membrane integrity was not restricted to the inoculation sites but also appeared in the surrounding tissues (Fig. 3B).

3.2 Histochemical detection of superoxide anion radical and hydrogen peroxide On the day of inoculation, after 7-day-NaCl treatment (T0), the total NBT-stained leaf area of 50 mM NaCl+Psl and 100 mM+Psl plants was 1.8 and 2.5 fold increased relative to Psl plants, respectively (Fig. 4). Similar relationship was observed 6 hai. Thereafter the total NBT-stained leaf area in the plants under combined stress decreased below the level of Psl plants. The DAB-stained area, indicative of H2O2 accumulation, in 50 mM NaCl+Psl and 100 mM+Psl plants was significantly increased when compared to Psl ones. At the time point of pathogen inoculation, over 2.5-fold increase in the total DAB-stained area in plants exposed to salt stress was observed, regardless of NaCl concentration. Enhanced DAB staining in these plants was maintained throughout the experiment, although the most intense staining in response to infection was detected 6 hai and 72 hai (Fig. 4).

3.3 Superoxide dismutase and catalase activities Using specific inhibitors, KCN and H2O2, several SOD isoforms were identified in cucumber leaves, four of them being MnSOD, two CuZnSOD and one FeSOD. The latter appeared at T2 and T5 only in the leaves of plants treated with NaCl and infected (Fig. 5A). The changes observed in the profile of SOD isoforms were both time- and stress type-dependent. Salt stress provoked total SOD activity increase (T0) resulting from that of MnSOD and CuZnSOD in 50 mM NaCl and 100 mM NaCl plants, respectively. During salt stress recovery, enhanced total SOD activity was due to elevated levels of both isoforms at T5 and T7. When applied individually, biotic stress significantly increased MnSOD and CuZnSOD at T2 and T5. Under combined stress, at T2 total SOD activity was decreased when compared to Psl plants, mainly due to MnSOD activity decline which was not compensated for by FeSOD activation. At T5, however, the plants under combined stress showed higher total SOD activity then Psl ones. It depended on the induction of either FeSOD (100 mM NaCl+Psl) or MnSOD and FeSOD (50 mM NaCl+Psl). Thereafter, in 50 mM NaCl+Psl plants, MnSOD activity increase was not parallel with the total SOD induction whereas in 100 mM NaCl+Psl ones both MnSOD and CuZnSOD were enhanced in relation to Psl plants (Fig. 5B). Unlike salt stress which had no impact on CAT activity in the leaves, infection induced CAT activity changes at T2 and they depended on the type of stress. In the plants infected without NaCl treatment, Psl induced CAT activity decrease by 25% while in combination with salt stress it caused CAT activity increase by about 10% (Fig. 5C).

3.4 Endogenous levels of free SA and SAGC At T0, in the leaves of both control and salt-treated plants, free SA dominated in the total pool of SA. On the following days of experiment, this relation was changed and significant increase in 7

SAGC was observed. The salt stress-induced changes (T0) were statistically insignificant when compared to the control, except for SA in 50 mM NaCl plants (Fig. 6A). However, in all Pslinfected variants a prolonged accumulation of free SA and SAGC was observed starting from T2. In 50 mM NaCl + Psl and100 mM NaCl + Psl plants, we found the most intense accumulation of free SA at T2 when SA content was 1.9 and 4.7-fold higher than in the 50 mM NaCl and 100 mM NaCl, respectively. In Psl plants, SA content was 2.2-fold higher than in the control at T5. In all Pslinfected variants, SAGC accounted for about 90% of the total SA pool throughout the experiment. Sequentially applied salt stress and infection caused an increase in SAGC concentration compared to the respective NaCl-treated plants, but the dynamics of these changes differed with NaCl concentration. In 50 mM NaCl + Psl plants the highest SAGC accumulation was observed at T2 (24-fold higher than in 50 mM NaCl variant) while in 100 mM NaCl + Psl ones the highest SAGC content (11-fold higher than in 100 mM NaCl variant) was noticed at T7 (Fig. 6A). With respect to the infection-induced changes, the differences between NaCl-treated and not-treated plants were visible only for free SA at T2 (both NaCl variants) and T7 (100 mM NaCl + Psl vs Psl) when its level was significantly higher under combined stress. We also observed changes in SA/SAGC ratio after salt pretreatment. SA/SAGC ratios at T0 in 50 mM and 100 mM NaCl plants were similar to the control. At the following time points, this ratio decreased and at T7 it was 1.7 and 2.8-fold lower than in the control for 50 mM NaCl and 100 mM NaCl, respectively. Moreover, SA/SAGC ratio measured in the control plants was also decreasing from 2.8 at T0 to 0.7 at T7.

3.5 Endogenous level of ABA After seven-day exposure to salt stress (T0), ABA content increased in both variants but its accumulation was greater under 100 mM NaCl (Fig. 6B). On the following days the content of ABA in 50 mM NaCl plants was increasing and at T7 it was four times higher than in the control. In the plants treated with 100 mM NaCl, the highest level of ABA was at T0 (11-fold higher than in the control) while on T7 it was 3-fold higher than in the control. After Psl inoculation, ABA content increased and it was about 2-fold higher than in the control throughout the experiment. Salt stress and infection applied sequentially caused decrease in the content of ABA in comparison to the NaCl treated plants. The effect of combined stress was intensified at T7, when ABA level was about 60% lower compared to the respective salt-treated and non-infected plants. Despite the significant decrease in the concentration of ABA in 100 mM NaCl + Psl plants their levels of ABA remained higher than in Psl plants at T2 and T5. This relationship was also evident in the infected plants previously treated with 50 mM NaCl at T2.

3.6 Relative gene expression of PR1 Salt treatment (T0) increased PR1 gene-expression level (Fig. 7). In 50 mM NaCl and 100 mM NaCl plants it was about 9-fold and 8-fold higher than in the control, respectively. At T2 there was no difference in PR1 expression between the control and 50 mM NaCl, and in 100 mM NaCl plants it was down-regulated. However, at T5, in both 50 mM NaCl and 100 mM NaCl plants, PR1 gene was up-regulated and the expression level was 15 and 4,5-fold higher than in the control, respectively. Psl infection caused 1.5- (T2) and 2.2-fold (T5) increases in PR1 gene-expression levels compared to the control. In plants sequentially exposed to salt stress and infection the response depended on NaCl concentration. PR1 expression level in 50 mM NaCl + Psl was 2.8-fold higher than in the control at T5 while in 100 mM NaCl + Psl plants, PR1 was down-regulated.

4. Discussion Psl infection of the plants previously exposed to salt stress resulted in more severe angular leaf spot disease symptoms in addition to reduced plant growth, stomatal aperture and relative leaf water content in comparison to pathogen-infected plants grown without NaCl-pretreatment. Plant growth limitation is one of the common effects of environmental stresses (Huber and Bauerle, 2016). Unlike salt stress, biotic stress applied individually did not change the leaf growth rate, shoot/root 8

ratio (Chojak et al., 2012), leaf RWC and membrane permeability assessed by Evans blue staining and it induced a weaker stomatal closure response than NaCl, indicating that these two stresses differed in the severity of impact on plant fitness. The combined stress intensified the negative impact of salt stress in terms of growth rates, leaf hydration and stomatal closure, confirming results on the additive effect of multiple stress factors (Suzuki et al., 2014). These negative changes were reversible upon rewatering (T7), suggesting that acclimation dominated over the detrimental effects of salt stress on plant growth. The process was less effective in leaves than in shoots and it was slower in the 100 mM NaCl plants than in the 50 mM NaCl ones therefore the salt-induced effect could negatively interfere with the early responses to infection especially in the 100 mM NaCl+Psl plants. Unlike changes in stem and leaf growth, the osmotic and ionic effects of NaCl treatment were not alleviated after rewatering and its potential influence on the plant-pathogen interaction persisted throughout the experiment. The conditions for pathogen growth in cucumber leaf tissues differed between the salt-pretreated and non-treated plants. Thus, the promotion of Psl growth in the leaves of salt-stressed cucumber plants showed by the increased bacterial population size and more intense disease symptoms could be attributed to NaCl-induced changes rendering the apoplastic space more favourable for colonization by the pathogen. In the NaCl-treated plants, the biotrophic bacteria could exploit both nutrients leaking to the apoplast due to extensive membrane injury recognized by Evans blue staining and the salt-induced osmolytes (Chojak et al., 2012), as they were shown to produce functional transporters for the uptake of osmoprotectants (Chen and Beattie, 2007). Modification of the infection process could also reflect the adaptation of bacteria to specific water and ionic relations encountered in the leaf tissues of NaCl-treated plants. Water potential influences bacterial growth and P. syringae pv syringae exhibited optimal growth in culture at water potential conferred by 50-200 mM NaCl. Moreover, during pathogenesis water potential of the apoplast can be actively lowered by the pathogen to support its optimal growth (Wright and Beattie, 2004). Alternatively, the promotion of disease development in NaCl-treated plants could reflect the inability to induce tailored defence response under combined stress due to perturbations in stress signalling (Ramegowda and Senthil-Kumar, 2015). Abiotic stress, except for creating a more favourable microenvironment for pathogen growth, can influence the redox-based and hormonal signalling pathways and the expression of components of the disease resistance mechanism (Rejeb et al., 2014). Although ABA can positively contribute to pre-invasive immunity (García-Andrade et al., 2011), the post-penetration defence was negatively regulated by ABA in most studied plant-pathogen systems and translated into disease phenotypes (Mauch-Mani and Mauch, 2005; Asselbergh et al., 2008). Here, NaCl treatment resulted in salt concentration-dependent ABA accumulation in the cucumber leaves (T0) and its increased level persisted during the period of salt stress relief (T2-T7). The subsequent biotic stress also modified the ABA level, however in the salinized plants, ABA content decreased after inoculation whereas in those infected without NaCl pretreatment, it increased. Owing to all these changes, the concentration of ABA under combined stress was still higher than after infection alone at T2, but at T7 the opposite relationship was observed. Unlike ABA, the salicylate pool in the cucumber leaves was preferentially influenced by biotic stress, although in other plants the abiotic stress-induced strong SA accumulation was reported (Abreu and Munné-Bosch, 2008). Our results confirmed that in addition to several shared traits some responses are specific to individual stresses (Pandey et al., 2015). However, under combined stress the infection-induced accumulation of SA at T2 as well as SAGC at T5 was much more pronounced. This effect was prolonged to T7 in the plants previously exposed to 100 mM NaCl. Our results suggest that salt stress ``primed'' the plants for SA biosynthesis after infection and newly synthesized SA was conjugated to glucose. SAGC may serve to sequester free SA thus protecting the cells from potentially toxic effects of high concentrations of SA accumulating in the stressed tissues and may act as a reservoir of free SA, releasing it in response to stress (Rivas-San Vicente and Plasencia, 2011). SAGC are generally thought to be biologically inactive, although some reports showed that their accumulation was required for the activation of defence responses (Dean 9

et al., 2005). Thus, modification of the infection process under combined stress could be attributed not only to the absolute hormone concentration at the time of pathogen challenge (Mohr and Cahill, 2007), but also to the changed ABA/SA equilibrium in the leaf tissues (Jiang et al., 2010). In accordance with the latter, a time-dependent biphasic effect of combined stress on the ABA/total salicylate ratio was observed in the 100 mM NaCl + Psl plants, being the most prone to infection. In these plants, its significant increase at T2 was followed by its several fold decrease at T7. The biphasic effect was not seen in 50 mM NaCl + Psl plants where the ABA/total salicylate ratio changed only at T2. SA accumulation in the high salt-stressed and infected plants did not favour biotic stress tolerance as the increased ABA content resulting from NaCl treatment which persisted throughout the experiment may have suppressed the SA-mediated defence response triggered by Psl. It was shown by the down-regulation of PR1 gene expression under combined stress in the plants pretreated with 100 mM NaCl, in which the Psl population size was the largest and the strongest disease phenotype was accompanied by the highest ABA content during disease establishment (T0 - T5) and with the most dynamic changes in the ABA/SA equilibrium. This is in line with the observations that high levels of ABA increased susceptibility whereas reduced ABA concentration enhanced resistance to pathogens (Asselbergh et al., 2008; Xu et al., 2013). It also cannot be excluded that in the heavily infected 100 mM NaCl + Psl plants, the pathogen suppressed the PR genes in a SA-independent manner to inhibit the host-plant defence (Chen et al., 2004). The slightly increased expression of PR1 in 50 mM NaCl + Psl plants at T5 could be related to lower-salt-stress-intensity-dependent hormonal balance, allowing SA-responsive gene expression. The pattern of PR1 expression in the plants exposed to combined stress could have also resulted from SA-independent induction of PR genes by salt stress, as we found that NaCl triggered the accumulation of PR1 transcripts irrespective of its effect on SA level. Other studies also showed the SA-independent induction of PR genes by abiotic stress, reflecting a complex signalling cross-talk between abiotic and biotic stress responses (Seo et al., 2010). In the cucumber plants infected without NaCl pretreatment, the expression of PR1, a marker of SA signalling, was relatively low. It could be related to the kinetics of the response as in other studies PR1 was shown to be up-regulated right after inoculation (López-Gresa et al., 2011) or with the stress signalling mechanisms. Moreover, in the Psl plants, accumulation of ABA, being probably the effect of pathogen-induced ABA biosynthesis gene expression (de Torres-Zabala et al., 2007), could antagonize SA signalling by promoting proteasome-mediated degradation of NPR1which directly regulates PR1 expression (Ding et al., 2016). ROS, including O2-. and H2O2, as well as ROS producing and scavenging enzymes contribute to SA and ABA signalling and ROS-mediated signals were suggested to play a central role in the cross talk between abiotic and biotic stress responsive networks (Baxter et al., 2013; Xia et al., 2015). We found that under combined stress, the leaf tissues were also more prone to accumulate O2- and H2O2 shortly after infection, as revealed by NBT and DAB staining, respectively. Later on, the decreased NBT staining coincided with the specific induction of FeSOD whereas H2O2 accumulation was followed by CAT activity increase. Thus, the O2-. and H2O2 accumulation-related oxidative burden under combined stress was significantly increased when compared with effects of biotic stress alone and the prooxidant/antioxidant mechanisms operated at levels different from those in the plants exposed to one stress only. The transient accumulation of O2-, accompanied by a prolonged H2O2 production, could be the effect of ROS production via plant NADPH-oxidizing phagocyte respiratory burst oxidase homologues, RbohD and RbohF, mediated by ABA synthetized in response to NaCl pretreatment (Kwak et al., 2006). ROS accumulation coincided with the combined stress-specific antioxidant response, manifested by activation of FeSOD. This confirmed that SOD changes were specific for tailored responses to stress (Alscher et al., 2002) and suggested that in chloroplasts the oxidative stress was specifically controlled under combined stress. Moreover, as SA and ABA biosynthesis occurs partly in the chloroplasts (Dempsey et al., 2011; Suzuki et al., 2016), these changes are likely to be important for the integration of ROS and phytohormone signalling 10

networks aimed at combined stress-specific defence response. Indeed, a functional link between chloroplastic H2O2 and SA in stress response was found in Arabidopsis (Noshi et al., 2012). In conclusion, our results show that in the cucumber plants sequentially exposed to salinity and biotic stress, the response to pathogen was negatively affected by prior abiotic stress episode, as shown by increased disease severity. We suggest that in the cucumber exposed to salt stress the defence against Psl was compromised due to: (1) the negative effects of NaCl on leaf tissues hydration, stomatal aperture as well as ionic and osmotic balance which could promote the pathogen growth and (2) the changed ABA/SA equilibrium which hindered the induction of defence response exemplified by PR1 expression. The plant response under combined stress was predominantly influenced by salt stress which affected plants stronger than infection, and the adverse effect of the combined stress on plant defence was NaCl concentration-dependent. Moreover, the combined stress resulted in specific expression of the components of prooxidant and antioxidant mechanisms, i.e. O2-/H2O2 and FeSOD, and suggested a role of chloroplasts in the integration of ROS and hormone-mediated signalling. Acknowledgments This work was supported by grant No. 2012/07/N/NZ9/00041 from National Science Centre (Poland). The authors want to thank dr. M. Wielanek (Department of Plant Physiology and Biochemistry, University of Lodz) for her help with HPLC analysis, dr. J. Cieśla (GMO Laboratory for Genetic Modification Analyses IBB PAS) for the invaluable help with gene expression analysis and prof. A. Kaźmierczak (Department of Cytophysiology, University of Lodz) for a possibility to assess stomatal pore width. Authors contributions J. Chojak-Koźniewska and E. Kuźniak conceived and designed the study; J. Chojak-Koźniewska and A. Linkiewicz performed lab experiments; A. Linkiewicz and S. Sowa designed RT-PCR assay, analyzed the data and revised critically the manuscript; J. Chojak-Koźniewska and E. Kuźniak interpreted the data and wrote the article. M.A. Radzioch prepared P. syringae pv lachrymans culture and evaluated bacteria population size in cucumber leaves. All authors have approved the article for publication. J. Chojak-Koźniewska ([email protected]) and E. Kuźniak ([email protected]) take responsibility for the integrity of the work as a whole. References Abreu, M.E., Munné-Bosch, S.,;1; 2008. Salicylic acid may be involved in the regulation of drought-induced leaf senescence in perennials: a case study in field-grown Salvia officinalis L. plants. Environ. Exp. Bot. 64, 105–112. Alscher, R.G., Erturk, N., Heath, L.S.,;1; 2002. Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. J. Exp. Bot. 53, 1331–1341. 10.1093/jexbot/53.372.1331 Asselbergh, B., De Vleesschauwer, D., Höfte, M.,;1; 2008. Global switches and fine-tuning-ABA modulates plant pathogen defense. Mol. Plant-Microbe Interact. 21, 709–719. 10.1094/MPMI-21-6-0709 Bandurska, H., Niedziela, J., Chadzinikolau, T.,;1; 2013. Separate and combined responses to water deficit and UV-B radiation. Plant Sci. 213, 98–105. 10.1016/j.plantsci.2013.09.003 Barba-Espín, G., Clemente-Moreno, M.J., Alvarez, S., García-Legaz, M.F., Hernández, J.A., DíazVivancos, P.,;1; 2011. Salicylic acid negatively affects the response to salt stress in pea plants. Plant Biol. 13, 909–17. 10.1111/j.1438-8677.2011.00461. x 11

Baxter, A., Mittler, R., Suzuki, N.,;1; 2013. ROS as key players in plant stress signalling. J. Exp. Bot. 19, 1–12. 10.1093/jxb/ert375 Beauchamp, C., Fridovich, I.,;1; 1971. Superoxide dismutase: improved assays and an assay applicable to acrylamide gels. Anal. Biochem. 44, 276-287. Bhat, N.A., Bhat, K.A., Zargar, M.Y., Teli, M.A., Nazir, M., Zargar, S.M.,;1; 2010. Current status of angular leaf spot (Pseudomonas syringae pv. lachrymans) of cucumber: a review. Int. J. Curr. Res. 8, 7–11. Bradford, M.M.,;1; 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–54. Cabello, J.V, Lodeyro, A.F., Zurbriggen, M.D.,;1; 2014. Novel perspectives for the engineering of abiotic stress tolerance in plants. Curr. Opin. Biotechnol. 26, 62–70. 10.1016/j.copbio.2013.09.011 Cao, F.Y., Yoshioka, K., Desveaux, D.,;1; 2011. The roles of ABA in plant-pathogen interactions. J. Plant Res. 124, 489–499. 10.1007/s10265-011-0409-y Chen, Z., Silva, H., Klessig, D.,;1; 1993. Active oxygen species in the induction of plant systemic acquired resistance by salicylic acid. Science 262, 1883-86. 10.1126/science.8266079 Chen, Z., Kloek, A.P., Cuzick, A., Moeder, W., Tang, D., Innes, R.W., Klessig, D.F., McDowell, J.M., Kunkel, B.N.,;1; 2004. The Pseudomonas syringae type III effector AvrRpt2 functions downstream or independently of SA to promote virulence on Arabidopsis thaliana. Plant J. 37, 494–504. 10.1111/j.1365-313X. 2003.01984. x Chen, C., Beattie, G.A.,;1; 2007. Characterization of the osmoprotectant transporter OpuC from Pseudomonas syringae and demonstration that cystathionine-beta-synthase domains are required for its osmoregulatory function. J. Bacteriol. 189, 6901–12. 10.1128/JB. 00763-07 Chojak, J., Kuźniak, E., Świercz, U., Sekulska-Nalewajko, J., Gocławski, J.,;1; 2012. Interaction between salt stress and angular leaf spot (Pseudomonas syringae pv lachrymans) in cucumber. Veg. Crop. Res. Bull. 77, 5–16. 10.2478/v10032-012-0011-4 de Torres-Zabala, M., Truman, W., Bennett, M.H., Lafforgue, G., Mansfield, J.W., Rodriguez Egea, P., Bögre, L., Grant, M.,;1; 2007. Pseudomonas syringae pv. tomato hijacks the Arabidopsis abscisic acid signalling pathway to cause disease. EMBO J. 26, 1434–1443. 10.1038/sj.emboj.7601575 Dean, J.V, Mohammed, L.A., Fitzpatrick, T.,;1; 2005. The formation, vacuolar localization, and tonoplast transport of salicylic acid glucose conjugates in tobacco cell suspension cultures. Planta 221, 287–96. 10.1007/s00425-004-1430-3 Dempsey, D.A., Vlot, A.C., Wildermuth, M.C., Klessig, D.F.,;1; 2011. Salicylic acid biosynthesis and metabolism. Arabidopsis Book 9, e0156. 10.1199/tab.0156 Dhindsa, R.S., Plumb-Dhindsa, P., Thorpe, T.A.,;1; 1981. Leaf senescence: correlated with increased leaves of membrane permeability and lipid peroxidation and decreased levels of superoxide dismutase and catalase. J. Exp. Bot. 32, 93–101.

12

Ding, Y., Dommel, M. and Mou, Z.,;1; 2016. Abscisic acid promotes proteasome-mediated degradation of the transcription coactivator NPR1 in Arabidopsis thaliana. Plant J. 86, 20–34. 10.1111/tpj.13141 Fan, W., Dong, X.,;1; 2002. In vivo interaction between NPR1 and transcription factor TGA2 leads to salicylic acid-mediated gene activation in Arabidopsis. Plant Cell 14, 1377–1389. 10.1105/tpc.001628. sence Flors, V., Ton, J., Mauch-Mani, B.,;1; 2009. Role of abscisic acid in disease resistance. In: Signal Crosstalk in Plant Stress Responses. Shinozaki, K. and Yoshioka K. (Ed.), Wiley-Blackwell, pp. 1– 22. García-Andrade, J., Ramírez, V., Flors, V., Vera, P.,;1; 2011. Arabidopsis ocp3 mutant reveals a mechanism linking ABA and JA to pathogen-induced callose deposition. Plant J. 67, 783–794. 10.1111/j.1365-313X. 2011.04633. x Glombitza, S., Dubuis, P.-H., Thulke, O., Welzl, G., Bovet, L., Götz, M., Affenzeller, M., Geist, B., Hehn, A., Asnaghi, C., Ernst, D., Seidlitz, H.K., Gundlach, H., Mayer, K.F., Martinoia, E., WerckReichhart, D., Mauch, F., Schäffner, A.R.,;1; 2004. Crosstalk and differential response to abiotic and biotic stressors reflected at the transcriptional level of effector genes from secondary metabolism. Plant Mol. Biol. 54, 817–35. 10.1007/s11103-004-0274-3 Gocławski, J., Sekulska-Nalewajko, J., Kuźniak, E.,;1; 2012. Neural network segmentation of images from stained cucurbits leaves with colour symptoms of biotic and abiotic stresses. Int. J. Appl. Math. Comput. Sci. 22, 669-684. Thordal-Christensen, H., Zhang, Z., Wei, Y., Collinge, D.B.,;1; 1997. Subcellular localization of H2O2 in plants. Plant J. 11, 1187–1194. Herrera-Vásquez, A., Salinas, P., Holuigue, L.,;1; 2015. Salicylic acid and reactive oxygen species interplay in the transcriptional control of defense genes expression. Front. Plant Sci. 6, 171. 10.3389/fpls.2015.00171 Huber, A.E., Bauerle, T.L.,;1; 2016. Long-distance plant signaling pathways in response to multiple stressors: the gap in knowledge. J. Exp. Bot. 67, 2063–2079. 10.1093/jxb/erw099 Jayakannan, M., Bose, J., Babourina, O., Rengel, Z., Shabala, S.,;1; 2015a. Salicylic acid in plant salinity stress signalling and tolerance. Plant Growth Regul. 76, 1, 25-40. 10.1007/s10725015-0028-z Jayakannan, M., Bose, J., Babourina, O., Shabala, S., Massart, A., Poschenrieder, C., Rengel, Z.,;1; 2015b. The NPR1-dependent salicylic acid signalling pathway is pivotal for enhanced salt and oxidative stress tolerance in Arabidopsis. J. Exp. Bot. 66, 1865–1875. 10.1093/jxb/eru528 Jiang, C.-J., Shimono, M., Sugano, S., Kojima, M., Yazawa, K., Yoshida, R., Inoue, H., Hayashi, N., Sakakibara, H., Takatsuji, H.,;1; 2010. Abscisic acid interacts antagonistically with salicylic acid signaling pathway in rice–Magnaporthe grisea interaction. Mol. Plant-Microbe Interact. 23, 791–798. 10.1094/MPMI-23-6-0791 Khan, M.I.R., Fatma, M., Per, T.S., Anjum, N. A, Khan, N. A,;1; 2015. Salicylic acid-induced abiotic stress tolerance and underlying mechanisms in plants. Front. Plant Sci. 6, 462. 10.3389/fpls.2015.00462

13

Khokon, M.A.R., Okuma, E., Hossain, M.A., Munemasa, S., Uraji, M., Nakamura, Y., Mori, I.C., Murata, Y.,;1; 2011. Involvement of extracellular oxidative burst in salicylic acid-induced stomatal closure in Arabidopsis. Plant Cell Environ. 34, 434–443. 10.1111/j.1365-3040.2010.02253. x Kim, T., Hauser, F., Ha, T., Xue, S., Böhmer, M., Nishimura, N., Hubbard, K., Peine, N., Lee, B., Lee, S., Robert, N., Jane, E., Schroeder, J.I.,;1; 2012. Chemical genetics reveals negative regulation of abscisic acid signaling by a plant immune response pathway. Curr. Biol. 21, 990–997. 10.1016/j.cub.2011.04.045. Kissoudis, C., van de Wiel, C., Visser, R.G.F., van der Linden, G.,;1; 2014. Enhancing crop resilience to combined abiotic and biotic stress through the dissection of physiological and molecular crosstalk. Front. Plant Sci. 5, 207. 10.3389/fpls.2014.00207 Kuźniak, E., Głowacki, R., Chwatko, G., Kopczewski, T., Wielanek, M., Gajewska, E., Skłodowska, M.,;1; 2014. Involvement of ascorbate, glutathione, protein S-thiolation and salicylic acid in benzothiadiazole-inducible defence response of cucumber against Pseudomonas syringae pv lachrymans. Physiol. Mol. Plant Pathol. 86, 89–97. 10.1016/j.pmpp.2014.04.004 Kwak, J., Nguyen, V., Schroeder, J.,;1; 2006. The role of reactive oxygen species in hormonal responses. Plant Physiol. 141, 323–329. 10.1104/pp.106.079004. ROS Lee, S.C., Luan, S.,;1; 2012. ABA signal transduction at the crossroad of biotic and abiotic stress responses. Plant Cell Environ. 35, 53–60. 10.1111/j.1365-3040.2011.02426. x Leon, J., Lawton, M.A., Raskin, I.,;1; 1995. Hydrogen peroxide stimulates salicylic acid biosynthesis in tobacco. Plant Physiol. 108, 1673–1678. Libik-Konieczny, M., Surówka, E., Kuźniak, E., Nosek, M., Miszalski, Z.,;1; 2011. Effects of Botrytis cinerea and Pseudomonas syringae infection on the antioxidant profile of Mesembryanthemum crystallinum C3/CAM intermediate plant. J. Plant Physiol. 168, 1052–1059. 10.1016/j.jplph.2010.12.015 López-Gresa, M.P., Torres, C., Campos, L., Lisón, P., Rodrigo, I., Bellés, J.M., Conejero, V.,;1; 2011. Identification of defence metabolites in tomato plants infected by the bacterial pathogen Pseudomonas syringae. Environ. Exp. Bot. 74, 216–228. http://dx.doi.org/10.1016/j.envexpbot.2011.06.003 Mauch-Mani, B., Mauch, F.,;1; 2005. The role of abscisic acid in plant-pathogen interactions. Curr. Opin. Plant Biol. 8, 409–414. 10.1016/j.pbi.2005.05.015 Mittler, R.,;1; 2006. Abiotic stress, the field environment and stress combination. Trends Plant Sci. 11, 15–9. 10.1016/j.tplants.2005.11.002 Mittler, R., Blumwald, E.,;1; 2015. The roles of ROS and ABA in systemic acquired acclimation. Plant Cell 27, 64–70. 10.1105/tpc.114.133090 Mohr, P.G., Cahill, D.M.,;1; 2007. Suppression by ABA of salicylic acid and lignin accumulation and the expression of multiple genes, in Arabidopsis infected with Pseudomonas syringae pv. tomato. Funct. Integr. Genomics 7, 181–91. 10.1007/s10142-006-0041-4 Molina, A., Bueno, P., Marín, M.C., Rodríguez-Rosales, M.P., Belver, A., Venema, K., Donaire, J.P.,;1; 2002. Involvement of endogenous salicylic acid content, lipoxygenase and antioxidant 14

enzyme activities in the response of tomato cell suspension cultures to NaCl. New Phytol. 156, 409–415. 10.1046/j.1469-8137.2002.00527. x Mou, Z., Fan, W., and Dong, X.,;1; 2003. Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell, 113: 935-944. Munns, R., Tester, M.,;1; 2008. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 59, 651– 81. 10.1146/annurev.arplant.59.032607.092911 Noshi, M., Maruta, T., Shigeoka, S.,;1; 2012. Relationship between chloroplastic H2O2 and the salicylic acid response. Plant Signal. Behav. 7, 944–946. 10.4161/psb.20906 Olczak-Woltman, H., Masny, A., Bartoszewski, G., Płucienniczak, A., Niemirowicz-Szczytt, K.,;1; 2007. Genetic diversity of Pseudomonas syringae pv. lachrymans strains isolated from cucumber leaves collected in Poland. Plant Pathol. 56, 373–382. 10.1111/j.1365-3059.2006.01550. x Olczak-Woltman, H., Schollenberger, M., Niemirowicz-Szczytt, K.,;1; 2009. Genetic background of host-pathogen interaction between Cucumis sativus L. and Pseudomonas syringae pv. lachrymans. J. Appl. Genet. 50, 1–7. 10.1007/BF03195645 Osakabe, Y., Osakabe, K., Shinozaki, K., Tran, L.-S.P.,;1; 2014. Response of plants to water stress. Front. Plant Sci. 5, 86. 10.3389/fpls.2014.00086 Pandey, P., Ramegowda, V., Senthil-Kumar, M.,;1; 2015. Shared and unique responses of plants to multiple individual stresses and stress combinations: physiological and molecular mechanisms. Front. Plant Sci. 6, 723. 10.3389/fpls.2015.00723 Peleg-Grossman, S., Melamed-Book, N., Levine, A.,;1; 2012. ROS production during symbiotic infection suppresses pathogenesis-related gene expression. Plant Signal. Behav. 7, 409–416. 10.4161/psb.19217 Prasch, C.M., Sonnewald, U.,;1; 2015. Signaling events in plants: Stress factors in combination change the picture. Environ. Exp. Bot. 114, 4–14. 10.1016/j.envexpbot.2014.06.020 Ramegowda, V., Senthil-Kumar, M.,;1; 2015. The interactive effects of simultaneous biotic and abiotic stresses on plants: Mechanistic understanding from drought and pathogen combination. J. Plant Physiol. 176, 47–54. 10.1016/j.jplph.2014.11.008 Rasmussen, R.,;1; 2001. Quantification on the LightCycler In: Rapid Cycle Real-time PCR, Methods and Applications. Meuer, S., Wittwer, C., Nakagawara, K., editor. Heidelberg: Springer, 21–34. Rejeb, I., Pastor, V., Mauch-Mani, B.,;1; 2014. Plant responses to simultaneous biotic and abiotic stress: molecular mechanisms. Plants 3, 458–475. 10.3390/plants3040458 Rivas-San Vicente, M., Plasencia, J.,;1; 2011. Salicylic acid beyond defence: its role in plant growth and development. J. Exp. Bot. 62, 3321–38. 10.1093/jxb/err031 Seo, P.J., Park, C.M.,;1; 2010. MYB96-mediated abscisic acid signals induce pathogen resistance response by promoting salicylic acid biosynthesis in Arabidopsis. New Phytol. 186, 471–483. 10.1111/j.1469-8137.2010.03183. x

15

Sewelam, N., Kazan, K., Schenk, P.M.,;1; 2016. Global plant stress signaling: reactive oxygen species at the cross-road. Front. Plant Sci. 7, 187. 10.3389/fpls.2016.00187 Suzuki, N., Rivero, R.M., Shulaev, V., Blumwald, E., Mittler, R.,;1; 2014. Abiotic and biotic stress combinations. New Phytol. 203, 32–43. 10.1111/nph.12797 Suzuki, N., Basil, E., Hamilton, J.S., Inupakutika, M.A., Zandalinas, S.I., Tripathy, D., Yuting, L., Dion, E., Fukui, G., Kumazaki, A., Nakano, R., Rivero, R.M., Verbeck, G.F., Azad, R.K., Blumwald, E., Mittler, R.,;1; 2016. ABA is required for plant acclimation to a combination of salt and heat stress. PLoS One 11, 1–21. 10.1371/journal.pone.0147625 Szepesi, A., Csiszár, J., Gémes, K., Horváth, E., Horváth, F., Simon, M.L., Tari, I.,;1; 2009. Salicylic acid improves acclimation to salt stress by stimulating abscisic aldehyde oxidase activity and abscisic acid accumulation, and increases Na+ content in leaves without toxicity symptoms in Solanum lycopersicum L. J. Plant Physiol. 166, 914–25. 10.1016/j.jplph.2008.11.012 Unger, C., Kleta, S., Jandl, G., Tiedemann, A.V.,;1; 2005. Suppression of the defence-related oxidative burst in bean leaf tissue and bean suspension cells by the necrotrophic pathogen Botrytis cinerea. J. Phytopathol. 153, 15–26. 10.1111/j.1439-0434.2004.00922. x Verma, V., Ravindran, P., Kumar, P.P.,;1; 2016. Plant hormone-mediated regulation of stress responses. BMC Plant Biol. 16, 86. 10.1186/s12870-016-0771-y Wildermuth, M.C., Dewdney, J., Wu, G., Ausubel, F.M.,;1; 2001. Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 414, 562–565. 10.1038/35107108 Wright, C.A., Beattie, G.A.,;1; 2004. Pseudomonas syringae pv. tomato cells encounter inhibitory levels of water stress during the hypersensitive response of Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 101, 3269–3274. 10.1073/pnas.0400461101 Wu, Y., Zhang, D., Chu, J.Y., Boyle, P., Wang, Y., Brindle, I.D., De Luca, V., Després, C.,;1; 2012. The Arabidopsis NPR1 protein is a receptor for the plant defense hormone salicylic acid. Cell Rep. 1, 639–647. 10.1016/j.celrep.2012.05.008 Xia, X.-J., Zhou, Y.-H., Shi, K., Zhou, J., Foyer, C.H., Yu, J.-Q.,;1; 2015. Interplay between reactive oxygen species and hormones in the control of plant development and stress tolerance. J. Exp. Bot. 66, 2839–56. 10.1093/jxb/erv089 Xu, J., Audenaert, K., Hofte, M., de Vleesschauwer, D.,;1; 2013. Abscisic acid promotes susceptibility to the rice leaf blight pathogen Xanthomonas oryzae pv oryzae by suppressing salicylic acid-mediated defenses. PLoS One 8, e67413. 10.1371/journal.pone.0067413 Yamamoto, Y., Kobayashi, Y., Matsumoto, H.,;1; 2001. Lipid peroxidation is an early symptom triggered by aluminium, but not the primary cause of elongation inhibition in pea roots. Plant Physiol. 125, 199–208. Zeng W, He SY.;1; A prominent role of the flagellin receptor FLAGELLIN-SENSING2 in mediating stomatal response to Pseudomonas syringae pv tomato DC3000 in Arabidopsis. Plant Physiol. 2010; 153:1188–1198. Yi, C., Yao, K., Cai, S., Li, H., Zhou, J., Xia, X., Shi, K., Yu, J., Foyer, C.H., Zhou, Y.,;1; 2015. High atmospheric carbon dioxide-dependent alleviation of salt stress is linked to RESPIRATORY 16

BURST OXIDASE 1 (RBOH1)-dependent H2O2 production in tomato (Solanum lycopersicum). J. Exp. Bot. 66, 7391–7404. 10.1093/jxb/erv435

Fig. 1 Concentration of sodium (A) and potassium (B) ions, leaf relative water content (C) and stomatal pore width (D) in cucumber plants after salt pretreatment, at the time point of P. syringae pv lachrymans (Psl) inoculation (T0) and 2, 5, 7 days after inoculation (T2, T5, T7). Data denoted by different letters are significantly different at P<0.05.

Fig. 2 Cucumber plant response to P. syringae pv lachrymans (Psl) infection assessed 2 and 7 days after infection (T2, T7) in salt pretreated and non-pretreated variants expressed by leaf surface growth, the ratio of shoot and root length, stomatal pore width and relative water content (RWC). Spider plots were drawn using mean values from Psl plants as 100%.

Fig. 3 Disease symptoms (A), loss of plasma membrane integrity evaluated by Evan’s blue staining (B) and disease severity (C) 2, 5, 7 days after P. syringae pv lachrymans (Psl) inoculation (dai) in leaves of salt pretreated (50 mM NaCl+Psl; 100 mM NaCl+Psl) and non-pretreated (Psl) cucumber plants. Salt pretreatment intensified disease symptoms expressed as chlorotic halo around necrotic spots (A, white arrow) as well as plasma membrane injury in tissues adjacent to the sites of inoculation (B, black arrow). The average necrotic spot size on cucumber leaves and Psl population size isolated from infected leaves shown as the percentage of Psl plants were measured 7 days after inoculation. Data in a column denoted by different letters are significantly different at P<0.05.

Fig. 4 Effect of salt stress on O2-. and H2O2 accumulation in cucumber leaves after P. syringae pv lachrymans (Psl) inoculation. O2-. and H2O2 were detected histochemically by NBT and DAB staining, respectively and recorded after salt pretreatment (0) and 6, 24, 72 hours after Psl inoculation. The results of staining in NaCl-treated and infected plants (50 mM NaCl+Psl; 100 mM NaCl+Psl) were expressed as percent of the data for plants infected without salt treatment (% Psl). Data denoted by different letters are significantly different at P<0.05, n=3.

Fig. 5 Identification of SOD isoforms by native PAGE (A), activities of SOD isoforms expressed in arbitrary units (B) and CAT activity (C) in cucumber leaves after salt pretreatment (T0) and 2, 5, 7 days after P. syringae pv lachrymans (Psl) inoculation (T2, T5, T7). White arrows indicate FeSOD isoform spots in the gel occurred after combined action of salt stress and Psl infection. Grey arrows indicate disappearance of FeSOD isoform spots in the gel. Data denoted by different letters are significantly different at P<0.05 (gel electrophoresis was performed in triplicates, n=3).

Fig. 6 Concentration of (A) free salicylic acid (SA) and its conjugates with glucose (SAGC) and (B) abscisic acid (ABA) in cucumber leaves after salt pretreatment (T0) and 2, 5, 7 days after P. syringae pv lachrymans (Psl) inoculation (T2, T5, T7). Data denoted by different letters are significantly different at P<0.05.

Fig. 7 Relative expression of PR1 gene after salt pretreatment (T0) and 2, 5 days after P. syringae pv lachrymans (Psl) inoculation (T2, T5). Expression of PR1 relative to control plants (set to one) and normalized to two reference genes (UBI1, UBI-ep) was calculated using REST. Statistical significance was determined using randomization tests (*P <0.05, **P <0.01 and ***P <0.001). Tables Table 1. Primer sequences for target and reference genes NCBI Accession Forward Primer Reverse Primer number XM_011660558.1

TGCTCAACAATATGCGAACC

TCATCCACCCACAACTGAAC

(PR1) 17

AF104391.1

CCTTATTGACCAACCAGTAGT

GGACAATGTTGATTTCCTCG

CACCAAGCCCAAGAAGATC

TAAACCTAATCACCACCAGC

(UBI-1) AY372537.1 (UBI-ep)

TDENDOFDOCTD

18

×

Report "Interactive effects of salt stress and Pseudomonas syringae pv. lachrymans infection in cucumber: Involvement of antioxidant enzymes, abscisic acid and salicylic acid"

Your name

Email

Reason -Select Reason- Pornographic Defamatory Illegal/Unlawful Spam Other Terms Of Service Violation File a copyright complaint

Description

Close Send

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close