Interference with function of a homeobox gene in Xenopus embryos produces malformations of the anterior spinal cord

Cell, Vol. 59, 81-93,

October

6, 1969, Copyright

0 1969 by Cell Press

Interference with Function of a Homeobox Gene in Xenopus Embryos Produces Malformations of the Anterior Spinal Cord Christopher V. E. Wright, Ken W. Y. Cho, Jane Hardwicke, Robert H. Collins, and Eddy M. De Robertis Department of Biological Chemistry University of California School of Medicine Los Angeles, California 90024-1737

Summary XlHbox 1 is expressed in a narrow band across the cervical region of Xenopus embryos. The gene produces two related proteins: ‘long” and %hort” XlHbox 1 homeodomaln proteins. Injection of antibodies to the long XlHbox 1 protein into l-cell embryos caused a phenotype in which the anterior spinal cord was morphologically transformed Into a hlndbrain-like structure. This alteration was restricted to the region normally expressing long XlHbox 1 protein. Injection of long protein mRNA disrupted segmentation and tissue organization without inhibiting cell proliferation. Injection of short protein mRNA Into l-cell embryos produced spinal cord malformations similar, but not identical, to those caused by the antibodies, suggesting antagonistic roles for long and short XlHbox 1 proteins. We immunostained tadpoles carrying extended hindbrains for N-CAM and consistently found defective organization of spinal nerves over the affected region. Introduction The homeotic genes of Drosophila, most of which contain homeoboxes, are involved in the specification of positional identity along the anteroposterior axis (Lewis, 1978; Akam, 1987). When a homeotic gene is inactivated (for example, by mutation), the body segment in which the gene is normally expressed is transformed, taking on the identity of a more anterior segment (Lewis, 1978; Hafen et al., 1984; Struhl and White, 1985). It is becoming increasingly clear that early vertebrate embryos can be considered to be subdivided, on the basis of homeobox gene expression, into defined regions, or bands, along the anteroposterior axis (Fienberg et al., 1987; Dressler and Gruss, 1988; Holland and Hogan, 1988; Wright et al., 1989a). Nevertheless, interesting distributions of homeobox gene expression along the anteroposterior axis of the early embryo provide only circumstantial evidence for a role in the determination of this axis. At present, there are few studies addressing the role of homeobox genes in vertebrate development. Cverexpression of Hox 7.4 in the appropriate tissues of transgenic mice results in a megacolon phenotype (Wolgemuth et al., 1989). In Xenopus, microinjection of synthetic Xhox-1A mRNA interferes with myotome formation (Harvey and Melton, 1988), and similar experiments with the gene Xhox3 produced a series of graded axial defects (Ruiz i

Altaba and Melton, 1989). Preliminary experiments with transgenic mice will, it is hoped, lead to genetic proof of homeobox gene function (Mansour et al., 1988; Zakany et al., 1988). We are interested in the role of the XlHbox 1 gene (Carrasco et al., 1984) in Xenopus laevis embryogenesis. XlHbox 1 is expressed in a narrow band across the cervical region of the central nervous system (CNS), neural crest, and mesoderm (Oliver et al., 1988; Wright et al., 1989a). Transcription is controlled by two promoters that differentially utilize the same open reading frame to produce two proteins, called the “long” and “short” XlHbox 1 proteins. Both XlHbox 1 proteins have the same homeodomain and the same DNA binding specificity, but the long protein has an extra 82 amino acids at the amino terminus (Cho et al., 1988). The distributions of the two proteins differ along the anteroposterior axis of the embryo. In both mesoderm and CNS, expression of the short protein starts more anteriorly than expression of the long protein (Oliver et al., 1988). In the absence of the genetic analyses possible in other vertebrates, we have explored other methods for defining the function of the long and short versions of the XlHbox 1 homeodomain protein in Xenopus embryogenesis. Attempts to produce phenotypically defective tadpoles by microinjection of antisense RNA have been unsuccessful, presumably owing to the action of the developmentally regulated RNA duplex unwinding activity (Rebagliati and Melton, 1987; Bass and Weintraub, 1987). We previously reported that microinjection of antibodies that react with both types of XlHbox 1 protein was associated with the deletion, over the region of XlHbox 1 expression, of some neural crest derivatives: dorsal fin and dorsal root ganglia (Cho et al., 1988). We have now improved our methods for microinjection into l-cell embryos (ensuring bilateral delivery of substances) and for immunocytochemical analysis of all surviving tadpoles. We have employed these techniques to investigate phenotypes caused by microinjection of antibodies specific for the long XlHbox 1 protein, and ectopic overexpression of long or short XlHbox 1 proteins made from microinjected synthetic mRNAs. We report here the following findings: First, injection of long XlHbox l-specific antibodies into the frog embryo at the l-cell stage results in tadpoles in which the cervical spinal cord, which lies immediately posterior to the hindbrain, is structurally transformed into a hindbrain-like structure. This change is visualized as an extension of the hindbrain posteriorly within the animal. Second, mRNA encoding the long XlHbox 1 protein is a potent disruptor of segmentation, causing gross morphological defects similar to those found previously with overexpression of a different homeobox gene, Xhox-1A (Harvey and Melton, 1988). or neural cell adhesion molecule (N-CAM) (Kintner, 1988). Third, injection of short protein mRNA caused morphological transformations in the spinal cord that are similar to those caused by microinjection of antibodies. Animals in which the morphology of the an-

ABC

1111

D

i

I

Figure 1. An XlHbox I-Ab-Injected

Tadpole with an Extended

Hindbrain

Line diagrams at the top of the figure indicate a control uninjected tadpole (I) and a long XlHbox lAb-injected tadpole with an extended hindbrain (II). The defect in the dorsal fin, by which this tadpole was originally identified, is shown in drawing II. A thick bar above each drawing indicates the anteroposterior band of expression of the long XlHbox 1 protein in Xenopus embryos. This region is also shaded in the CNS; note that in control tadpoles (I) it occupies spinal cord, but in the antibody-injected tadpole (II) it lies in a hindbrain-like structure complete with expanded fourth ventricle. (A-E) (control, tadpole I) and (A’-E’) (antibody-injected, tadpole II) show transverse sections taken at the levels indicated by the vertical arrows in drawings I and II. All sections were immunostained with long XlHbox IAb. The dorsal fin defect indicated in drawing II is visible in (C’) and (LY); compare with (C) and (D). Animals injected with the out-of-frame control antibody (see text and Table 1) are indistinguishable from the uninjected tadpole shown here. The position of the pronephros (PN) is shown. In (C) and (CT, the region of expression of long XlHbox 1 protein, which appears as dark nuclei, is indicated by an arrowhead. Note that posterior to the region of XlHbox 1 expression, the CNS adopts the morphology of normal spinal cord. Abbreviations: BA, branchial arch; DF, dorsal fin; EC, ependymal canal; HB, hindbrain; IV, the hindbrain cavity, called the fourth ventricle; WC, myotome; NO, notochord; SC, spinal cord. Bar = 50 pm.

tenor spinal cord was changed into a hindbrain-like structure exhibited distinct abnormalities in the nerves arising from this region. Results A Tadpole with an Extended Hindbrain We have previously shown that microinjected affinitypurified rabbit polyclonal antibodies are stable for at least 2 days of early Xenopus embryogenesis (Cho et al., 1988). They diffuse rapidly to become uniformly distributed through one side of the embryo (if injected at the 2-cell stage) or bilaterally (if injected at the l-cell stage). Injection of antibodies at the l-cell stage sometimes resulted in deletions of neural crest derivatives that normally express XlHbox 1 (Cho et al., 1988). The antibody used in that study reacted with both long and short XlHbox 1 proteins (antibody B of Oliver et al., 1988). We have now carried out an extensive series of microinjections with affinity-purified

antibodies specific for the long XlHbox 1 protein. These antibodies react only with the 82 amino acid domain that is absent from the short XlHbox 1 protein, and contain no anti-homeodomain activity (see Experimental Procedures). For brevity, these antibodies are hereafter referred to as “long XlHbox 1Ab.” In two preliminary series of injections, some surviving 8-day-old tadpoles that had been injected with long XlHbox 1Ab at the l- to 2-cell stage swam abnormally, usually in circles. No dorsal fin irregularities or deletions were observed among the defective tadpoles, but serial sectioning and immunostaining of the entire animal consistently showed disruption of the normal pattern of XlHbox l-positive neurons, usually unilaterally (data not shown). In the next experiment, long XlHbox 1-Ab was introduced at the l-cell stage and the embryos were allowed to develop for 4 days. A tadpole with a kinked dorsal fin was found (shown in Figure 1, diagram II, and indicated

Frog Homeoprotein 83

Function

in Figures lc’ and 10’). Because dorsal fin defects were correlated previously with deletions of XlHbox l-expressing neural crest cells (Cho et al., 1988) we transversely sectioned and immunostained the whole animal with long XlHbox 1-Ab. In an uninjected tadpole, long XlHbox 1 protein is expressed in neurons of the anterior cervical spinal cord (Figure 1C) as well as in the underlying mesoderm (Wright et al., 1989a; De Robertis et al., 1989). Hindbrain nuclei (Figure 1A) are devoid of long XlHbox 1 protein. The Xenopus hindbrain (medulla oblongata) is distinguished anatomically by a large cavity (the fourth ventricle) closed dorsally by a thin layer of neural tube cells called the roof of the fourth ventricle. Spinal cord, in contrast, has a small tubular cavity (the ependymal canal) that is closed dorsally by a thick layer of neural tissue (see Figures lB-1E). In the antibody-injected tadpole (Figures lA’-E’), XlHbox l-expressing neurons (Figure 1C’) are now found in a structure closed dorsally by a thin layer of cells with a large cavity continuous with the fourth ventricle (see line diagrams in Figure 1). Using the position of the pronephros as an internal landmark (indicated as PN in Figures 1B and lB’), the structurally altered hindbrain-like region of the CNS, which expresses XlHbox 1 protein, is located in a position normally occupied by spinal cord in control tadpoles (compare Figures 1C and 1C’). Moving posteriorly in the experimental tadpole, as soon as XlHbox l-positive neurons are no longer found, the thin roof disappears, the central canal narrows, and the CNS becomes indistinguishable from normal spinal cord (compare Figures 1D and lD’, and IE and 1E’). The defect in dorsal fin structure by which this tadpole was first identified can be seen in Figures 1C’and 1D’. Figure 2 presents higher-magnification CNS sections of the same two tadpoles to show better that the region of XlHbox 1 expression in the antibody-injected tadpole resembles hindbrain more than spinal cord. The morphological transformation of the spinal cord that is described above extends the fourth ventricle to about double its normal length. The anatomy of this expanded region resembles hindbrain and not a more anterior vesicle of the brain. Midbrain, for example, is characterized by having a thicker roof. Whole-mount staining of tadpoles with such morphological transformations (with anti-N-CAM antibodies) confirms that the anterior brain ventricles are normal, with the phenotype resulting from an enlargement of the fourth ventricle at the expense of the spinal cord (see below). Whole-Mount Staining Facilitates Screening for Phenotypes None of the other six survivors from the previous experiment showed the same structural alteration from spinal cord to hindbrain, although most had some disruption in the distribution of spinal cord neurons expressing long XlHbox 1 protein. This low frequency was possibly due to a failure to deliver antibody uniformly and bilaterally, because embryos were injected after the first cleavage furrow was formed. A higher proportion of tadpoles with the spinal cord changed into a hindbrain-like structure was obtained after

technical improvements in our microinjection and analysis procedures. The important points were as follows: First, bilateral delivery of the antibody seems to be essential for producing the spinal cord malformations described in this paper. Injection was therefore timed precisely to precede immediately the formation of a visible first-cleavage furrow. Second, injection at the l-cell stage results in abnormal cleavage in many embryos, presumably because of mechanical disruption of the large mitotic spindle (or other structures) in the fertilized egg; embryos microinjected at the 2-cell stage show vastly increased survival rates. Similar lethality is also found when control antibodies are microinjected at the l-cell stage. Embryos that did not gastrulate or neurulate perfectly were discarded after 48 hr of development. A large proportion of the long XlHbox lAbinjected embryos and the control antibody-injected embryos are therefore eliminated before analysis. By this design it is possible that more severe phenotypes were discarded, but this greatly simplified analysis. The average percentage of embryos analyzed following microinjection at the l-cell stage was 20% (Table 1). Third, the final and most important improvement was the new availability of a whole-mount staining procedure for Xenopus embryos (Dent et al., 1989) which was kindly made available before publication by Dr. M. Klymkowsky. This permits the rapid screening, with antibody markers, of all surviving microinjected embryos for specific internal malformations, rather than relying on external signs such as dorsal fin defects or labor-intensive serial sectioning and staining. In our hands the effectiveness of this procedure is greatly enhanced by the use of albino (ap) embryos (Hoperskaya, 1975) which were used in all further experiments. Antibody Micminjection Alters the Morphology of the Anterior Spinal Cord Applying these procedures, we performed five additional antibody microinjection experiments as summarized in Table 1. The frequency of spinal cord conversion was sometimes as high as 45% of survivors, but averaged around 29%. In Figure 3 we compare two examples of the extreme hindbrain-like phenotype caused by long XlHbox 1Ab injection with a tadpole that was injected with a control antibody specific for a fusion protein derived from an out-of-frame cDNA. In both these tadpoles the fourth ventricle is expanded greatly and appears as a huge vesicle covered by epidermis (Figures 3D and 3F). Such severe alterations accounted for 120ut of 26 (46%) of the affected animals. Other spinal cord transformations tended to be less severe, but in all cases serial sectioning showed an enlarged cavity closed dorsally by a thin roof, thus resembling hindbrain rather than spinal cord. This phenotype is not due to a defect in neural tube closure of the anterior spinal cord because of the presence of a thin roof layer continuous with the roof of the fourth ventricle. The region of CNS occupied by the hindbrainlike structure corresponds to spinal cord of normal tadpoles, considering its position relative to landmarks such as the pronephros (PN in Figure 3). This is also shown

Figure 2. The Alterations

in the Spinal Cord Extend the Fourth Ventricle into Regions Normally Occupied

by Spinal Cord

Higher magnifications of selected sections from the animals shown in Figure 1, giving prominence to the morphology of the CNS. (A-C) are from an uninjected tadpole, (A%‘) from a long XlHbox l-Ab-injected tadpole. The region where nuclei are positive (dark purple staining) for the long XlHbox 1 protein is indicated by an arrowhead in (B) and (B’). Abbreviations: EC, ependymal canal; HB, hindbrain; IV, hindbrain cavity called the fourth ventricle; WC, myotome; NO, notochord; SC, spinal cord. Bar = 50 urn.

using two spinal cord-specific antibody markers. One is long XlHbox 1Ab and the other is an antibody to XlHbox 6 (Figures 2 and 3). The spatial expression of XlHbox 6 determined with the latter antibody will be described in another report, but it is in agreement with the distribution of XlHbox 6 RNA(Sharpe et al., 1967). In brief, XlHbox 6 antibodies immunostain the spinal cord throughout almost its entire length but do not stain the hindbrain (Figure 3A). Tadpoles injected with long XlHbox 1Ab express XlHbox 6 protein in the hindbrain-like transformed region (Figures 3C and 3E). The spinal cord of long XlHbox lAb-injected embryos appears completely normal in posterior regions that do not express XlHbox 1 long protein. Morphological transformations of the spinal cord were never found in control tadpoles injected with the “out-of-frame” control antibody (Table 1). We also microinjected antibodies against two

Figure 3. Injection of Long XlHbox l-Ab Produces Spinal Cord Defects over the Region of Expression of Long XlHbox 1 Protein Three 2.5-day-old tadpoles are presented in pairs of photographs (A, 8; C. D; E, F). (A) and (6) show a tadpole injected with an out-f-frame control antibody. (C)-(F) show two long XlHbox 1-Ab-injected tadpoles with phenotypic defects over the cervical spinal cord. The left-hand panel of each pair shows the embryo immunostained in whole mount with the spinal cord-specific XlHbox 6 antibody. XlHbox 6-positive nuclei in the spinal cord can be seen as dark brown dots over a uniform

lighter-brown background. Over the region of spinal cord alteration in the antibody-injected tadpoles, the CNS resembles hindbrain, being closed dorsally by a thin roof and having a large cavity continuous with the fourth ventricle. Note that the position indicated by the arrow, which is within the region of the CNS affected by injecting long XlHbox lAb, expresses XlHbox 6 protein. Also note the position of the pronephros (PN) in relation to the normal spinal cord or morphologically transformed region of spinal cord, and the region of XIHbox 6 immunostaining. The right-hand panel of each pair shows a transverse section of the same embryo immunostained with long XlHbox 1Ab. The section was taken at the level indicated by the arrow in (A), (C), or(E), as appropriate. In the sections, the dark purple nuclear staining in the CNS shows that long XlHtxrx 1 protein is expressed in the cervical spinal cord of control tadpoles (B), but in the hindbrain-like regions of antibody-injected animals (D and F). Abbreviations: EC, ependymal canal: IV, hindbrain cavity called the fourth ventricle; SC, spinal cord.

Frog Homeoprotein 05

Table 1. Summary

Function

of Phenotypic

Defects Caused

by Microinjecting

Long XlHbox 1-Ab into the l-Cell Stage Xenopus Number with Phenotype

Embryo

(% of Survivors)

Antibody Injected at l-Cell

Age (days)

Total Surviving Embryosa

XlHbox 1 XlHbox 1 XlHbox 1 XlHbox 1

4 3 3 2.5

15 17 11 11

XlHbox

3

30

11 (29%)

1 (3%)

26 (66%)

OOFd OOF OOF

3 2.5 4

16 17 8

0 (0%) 0 (0%) 0 (0%)

0 (0%) 0 (0%) 0 (0%)

16 (196%) 17 (100%) 6 (100%)

XlHbox 6e

3

6

0 (0%)

0 (0%)

XlHbox 6e XlHbox 6* XlHbox 6*

3 2.5 4

10 34 7

0 (0%) 0 (0%) cl (0%)

0 (0%) 0 (0%)

lc

Spinal Cord Transformation 2 4 4 5

(13%) (23%) (36%) (45%)

Reduced Antibody Stainingb

‘Normal”

3 2 0 0

10 11 7 6

(20%) (12%) (0%) (0%)

0 (0%)

(67%) (65%) (64%) (55%)

6 (lCiCI%) 18 (100%) 34 (100%) 7 (100%)

The results summarized here are from five independent experiments using embryos derived from five different pairs of albino frogs. a Embryos that were dead or partially lysed, or that had not undergone perfect neurulation, were eliminated from further analysis. Because injections were at the l-cell stage, survivors vary from 6%-5tI% but are generally within the range of 20% of the injected embryos. b Reduced number of nuclei stained, or much less intense staining per nucleus, as deduced from whole-mount staining with antibodies against XlHbox 1 in comparison with normal sibling tadpoles of the same age. c The degree of spinal cord alteration to hindbrain morphology was determined after N-CAM antibody immunostaining. Because N-CAM is expressed throughout the CNS, it is more difficult to determine the exact number of tadpoles with an extended hindbrain. Hence, the number of morphologically transformed tadpoles is probably underestimated. d OOF is the antibody specific for the peptide sequence encoded by an out-of-frame piece of cDNA, which should never be encountered in Xenopus embryos. e Apparently, all embryos injected with these antibodies develop completely normally. In relation to the defects caused by long XlHbox I-Ab, we therefore consider these as extra controls.

other proteins, XlHbox 6 and XlHbox 6, and failed to find any type of abnormal phenotype; these embryos can be considered as additional controls (Table 1). Abnormal development of the spinal cord has been reported in embryos in which the notochord is removed surgically or by centrifugation or in which myotomes are absent from one side (Huxley and De Beer, 1934; Holtfreter and Hamburger, 1955). We would like to emphasize that in our case the affected embryos have entirely normal notochords and somites (Figures 1 and 3), and thus the malformations cannot be explained by a generalized disruption of mesoderm development. From these data we conclude that antibody microinjection affects CNS morphology only over the normal region of expression of the long XlHbox 1 protein and that the embryos appear normal both posterior and anterior to this region. Internal anatomical landmarks (pronephros) and spinal cord-specific antibodies (antiXIHbox 1 and antiXlHbox 6) show that the malformations occur over the region of the CNS normally destined to form cervical spinal cord. The phenotype caused by bilateral delivery of long XlHbox 1Ab therefore seems to be a morphological transformation of the spinal cord so that it resembles the adjacent anterior structure, i.e., hindbrain. Although the hindbrain-like region still expresses spinal cord markers, the nerve roots that exit from it are distinct from spinal cord nerves (shown below in Figure 7). The possibility that the antibody interferes with XlHbox 1 function at early embryonic stages when the mesoderm imparts anteropos-

terior identity to the CNS will be addressed in the Discussion. Overexpression of Long and Short XlHbox 1 Proteins Since we are interested in determining whether there are functional differences between the long and short XlHbox 1 proteins, we have also investigated the effects of overexpressing each protein in embryos. We made capped synthetic mRNAs that act as efficient translation templates when microinjected into embryos (Krieg and Melton, 1964). As controls, we injected equivalent amounts of mutant XlHbox 1 mRNAs encoding proteins with no DNA binding capacity (see Experimental Procedures). Wholemount immunostaining experiments on embryos of different stages (blastula, gastrula, neurula, and tailbud) that were microinjected at the l-cell or 2-cell stage with normal or mutant XlHbox 1 mRNAshowed that both mRNAs were uniformly distributed and translated, and also that the proteins were equivalently karyophilic and long-lived (Figure 4A and data not shown). The homeodomain mutant was made using site-directed mutagenesis to change the very conserved isoleutine residue in the fourth position of the recognition helix. The wild-type sequence of XlHbox 1 in this region is ERQJKIWFQNR. The fourth residue is conserved (either Ile or Val) in all known homeodomain proteins and in prokaryotic repressors interacts hydrophobically with an alanine in the preceding helix. This interaction helps to position the DNA recognition helix in the helix-turn-helix

Cell 66

structure found in DNA binding homeodomains and prokaryotic repressors (Scott et al., 1989; Otting et al., 1989; Miiller et al., 1989; Mihara and Kaiser, 1989). We reasoned that changing this critical residue to proline would introduce an obligate bend within the DNA recognition helix and consequently inactivate DNA binding. Using P-galactosidase (P-gal) fusion proteins corresponding to the wildtype short XlHbox 1 protein (described in Cho et al., 1988) and the mutated homeodomain version (XIHbox l/pro45), we showed that the mutant protein has lost sequencespecific DNA binding activity (see Experimental Procedures).

Figure 4. Phenotypic XlHbox 1 Protein

Effect of Microinjecting

mRNA Encoding

Long

(A) Synthetic XlHbox 1 mRNAs are efficiently translated in embryos. The embryo was injected at the 2-cell stage with long XlHbox 1 mRNA, incubated until blastula, and then immunostained in whole mount with antibodies against long XlHbox 1 protein. Large amounts of protein are found in all nuclei over half of the embryo, corresponding to cells that received the mRNA (intense dark staining in the upper region). At later stages, such as neurula and tailbud (not shown), cells containing long XlHbox 1 protein are found unilaterally through all three germ layers (although they are less stained at the tailbud stage). (B) Phenotypic effect of unilateral microinjection of long XlHbox 1 protein mRNA. This is a representative selection of four embryos exhibiting different degrees of the “bent” phenotype caused by unilateral injection of long protein mRNA at the 2-tell stage. The whole embryos are oriented anterior to the left, but are viewed as they come to rest naturally (mostly from a dorsal/lateral aspect). Whole-mount immunostaining shows that nuclei of all cells on the concave side (the side that received synthetic mRNA) contain long XlHbox 1 protein. (C) Horizontal longitudinal section (i.e., viewed from the dorsal aspect) of an uninjected control tadpole, stained with Hoechst 33258, showing normal bilateral ordered arrangement of myotome nuclei (arrowheads). Embryos microinjected at the 2-cell stage with mutant mRNA

Overexpression of Long XlHbox 1 Protein Disrupts Morphogenesis As shown in Figure 4A, long protein mRNA injected unilaterally at the 2cell stage results in the production of long XlHbox 1 protein in vast quantities over half of the early embryo. Hence, the synthetic mRNA diffuses fairly quickly and becomes incorporated into almost all progeny cells. We have not quantitated the amount of protein produced in this way, but each blastula nucleus shown in Figure 4A must have many times more (at least lOO-fold more, based on immunostaining development times and dilutions of the detecting antibody) than the level of endogenous XlHbox 1 protein found in normal embryonic cells expressing XlHbox 1. Figure 4 shows the phenotypic defects resulting from unilateral delivery of XlHbox 1 long protein mRNA into the Xenopus embryo at the 2-cell stage. Figure 46 shows a representative series of four 2-day-old tadpoles that exhibit different degrees of abnormal bending or kinking. Whole-mount staining of these tadpoles with long XlHbox 1Ab shows that the concave side of the bent tadpole corresponds to the side that received the mRNA. The frontal (horizontal longitudinal) section in Figure 4C shows the normal segmentation of a control tadpole, with the aligned myotome nuclei visualized with Hoechst 33258 (arrowheads). Figure 4D shows that, while the uninjected side appears completely normal, segmentation on the injected side of the experimental animal is nonexistent. Furthermore, the CNS and mesoderm appear equally perturbed, both from sections and whole mounts. The long XlHbox 1 protein does not inhibit cell proliferation; indeed, there are more nuclei, and hence more cells, in the side that received the mRNA. We cannot tell whether expression of the long XlHbox 1 protein on the injected side caused elimination of specific cell types, but we do conclude that the bent phenotype does not result from nonspecific cell death. It is conceivable that overproduction of long

encoding the long XlHbox l/pro45 protein, which is incapable of sequence-specific DNA binding, are indistinguishable from uninjected tadpoles. ANT, anterior; POST, posterior. (D) One of the bent tadpoles shown in (8) was sectioned in the same orientation as (C) and stained with Hoechst 33256. Segmentation of the mesoderm and organization of the CNS in the left side of the embryo (bottom) are greatly disrupted. The uninjected side (top) appears relatively normal (compare the aligned myotome nuclei indicated by the arrowheads in [C] and [D]).

Frog Homeoprotein 87

Function

B

A

ANT.

c

DF

POST,

D

. .

Xllibox 1 protein causes embryonic cell8 to acquire new cell surface characteristics that then prevent correct cellcell interactions necessary for normal morphogenesis and segmentation. Experiments to test this hypothesis are feasible. Essentially identical results have been obtained in three separate experiments using different batches of eggs and different RNA preparations: 18 out of 24 survivors exhibited this bent phenotype (87%). When the long Xllibox 1 mRNA was delivered bilaterally at the l-cell stage, gastrulation movements were arrested although cell division continued (data not shown). This behavior is quite different from that observed in embryos damaged by a variety of nonspecific treatments (such as high salt concentrations) that also interfere with gastrulation but cause exogastrulation rather than gastrulation arrest. Microinjection of the long XlHbox l/pro45 mRNA did not result in any disruption of segmentation, and all tadpoles were apparently normal. We did not observe any obvious “dominant negative phenotypes” (Herskowitz, 1987) associated with the introduction of XlHbox l/pro45 mutant proteins, but this interesting possibility ha8 not yet been systematically explored. Our results with long XlHbox 1 mRNA injections are very similar to those reported by Harvey and Melton (1988) for Xhox-lA, another homeobox gene of the Antennapedia class. In our case, because XlHbox 1 is not expressed in myotome (see, for example, Figure 5B), it cannot be argued that altered segmentation results from overexpression of XlHbox 1 in its normal tissue of expression. It is possible that disrupted segmentation is a phenotype of ectopic expression of many, but not all (see results for short XlHbox 1 protein below), Antennapedia-type homeodomain proteins. Disordered myotomes were also as-

Figure 5. Effect of Unilateral Injection at the Z-Cell Stage of mRNA Encoding the Short XlHbox 1 Protein The top two photographs (A, B) are of an embryo injected with mutant short XlHbox l/pro45 protein mRNA. Uninjected control tadpoles were identical. The bottom pair (C, D) corresponds to an embryo injected with short XlHbox 1 protein mANA. (A) and (C) show dorsal views of embryos immunostained in whole mount with long XlHbox 1Ab. (B) and (D) show transverse sections taken at the level of the arrows in (A) and (C), respectively, immunostained with long XlHbox I-Ab; positive nuclei appear black. Arrowheads in (C) and (D) indicate the reduced number of neurons expressing XlHbox 1 caused by producing short XlHbox 1 protein on this side of the embryo. In (8) and (D), XlHbox l-positive nuclei are present in the lateral plate mesoderm (Oliver et al., 1988; Wright et al., 1989a). Mydome cells do not express the XlHbox 1 protein. Abbreviations: ANT., anterior; POST., posterior; DF, dorsal fin; ENDO, endoderm; LPM, lateral plate mesoderm; MYO, myotome; NO, notochord; SC, spinal cord. Bar = 50 pm.

sociated with the injection of mRNA for N-CAM (Kintner, 1988), suggesting that segmentation is a delicate process that can be interfered with in a number of ways. From these experiments we conclude that ectopic overexpression of the long XlHbox 1 protein interferes greatly with development of the mesoderm and the CNS, fully suppressing segmentation and myotome formation but not inhibiting cell proliferation. Furthermore, a functional homeodomain capable of binding to DNA is necessary for these phenotypes. Misexpression of Short XlHbox 1 Protein Also Produces Morphological lkansformations of the Spinal Cord The short protein is also synthesized in large amounts from microinjected mRNA (although the translational efficiency is about one-half that of long protein mRNA, based on whole-mount immunostaining data). As shown in Figure 5, unilateral injection of short protein mRNA at the 2-cell stage has a very different effect on embryogenesis from that of long protein mRNA. Segmentation is not disrupted and thus embryos do not become bent, but staining with long XlHbox 1Ab reveals many fewer positive neurons on the injected side (compare Figure 5A with 5C, and 58 with 5D). As visualized with antiXlHbox 8 antibodies on serial sections (not shown), neurons positive for XlHbox 8 were also reduced in number on the injected side, but the asymmetry extended into more posterior regions of the CNS that are outside of the domain of XlHbox 1 expression (data not shown). This Suggests that the short XlHbox 1 protein somehow interferes with the action of multiple genes, not only XlHbox 1, controlling neuronal differentiation over a wide region of the CNS (see Discussion).

Ceil

aa

B’

C’

D’

Figure 6. Injection of mRNA Encoding

Short XlHbox 1 Protein Changes

the Morphology

of Anterior Spinal Cord to That of Hindbrain

(Top row) Control 3-day-old tadpole injected with mutant short XlHbox l/pro45 mRNA. Uninjected control tadpoles were identical. (Bottom row) Sibling 3-day-old tadpole injected with short XlHbox 1 protein mRNA. (A, A) Tadpoles were immunostained in whole mount with XlHbox 6 antibody and viewed dorsally. Specific nuclear staining is observed in the CNS, which runs horizontally from hindbrain to spinal cord, with XlHbox 6 staining beginning just ahead of arrow B or B’. XlHbox 6 is found in the spinal cord of the control tadpole, but in tadpoles showing cervical spinal cord malformations, XlHbox 6 is expressed in the new hindbrain-like region as well as the more posterior normal spinal cord. The unstained pronephri appear symmetrically as two darkened regions on each side of the control tadpole, but were accidentally removed together with the endoderm from the embryo injected with wild-type mRNA. The phenotype was analyzed further by serial sectioning and immunostaining with antibodies specific for XlHbox 1 and XlHbox 6. (B-D; S-D’) Transverse sections taken at the levels indicated by the arrows in (A) and (A)‘, respectively. All sections were immunostained with XlHbox 6 antibody, with positive nuclei appearing as black dots within the CNS. Comparison of the two rows of photographs shows that the affected cervical region resembles hindbrain rather than spinal cord, and expresses the spinal cord-specific XlHbox 6 protein over the normal anteroposterior limits. The alteration shown here extends more posteriorly than that seen in the long XlHbox l-Ab injection experiments. Abbreviations: HB, hindbrain; IV, hindbrain cavity called the fourth ventricle; SC, spinal cord.

The frequency of this defect in the surviving microinjetted tadpoles was high: for three separate preparations of short protein mRNA and separate batches of embryos, the same defect was found in a total of 22 out of 36 survivors (610/o). As far as we can determine from whole mounts, the normal mesodermal band of long XlHbox 1 protein expression that girdles the embryo is not affected by this misexpression of short XlHbox 1 protein. This phenotype was never found in many control embryos overexpressing mutant short XlHbox l/pro45 protein. When short XlHbox 1 protein mRNA was delivered bilaterally by careful injection at the l-cell stage, we observed altered morphology in the CNS so that the hindbrain appears posteriorly extended into the region that is normally anterior spinal cord (Figure 6). This phenotype is similar to that caused by injecting long XlHbox 1Ab at the l-cell stage, with the important difference that the malformation extends more posteriorly, significantly beyond the cervical region that normally expresses long XlHbox 1 protein. This is consistent with the extended asymmetry in XlHbox 6 expression associated with unilateral delivery of short XlHbox 1 mRNA, noted above. In contrast, the antibody was effective only over the normal region of long XlHbox 1 protein expression. We encountered this rather drastic phenotype in a total of 14 of 41 survivors (34%) using different mRNA preparations and different batches of embryos (9 other survivors showed a less severe phenotype). Such alterations were never seen in uninjetted embryos, and tadpoles that had been injected with

short XlHbox l/pro45 mRNA or the out-of-frame antibody preparation always appeared entirely normal (51 of 51 survivors). From these sets of synthetic mRNA injection experiments, we conclude that there is a significant difference between the phenotypes caused by overexpression of the long and short XlHbox 1 proteins. The long protein disrupts segmentation, while the short protein causes unilateral asymmetries in the CNS or bilateral spinal cord malformations that resemble hindbrain, but extend more posteriorly than those produced by antibodies. These phenotypes are dependent on the sequence-specific DNA binding activity of the homeodomain. The effect of overexpressing short XlHbox 1 protein is therefore similar to that caused by inhibiting long XlHbox 1 protein function with antibodies. This implies some degree of antagonism in the function of short and long XlHbox 1 proteins in embryogenesis. Possible explanations for this will be explored in the Discussion. Abnormal News Roots Arise from the Hindbrain-like Region Because the transformed hindbrain-like region of the CNS produced by these manipulations still expresses two spinal cord markers, it is important to look for, in addition to the morphological appearance (large fourth ventricle closed dorsally by a thin roof), other criteria supporting the view that the structural changes seen reflect local changes in positional identity such that the cervical spinal

Frog Homeoprotein 09

Function

Figure 7. Defects in Spinal Nerves over the Affected Region of the Anterior Spinal Cord Tadpoles at 3 days of age were immunostained in whole mount with anti-N-CAM antibodies. (A) N-CAM staining pattern in a normal uninjected tadpole at low magnification. (6) High magnification of the same tadpole shown in (A). (C)A tadpole injected with long Xllibox I-Ah at the l-cell stage, carrying an extended hindbrain. Note the three roots entering the ganglion of the Ix/x cranial nerves and the meshwork of axons (mixing with axons coming from the vagus) that replaces the discrete bundles of spinal nerves seen in normal tadpoles. (D) A tadpole injected at the l-cell stage with mRNA encoding the short XlHbox 1 protein. Note the more extensive spinal cord malformation and the replacement of spinal nerves with a meshwork of axons that now occupies a much wider region than in the antibody-injected animal (C). Abbreviations: E, eye; AV, auditory vesicle; IX and X, ninth and tenth cranial nerves; SN, spinal nerves; M, diffuse meshwork of axons that would normally be discrete spinal nerves.

cord adopts a more anterior character. To this end, we took embryos in which spinal cord malformations had been produced by injecting either long XlHbox 1-Ab or short XlHbox 1 mRNA, and stained them in whole mount with anti-N-CAM antibodies. In Xenopus, N-CAM is a neuralspecific marker (Jacobson and Ruthishauser, 1986; Kintner and Melton, 1987). Figure 7A shows that this antibody decorates not only CNS but also peripheral nerves. In the 3-day-old tadpole, the peripheral nerves exhibit a characteristic and very reproducible pattern (Nieuwkoop and Faber, 1969). The reiterated spinal nerves can be clearly distinguished, as can the individual cranial nerves. Over the region of interest (Figure 76), the auditory vesicle (innervated by cranial nerve VIII) is followed by the roots of nerves IX (glossopharyngeal) and X (vagus), which fuse into a common ganglionic complex (the nodose ganglion). Nerves IX and X emerge from this ganglion in an invariant pattern: nerve IX emerges in an anterior and ventral direction, whereas nerve X bends posteriorly as it fans out into a diffuse meshwork innervating the internal organs. When viewed laterally, there is a region devoid of N-CAM staining until the first spinal nerve is reached. All the spinal nerves migrate ventrally as independent tight bundles, appearing as lines of staining perpendicular to the CNS. Figures 7C and 7D depict tadpoles in which spinal cord malformation was achieved by microinjecting long XlHbox 1Ab or short protein mRNA, respectively. The main alteration seen reproducibly with both treatments is the failure to form discrete spinal nerves over the affected region. Instead, the newe roots form a diffuse meshwork of axons that migrate irregularly through the flank of the animal and mix together with axons from the vagus nerve (particularly well visualized in Figure 7D). Roots emerging posterior to the affected region form normal spinal newes, and cranial newes anterior to the auditory vesicle seem unaffected. A number of alterations in the patterns of the IX and X cranial nerves are often seen. For example, the tadpole in Figure 7D is missing the IX and X newes, which become incorporated into the same meshwork formed from the roots arising in the transformed spinal cord region. The antibody-injected tadpole in Figure 7C clearly shows three roots entering the common IX/X ganglion, instead of two (compare with the control in Figure 78). Nerve IX, but not nerve X, was sometimes missing in other tadpoles. From this we conclude that although the morphologically transformed region of the CNS expresses two spinal cord markers, the newes arising from it do not behave as spinal nerves. In both antibody- and mRNA-injected embryos, the spinal newes in the affected segments form a diffuse meshwork. A variety of defects in cranial nerves were observed, but no individual defect was as reproducible as the change from discrete spinal newes to an aberrant axon network. Discussion In this paper we show that microinjected antibodies specific for the long Xlfibox 1 protein cause a change in the structure of the anterior spinal cord so that it resembles the adjacent anterior region of the CNS, namely, the hind-

brain. This phenotype was restricted to the normal cervical region of expression of the long XlHbox 1 protein, and results in a doubling of the length of the fourth ventricle. It was seen neither in embryos that had been injected with an out-of-frame antibody nor in uninjected control tadpoles. We also show that similar structural transformations were associated with microinjection of an mRNA encoding the short version of the XlHbox 1 protein, which has an inhibitory effect on the development of neurons expressing long XlHbox 1 protein. In contrast, injection of mRNA encoding the long XlHbox 1 protein caused gross morphogenetic disruptions from which a specific phenotype could not be determined. No defects were seen in embryos that were microinjected with synthetic mRNAs encoding long or short XlHbox 1 proteins with a mutant homeodomain that is incapable of sequence-specific DNA binding. These data indicate that XlHbox 1 proteins play a role in the correct morphogenesis of the anterior spinal cord that is dependent on their ability to recognize specific DNA target sequences. Mechanism Resulting in Morphological Transformation of the Spinal Cod It is clear from a number of classical transplantation experiments in amphibia that the anteroposterior polarity of the CNS results from an instructive induction by the underlying mesoderm (reviewed by Hamburger, 1988). In light of the alteration of the anterior spinal cord reported here, the question arises: Where did the injected substances exert their effect? The pattern of expression of XlHbox 1 is such that, during normal embryogenesis, the protein is found in a band in the mesoderm that is in precise alignment with the region of expression in the anterior spinal cord (Wright et al., 1989a; De Robertis et al. 1989). Since the antibodies become distributed throughout all of the embryo, it is possible that they act by inhibiting gene products in the neural tube. Conversely, it is equally possible that the antibodies interfere with long XlHbox 1 protein in the mesoderm during the relatively small window of time when it is imparting values of anteroposterior polarity to the neuroectoderm (discussed by De Robertis et al., 1989). At early times of embryogenesis, inhibition of relatively small amounts of XlHbox 1 protein (either in the neuroectoderm or in the mesoderm) could change positional identity, and hence morphology, during the critical period in which the body plan is established. As a result, the anterior spinal cord would adopt the morphology of a more anterior structure, with a fourth ventricle closed dorsally by a thin roof. At later stages, however, continuing inductive signals may overcome the inhibition and cause the production of more XlHbox 1 protein, a spinal cord marker, even in regions that have already adopted a hindbrain morphology. Whether the effect of injected antibodies is exerted in the neuroectoderm or the mesoderm could, in principle, be distinguished by grafting normal neural plate fragments onto embryos microinjected with antibody, and vice versa. However, such experiments would be difficult in light of the narrow band of normal XlHbox 1 expression,

the need for uniform delivery of antibodies, and our lack of expertise in this technique. Ectopic Overexpression of Homeobox Proteins from mRNA How is it that two different substances-antibodies specific for the long XlHbox 1 protein and mRNA encoding short XlHbox 1 protein-can cause related phenotypes in microinjected embryos? It is possible that both materials inhibit some aspect of XlHbox 1 function necessary for the acquisition of a positional identity along the anteroposterior axis, and subsequently the morphology of the cervical region of the CNS. The defect caused by the antibody, which is restricted to the region of normal expression of long XlHbox 1 protein, could then be explained on the basis of specific inhibition wherever long XlHbox 1 protein is expressed. However, overexpression of the short XlHbox 1 protein produces changes of spinal cord to hindbrain-like morphology encompassing a much wider region of the CNS than that occupied by XlHbox 1 in normal tadpoles. A number of possible mechanisms can be envisaged whereby the short protein causes effects similar to those caused by interfering with the function of the long protein. First, we cannot tell whether anterior spinal cord expresses both long and short protein or the long protein alone, since an antibody specific for the short protein cannot be made (see Oliver et al., 1988) but it is clear that the hindbrain expresses only the short form. Ectopic overexpression of the short protein might, in a dominant manner, cause wide regions of the CNS to adopt hindbrain-like morphology (Figures 6A’and 7D). Perhaps consistent with this hypothesis, tadpoles injected with short protein mRNA show some degree of reduction in the size of anterior neural structures (for example, note the smaller eye in Figure 7D) as well as a greatly elongated hindbrain. Second, because the short and long versions of the XlHbox 1 protein share the same homeodomain and exhibit the same DNA target site specificity (Cho et al., 1988) it is possible that overproduction of short protein results in competition for target sites normally bound by the long protein (or other related proteins). In this scenario, such binding might inhibit genes that are normally activated by long XlHbox 1 protein. Third, it is possible that misexpression of short XlHbox 1 protein influences the activity of other genes in the same homeobox gene complex. (In human, the promoter of the homolog of the short XlHbox 1 protein is thought to be a “master promoter” involved in the transcription of at least two more homeobox genes lying downstream in this complex, as reported by Simeone et al. [1988] and Acampora et al. [1988]). It is equally possible that other loci involved in anteroposterior identity and subsequent morphology are influenced by this transcription factor. All of these explanations presented here are, necessarily, highly speculative because the target genes for the XlHbox 1 protein are unknown. The interpretation of the short protein mRNA injection experiments, therefore, is less straightforward than interpretation of the antibody microinjection experiment.

Frog HomeoproteinFunction 91

Antibodies and Spinal Cord Abnormalities The results presented here suggest that injection of antibodies specific for the long XlHbox 1 protein specifically inhibits some aspect of XlHbox 1 function necessary for normal morphogenesis of the anterior spinal cord. Injection of a control antibody directed against an artificial protein encoded by an out-of-frame piece of DNA produced absolutely normal tadpoles. Other antibodies directed against non-N-terminal regions of the Xllibox 8 and XlHbox 8 homeodomain-containing proteins were also apparently innocuous, at least at the stages of embryogenesis with which we are concerned here (Table l), and acted as additional controls. Thus it seems unlikely that all antibodies are capable of blocking protein function in vivo. Perhaps anti-N-terminal antibodies, such as that used here for XlHbox 1, are more efficient in this respect. In future it might be informative to microinject antibodies or mFlNAs corresponding to other homeobox genes to see whether morphogenesis of other regions of the vertebrate CNS is controlled by different homeobox gene products. Our results show that a region of the CNS that was originally destined to form anterior spinal cord adopts a morphologytypical of hindbrain, having a wide lumen continuous with the fourth ventricle, with the neural tube being closed dorsally by a thin roof. We do not know whether the affected region of the cervical spinal cord expresses a biochemical marker specific to hindbrain, but such markers should be available soon. For example, transcripts from the Krox-20 gene are found only in the hindbrain of the normal mouse embryo (Wilkinson et al., 1989). A recently developed anti-engrailed antibody (Pate1 et al., 1989) has been shown to cross-react in Xenopus embryos mostly over the midbrain and not over the posterior parts of the hindbrain that we are concerned with here (Brivanlou and Harland, 1989). However, we investigated the nature of the nerves arising from the affected region in our transformed tadpoles using the N-CAM marker. We consistently found a lack of properly organized spinal nerves over the transformed region, with the roots forming a complex and diffuse meshwork of axons (Figure 7). This phenotype was observed in tadpoles transformed both by antibody injection and by short protein mRNA injection, and is a behavior somewhat reminiscent of cranial nerves such as the vagus rather than of spinal nerves, which form tight bundles. Less frequently, other changes were observed in the pattern of emerging cranial nerves. Could the apparent transformation of spinal cord into hindbrain, presumably caused by inhibiting XlHbox 1 function, be termed a “homeotic transformation”? In Drosophila, for example, mutations that repress Ultrabithorax function in parasegment 5 of the embryo homeotically transform it into the immediately anterior parasegment 4, so that anterior wing emerges from what would otherwise have been anterior haltere (Casanova et al., 1985; Peifer and Bender, 1986). It is possible, though unproven, that the spatially sequential activation of homeobox genes along the anteroposterior axis controls vertebrate morphogenesis in the same way that it does in Drosophila (Gaunt et al., 1988; Graham et al., 1989). If this were so, then the prediction would be that inhibition of XlHbox 1

function should cause the anterior spinal cord to adopt the next most anterior structure. The phenotype observed in our experiments could be considered consistent with this hypothesis. Experimental

Procedums

Microinjection

Procedures Most of the embryos used in this study were from pairs of albino frogs or from an albino mother fertilized with wild-type male sperm. Embryos were fertilized in vitro, dejellied, and washed back into 0.1 x M B S (Gurdon, 1976) as described in Gho et al. (1988). For l-cell injections, delivery was precisely timed as described in Cho et al. (1988). In brief, some of the fertilized eggs were left at room temperature; the rest were put at 1PC. When the eggs at room temperature started lo show a firstcleavage furrow, aliquots of eggs were removed from 17°C for microinjection. For unilateral delivery, injection was delayed until first cleavage was absolutely complete. We have adopted the use of a gas-driven precision microinjection apparatus (Narashige USA, Inc.) that delivers small volumes (routinely 25 nl) very reproducibly and with a long injection period; an injection period of 4 set gives the best survival. All injected substances were dissolved in 15 m M Tris-HCI (pli 7.5). 88 m M NaCI, 1 m M KCI (Gurdon, 1976). Affinity-purified antibody preparations were injected at 50 pg/ml (measured by the Bradford assay). mRNA was injected at 0.3-0.4 mg/ml in all cases. After injection. embryos were maintained in 0.1x M B S until fixation for embedding and setiioning, or before whole-mount immunostaining. Production and Purlflcatlon of Antibodies Rabbit polyclonal antibodies were raised against a b-gal fusion protein corresponding to the long XlHbox 1 protein sequence upstream of the homeodomain. Antiserum was depleted and specific antibodies were affinity purified as described (Oliver et al., 1986) on a matrix of fusion protein corresponding to amino acids 2-82 of the long XlHbox 1 protein. This antibody has been referred to previously as XlHbox 1 antibody C (Oliver et al., 1988). For the control antibody, a piece of DNA from an XlHbox 4 cDNA was fused out of frame to &gal. The affinitypurified control antibodies are thus directed against a 56 amino acid nonsense sequence. Preparation of antiXlHbox 8 antibodies is described in Wright 81 al. (1989b). The preparation of antibodies specific for XlHbox 6 will be described elsewhere (C. V. E. W., E. Morita, D. Wilkin, and E. M. D. FL, unpublished). Affinity-purified rabbit polyclonal antibodies against Xenopus N-CAM were a gift from Dr. C. M. Chuong, University of Southern California. Whole-Mount and Section Immunostelnlng Whole-mount staining of Xenopus embryos was performed essentially according to Dent et al. (1989). TBST (10 m M Tris-HCI IpH 7.0].150 m M NaCI, 0.05% Tweet+20) was used for washes and as buffer for the diaminobenzidine-hydrogen peroxide staining reactions. A pH of 6.5-7.0 gives more intense staining. Primary antibodies were diluted 1:30 in blocking solution (20% newborn calf serum in TBST) and incubated with the embryos in microfuge tubes at room temperature overnight with gentle rocking. Peroxidase-coupled secondary antibodies were reconstituted according lo the supplier (Cappell) and diluted 1500 in blocking solution. Secondary antibody was incubated overnight at 4OC. We sometimes used a third step of incubation with PAP (peroxidase-anti-peroxidase complex; Cappell) to amplify the immunostaining signal, which worked well provided that the PAP was optimally titrated. Whole mountswere positioned for photography by the following pm cedure. A small cube of aqueous 1% agarose gel was firmly and eccentrically placed in a depression slide, and clearing solution (also called BABB; Dent et al., 1989) was then poured over it. Cleared embryos were carefully pressed to the block, which temporarily positions them for dorsal and other views. Subsequently, the animals were prized off without damage. For immunohistological staining, embryos that had been wholemount stained were prepared for embedding by removing the clearing solution and rocking the embryos sequentially in methanol (three times for 10 min), ethanol (twice for 15 min). and isopropanol (twice for 30 min). The embryos were then embedded in wax, and 8-10 urn sec-

Cell 92

tlons were cut and immunostamed essentially as described in Oliver et al. (1988). Embryos that were not whole-mount immunostained were fixed by immersion into a modified Bouin’s fixative for 2 hr before embedding in paraffin (Oliver et al., 1988). Synthesis of Artificial mRNAs Encoding Long and Short Xlliboxl Proteins We initially tried using the SV40 early promoter to express Xllibox 1 proteins from DNA expression vectors. We found, however, that synthetic mRNA resulted in a more uniform and reproducible production of protein; the DNA tended to be toxic, and cells expressing the proteins were highly mosaic (not shown). Therefore, synthetic mRNAs encoding either the short or long version of Xllibox 1 protein were injected into embryos and the survivors were screened for phenotypic defects. Long Protein mRNA The construct pSP64-Xpm (Kneg and Melton, 1984) was restricted with Ncol and Xbal and filled in. The globin insert was then removed from the mixture of digestion products. The entire EcoRl fragment of the p15 cDNA, corresponding to the transcript encoding the long XlHbox 1 protein (Cho et al., 1988), was filled in and inserted into this vector. The junction of filled-in NcollEcoRl sites, checked by sequencing, produced the authentic initiator methionine of the long XlHbox 1 protein The long protein RNA thus has an approximately 50 nucleotide Xenopus b-globin leader immediately adjacent to the initiator methionine. We call the resulting plasmid X!3 ~15. Sense RNA was produced from Xbal-linearized plasmid using SP6 RNA polymerase (United States Biochemical Corp.) and standard procedures. We 5’-capped the RNA using cap analog (Pharmacia catalog number 27463502) at a lo-fold molar excess over GTP during the polymerase reaction (as suggested by Krieg and Melton, 1987). Short Protein mRNA The sequence from nucleotide 217 to the 3’ end of the p15 cDNA was excised using an internal BamHl site and the EcoRl site in the 3’ linker, and filled in. This fragment encodes the short XlHbox 1 protein, with an additional 30 nucleotides of short protein leader. pSP64-Xl3m was restricted with Ncol and Xbal and blunt ended with the exonuclease activity of T4 DNA polymerase. Thus we removed an initiator methionine that would have been upstream of the real initiator for short XlHbox 1 protein. We call the resulting plasmid Xgm ~10. Again, linearization with Xbal allowed the production of sense RNA by SP6 RNA polymerase. We also produced short protein mRNA in another form, without the 50 nucleotide Xpm leader. To do this we took the 3’ BarnHI-EcoRI fragment of the p15 cDNA and subcloned it into Smalcut pGEM1 (Promega Biotec) in the orientation allowing the production of sense RNA by T7 RNA polymerase (Pharmacia). Translation of Synthetic mRNAs Long protein and short protein mRNAs were equivalently translated in vitro, but long protein mRNA was better translated (about P-fold) in oocytes and embryos. Both short protein mRNAs, with or without the Xbm leader, were equivalently translated in vitro (reticulocyte and wheat germ lysate; Amersham) and in vivo (oocyte and embryo injection). Both short protein mRNAs were also equivalent in their phenotypic effects in microinjected embryos. The quality of all synthetic mRNAs was checked by agarose gel electrophoresis before proceeding with microinjections. Where short protein mRNA was injected, the translation product could not be detected with the long XlHbox l-Ab. In these cases we used an antibody that reacts with both the long and short versions (called antibody B in Oliver et al., 1988). Site-Directed Mutagenesis Oligonucleotide-mediated site-directed mutagenesis was performed with a commercial kit (Amersham). We subcloned DNA encoding the long Xlfibox 1 protein (~15 cDNA) into Ml3 mp8 and used the oligonucleotide CAGAGCGGCAGCCCAAAATCTGGTTC to change the normal codon (ATC) of the fourth residue of the homeodomain DNA recognition helix to proline (CCC). We then reinserted these mutated sequences into the SP6/T7 plasmids described above. This allows the production Of mRNA encoding mutant long or short XlHbox I identical in every respect to the wild-type mRNAs except for the single codon change in the homeobox. Fusion Proteins and Gel Retardation Fusion Proteins pCW4, corresponding

to the XlHbox 1 short protein

fused to p-gal (prewously described in Cho et al., 1988) and mutant pCW4/pro45 were induced and purified from F’llrecA as described in Oliver et al., (1988). Purified fusion proteins were dialyzed against lx binding buffer (20 m M HEPES [pH 7.91, 120 m M KCI, 8 m M MgClp. 0.2 m M EDTA, 0.5 m M OTT, 0.2 mglml BSA. 20% [v/v] glycerol) containing 0.5 m M PMSF and analyzed by SDS-polyacrylamide gel electrophoresis to check that the ratio of full-length fusion protein to b-gal was the same. The concentrations of pCW4 and pCW4/pro45 were 3.0 and 3.5 mglml. respectively. We have previously used DNAase I footprinting to define an in vitro bmding site for XlHbox l-p-gal fusion proteins in a Xenopus homeobox gene complex (Cho et al., 1988). We synthesized two oligonucleotides, GATCGCAATTAAACTATAAAGCAATT and CGTTAATTTGATATTTCGTTAACTAG, corresponding to one of the footprinted sequences (Fl, Cho et al., 1988) with the addition of BarnHI-compatible ends. The two oligonucleotides were mixed, annealed, and end-labeled with 32P using polynucleotide kinase. Gel retardation was performed essentially as described by Sturm et al. (1987). Two microliters (6 vg or 7 pg) of protein was mixed with 5 ~1 of 2x binding buffer and O-2.5 pg of poly(dl-dC) (Pharmacia) in a final volume of 10 1.11.The sample was preincubated at room temperature for 10 min. Then 1 ~1 (approximately 10,000 dpm) of probe was added. After incubating for a further 15 min, 11 VI of 2x loading buffer (10% glycerol, 20 m M DTT) was added. The samples were applied to 6% acrylamide gels running in 40 m M Tris-glycine (pH 8.5) and electrophoresed at 10 V/cm, until bromophenol blue in a single marker lane (in the same loading buffer) had run about two-thirds down the gel. Gels were immediately dried on Whatman paper without acid fixation and were autoradiographed with an intensifying screen for l-3 days. The pCW4 protein specifically retarded the probe even in the presence of 1 w of poly(dl-dC) competitor, but equivalent amounts of the mutant pCW41pro45 protein were incapable of the slightest binding even in the complete absence of competitor (data not shown). Acknowledgments We thank Dr. Cheng Ming Chuong for the gift of the anti-N-CAM antibodies. We thank Larry Tabata for excellent photographic assistance, and L. Zipursky, S. Crews, B. Blumberg. and D. Bittner for critical comments on the manuscript. C. V. E. W. is an American Cancer Society (California Division) Senior Fellow. This work was supported by a grant from the National Institutes of Health (HD 21502-04). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC. Section 1734 solely to indicate this fact. Received

March 13, 1989; revised July 19, 1989.

References Acampora, D., Pannese, M., D’Esposito. M., Simeone, A., and Boncinelli, E. (1987). Human homeobox-containing genes in development. Hum. Reprod. 2, 407-414. Akam, M. (1987). The molecular basis for metamenc pattern in the Drosophila embryo. Development 701, l-22. Bass, B. L., and Weintraub. H. (1987). A developmentally tivity that unwinds RNA duplexes. Cell 48, 607-613.

regulated ac-

Brivanlou, A. H., and Harland, R. M. (1989). Expression of an en&/ailed-related protein is induced in the antenor neural ectoderm of early Xenopus embryos. Development, in press. Carrasco, A. E., McGinnis, W., Gehring, W. J., and De Robertis, E. M. (1984). Cloning of an X. laevis gene expressed during early embryogenesis coding for a peptide region homologous to Drosophila homeotic genes. Cell 37, 409-414. Casanova, J., Sanchez-Herrero. E., and Morata, G. (1985). Prothoracic transformation and functional structure of the Ulfrabithorax gene of Drosophila. Cell 42, 663-669. Cho. K. W. V., Goetz, J., Wright, C. V. E.. Fritz. A., Hardwicke, J., and De Robertis, E. M. (1988). Differential utilization of the same reading frame in a Xenopus homeobox gene encodes two proteins sharing the same DNA-binding specificity. EMBO J. 7, 2139-2149.

Frog Homeoprotein 93

Function

Dent, J. A., Poison, A. G., and Klymkowsky, M. W. (1989). A wholemount immunocytochemical analysis of the expression of the intermediate filament protein vimentin in Xenopus. Development 105, 61-74. De Robertis, E. M., Oliver, G., and Wright, C. V. E. (1989). Determination of axial polarity in the vertebrate embryo: homeodomain proteins and homeogenetic induction. Cell 57, 189-191.

Miiller, M., Affolter, M., Leupin, W., Otting. G., Wiithrich, K., and Gehring, W. J. (1988). Isolation and sequence-specific DNA binding of the Anfennapedia homeodomain. EMBO J. 7, 4299-4304. Nieuwkoop, l? D., and Faber, J. (1969). Normal table of Xenopus laevis (Daudin) (Amsterdam: North Holland).

Dressler, G. R., and Gruss, P (1988). Do multigene families regulate vertebrate development? Trends Genet. 4, 214-219.

Oliver, G., Wright, C. V E.. Hardwicke, J., and De Robertis, E. M. (1988). Differential antero-posterior expression of two proteins encoded by a homeobox gene in Xanopus and mouse embryos. EMBO J. 7, 3199-3289.

Fienberg, A. A., Utset, M. F., Bogarad, L. D., Hart, C. P, Awgulewitsch, A., Ferguson-Smith, A., Fainsod, A., Rabin, M., and Ruddle, F. H. (1987). Homeo box genes in murine development. Curr. Top. Dev. Biol. 23, 233-256.

Otting, G., Chart, Y., Muller, M., Affolter, M., Gehring, W. J., and Wiithrich, K. (1988). Secondary structure determination for the Anfennapedia homeodomain by nuclear magnetic resonance and evidence for a helix-turn-helix motif. EMBO J. 7, 4305-4309.

Gaunt, S. J., Sharpe, P T., and Duboule, D. (1988). Spatially restricted domains of homeogene transcripts in mouse embryos: relation to a segmented body plan. Development 704 (Suppl.), 169-179.

F’atel, N. H., Martin-Blanco, E., Coleman, K. G., Poole, S. J., Ellis, M. C., Kornberg, T. B., and Goodman, C. S. (1989). Expression of engraihd proteins in arthropods, annelids, and chordates. Cell 58, 955-968. Peifer, M., and Bender, W. (1986). The anfembifhorax and bithofax mutations of the bithorax complex. EMBO J. 5, 2293-2303.

Graham, A., Papalopulu,

N., and Krumlauf, R. (1989). The murine and

nization and expression.

Cell 57, 367-378.

Gurdon, J. B. (1978). Injected nuclei in frog oocytes: fate, enlargement, and chromatin dispersal. J. Embryol. Exp. Morphol. 36, 523-546. Hafen, E.. Levine, M., and Gehring, W. J. (1984). Regulation of Anfennapedia transcript distribution by the bithorax complex of Drosophila. Nature 3Oi: 287-289. Hamburger, V. (1988). The Heritage of Experimental Embryology: Hans Spemann and the Organizer (Oxford: Oxford University Press). Harvey, R. P, and Melton, D. A. (1988). Microinjection of synthetic Xhox-?A homeobox mRNA disrupts somite formation in developing Xenopus embryos. Cell 53, 687-697. Herskowitz. I. (1987). Functional inactivation negative mutations. Nature 329, 219-222.

of genes by dominant

Holland, l? W. H., and Hogan, B. L. M. (1986). Expression of homeobox genes during mouse development: a review. Genes Dev. 2.773-782. Holtfreter, J., and Hamburger, V. (1955). The induction of neural crest derivatives and of other ectodermal structures, In Analysis of Development, B. H. Willier, P A. Weiss, and V. Hamburger, eds. (Philadelphia: W. B. Saunders), pp. 254-257. Hoperskaya, 0. A. (1975). The development of animals homozygous for a mutation causing periodic albinism in Xenopus laevis. J. Embryol. Exp. Morphol. 34, 253-264. Huxley, J. S., and DeBeer, G. R. (1934). The Elements of Experimental Embryology (Cambridge: Cambridge University Press), p. 374. Jacobson, M., and Rutishauser, U. (1986). Induction of neural cell adhesion molecule (N-CAM) in Xenopus embryos. Dev. Biol. 116, 524-531. Kintner, C. (1988). Effects of altered expression of the neural cell adhesion molecule, N-CAM, on early neural development in Xenopus embryos. Neuron 1, 545-555. Kintner, C., and Melton, D. A. (1987). Expression of Xenopus N-CAM RNA in ectoderm is an early response to neural induction. Develop ment 99, 311-325. Ko, H.-S., Fast, P. McBride, W., and Staudt, L. M. (1988). A human protein specific for the immunoglobulin octamer DNA motif contains a functional homeobox domain, Cell 55, 135-144. Krieg, P A., and Melton, D. A. (1984). Functional messenger RNAsare produced by SP6 in vitro transcription of cloned cDNAs. Nucl. Acids Res. 72, 7057-7070. Krieg. P A., and Melton, D. A. (1987). In vitro RNA synthesis RNA polymerase. Meth. Enzymol. 755, 397-415. Lewis, E. 8. (1978). A gene complex controlling sophila. Nature 276, 565-570.

segmentation

with SP6 in Dro

Mansour, S. L., Thomas, K. R., and Capecchi, M. R. (1968). Disruption of the proto-oncogene int-2 in mouse embryo-derived stem cells: a general strategy for targeting mutations to non-selectable genes. Nature 336, 348-352. Mihara, H., and Kaiser, E. T. (1988). A chemically synthesized Antannap&a homeo domain binds to a specific DNA sequence. Science 242. 925-927.

Rebagliati, M. R., and Melton, D. A. (1987). Antisense RNA injections in fertilized frog eggs reveal an RNA duplex unwinding activity. Cell 48, 599605. Rub i Altaba, A., and Melton, D. A. (1989). Involvement of the Xenopus homeobox gene Xhox3 in pattern formation along the anterior-posterior axis. Cell 57, 317-326. Scott, M. P, Tamkun, J. W., and Hartzell, G. W. (1989). The structure and function of the homeodomain. BBA Rev. Cancer, in press. Sharpe, C. R., Fritz, A., De Robertis. E. M.. and Gurdon, J. B. (1987). A home&ox-containing marker of posterior neural differentiation shows the importance of predetermination in neural induction. Cell 50, 749-758. Simeone. A., Pannese, M.. Acampora, D., D’Esposito, M., and Boncinelli, E. (1988). At least three human homeoboxes on chromosome 12 belong to the same transcription unit. Nucl. Acids Res. 78, 5379-5389. Struhl, G., and White, R. A. H. (1985). Regulation of the Utmbithorax gene of Drosophila by other bithorax complex genes. Cell 43,507-519. Sturm, R.. Baumraker, T.. Franza. B. R., Jr., and Herr, W. (1987). A loOkD HeLa cell octamer binding protein (OBPlrIQ interacts differently with two separate octamer-related sequences within the SV40 enhancer. Genes Dev. 7, 1147-1168. Wilkinson, D. G., Bhatt, S., Chavrier, P, Bravo, R., and Charnay, P (1989). Segment-specific expression of zinc-finger gene in the develop ing nervous system of the mouse. Nature 337, 461-464. Wolgemuth. D. J., Behringer, R. R., Mostoller, M. P, Brinster, R. L., and Palmiter, R. D. (1989). Transgenic mice overexpressing the mouse homeobox-containing gene Hex-1.4 exhibit abnormal gut develop ment. Nature 337, 464-467 Wright, C. V. E., Cho, K. W. Y., Oliver, G., and De Robertis, E. M. (1989a). Vertebrate homeodomain proteins: families of region-specific transcription factors. Trends Biochem. Sci. 74, 52-56. Wright, C. V. E., Schnegelsberg, P., and De Robertis, E. M. (1989b). XlHbox 8: a novel Xenopus homeo protein restricted to a narrow band of endoderm. Development 705, 787-794. Zakany, J., Tuggle, C. K., Patel, M. D.. and Nguyen-Huu, M. C. (1988). Spatial regulation of homeobox gene fusions in the embryonic central nervous system. Neuron 7, 679-691.