- Email: [email protected]
Interleukin-10 and tumor necrosis factor gene polymorphisms and risk of coronary artery disease and myocardial infarction
Atherosclerosis 159 (2001) 137– 144 www.elsevier.com/locate/atherosclerosis
Interleukin-10 and tumor necrosis factor gene polymorphisms and risk of coronary artery disease and myocardial infarction Werner Koch *, Adnan Kastrati, Corinna Bo¨ttiger, Julinda Mehilli, Nicolas von Beckerath, Albert Scho¨mig Deutsches Herzzentrum Mu¨nchen and 1 Medizinische Klinik rechts der Isar, Technische Uni6ersita¨t Mu¨nchen, Munich, Germany Received 26 October 2000; received in revised form 15 January 2001; accepted 31 January 2001
Abstract Inflammation plays an important role in the pathogenesis of atherosclerosis and acute coronary syndromes. Cytokines IL-10 and TNF-a exert opposite functions in inflammatory reactions, IL-10 acting predominantly as an antiinflammatory and TNF-a as a proinflammatory factor. Functional single nucleotide polymorphisms in the genes of IL-10, TNF-a, and TNF-b are associated with gene expression and plasma levels of IL-10 and TNF-a. The aim of the study was to assess whether these IL-10 and TNF gene polymorphisms are related to the risk of coronary artery disease (CAD) and myocardial infarction (MI). Consecutive, angiographically examined patients with significant coronary stenoses but without symptoms or signs of old or acute MI constituted the group with CAD (n=998) and patients with old or acute MI constituted the group with MI (n= 793). Subjects with neither angiographic CAD nor symptoms or signs of MI (n= 340) served as controls. They were matched with the patients for age and sex. Genotyping was performed with techniques based on the polymerase chain reaction. Allele frequencies, genotype distributions, and frequencies of allele combinations for three IL-10 promoter polymorphisms, − 1082G/A, − 819C/T and −592C/A, were similar between CAD patients, MI patients, and matched controls. Similarly, genetic analysis did not reveal group-specific differences for the TNF-a promoter polymorphisms −863C/A and − 308G/A, as well as for the TNF-b intron 1 polymorphism 252G/A. In addition, no relationship was found between specific combinations of IL-10 and TNF alleles, indicative of low IL-10 and high TNF-a production, respectively, and CAD or MI. The lack of association persisted also after adjusting for other cardiovascular risk factors. Our findings suggest that six different and functionally relevant polymorphisms of the genes coding for IL-10, TNF-a, and TNF-b are neither separately nor in cooperation associated with the risk of CAD or MI in angiographically examined patients. © 2001 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Coronary artery disease; Myocardial infarction; Interleukin-10; Tumor necrosis factor; Genetics
1. Introduction The major contribution of inflammatory mechanisms to atherosclerosis has recently been emphasized [1–4]. The pattern and magnitude of cytokine release at the site of tissue injury is considered to be a critical determinant of severity and duration of the response. Interleukin-10 (IL-10) and tumor necrosis factor alpha (TNF-a) have complex and predominantly opposing roles in inflammation [1,2,5 – 9]. An autoregulatory loop * Corresponding author. Present address: Deutsches Herzzentrum Mu¨nchen, Experimentelle Kardiologie, Lazarettstrasse 36, 80636 Munich, Germany. Tel.: +49-89-12182601; fax: +49-89-12183053. E-mail address: [email protected] (W. Koch).
appears to exist in which TNF-a stimulates IL-10 production, which, in turn, reduces TNF-a synthesis [10]. Playing a major role in suppressing immune and inflammatory responses, several functions of IL-10 are centered on inhibition of macrophage function, including cytotoxic activity and cytokine synthesis. In experiments with cultured cells and mice, IL-10 was found to block atherosclerotic events and it was suggested that IL-10 may arrest and reverse the chronic inflammatory response in established atherosclerosis, as well as limit thrombotic complications [11,12]. TNF-a is a potent immunomediator and proinflammatory cytokine that has been implicated in the pathogenesis of a large number of human diseases [13]. The presence of TNF-a in the majority of atherosclerotic
0021-9150/01/$ - see front matter © 2001 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 0 2 1 - 9 1 5 0 ( 0 1 ) 0 0 4 6 7 - 1
138
W. Koch et al. / Atherosclerosis 159 (2001) 137–144
lesions and absence from normal tissues suggests its involvement in atherogenesis [14,15]. TNF-a may contribute to atherosclerosis by activation of growth factors, cytokines, and chemoattractants and by effecting the synthesis and stimulation of adhesion molecules [16,17]. Secretion of TNF-a from mononuclear leukocytes of patients with stable and unstable angina pectoris is elevated when compared with control individuals [18]. In addition, TNF-a possibly increases the risk of thrombotic events by stimulation of procoagulant activity and suppression of antithrombotic pathways in endothelial cells [19]. The human IL-10 gene is located on chromosome 1 and has been mapped to the junction between 1q31 and 1q32 [20,21]. The genes for TNF-a and TNF-b are situated close to each other within the human leukocyte antigen (HLA) class III gene cluster on the short arm of chromosome 6, approximately 220 kilo base pairs (kbp) centromeric of the HLA-B locus and about 850 kbp telomeric of the HLA class II region [22]. Stimulation of human blood samples with bacterial lipopolysaccharide showed large interindividual variations of IL-10 and TNF-a production, suggesting a genetic component of approximately 75 and 60%, respectively [23]. Interindividual differences in the regulation of IL-10 and TNF-a production may be critical in a variety of healthy and abnormal inflammatory responses. Several polymorphisms located close to or within the IL-10, TNF-a, and TNF-b genes are potentially associated with transcription levels, however, the molecular mechanisms linking these polymorphisms to gene expression and posttranscriptional processing are only partially known [9,13,24– 32]. The best documented of these polymorphisms are the IL-10 gene promoter polymorphisms −1082G/A, − 819C/T, and − 592C/A, the TNF-a promoter polymorphisms −863C/A and − 308G/A, as well as the TNF-b intron 1 polymorphism 252G/A [28,33–37]. This study was based on the assumption that the IL-10 and TNF gene polymorphisms have a measurable influence on atherosclerotic mechanisms and contribute to or reduce the occurrence of coronary artery disease (CAD) and myocardial infarction (MI).
2. Subjects and methods
2.1. Patients and controls The study population comprised individuals of Caucasian origin examined with coronary angiography at Deutsches Herzzentrum Mu¨ nchen and 1. Medizinische Klinik rechts der Isar der Technischen Universita¨ t Mu¨ nchen and participating in the Risk Evaluation in Subjects Investigated with Coronary Angiography (RESICA) project. Consecutive patients with significant
coronary stenoses but without symptoms or signs of old or acute MI constituted the group with CAD (n= 998). Consecutive patients with old or acute MI constituted the group with MI (n= 793). Controls (n =340), matched with patients for age and sex, were represented by subjects with neither CAD nor symptoms or signs of acute or old MI. The study was approved by the local Ethics Committee, and informed genetic consent was obtained from all the subjects.
2.2. Definitions The diagnosis of CAD was established angiographically in the presence of ] 50% stenosis in at least one of the three major coronary arteries or major branches. Acute MI, present in 369 patients, was defined on the basis of chest pain for more than 30 min, ST-segment elevation of more than 0.1 mV in two or more successive leads monitored by a standard 12-lead electrocardiogram, and a rise of creatine kinase to greater than twice the normal levels [38]. The diagnosis of old MI, established for 424 patients, was based on the presence of unequivocal changes on the current electrocardiogram. Of the patients with old MI, 35.8% had angiographically occluded infarct-related arteries and 90.3% showed regional wall motion abnormalities corresponding to the electrocardiographic infarct localisation. Individuals were considered disease-free and, therefore, eligible as controls when their coronary arteries were angiographically normal and when they showed neither symptoms nor signs of old or acute MI. Diabetes mellitus was defined in the presence of an active treatment with insulin or an oral antidiabetic agent; for patients on dietary treatment, documentation of an abnormal fasting blood glucose or glucose tolerance test based on the World Health Organisation criteria [39] was required for establishing this diagnosis. Persons reporting regular smoking in the previous 6 months were considered as current smokers. Systemic arterial hypertension was defined as a systolic blood pressure of 140 mmHg or greater and/or a diastolic blood pressure of 90 mm Hg or greater [40] at least on two separate occasions. Hypercholesterolaemia was defined as an documented total cholesterol value 240 mg/dl (6.2 mmoles/l). The definition of cardiovascular risk factors was based on the data obtained during the actual hospitalisation or from the patient’s chart. Being aware of some discrepancies, in the literature, regarding the relative locations of the polymorphic sites in the IL-10 and TNF-a gene promoters, we refer to these positions as reported in the original publications [28,35], with the exception of the C A substitution at − 863 in the TNF-a promoter, for which we keep in line with a recent report [32]. The G to A transition in intron 1 of the TNF-b gene is located at position 252 relative to the transcription start site [34].
W. Koch et al. / Atherosclerosis 159 (2001) 137–144
2.3. Determination of genotypes Genomic DNA was extracted from peripheral blood leukocytes using commercially available kits (Qiagen, Hilden, Germany, and Roche Molecular Biochemicals, Mannheim, Germany). After amplification of genomic DNA by polymerase chain reaction (PCR), genotypes were determined either by allele-specific restriction enzyme analysis or with the use of allele-specific oligonucleotide probes. The sequences of primers and probes are shown in Table 1. Primer pairs 1 and 2 were used to amplify a 377-bp
139
sequence containing the variable − 1082G/A position and a 477-bp sequence containing the variable − 819C/ T and − 592C/A positions of the IL-10 gene, respectively. Primer pairs 3, 4, and 5 were used to amplify a 150-bp sequence containing the − 863C/A position (TNF-a), a 253-bp sequence containing the − 308G/A position (TNF-a), and a 179-bp sequence containing the 252G/A position (TNF-b), respectively. As specifically indicated in Table 1A, the downstream primer of primer pair 3 was modified with respect to the genomic sequence (C6 instead of A) to create a TaiI restriction site (AC6 GT) in the PCR products, if an A was present
Table 1 Primers and probes Primer pair
Polymorphism
(A) Primer pairs for allele-specific restriction enzyme analysis 1 IL-10: −1082G/A 2
IL-10: −819C/T and −592C/A
3
TNF-a: −863C/A
4
TNF-a: −308G/A
5
TNF-b: 252G/A
(B) Primer pairs used in combination with allele-specific probes 6 IL-10: −1082G/A 7
IL-10: −819C/T
8
IL10: −592C/A
9
TNF-a: −863C/A
10
TNF-a: −308G/A
11
TNF-b: 252G/A
(C) Allele-specific probe pairs 1a IL-10: −1082G −1082A 2 IL-10: −819C −819T 3 IL-10: −592C −592A 4 TNF-a: −863C −863A 5a TNF-a: -308G −308A 6 TNF-b: 252G 252A a
Sequence
CCAAGACAACACTACTAAGGCTCCTTT GCTTCTTATATGCTAGTCAGGTA CAACTTCTTCCACCCCATCTTT GTGGGCTAAATATCCTCAAAGTT CCTGGGAGATATGGCCACAcGT CTACATGGCCCTGTCTTCGTTAcG GGAGGCAATAGGTTTTGAGGGcCAT CCTTGGTGGAGAAACCCATGgGCT CTGCCTGGGCCTGGGCCTTGGT GATGCAGTCAGAGAAACCCCAtGGT CACACACACAAATCCAAGACAACA GCTGGATAGGAGGTCCCTTACTTT AGGGTGAGGAAACCAAATTCTCA GACCCCTACCGTCTCTATTTTATAGTGA GAGAATCCTAATGAAATCGGGGTAA CCCAAGCAGCCCTTCCAT CACAGCAATGGGTAGGAGAATGT GAGGTCCTGGAGGCTCTTTCA AGTTAGAAGGAAACAGACCACAGACCT TGATTTGTGTGTAGGACCCTGGA CAGTCTCATTGTCTCTGTCACACATTC GAAGAGACGTTCAGGTGGTGTCAT Probe pair polymorphism sequence FAM-CTACTTCCCCC6 TCCCAAAGAAGCCTTA VIC-CCTACTTCCCCT6 TCCCAAAGAAGCCT FAM-CTTGTACAGGTGATGTAAC6 ATCTCTGTGCCTC VIC-CCCTTGTACAGGTGATGTAAT6 ATCTCTGTGCC FAM-CCGCCTGTC6 CTGTAGGAAGCCA VIC-ACCCCGCCTGTA6 CTGTAGGAAGCC FAM-CGAGTATGGGGACCCCCC6 CTTAA VIC-AGTCGAGTATGGGGACCCCCA6 CTTAA FAM-TGAACCCCGTCCC6 CATGCC VIC-AACCCCGTCCT6 CATGCCCCTC FAM-TTTCTGCCATGG6 TTCCTCTCTGTTCC VIC-TCTGTTTCTGCCATGA6 TTCCTCTCTGTTC
Sequences correspond to the DNA strands complementary to published sequences. Nucleotide sequences of primers and probes are based on sequences deposited in Genbank and EMBL databases; accession numbers: U06844 (IL-10) and M16441 (TNF). Sequences are in 5%–3% direction. Sequences of upstream primers are shown above sequences of downstream primers. Primer nucleotides different from the genomic sequences are in minor letters (see Section 2.3 in Section 2 for details). Allele-specific nucleotides in the probe sequences are underlined. FAM and VIC: fluorogenic dyes attached to the 5% ends of the probe molecules.
140
W. Koch et al. / Atherosclerosis 159 (2001) 137–144
at the template’s polymorphic position, located immediately adjacent to the primer-binding site, and the upstream primer was modified (C6 instead of T) to introduce a TaiI restriction sequence (AC6 GT), serving as an invariant internal control site for restriction analysis. Similarly, with primer pair 4, the upstream primer was modified (C6 instead of G) to create a NcoI site (C6 CATGG), if a C was present at the template’s polymorphic position, located 2 nucleotides off the primerbinding site, and the downstream primer was modified (G6 instead of A) to invariantly introduce a control NcoI site (CCATGG6 ). Finally, the downstream primer of primer pair 5 was modified (T6 instead of A) to create an invariant control NcoI site (CCAT6 GG). DNA amplifications were performed by 30 cycles of two-step reactions consisting of denaturation at 95°C for 1 min and primer annealing and extension at 60°C (IL-10 and TNF-a) or 70°C (TNF-b) for 1 min, followed by a final extension at 72°C for 7 min. Cyclers GeneAmp PCR System 9600, GeneAmp PCR System 9700 (Applied Biosystems, Weiterstadt, Germany), and Primus 96 (MWG-Biotech, Ebersberg, Germany) were used. Restriction enzyme XagI (MBI Fermentas, St. LeonRot, Germany) cleaved the −1082G-specific PCR product into three fragments of 253, 97, and 27 bp and the −1082A-specific PCR product into two fragments of 280 and 97 bp. MaeIII (Roche) cleaved the − 819Cspecific PCR product into three fragments of 217, 175, and 85 bp and the − 819T-specific PCR product into two fragments of 392 and 85 bp. RsaI (Roche) cleaved the − 592C-specific PCR product into four fragments of 311, 116, 42, and 8 bp and the − 592A-specific PCR product into five fragments of 240, 116, 71, 42, and 8 bp. TaiI (MBI Fermentas) cleaved the − 863C-specific PCR product into two fragments of 128 and 22 bp and the −863A-specific PCR product into three fragments of 103, 25 and 22 bp. NcoI (MBI Fermentas) cleaved the − 308G-specific PCR product into three fragments of 210, 23 and 20 bp, and the −308A-specific PCR product into two fragments of 233 and 20 bp. NcoI cleaved the 252G-specific PCR product into three fragments of 105, 51 and 23 bp, and the 252A-specific PCR product into two fragments of 156 and 23. Restriction fragments were separated, by electrophoresis, in 8% polyacrylamide gels (Invitrogen, Groningen, The Netherlands) and, after staining with ethidium bromide solution, identified by 312-nm ultraviolet transillumination. Photographs were taken with a digital documentation system (GelPrint 2000i, MWG-Biotech). Genotyping was also performed with the ABI Prism Sequence Detection System 7700 (Applied Biosystems). The use of allele-specific fluorogenic probe pairs combined DNA amplification and genotype determination into a single assay [41]. Primers and probes were selected with the help of the ‘Primer Express’ software (Applied Biosystems). Primer pairs 6, 7, and 8 (Table
1B) were used to amplify sequences of 93, 107, and 106 bp containing the variable − 1082G/A, − 819C/T and − 592C/A positions of the IL-10 gene, respectively. Probe pairs 1, 2, and 3 (Table 1C) were included in the reactions for discrimination between alleles −1082G and − 1082A, − 819C and − 819T, and − 592C and − 592A, respectively. Of each probe pair, one probe was labeled with the fluorescent dye 6-carboxy-fluorescein (‘FAM’) and the other one with the fluorescent dye ‘VIC’ (Applied Biosystems, patent pending), as indicated in Table 1C. Primer pairs 9, 10, and 11 were used to amplify sequences of 116, 108, and 273 bp containing the − 863C/A and − 308G/A positions of the TNF-a gene and the 252G/A position of the TNF-b gene, respectively. Probe pairs 4, 5, and 6 were used to discriminate between alleles − 863C and − 863A, − 308G and −308A, and 252G and 252A, respectively. DNA amplifications were performed by 40 cycles of denaturation at 95°C for 15 s and primer annealing and extension at 60°C (IL-10 polymorphisms and −308G/ A) or 62°C ( − 863C/A and 252G/A) for 1 min.
2.4. Statistical analysis The analysis consisted of comparing separately genotype distributions between CAD patients and MI patients on one hand and controls on the other. Discrete variables are expressed as counts (%) and compared by 2-or Fisher’s exact test. Continuous variables are expressed as mean9 S.D. and compared by the means of the unpaired, two-sided t-test. Allele associations were tested and estimated with the EH program [42]. The independent association between CAD or MI and the presence of the − 1082A, −819T, −592A, −863C, − 308A, or 252A allele was assessed after adjusting for other potential confounding factors using multiple logistic regression analysis and calculating the adjusted odds ratios and their 95% confidence intervals (CI). Statistical significance was accepted for P-values of B 0.05.
3. Results The main baseline characteristics of matched controls, patients with CAD and patients with MI are shown in Table 2. Diabetes mellitus and cigarette smoking were encountered significantly more often in both the patient groups if compared with controls. Arterial hypertension was also more frequent in CAD patients. The distributions of genotypes did not differ significantly between matched controls, patients with CAD and patients with MI (Table 3). Within each study group, the genotype distributions were consistent with those predicted by the Hardy-Weinberg equilibrium.
W. Koch et al. / Atherosclerosis 159 (2001) 137–144 Table 2 Baseline clinical characteristics of controls and CAD and MI patientsa
Age, years Women Arterial hypertension Diabetes Current smokers Hypercholesterolaemia
Matched controls (n= 340)
CAD (n= 998)
MI (n =793)
63.49 10.3
64.19 10.2
62.6
24.7 60.6 10.3 18.8 40.6
24.1 70.8b 20.2b 24.6c 45.8
911.6 22.6 62.7 21.6b 34.3b 37.8
a Age is mean9S.D.; other variables are % of controls and patients. b PB0.001 versus controls; all others: P= not significant for comparison with matched controls. c PB0.03 versus controls.
The observed IL-10 and TNF allele frequencies were closely similar between the groups − 1082G =0.45 (matched controls, CAD, and MI); −819C or − 592C= 0.72 (matched controls), 0.74 (CAD), and 0.75 (MI); − 863C= 0.84 (matched controls), 0.85 (CAD), and 0.83 (MI); − 308G = 0.84 (matched controls and CAD) and 0.85 (MI); 252G=0.32 (matched controls and CAD) and 0.31 (MI). Then, linkage disequilibrium between the three polyTable 3 IL-10 and TNF genotype distributions in matched controls with coronary angiography, and in CAD and MI casesa Matched controls (n =340) IL-10: −1082
GG 21.8
GA AA −819 CC CT TT −592 CC CA AA TNF: −863 CC CA AA −308 GG GA AA 252 GG GA AA
47.3 30.9 51.5 40.6 7.9 51.5 40.6 7.9 71.1 26.5 2.4 71.8 24.4 3.8 10.3 43.5 46.2
CAD (n= 998)
MI (n= 793)
20.8
21.3
49.2 30.0 54.5 39.1 6.4 54.5 39.1 6.4 71.7 26.3 2.0 70.3 26.9 2.8 9.8 44.5 45.7
48.3 30.4 56.6 37.1 6.3 56.6 37.1 6.3 68.9 28.6 2.5 71.3 27.1 1.6 8.4 44.1 47.5
a Variables are % of controls and patients. P= not significant for all the comparisons.
141
morphic loci of the IL-10 promoter and, separately, between the three polymorphic sites in the genes for TNF-a and TNF-b was tested and estimated. In the case of the IL-10 polymorphisms, three out of eight different theoretically possible allele combinations were present in our population, i.e. − 1082G, − 819C, and − 592C (GCC), ACC, and ATA. The frequencies of these allele combinations were GCC= 0.46 (matched controls) and 0.45 (CAD or MI); ACC= 0.26 (matched controls), 0.29 (CAD), and 0.30 (MI); ATA=0.28 (matched controls), 0.26 (CAD), and 0.25 (MI). The existence of only these allele combinations was independently indicated by the presence of individuals with combinations of the homozygous genotypes − 1082GG, −819CC, and − 592CC (GGCCCC), AACCCC, and AATTAA, but not of individuals with other possible combinations of homozygous genotypes. For the TNF polymorphisms, four different allele combinations were present, i.e. −863C, −308G, and 252A (CGA), CGG, CAG, and AGA. The frequencies of these allele combinations were CGA= 0.52 (matched controls) and 0.53 (CAD or MI); CGG or CAG=0.16 (matched controls or CAD) and 0.15 (MI); AGA= 0.16 (matched controls), 0.15 (CAD), and 0.17 (MI). Similar to the IL-10 polymorphisms, the existence of only these allele combinations was also obvious from the presence of individuals with combinations of the homozygous TNF genotypes − 863CC, − 308GG, and 252GG (CCGGGG), CCGGAA, CCAAGG, and AAGGAA, whereas individuals with other possible combinations of homozygous genotypes were absent from our population. In essence, the frequency of each IL-10 or TNF allele combination was not significantly different between matched controls, CAD patients, and MI patients. Thus, we did not find any indication of an association between a specific allele combination and CAD or MI. The possibility existed that combinations of certain IL-10 and TNF-a genotypes reportedly associated with relatively low IL-10 levels and relatively high TNF-a production, respectively, e.g. genotype − 1082AA (IL10) and genotype − 863CC (TNF-a), were representing cardiovascular risk combinations, and, therefore, should be present more often in the groups of CAD and MI patients than among controls. However, individuals carrying genotype − 1082AA, as well as genotype −863CC were found in the groups in similar frequencies, 0.22 in matched controls and CAD patients and 0.21 in MI patients. This finding, and corresponding results obtained with other hypothetical risk combinations (data not shown), argued against such an association. Using multiple logistic regression analysis, we assessed whether the lack of association between CAD or MI and the presence of −1082A, − 819T, −592A, − 863C, −308A or 252A alleles persisted after adjust-
142
W. Koch et al. / Atherosclerosis 159 (2001) 137–144
ing for the conventional cardiovascular risk factors age, sex, arterial hypertension, diabetes, current smoking and hypercholesterolaemia. In the case of CAD, the adjusted odds ratios for the −1082A, − 819T/ − 592A, −863C, −308A or 252A alleles were 1.01 (95% CI, 0.74–1.37), 0.84 (0.66– 1.08), 1.26 (0.53– 2.95), 1.07 (0.81 –1.41), and 1.09 (0.72– 1.66), and in the case of MI, the adjusted odds ratios were 1.03 (0.75– 1.42), 0.85 (0.65 –1.10), 0.82 (0.35-1.92), 1.02 (0.76– 1.36), and 1.35 (0.87 –2.11), respectively. Thus, even after inclusion of conventional risk factors in the statistical analysis, no relationship was found. In addition, genotype distributions were not significantly different between CAD patients with single-vessel disease (SVD) and those with multi-vessel disease (MVD) and between patients with old MI and those with acute MI. The allele frequencies of patients with SVD and MVD were −1082G =0.47 (SVD) and 0.45 (MVD); −819C or −592C = 0.76 (SVD) and 0.73 (MVD); − 863C= 0.87 (SVD) and 0.84 (MVD); − 308G= 0.85 (SVD) and 0.83 (MVD); 252G=0.35 (SVD) and 0.31 (MVD). For patients with old MI and acute MI, allele frequencies were − 1082G = 0.42 (old MI) and 0.49 (acute MI); −819C or − 592C = 0.73 (old MI) and 0.77 (acute MI); −863C = 0.84 (old MI) and 0.82 (acute MI); − 308G =0.86 (old MI) and 0.84 (acute MI); 252G= 0.30 (old MI) and 0.31 (acute MI). Finally, no significant differences of IL-10 and TNF genotype distributions and allele frequencies were seen between the younger patients (B60 years) with CAD or MI and matched controls.
4. Discussion The main result of this study was that the IL-10 gene polymorphisms −1082G/A, −819C/T, and − 592C/ A, the TNF-a gene polymorphisms − 863C/A and − 308G/A, and the TNF-b polymorphism 252G/A had no measurable influence on the occurence of CAD or MI in angiographically evaluated patients. This finding was based on separate analyses of individual alleles, allele combinations, and genotypes. We observed frequencies of alleles and allele combinations and genotype distributions to be in good correlation with the results of previous studies with Caucasian populations [28,31,32,43– 47]. As found here and in earlier reports [28,30,31,43], complete linkage of allele − 819C with allele −592C and of allele − 819T with allele −592A, and the presence of three different allele combinations, −1082G, − 819C, and − 592C (GCC), ACC, and ATA, are characteristic of the IL-10 polymorphisms in Caucasians. Being a typical feature of the TNF gene polymorphisms − 308G/A (TNF-a) and 252G/A (TNF-b), we and others [44,45] noticed allele A of either polymorphism to be exclusively linked
to allele G in the other one, a rule that is not true in the reverse direction. A possible relationship between IL-10 and TNF alleles and IL-10 and TNF-a gene expression and protein production was previously examined in different experimental settings. In the presence of allele −1082A, stimulation of lymphocytes with concanavalin A (Con A) resulted in lower IL-10 production than in allele − 1082A-negative cells, whereas protein production was independent of allele − 819 and allele − 592 [28]. However, genotype − 592AA was reported to reduce IL-10 production in cultures of peripheral blood mononuclear cells (PBMC) treated with interferon-a [27]. The IL-10 allele combination ATA was related to lower transcriptional activity than allele combination GCC in a monocytic cell line and genotype AATTAA was associated with decreased IL-10 production in whole blood cultures stimulated with lipopolysaccharide [30]. In Con A-stimulated PBMC, allele combinations GCC, ACC and ATA were correlated with high, intermediate and low IL-10 production, respectively [31]. The presence of the common TNF-a allele −863C was found to be associated with higher transcriptional levels in a cell line of human origin, to bind nuclear protein with much higher affinity, and to be related with elevated serum TNF-a levels, if compared with the rare allele − 863A [32]. In contrast, no stimulating influence of allele − 863C on gene expression was observed in a murine cell line [37]. There are also data relating the rare − 308A allele to a higher transcriptional activity than the common − 308G allele [26,29]. However, a lack of such an association has also been reported [32,37,44,48]. Increased secretion of TNF-a from stimulated monocytes prepared from PBMC of healthy individuals was found in association with genotype 252AA, whereas no association between the secretion of TNF-a from unfractionated PBMC and genotype 252AA was detected [24,34,49,50]. Despite these and other findings suggesting a relationship of certain IL-10 and TNF alleles, allele combinations, and genotypes with gene expression and protein production and secretion, our examination of these genetic markers did not indicate any correlation with CAD or MI, the clinical parameters of our study. Obviously, in the context of this study, the cytokine gene polymorphisms we chose for examination do not provide a key to reveal an involvement of IL-10 and TNF-a in CAD and MI. Other polymorphisms in or close to the IL-10 and TNF genes or located in the genes of other cytokines might prove suitable to reveal an association of allelic markers with CAD and MI [13,36]. Recent studies suggested that specific alleles of several polymorphisms of the TNF-a gene, including − 863C/A and − 308G/A, did not contribute to acute MI in an important way [51], that − 308G/A was not
W. Koch et al. / Atherosclerosis 159 (2001) 137–144
associated with CAD [52], and that neither −308G/A nor 252G/A was related to congestive heart failure, whereas plasma levels of TNF-a were elevated in the patients [45]. However, results indicating an association of IL-10 and TNF alleles with disease were also reported. Combination of the low IL-10 producer genotype −1082AA with the high TNF-a producer allele −308A was correlated with increased levels of early heart transplant rejection [53]. In addition, evidence exists suggesting that genetic variations of the IL-10 and TNF locus, including the polymorphisms − 1082G/A and −308G/A, respectively, were involved in determining susceptibility to inflammatory autoimmune diseases, like rheumatoid arthritis, asthma, and insulindependent diabetes mellitus [13,24,30,36,47]. Remarkably, similarities between the inflammatory responses of rheumatoid arthritis and atherosclerosis were observed, suggesting, at least in part, common pathways of disease development to exist [54]. However, in contrast to data indicating an association between the IL-10 allele combination ATA and certain phenotypes of juvenile rheumatoid arthritis [30], our study did not reveal a corresponding result for CAD and MI, two clinically important manifestations of atherosclerosis.
5. Limitations of the study Since this study was performed with individuals of Caucasian origin, it has to be determined separately whether or not the results are valid in populations of other ethnic origin. Notably, in a Chinese population, IL-10 promoter allele and haplotype frequencies were found to greatly differ from those in Caucasians [55]. Several lines of evidence suggested that approximately 20-30% of patients who develop an acute coronary event die before arrival at the hospital [56]. For this reason, a considerable number of potentially eligible patients with acute MI was probably not included in the study. Consequently, underrepresentation of potential risk alleles or genotypes constituted a selection bias that could have affected the result of evaluating associations between genetic factors and MI. Another limitation was the missing determination of plasma levels of IL-10 and TNF-a. Thus, the lack of association between IL-10 and TNF gene polymorphisms and CAD or MI found in this study should not be interpreted as data negating the potential role of IL-10 and TNF-a in atherosclerosis.
Acknowledgements The authors thank Angela Ehrenhaff, Marianne Eichinger, Wolfgang Latz, and Gisela Werner for skilful technical assistance.
143
References [1] Mehta JL, Saldeen TGP, Rand K. Interactive role of infection, inflammation and traditional risk factors in atherosclerosis and coronary artery disease. J Am Coll Cardiol 1998;31:1217 –25. [2] Ross R. Atherosclerosis — an inflammatory disease. New Engl J Med 1999;340:115 – 26. [3] Libby P, Ridker PM. Novel inflammatory markers of coronary risk. Theory versus practice. Circulation 1999;100:1148 –50. [4] Libby P, Hansson GK, Pober JS. Atherogenesis and inflammation. In: Chien KR, editor. Molecular Basis of Cardiovascular Disease. Philadelphia: W.B. Saunders Company, 1999:349 – 66. [5] Mosmann TR. Properties and functions of interleukin-10. Adv Immunol 1994;56:1 – 26. [6] Lalani I, Bhol K, Ahmed AR. Interleukin-10: biology, role in inflammation and autoimmunity. Ann Allergy Asthma Immunol 1997;79:469 – 84. [7] Cope AP. Regulation of autoimmunity by proinflammatory cytokines. Curr Opin Immunol 1998;10:669 – 76. [8] LeBoeuf RC, Schreyer SA. The role of tumor necrosis factor-a receptors in atherosclerosis. Trends Cardiovasc Med 1998;8:131 – 8. [9] Makhatadze NJ. Tumor necrosis factor locus: Genetic organisation and biological implications. Hum Immunol 1998;59:571 –9. [10] van der Poll T, Jansen J, Levi M, ten Cate H, ten Cate JW, van Deventer SJH. Regulation of interleukin 10 release by tumor necrosis factor in humans and chimpanzees. J Exp Med 1994;180:1985 – 8. [11] Pinderski Oslund LJ, Hedrick CC, Olvera T, Hagenbaugh A, Territo M, Berliner JA, Fyfe AI. Interleukin-10 blocks atherosclerotic events in vitro and in vivo. Arterioscler Thromb Vasc Biol 1999;19:2847 – 53. [12] Terkeltaub RA. IL-10: an ‘immunologic scalpel’ for atherosclerosis? Arterioscler Thromb Vasc Biol 1999;19:2823 – 5. [13] Wilson AG, di Giovine FS, Duff GW. Genetics of tumour necrosis factor-a in autoimmune, infectious, and neoplastic diseases. J Inflamm 1995;45:1 – 12. [14] Barath P, Fishbein MC, Cao J, Berenson J, Helfant RH, Forrester JS. Detection and localization of tumor necrosis factor in human atheroma. Am J Cardiol 1990;65:297 – 302. [15] Barath P, Fishbein MC, Cao J, Berenson J, Helfant RH, Forrester JS. Tumor necrosis factor gene expression in human vascular intimal smooth muscle cells detected by in situ hybridization. Am J Pathol 1990;137:503 – 9. [16] Shanley TP, Warner RL, Ward PA. The role of cytokines and adhesion molecules in the development of inflammatory injury. Mol Med Today 1995;1:40 – 5. [17] Thurberg BL, Collins T. The nuclear factor-kB/inhibitor of kB autoregulatory system and atherosclerosis. Curr Opin Lipidol 1998;9:387 – 96. [18] Vaddi K, Nicolini FA, Mehta P, Mehta JL. Increased secretion of tumor necrosis factor-a and interferon-g by mononuclear leukocytes in patients with ischemic heart disease. Relevance in superoxide anion generation. Circulation 1994;90:694 – 9. [19] Nawroth PP, Stern DM. Modulation of endothelial cell hemostatic properties by tumor necrosis factor. J Exp Med 1986;163:740 – 5. [20] Kim JM, Brannan CI, Copeland NG, Jenkins NA, Khan TA, Moore KW. Structure of the mouse IL-10 gene and chromosomal localization of the mouse and human genes. J Immunol 1992;148:3618 – 23. [21] Eskdale J, Kube D, Tesch H, Gallagher G. Mapping of the human IL10 gene and further characterization of the 5% flanking sequence. Immunogenetics 1997;46:120 – 8. [22] Campbell RD, Trowsdale J. Map of the human MHC. Immunol Today 1993;14:349 – 52.
144
W. Koch et al. / Atherosclerosis 159 (2001) 137–144
[23] Westendorp RGJ, Langermans JAM, Huizinga TWJ, Elouali AH, Verweij CL, Boomsma DI, Vandenbroucke JP. Genetic influence on cytokine production and fatal meningococcal disease. Lancet 1997;349:170 –3. [24] Pociot F, Briant L, Jongeneel CV, et al. Association of tumor necrosis factor (TNF) and class II major histocompatibility complex alleles with the secretion of TNF-a and TNF-b by human mononuclear cells: a possible link to insulin-dependent diabetes mellitus. Eur J Immunol 1993;23:224 –31. [25] Stu¨ ber F, Petersen M, Bokelmann F, Schade U. A genomic polymorphism within the tumor necrosis factor locus influences plasma tumor necrosis factor-a concentrations and outcome of patients with severe sepsis. Crit Care Med 1996;24:381 – 4. [26] Kroeger KM, Carville KS, Abraham LJ. The – 308 tumor necrosis factor-a promoter polymorphism effects transcription. Mol Immunol 1997;34:391 –9. [27] Rosenwasser LJ, Borish L. Genetics of atopy and asthma: the rationale behind promoter-based candidate gene studies (IL-4 and IL-10). Am J Respir Crit Care Med 1997;156:S152 – 5. [28] Turner DM, Williams DM, Sankaran D, et al. An investigation of polymorphism in the interleukin-10 gene promoter. Eur J Immunogenet 1997;24:1 –8. [29] Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of a polymorphism in the human tumor necrosis factor a promoter on transcriptional activation. Proc Natl Acad Sci USA 1997;94:3195 –9. [30] Crawley E, Kay R, Sillibourne J, Patel P, Hutchinson I, Woo P. Polymorphic haplotypes of the interleukin-10 5% flanking region determine variable interleukin-10 transcription and are associated with particular phenotypes of juvenile rheumatoid arthritis. Arthritis Rheum 1999;42:1101 –8. [31] Edwards-Smith CJ, Jonsson JR, Purdie DM, Bansal A, Shorthouse C, Powell EE. Interleukin-10 promoter polymorphism predicts initial response of chronic hepatitis C to interferon alfa. Hepatology 1999;30:526 –30. [32] Skoog T, van’t Hooft FM, Kallin B, et al. A common functional polymorphism (C A substitution at position – 863) in the promoter region of the tumour necrosis factor-a (TNF-a) gene associated with reduced circulating levels of TNF-a. Hum Mol Genet 1999;8:1443 – 9. [33] Abraham LJ, Du DC, Zahedi K, Dawkins RL, Whitehead AS. Haplotypic polymorphisms of the TNFB gene. Immunogenetics 1991;33:50 – 3. [34] Messer G, Spengler U, Jung MC, et al. Polymorphic structure of the tumor necrosis factor (TNF) locus: an NcoI polymorphism in the first intron of the human TNF-b gene correlates with a variant amino acid in position 26 and a reduced level of TNF-b production. J Exp Med 1991;173:209 – 19. [35] Wilson AG, di Giovine FS, Blakemore AIF, Duff GW. Single base polymorphism in the human tumor necrosis factor alpha (TNFa) gene detectable by NcoI restriction of PCR product. Hum Mol Genet 1992;1:353. [36] Hurme M, Lahdenpohja N, Santtila S. Gene polymorphisms of interleukins 1 and 10 in infectious and autoimmune diseases. Ann Med 1998;30:469 –73. [37] Uglialoro AM, Turbay D, Pesavento PA, et al. Identification of three new single nucleotide polymorphisms in the human tumor necrosis factor-a gene promoter. Tissue Antigens 1998;52:359 – 67.
[38] Joint International Society and Federation of Cardiology/World Health Organization Task Force. Nomenclature and criteria for diagnosis of ischemic heart disease. Circulation 1979; 59: 607 –9. [39] World Health Organization Study Group. Diabetes mellitus. WHO Tech Rep Ser 1985; 727: 1 – 104. [40] Guidelines Subcommittee. 1999 World Health Organization-International Society of Hypertension Guidelines for the Management of Hypertension. J Hypertens 1999; 17: 151 – 83. [41] Livak KJ. Allelic discrimination using fluorogenic probes and the 5% nuclease assay. Genet Anal 1999;14:143 – 9. [42] Terwilliger JD, Ott J. In: Handbook of Human Genomic Linkage. London: The John Hopkins University Press, 1994:188 – 210. [43] Perrey C, Pravica V, Sinnott PJ, Hutchinson IV. Genotyping for polymorphisms in interferon-g, interleukin-10, transforming growth factor-b1 and tumour necrosis factor-a genes: a technical report. Transpl Immunol 1998;6:193 – 7. [44] Stu¨ ber F, Udalova IA, Book M, et al. − 308 tumor necrosis factor (TNF) polymorphism is not associated with survival in severe sepsis and is unrelated to lipopolysaccharide inducibility of the human TNF promoter. J Inflamm 1996;46:42 – 50. [45] Kubota T, McNamara DM, Wang JJ, Trost M, McTiernan CF, Mann DL, Feldman AM. Effects of tumor necrosis factor gene polymorphisms on patients with congestive heart failure. Circulation 1998;97:2499 – 501. [46] Fugger L, Morling N, Ryder LP, et al. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNFa) region in primary biliary cirrhosis and in healthy Danes. Scand J Immunol 1989;30:185 – 9. [47] Lim S, Crawley E, Woo P, Barnes PJ. Haplotype associated with low interleukin-10 production in patients with severe asthma. Lancet 1998;352:113. [48] Brinkman BMN, Zuijdgeest D, Kaijzel EL, Breedveld FC, Verweij CL. Relevance of the tumor necrosis factor alpha (TNFa) −308 promoter polymorphism in TNFa gene regulation. J Inflamm 1996;46:32 – 41. [49] Mølvig J, Pociot F, Baek L, et al. Monocyte function in IDDM patients and healthy individuals. Scand J Immunol 1990;32:297 – 311. [50] Pociot F, Mølvig J, Wogensen L, Worsaae H, Dalbøge H, Baek L, Nerup J. A tumour necrosis factor beta gene polymorphism in relation to monokine secretion and insulin-dependent diabetes mellitus. Scand J Immunol 1991;33:37 – 49. [51] Hermann SM, Richard S, Nicaud V, et al. Polymorphisms of the tumour necrosis factor-a gene, coronary heart disease and obesity. Eur J Clin Invest 1998;28:59 – 66. [52] Wang XL, Oosterhof J. Tumour necrosis factor a G − 308 A polymorphism and risk for coronary artery disease. Clin Sci 2000;98:435 – 7. [53] Turner D, Grant SCD, Yonan N, Sheldon S, Dyer PA, Sinnott PJ, Hutchinson IV. Cytokine gene polymorphism and heart transplant rejection. Transplantation 1997;64:776 – 9. [54] Pasceri V, Yeh ETH. A tale of two diseases – atherosclerosis and rheumatoid arthritis. Circulation 1999;100:2124 – 6. [55] Mok CC, Lanchbury JS, Chan DW, Lau CS. Interleukin-10 promoter polymorphisms in Southern Chinese patients with systemic lupus erythematosus. Arthritis Rheum 1998;41:1090 –5. [56] Topol EJ, Van de Werf FJ. Acute myocardial infarction. Early diagnosis and management. In: Topol EJ, editor. Textbook of Cardiovascular Medicine. Philadelphia: Lippincott-Raven, 1998:395 – 435.
Interleukin-10 and tumor necrosis factor gene polymorphisms and risk of coronary artery disease and myocardial infarction Werner Koch *, Adnan Kastrati, Corinna Bo¨ttiger, Julinda Mehilli, Nicolas von Beckerath, Albert Scho¨mig Deutsches Herzzentrum Mu¨nchen and 1 Medizinische Klinik rechts der Isar, Technische Uni6ersita¨t Mu¨nchen, Munich, Germany Received 26 October 2000; received in revised form 15 January 2001; accepted 31 January 2001
Abstract Inflammation plays an important role in the pathogenesis of atherosclerosis and acute coronary syndromes. Cytokines IL-10 and TNF-a exert opposite functions in inflammatory reactions, IL-10 acting predominantly as an antiinflammatory and TNF-a as a proinflammatory factor. Functional single nucleotide polymorphisms in the genes of IL-10, TNF-a, and TNF-b are associated with gene expression and plasma levels of IL-10 and TNF-a. The aim of the study was to assess whether these IL-10 and TNF gene polymorphisms are related to the risk of coronary artery disease (CAD) and myocardial infarction (MI). Consecutive, angiographically examined patients with significant coronary stenoses but without symptoms or signs of old or acute MI constituted the group with CAD (n=998) and patients with old or acute MI constituted the group with MI (n= 793). Subjects with neither angiographic CAD nor symptoms or signs of MI (n= 340) served as controls. They were matched with the patients for age and sex. Genotyping was performed with techniques based on the polymerase chain reaction. Allele frequencies, genotype distributions, and frequencies of allele combinations for three IL-10 promoter polymorphisms, − 1082G/A, − 819C/T and −592C/A, were similar between CAD patients, MI patients, and matched controls. Similarly, genetic analysis did not reveal group-specific differences for the TNF-a promoter polymorphisms −863C/A and − 308G/A, as well as for the TNF-b intron 1 polymorphism 252G/A. In addition, no relationship was found between specific combinations of IL-10 and TNF alleles, indicative of low IL-10 and high TNF-a production, respectively, and CAD or MI. The lack of association persisted also after adjusting for other cardiovascular risk factors. Our findings suggest that six different and functionally relevant polymorphisms of the genes coding for IL-10, TNF-a, and TNF-b are neither separately nor in cooperation associated with the risk of CAD or MI in angiographically examined patients. © 2001 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Coronary artery disease; Myocardial infarction; Interleukin-10; Tumor necrosis factor; Genetics
1. Introduction The major contribution of inflammatory mechanisms to atherosclerosis has recently been emphasized [1–4]. The pattern and magnitude of cytokine release at the site of tissue injury is considered to be a critical determinant of severity and duration of the response. Interleukin-10 (IL-10) and tumor necrosis factor alpha (TNF-a) have complex and predominantly opposing roles in inflammation [1,2,5 – 9]. An autoregulatory loop * Corresponding author. Present address: Deutsches Herzzentrum Mu¨nchen, Experimentelle Kardiologie, Lazarettstrasse 36, 80636 Munich, Germany. Tel.: +49-89-12182601; fax: +49-89-12183053. E-mail address: [email protected] (W. Koch).
appears to exist in which TNF-a stimulates IL-10 production, which, in turn, reduces TNF-a synthesis [10]. Playing a major role in suppressing immune and inflammatory responses, several functions of IL-10 are centered on inhibition of macrophage function, including cytotoxic activity and cytokine synthesis. In experiments with cultured cells and mice, IL-10 was found to block atherosclerotic events and it was suggested that IL-10 may arrest and reverse the chronic inflammatory response in established atherosclerosis, as well as limit thrombotic complications [11,12]. TNF-a is a potent immunomediator and proinflammatory cytokine that has been implicated in the pathogenesis of a large number of human diseases [13]. The presence of TNF-a in the majority of atherosclerotic
0021-9150/01/$ - see front matter © 2001 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 0 2 1 - 9 1 5 0 ( 0 1 ) 0 0 4 6 7 - 1
138
W. Koch et al. / Atherosclerosis 159 (2001) 137–144
lesions and absence from normal tissues suggests its involvement in atherogenesis [14,15]. TNF-a may contribute to atherosclerosis by activation of growth factors, cytokines, and chemoattractants and by effecting the synthesis and stimulation of adhesion molecules [16,17]. Secretion of TNF-a from mononuclear leukocytes of patients with stable and unstable angina pectoris is elevated when compared with control individuals [18]. In addition, TNF-a possibly increases the risk of thrombotic events by stimulation of procoagulant activity and suppression of antithrombotic pathways in endothelial cells [19]. The human IL-10 gene is located on chromosome 1 and has been mapped to the junction between 1q31 and 1q32 [20,21]. The genes for TNF-a and TNF-b are situated close to each other within the human leukocyte antigen (HLA) class III gene cluster on the short arm of chromosome 6, approximately 220 kilo base pairs (kbp) centromeric of the HLA-B locus and about 850 kbp telomeric of the HLA class II region [22]. Stimulation of human blood samples with bacterial lipopolysaccharide showed large interindividual variations of IL-10 and TNF-a production, suggesting a genetic component of approximately 75 and 60%, respectively [23]. Interindividual differences in the regulation of IL-10 and TNF-a production may be critical in a variety of healthy and abnormal inflammatory responses. Several polymorphisms located close to or within the IL-10, TNF-a, and TNF-b genes are potentially associated with transcription levels, however, the molecular mechanisms linking these polymorphisms to gene expression and posttranscriptional processing are only partially known [9,13,24– 32]. The best documented of these polymorphisms are the IL-10 gene promoter polymorphisms −1082G/A, − 819C/T, and − 592C/A, the TNF-a promoter polymorphisms −863C/A and − 308G/A, as well as the TNF-b intron 1 polymorphism 252G/A [28,33–37]. This study was based on the assumption that the IL-10 and TNF gene polymorphisms have a measurable influence on atherosclerotic mechanisms and contribute to or reduce the occurrence of coronary artery disease (CAD) and myocardial infarction (MI).
2. Subjects and methods
2.1. Patients and controls The study population comprised individuals of Caucasian origin examined with coronary angiography at Deutsches Herzzentrum Mu¨ nchen and 1. Medizinische Klinik rechts der Isar der Technischen Universita¨ t Mu¨ nchen and participating in the Risk Evaluation in Subjects Investigated with Coronary Angiography (RESICA) project. Consecutive patients with significant
coronary stenoses but without symptoms or signs of old or acute MI constituted the group with CAD (n= 998). Consecutive patients with old or acute MI constituted the group with MI (n= 793). Controls (n =340), matched with patients for age and sex, were represented by subjects with neither CAD nor symptoms or signs of acute or old MI. The study was approved by the local Ethics Committee, and informed genetic consent was obtained from all the subjects.
2.2. Definitions The diagnosis of CAD was established angiographically in the presence of ] 50% stenosis in at least one of the three major coronary arteries or major branches. Acute MI, present in 369 patients, was defined on the basis of chest pain for more than 30 min, ST-segment elevation of more than 0.1 mV in two or more successive leads monitored by a standard 12-lead electrocardiogram, and a rise of creatine kinase to greater than twice the normal levels [38]. The diagnosis of old MI, established for 424 patients, was based on the presence of unequivocal changes on the current electrocardiogram. Of the patients with old MI, 35.8% had angiographically occluded infarct-related arteries and 90.3% showed regional wall motion abnormalities corresponding to the electrocardiographic infarct localisation. Individuals were considered disease-free and, therefore, eligible as controls when their coronary arteries were angiographically normal and when they showed neither symptoms nor signs of old or acute MI. Diabetes mellitus was defined in the presence of an active treatment with insulin or an oral antidiabetic agent; for patients on dietary treatment, documentation of an abnormal fasting blood glucose or glucose tolerance test based on the World Health Organisation criteria [39] was required for establishing this diagnosis. Persons reporting regular smoking in the previous 6 months were considered as current smokers. Systemic arterial hypertension was defined as a systolic blood pressure of 140 mmHg or greater and/or a diastolic blood pressure of 90 mm Hg or greater [40] at least on two separate occasions. Hypercholesterolaemia was defined as an documented total cholesterol value 240 mg/dl (6.2 mmoles/l). The definition of cardiovascular risk factors was based on the data obtained during the actual hospitalisation or from the patient’s chart. Being aware of some discrepancies, in the literature, regarding the relative locations of the polymorphic sites in the IL-10 and TNF-a gene promoters, we refer to these positions as reported in the original publications [28,35], with the exception of the C A substitution at − 863 in the TNF-a promoter, for which we keep in line with a recent report [32]. The G to A transition in intron 1 of the TNF-b gene is located at position 252 relative to the transcription start site [34].
W. Koch et al. / Atherosclerosis 159 (2001) 137–144
2.3. Determination of genotypes Genomic DNA was extracted from peripheral blood leukocytes using commercially available kits (Qiagen, Hilden, Germany, and Roche Molecular Biochemicals, Mannheim, Germany). After amplification of genomic DNA by polymerase chain reaction (PCR), genotypes were determined either by allele-specific restriction enzyme analysis or with the use of allele-specific oligonucleotide probes. The sequences of primers and probes are shown in Table 1. Primer pairs 1 and 2 were used to amplify a 377-bp
139
sequence containing the variable − 1082G/A position and a 477-bp sequence containing the variable − 819C/ T and − 592C/A positions of the IL-10 gene, respectively. Primer pairs 3, 4, and 5 were used to amplify a 150-bp sequence containing the − 863C/A position (TNF-a), a 253-bp sequence containing the − 308G/A position (TNF-a), and a 179-bp sequence containing the 252G/A position (TNF-b), respectively. As specifically indicated in Table 1A, the downstream primer of primer pair 3 was modified with respect to the genomic sequence (C6 instead of A) to create a TaiI restriction site (AC6 GT) in the PCR products, if an A was present
Table 1 Primers and probes Primer pair
Polymorphism
(A) Primer pairs for allele-specific restriction enzyme analysis 1 IL-10: −1082G/A 2
IL-10: −819C/T and −592C/A
3
TNF-a: −863C/A
4
TNF-a: −308G/A
5
TNF-b: 252G/A
(B) Primer pairs used in combination with allele-specific probes 6 IL-10: −1082G/A 7
IL-10: −819C/T
8
IL10: −592C/A
9
TNF-a: −863C/A
10
TNF-a: −308G/A
11
TNF-b: 252G/A
(C) Allele-specific probe pairs 1a IL-10: −1082G −1082A 2 IL-10: −819C −819T 3 IL-10: −592C −592A 4 TNF-a: −863C −863A 5a TNF-a: -308G −308A 6 TNF-b: 252G 252A a
Sequence
CCAAGACAACACTACTAAGGCTCCTTT GCTTCTTATATGCTAGTCAGGTA CAACTTCTTCCACCCCATCTTT GTGGGCTAAATATCCTCAAAGTT CCTGGGAGATATGGCCACAcGT CTACATGGCCCTGTCTTCGTTAcG GGAGGCAATAGGTTTTGAGGGcCAT CCTTGGTGGAGAAACCCATGgGCT CTGCCTGGGCCTGGGCCTTGGT GATGCAGTCAGAGAAACCCCAtGGT CACACACACAAATCCAAGACAACA GCTGGATAGGAGGTCCCTTACTTT AGGGTGAGGAAACCAAATTCTCA GACCCCTACCGTCTCTATTTTATAGTGA GAGAATCCTAATGAAATCGGGGTAA CCCAAGCAGCCCTTCCAT CACAGCAATGGGTAGGAGAATGT GAGGTCCTGGAGGCTCTTTCA AGTTAGAAGGAAACAGACCACAGACCT TGATTTGTGTGTAGGACCCTGGA CAGTCTCATTGTCTCTGTCACACATTC GAAGAGACGTTCAGGTGGTGTCAT Probe pair polymorphism sequence FAM-CTACTTCCCCC6 TCCCAAAGAAGCCTTA VIC-CCTACTTCCCCT6 TCCCAAAGAAGCCT FAM-CTTGTACAGGTGATGTAAC6 ATCTCTGTGCCTC VIC-CCCTTGTACAGGTGATGTAAT6 ATCTCTGTGCC FAM-CCGCCTGTC6 CTGTAGGAAGCCA VIC-ACCCCGCCTGTA6 CTGTAGGAAGCC FAM-CGAGTATGGGGACCCCCC6 CTTAA VIC-AGTCGAGTATGGGGACCCCCA6 CTTAA FAM-TGAACCCCGTCCC6 CATGCC VIC-AACCCCGTCCT6 CATGCCCCTC FAM-TTTCTGCCATGG6 TTCCTCTCTGTTCC VIC-TCTGTTTCTGCCATGA6 TTCCTCTCTGTTC
Sequences correspond to the DNA strands complementary to published sequences. Nucleotide sequences of primers and probes are based on sequences deposited in Genbank and EMBL databases; accession numbers: U06844 (IL-10) and M16441 (TNF). Sequences are in 5%–3% direction. Sequences of upstream primers are shown above sequences of downstream primers. Primer nucleotides different from the genomic sequences are in minor letters (see Section 2.3 in Section 2 for details). Allele-specific nucleotides in the probe sequences are underlined. FAM and VIC: fluorogenic dyes attached to the 5% ends of the probe molecules.
140
W. Koch et al. / Atherosclerosis 159 (2001) 137–144
at the template’s polymorphic position, located immediately adjacent to the primer-binding site, and the upstream primer was modified (C6 instead of T) to introduce a TaiI restriction sequence (AC6 GT), serving as an invariant internal control site for restriction analysis. Similarly, with primer pair 4, the upstream primer was modified (C6 instead of G) to create a NcoI site (C6 CATGG), if a C was present at the template’s polymorphic position, located 2 nucleotides off the primerbinding site, and the downstream primer was modified (G6 instead of A) to invariantly introduce a control NcoI site (CCATGG6 ). Finally, the downstream primer of primer pair 5 was modified (T6 instead of A) to create an invariant control NcoI site (CCAT6 GG). DNA amplifications were performed by 30 cycles of two-step reactions consisting of denaturation at 95°C for 1 min and primer annealing and extension at 60°C (IL-10 and TNF-a) or 70°C (TNF-b) for 1 min, followed by a final extension at 72°C for 7 min. Cyclers GeneAmp PCR System 9600, GeneAmp PCR System 9700 (Applied Biosystems, Weiterstadt, Germany), and Primus 96 (MWG-Biotech, Ebersberg, Germany) were used. Restriction enzyme XagI (MBI Fermentas, St. LeonRot, Germany) cleaved the −1082G-specific PCR product into three fragments of 253, 97, and 27 bp and the −1082A-specific PCR product into two fragments of 280 and 97 bp. MaeIII (Roche) cleaved the − 819Cspecific PCR product into three fragments of 217, 175, and 85 bp and the − 819T-specific PCR product into two fragments of 392 and 85 bp. RsaI (Roche) cleaved the − 592C-specific PCR product into four fragments of 311, 116, 42, and 8 bp and the − 592A-specific PCR product into five fragments of 240, 116, 71, 42, and 8 bp. TaiI (MBI Fermentas) cleaved the − 863C-specific PCR product into two fragments of 128 and 22 bp and the −863A-specific PCR product into three fragments of 103, 25 and 22 bp. NcoI (MBI Fermentas) cleaved the − 308G-specific PCR product into three fragments of 210, 23 and 20 bp, and the −308A-specific PCR product into two fragments of 233 and 20 bp. NcoI cleaved the 252G-specific PCR product into three fragments of 105, 51 and 23 bp, and the 252A-specific PCR product into two fragments of 156 and 23. Restriction fragments were separated, by electrophoresis, in 8% polyacrylamide gels (Invitrogen, Groningen, The Netherlands) and, after staining with ethidium bromide solution, identified by 312-nm ultraviolet transillumination. Photographs were taken with a digital documentation system (GelPrint 2000i, MWG-Biotech). Genotyping was also performed with the ABI Prism Sequence Detection System 7700 (Applied Biosystems). The use of allele-specific fluorogenic probe pairs combined DNA amplification and genotype determination into a single assay [41]. Primers and probes were selected with the help of the ‘Primer Express’ software (Applied Biosystems). Primer pairs 6, 7, and 8 (Table
1B) were used to amplify sequences of 93, 107, and 106 bp containing the variable − 1082G/A, − 819C/T and − 592C/A positions of the IL-10 gene, respectively. Probe pairs 1, 2, and 3 (Table 1C) were included in the reactions for discrimination between alleles −1082G and − 1082A, − 819C and − 819T, and − 592C and − 592A, respectively. Of each probe pair, one probe was labeled with the fluorescent dye 6-carboxy-fluorescein (‘FAM’) and the other one with the fluorescent dye ‘VIC’ (Applied Biosystems, patent pending), as indicated in Table 1C. Primer pairs 9, 10, and 11 were used to amplify sequences of 116, 108, and 273 bp containing the − 863C/A and − 308G/A positions of the TNF-a gene and the 252G/A position of the TNF-b gene, respectively. Probe pairs 4, 5, and 6 were used to discriminate between alleles − 863C and − 863A, − 308G and −308A, and 252G and 252A, respectively. DNA amplifications were performed by 40 cycles of denaturation at 95°C for 15 s and primer annealing and extension at 60°C (IL-10 polymorphisms and −308G/ A) or 62°C ( − 863C/A and 252G/A) for 1 min.
2.4. Statistical analysis The analysis consisted of comparing separately genotype distributions between CAD patients and MI patients on one hand and controls on the other. Discrete variables are expressed as counts (%) and compared by 2-or Fisher’s exact test. Continuous variables are expressed as mean9 S.D. and compared by the means of the unpaired, two-sided t-test. Allele associations were tested and estimated with the EH program [42]. The independent association between CAD or MI and the presence of the − 1082A, −819T, −592A, −863C, − 308A, or 252A allele was assessed after adjusting for other potential confounding factors using multiple logistic regression analysis and calculating the adjusted odds ratios and their 95% confidence intervals (CI). Statistical significance was accepted for P-values of B 0.05.
3. Results The main baseline characteristics of matched controls, patients with CAD and patients with MI are shown in Table 2. Diabetes mellitus and cigarette smoking were encountered significantly more often in both the patient groups if compared with controls. Arterial hypertension was also more frequent in CAD patients. The distributions of genotypes did not differ significantly between matched controls, patients with CAD and patients with MI (Table 3). Within each study group, the genotype distributions were consistent with those predicted by the Hardy-Weinberg equilibrium.
W. Koch et al. / Atherosclerosis 159 (2001) 137–144 Table 2 Baseline clinical characteristics of controls and CAD and MI patientsa
Age, years Women Arterial hypertension Diabetes Current smokers Hypercholesterolaemia
Matched controls (n= 340)
CAD (n= 998)
MI (n =793)
63.49 10.3
64.19 10.2
62.6
24.7 60.6 10.3 18.8 40.6
24.1 70.8b 20.2b 24.6c 45.8
911.6 22.6 62.7 21.6b 34.3b 37.8
a Age is mean9S.D.; other variables are % of controls and patients. b PB0.001 versus controls; all others: P= not significant for comparison with matched controls. c PB0.03 versus controls.
The observed IL-10 and TNF allele frequencies were closely similar between the groups − 1082G =0.45 (matched controls, CAD, and MI); −819C or − 592C= 0.72 (matched controls), 0.74 (CAD), and 0.75 (MI); − 863C= 0.84 (matched controls), 0.85 (CAD), and 0.83 (MI); − 308G = 0.84 (matched controls and CAD) and 0.85 (MI); 252G=0.32 (matched controls and CAD) and 0.31 (MI). Then, linkage disequilibrium between the three polyTable 3 IL-10 and TNF genotype distributions in matched controls with coronary angiography, and in CAD and MI casesa Matched controls (n =340) IL-10: −1082
GG 21.8
GA AA −819 CC CT TT −592 CC CA AA TNF: −863 CC CA AA −308 GG GA AA 252 GG GA AA
47.3 30.9 51.5 40.6 7.9 51.5 40.6 7.9 71.1 26.5 2.4 71.8 24.4 3.8 10.3 43.5 46.2
CAD (n= 998)
MI (n= 793)
20.8
21.3
49.2 30.0 54.5 39.1 6.4 54.5 39.1 6.4 71.7 26.3 2.0 70.3 26.9 2.8 9.8 44.5 45.7
48.3 30.4 56.6 37.1 6.3 56.6 37.1 6.3 68.9 28.6 2.5 71.3 27.1 1.6 8.4 44.1 47.5
a Variables are % of controls and patients. P= not significant for all the comparisons.
141
morphic loci of the IL-10 promoter and, separately, between the three polymorphic sites in the genes for TNF-a and TNF-b was tested and estimated. In the case of the IL-10 polymorphisms, three out of eight different theoretically possible allele combinations were present in our population, i.e. − 1082G, − 819C, and − 592C (GCC), ACC, and ATA. The frequencies of these allele combinations were GCC= 0.46 (matched controls) and 0.45 (CAD or MI); ACC= 0.26 (matched controls), 0.29 (CAD), and 0.30 (MI); ATA=0.28 (matched controls), 0.26 (CAD), and 0.25 (MI). The existence of only these allele combinations was independently indicated by the presence of individuals with combinations of the homozygous genotypes − 1082GG, −819CC, and − 592CC (GGCCCC), AACCCC, and AATTAA, but not of individuals with other possible combinations of homozygous genotypes. For the TNF polymorphisms, four different allele combinations were present, i.e. −863C, −308G, and 252A (CGA), CGG, CAG, and AGA. The frequencies of these allele combinations were CGA= 0.52 (matched controls) and 0.53 (CAD or MI); CGG or CAG=0.16 (matched controls or CAD) and 0.15 (MI); AGA= 0.16 (matched controls), 0.15 (CAD), and 0.17 (MI). Similar to the IL-10 polymorphisms, the existence of only these allele combinations was also obvious from the presence of individuals with combinations of the homozygous TNF genotypes − 863CC, − 308GG, and 252GG (CCGGGG), CCGGAA, CCAAGG, and AAGGAA, whereas individuals with other possible combinations of homozygous genotypes were absent from our population. In essence, the frequency of each IL-10 or TNF allele combination was not significantly different between matched controls, CAD patients, and MI patients. Thus, we did not find any indication of an association between a specific allele combination and CAD or MI. The possibility existed that combinations of certain IL-10 and TNF-a genotypes reportedly associated with relatively low IL-10 levels and relatively high TNF-a production, respectively, e.g. genotype − 1082AA (IL10) and genotype − 863CC (TNF-a), were representing cardiovascular risk combinations, and, therefore, should be present more often in the groups of CAD and MI patients than among controls. However, individuals carrying genotype − 1082AA, as well as genotype −863CC were found in the groups in similar frequencies, 0.22 in matched controls and CAD patients and 0.21 in MI patients. This finding, and corresponding results obtained with other hypothetical risk combinations (data not shown), argued against such an association. Using multiple logistic regression analysis, we assessed whether the lack of association between CAD or MI and the presence of −1082A, − 819T, −592A, − 863C, −308A or 252A alleles persisted after adjust-
142
W. Koch et al. / Atherosclerosis 159 (2001) 137–144
ing for the conventional cardiovascular risk factors age, sex, arterial hypertension, diabetes, current smoking and hypercholesterolaemia. In the case of CAD, the adjusted odds ratios for the −1082A, − 819T/ − 592A, −863C, −308A or 252A alleles were 1.01 (95% CI, 0.74–1.37), 0.84 (0.66– 1.08), 1.26 (0.53– 2.95), 1.07 (0.81 –1.41), and 1.09 (0.72– 1.66), and in the case of MI, the adjusted odds ratios were 1.03 (0.75– 1.42), 0.85 (0.65 –1.10), 0.82 (0.35-1.92), 1.02 (0.76– 1.36), and 1.35 (0.87 –2.11), respectively. Thus, even after inclusion of conventional risk factors in the statistical analysis, no relationship was found. In addition, genotype distributions were not significantly different between CAD patients with single-vessel disease (SVD) and those with multi-vessel disease (MVD) and between patients with old MI and those with acute MI. The allele frequencies of patients with SVD and MVD were −1082G =0.47 (SVD) and 0.45 (MVD); −819C or −592C = 0.76 (SVD) and 0.73 (MVD); − 863C= 0.87 (SVD) and 0.84 (MVD); − 308G= 0.85 (SVD) and 0.83 (MVD); 252G=0.35 (SVD) and 0.31 (MVD). For patients with old MI and acute MI, allele frequencies were − 1082G = 0.42 (old MI) and 0.49 (acute MI); −819C or − 592C = 0.73 (old MI) and 0.77 (acute MI); −863C = 0.84 (old MI) and 0.82 (acute MI); − 308G =0.86 (old MI) and 0.84 (acute MI); 252G= 0.30 (old MI) and 0.31 (acute MI). Finally, no significant differences of IL-10 and TNF genotype distributions and allele frequencies were seen between the younger patients (B60 years) with CAD or MI and matched controls.
4. Discussion The main result of this study was that the IL-10 gene polymorphisms −1082G/A, −819C/T, and − 592C/ A, the TNF-a gene polymorphisms − 863C/A and − 308G/A, and the TNF-b polymorphism 252G/A had no measurable influence on the occurence of CAD or MI in angiographically evaluated patients. This finding was based on separate analyses of individual alleles, allele combinations, and genotypes. We observed frequencies of alleles and allele combinations and genotype distributions to be in good correlation with the results of previous studies with Caucasian populations [28,31,32,43– 47]. As found here and in earlier reports [28,30,31,43], complete linkage of allele − 819C with allele −592C and of allele − 819T with allele −592A, and the presence of three different allele combinations, −1082G, − 819C, and − 592C (GCC), ACC, and ATA, are characteristic of the IL-10 polymorphisms in Caucasians. Being a typical feature of the TNF gene polymorphisms − 308G/A (TNF-a) and 252G/A (TNF-b), we and others [44,45] noticed allele A of either polymorphism to be exclusively linked
to allele G in the other one, a rule that is not true in the reverse direction. A possible relationship between IL-10 and TNF alleles and IL-10 and TNF-a gene expression and protein production was previously examined in different experimental settings. In the presence of allele −1082A, stimulation of lymphocytes with concanavalin A (Con A) resulted in lower IL-10 production than in allele − 1082A-negative cells, whereas protein production was independent of allele − 819 and allele − 592 [28]. However, genotype − 592AA was reported to reduce IL-10 production in cultures of peripheral blood mononuclear cells (PBMC) treated with interferon-a [27]. The IL-10 allele combination ATA was related to lower transcriptional activity than allele combination GCC in a monocytic cell line and genotype AATTAA was associated with decreased IL-10 production in whole blood cultures stimulated with lipopolysaccharide [30]. In Con A-stimulated PBMC, allele combinations GCC, ACC and ATA were correlated with high, intermediate and low IL-10 production, respectively [31]. The presence of the common TNF-a allele −863C was found to be associated with higher transcriptional levels in a cell line of human origin, to bind nuclear protein with much higher affinity, and to be related with elevated serum TNF-a levels, if compared with the rare allele − 863A [32]. In contrast, no stimulating influence of allele − 863C on gene expression was observed in a murine cell line [37]. There are also data relating the rare − 308A allele to a higher transcriptional activity than the common − 308G allele [26,29]. However, a lack of such an association has also been reported [32,37,44,48]. Increased secretion of TNF-a from stimulated monocytes prepared from PBMC of healthy individuals was found in association with genotype 252AA, whereas no association between the secretion of TNF-a from unfractionated PBMC and genotype 252AA was detected [24,34,49,50]. Despite these and other findings suggesting a relationship of certain IL-10 and TNF alleles, allele combinations, and genotypes with gene expression and protein production and secretion, our examination of these genetic markers did not indicate any correlation with CAD or MI, the clinical parameters of our study. Obviously, in the context of this study, the cytokine gene polymorphisms we chose for examination do not provide a key to reveal an involvement of IL-10 and TNF-a in CAD and MI. Other polymorphisms in or close to the IL-10 and TNF genes or located in the genes of other cytokines might prove suitable to reveal an association of allelic markers with CAD and MI [13,36]. Recent studies suggested that specific alleles of several polymorphisms of the TNF-a gene, including − 863C/A and − 308G/A, did not contribute to acute MI in an important way [51], that − 308G/A was not
W. Koch et al. / Atherosclerosis 159 (2001) 137–144
associated with CAD [52], and that neither −308G/A nor 252G/A was related to congestive heart failure, whereas plasma levels of TNF-a were elevated in the patients [45]. However, results indicating an association of IL-10 and TNF alleles with disease were also reported. Combination of the low IL-10 producer genotype −1082AA with the high TNF-a producer allele −308A was correlated with increased levels of early heart transplant rejection [53]. In addition, evidence exists suggesting that genetic variations of the IL-10 and TNF locus, including the polymorphisms − 1082G/A and −308G/A, respectively, were involved in determining susceptibility to inflammatory autoimmune diseases, like rheumatoid arthritis, asthma, and insulindependent diabetes mellitus [13,24,30,36,47]. Remarkably, similarities between the inflammatory responses of rheumatoid arthritis and atherosclerosis were observed, suggesting, at least in part, common pathways of disease development to exist [54]. However, in contrast to data indicating an association between the IL-10 allele combination ATA and certain phenotypes of juvenile rheumatoid arthritis [30], our study did not reveal a corresponding result for CAD and MI, two clinically important manifestations of atherosclerosis.
5. Limitations of the study Since this study was performed with individuals of Caucasian origin, it has to be determined separately whether or not the results are valid in populations of other ethnic origin. Notably, in a Chinese population, IL-10 promoter allele and haplotype frequencies were found to greatly differ from those in Caucasians [55]. Several lines of evidence suggested that approximately 20-30% of patients who develop an acute coronary event die before arrival at the hospital [56]. For this reason, a considerable number of potentially eligible patients with acute MI was probably not included in the study. Consequently, underrepresentation of potential risk alleles or genotypes constituted a selection bias that could have affected the result of evaluating associations between genetic factors and MI. Another limitation was the missing determination of plasma levels of IL-10 and TNF-a. Thus, the lack of association between IL-10 and TNF gene polymorphisms and CAD or MI found in this study should not be interpreted as data negating the potential role of IL-10 and TNF-a in atherosclerosis.
Acknowledgements The authors thank Angela Ehrenhaff, Marianne Eichinger, Wolfgang Latz, and Gisela Werner for skilful technical assistance.
143
References [1] Mehta JL, Saldeen TGP, Rand K. Interactive role of infection, inflammation and traditional risk factors in atherosclerosis and coronary artery disease. J Am Coll Cardiol 1998;31:1217 –25. [2] Ross R. Atherosclerosis — an inflammatory disease. New Engl J Med 1999;340:115 – 26. [3] Libby P, Ridker PM. Novel inflammatory markers of coronary risk. Theory versus practice. Circulation 1999;100:1148 –50. [4] Libby P, Hansson GK, Pober JS. Atherogenesis and inflammation. In: Chien KR, editor. Molecular Basis of Cardiovascular Disease. Philadelphia: W.B. Saunders Company, 1999:349 – 66. [5] Mosmann TR. Properties and functions of interleukin-10. Adv Immunol 1994;56:1 – 26. [6] Lalani I, Bhol K, Ahmed AR. Interleukin-10: biology, role in inflammation and autoimmunity. Ann Allergy Asthma Immunol 1997;79:469 – 84. [7] Cope AP. Regulation of autoimmunity by proinflammatory cytokines. Curr Opin Immunol 1998;10:669 – 76. [8] LeBoeuf RC, Schreyer SA. The role of tumor necrosis factor-a receptors in atherosclerosis. Trends Cardiovasc Med 1998;8:131 – 8. [9] Makhatadze NJ. Tumor necrosis factor locus: Genetic organisation and biological implications. Hum Immunol 1998;59:571 –9. [10] van der Poll T, Jansen J, Levi M, ten Cate H, ten Cate JW, van Deventer SJH. Regulation of interleukin 10 release by tumor necrosis factor in humans and chimpanzees. J Exp Med 1994;180:1985 – 8. [11] Pinderski Oslund LJ, Hedrick CC, Olvera T, Hagenbaugh A, Territo M, Berliner JA, Fyfe AI. Interleukin-10 blocks atherosclerotic events in vitro and in vivo. Arterioscler Thromb Vasc Biol 1999;19:2847 – 53. [12] Terkeltaub RA. IL-10: an ‘immunologic scalpel’ for atherosclerosis? Arterioscler Thromb Vasc Biol 1999;19:2823 – 5. [13] Wilson AG, di Giovine FS, Duff GW. Genetics of tumour necrosis factor-a in autoimmune, infectious, and neoplastic diseases. J Inflamm 1995;45:1 – 12. [14] Barath P, Fishbein MC, Cao J, Berenson J, Helfant RH, Forrester JS. Detection and localization of tumor necrosis factor in human atheroma. Am J Cardiol 1990;65:297 – 302. [15] Barath P, Fishbein MC, Cao J, Berenson J, Helfant RH, Forrester JS. Tumor necrosis factor gene expression in human vascular intimal smooth muscle cells detected by in situ hybridization. Am J Pathol 1990;137:503 – 9. [16] Shanley TP, Warner RL, Ward PA. The role of cytokines and adhesion molecules in the development of inflammatory injury. Mol Med Today 1995;1:40 – 5. [17] Thurberg BL, Collins T. The nuclear factor-kB/inhibitor of kB autoregulatory system and atherosclerosis. Curr Opin Lipidol 1998;9:387 – 96. [18] Vaddi K, Nicolini FA, Mehta P, Mehta JL. Increased secretion of tumor necrosis factor-a and interferon-g by mononuclear leukocytes in patients with ischemic heart disease. Relevance in superoxide anion generation. Circulation 1994;90:694 – 9. [19] Nawroth PP, Stern DM. Modulation of endothelial cell hemostatic properties by tumor necrosis factor. J Exp Med 1986;163:740 – 5. [20] Kim JM, Brannan CI, Copeland NG, Jenkins NA, Khan TA, Moore KW. Structure of the mouse IL-10 gene and chromosomal localization of the mouse and human genes. J Immunol 1992;148:3618 – 23. [21] Eskdale J, Kube D, Tesch H, Gallagher G. Mapping of the human IL10 gene and further characterization of the 5% flanking sequence. Immunogenetics 1997;46:120 – 8. [22] Campbell RD, Trowsdale J. Map of the human MHC. Immunol Today 1993;14:349 – 52.
144
W. Koch et al. / Atherosclerosis 159 (2001) 137–144
[23] Westendorp RGJ, Langermans JAM, Huizinga TWJ, Elouali AH, Verweij CL, Boomsma DI, Vandenbroucke JP. Genetic influence on cytokine production and fatal meningococcal disease. Lancet 1997;349:170 –3. [24] Pociot F, Briant L, Jongeneel CV, et al. Association of tumor necrosis factor (TNF) and class II major histocompatibility complex alleles with the secretion of TNF-a and TNF-b by human mononuclear cells: a possible link to insulin-dependent diabetes mellitus. Eur J Immunol 1993;23:224 –31. [25] Stu¨ ber F, Petersen M, Bokelmann F, Schade U. A genomic polymorphism within the tumor necrosis factor locus influences plasma tumor necrosis factor-a concentrations and outcome of patients with severe sepsis. Crit Care Med 1996;24:381 – 4. [26] Kroeger KM, Carville KS, Abraham LJ. The – 308 tumor necrosis factor-a promoter polymorphism effects transcription. Mol Immunol 1997;34:391 –9. [27] Rosenwasser LJ, Borish L. Genetics of atopy and asthma: the rationale behind promoter-based candidate gene studies (IL-4 and IL-10). Am J Respir Crit Care Med 1997;156:S152 – 5. [28] Turner DM, Williams DM, Sankaran D, et al. An investigation of polymorphism in the interleukin-10 gene promoter. Eur J Immunogenet 1997;24:1 –8. [29] Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of a polymorphism in the human tumor necrosis factor a promoter on transcriptional activation. Proc Natl Acad Sci USA 1997;94:3195 –9. [30] Crawley E, Kay R, Sillibourne J, Patel P, Hutchinson I, Woo P. Polymorphic haplotypes of the interleukin-10 5% flanking region determine variable interleukin-10 transcription and are associated with particular phenotypes of juvenile rheumatoid arthritis. Arthritis Rheum 1999;42:1101 –8. [31] Edwards-Smith CJ, Jonsson JR, Purdie DM, Bansal A, Shorthouse C, Powell EE. Interleukin-10 promoter polymorphism predicts initial response of chronic hepatitis C to interferon alfa. Hepatology 1999;30:526 –30. [32] Skoog T, van’t Hooft FM, Kallin B, et al. A common functional polymorphism (C A substitution at position – 863) in the promoter region of the tumour necrosis factor-a (TNF-a) gene associated with reduced circulating levels of TNF-a. Hum Mol Genet 1999;8:1443 – 9. [33] Abraham LJ, Du DC, Zahedi K, Dawkins RL, Whitehead AS. Haplotypic polymorphisms of the TNFB gene. Immunogenetics 1991;33:50 – 3. [34] Messer G, Spengler U, Jung MC, et al. Polymorphic structure of the tumor necrosis factor (TNF) locus: an NcoI polymorphism in the first intron of the human TNF-b gene correlates with a variant amino acid in position 26 and a reduced level of TNF-b production. J Exp Med 1991;173:209 – 19. [35] Wilson AG, di Giovine FS, Blakemore AIF, Duff GW. Single base polymorphism in the human tumor necrosis factor alpha (TNFa) gene detectable by NcoI restriction of PCR product. Hum Mol Genet 1992;1:353. [36] Hurme M, Lahdenpohja N, Santtila S. Gene polymorphisms of interleukins 1 and 10 in infectious and autoimmune diseases. Ann Med 1998;30:469 –73. [37] Uglialoro AM, Turbay D, Pesavento PA, et al. Identification of three new single nucleotide polymorphisms in the human tumor necrosis factor-a gene promoter. Tissue Antigens 1998;52:359 – 67.
[38] Joint International Society and Federation of Cardiology/World Health Organization Task Force. Nomenclature and criteria for diagnosis of ischemic heart disease. Circulation 1979; 59: 607 –9. [39] World Health Organization Study Group. Diabetes mellitus. WHO Tech Rep Ser 1985; 727: 1 – 104. [40] Guidelines Subcommittee. 1999 World Health Organization-International Society of Hypertension Guidelines for the Management of Hypertension. J Hypertens 1999; 17: 151 – 83. [41] Livak KJ. Allelic discrimination using fluorogenic probes and the 5% nuclease assay. Genet Anal 1999;14:143 – 9. [42] Terwilliger JD, Ott J. In: Handbook of Human Genomic Linkage. London: The John Hopkins University Press, 1994:188 – 210. [43] Perrey C, Pravica V, Sinnott PJ, Hutchinson IV. Genotyping for polymorphisms in interferon-g, interleukin-10, transforming growth factor-b1 and tumour necrosis factor-a genes: a technical report. Transpl Immunol 1998;6:193 – 7. [44] Stu¨ ber F, Udalova IA, Book M, et al. − 308 tumor necrosis factor (TNF) polymorphism is not associated with survival in severe sepsis and is unrelated to lipopolysaccharide inducibility of the human TNF promoter. J Inflamm 1996;46:42 – 50. [45] Kubota T, McNamara DM, Wang JJ, Trost M, McTiernan CF, Mann DL, Feldman AM. Effects of tumor necrosis factor gene polymorphisms on patients with congestive heart failure. Circulation 1998;97:2499 – 501. [46] Fugger L, Morling N, Ryder LP, et al. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNFa) region in primary biliary cirrhosis and in healthy Danes. Scand J Immunol 1989;30:185 – 9. [47] Lim S, Crawley E, Woo P, Barnes PJ. Haplotype associated with low interleukin-10 production in patients with severe asthma. Lancet 1998;352:113. [48] Brinkman BMN, Zuijdgeest D, Kaijzel EL, Breedveld FC, Verweij CL. Relevance of the tumor necrosis factor alpha (TNFa) −308 promoter polymorphism in TNFa gene regulation. J Inflamm 1996;46:32 – 41. [49] Mølvig J, Pociot F, Baek L, et al. Monocyte function in IDDM patients and healthy individuals. Scand J Immunol 1990;32:297 – 311. [50] Pociot F, Mølvig J, Wogensen L, Worsaae H, Dalbøge H, Baek L, Nerup J. A tumour necrosis factor beta gene polymorphism in relation to monokine secretion and insulin-dependent diabetes mellitus. Scand J Immunol 1991;33:37 – 49. [51] Hermann SM, Richard S, Nicaud V, et al. Polymorphisms of the tumour necrosis factor-a gene, coronary heart disease and obesity. Eur J Clin Invest 1998;28:59 – 66. [52] Wang XL, Oosterhof J. Tumour necrosis factor a G − 308 A polymorphism and risk for coronary artery disease. Clin Sci 2000;98:435 – 7. [53] Turner D, Grant SCD, Yonan N, Sheldon S, Dyer PA, Sinnott PJ, Hutchinson IV. Cytokine gene polymorphism and heart transplant rejection. Transplantation 1997;64:776 – 9. [54] Pasceri V, Yeh ETH. A tale of two diseases – atherosclerosis and rheumatoid arthritis. Circulation 1999;100:2124 – 6. [55] Mok CC, Lanchbury JS, Chan DW, Lau CS. Interleukin-10 promoter polymorphisms in Southern Chinese patients with systemic lupus erythematosus. Arthritis Rheum 1998;41:1090 –5. [56] Topol EJ, Van de Werf FJ. Acute myocardial infarction. Early diagnosis and management. In: Topol EJ, editor. Textbook of Cardiovascular Medicine. Philadelphia: Lippincott-Raven, 1998:395 – 435.