- Email: [email protected]
INTERLEUKIN 10 (IL-10)-MEDIATED INHIBITION OF INFLAMMATORY CYTOKINE PRODUCTION BY HUMAN ALVEOLAR MACROPHAGES
doi:10.1006/cyto.2000.0721, available online at http://www.idealibrary.com on
INTERLEUKIN 10 (IL-10)-MEDIATED INHIBITION OF INFLAMMATORY CYTOKINE PRODUCTION BY HUMAN ALVEOLAR MACROPHAGES Baisakhi Raychaudhuri,1 Charles J. Fisher,5 Carol F. Farver,2 Anagha Malur,1 Judith Drazba,3 Mani S. Kavuru,1 Mary Jane Thomassen1,4 Alveolar macrophages are an important source of inflammatory cytokines in the lung. IL-10 has been shown to inhibit inflammatory cytokine production by human alveolar macrophages, but mechanisms are unclear. The purpose of the present study was to investigate whether IL-10 modified cytokine production by interference with transcriptional pathways. Alveolar macrophages were obtained from healthy controls by fiberoptic bronchoscopy and incubated with LPSIL-10. Results indicated that steady state mRNA levels of tumour necrosis factor- (TNF) and interleukin 1- (IL-1) decreased in the presence of IL-10. Consequently, electrophoretic mobility shift assays were performed using end-labelled nuclear factor-B (NF-B) or activator protein-1 (AP-1) probe. NF-B binding was decreased in extracts from macrophages incubated for 4 h with LPS+IL-10 in comparison to those incubated with LPS alone. IL-10 also inhibited TNF secretion and NF-B activation induced by another stimulus, staphylococcal toxin. Supershift assays revealed the presence of both p50 and p65 subunits of NF-B. AP-1 was not affected by IL-10. Further examination of mechanisms indicated that IL-10 delayed the LPS-mediated degradation of the inhibitor protein IB, thus delaying the nuclear translocation of the p65 subunit. These observations provide the first evidence that IL-10 antagonizes cytokine transcription in human alveolar macrophages by impeding the nuclear translocation of NF-B by delaying the degradation of IB. 2000 Academic Press
Interleukin 10 (IL-10) inhibits the production of a wide range of inflammatory cytokines from both monocytes and alveolar macrophages.1–4 Recent evidence suggests that IL-10 is important in the maintenance of pulmonary homeostasis. Deficiencies in pulmonary IL-10 are associated with tissue injury and inflammation. IL-10 knock-out mice exhibit dysregulated inflammatory responses including a more severe inflammatory response and granuloma formation with experimentally-induced hypersensitivity pneumonitis From the Departments of 1Pulmonary and Critical Care Medicine, 2 Anatomic Pathology, 3Neurosciences and 4Cell Biology, The Cleveland Clinic Foundation, 9500 Euclid Avenue Cleveland, Ohio 44195-5038, 5Lilly Research Laboratories, a division of Eli Lilly and Company, Lilly Corporate Center, Indianapolis, Indiana 46285, USA Correspondence to: Dr Mary Jane Thomassen, Department of Pulmonary and Critical Care Medicine, 9500 Euclid Avenue, Cleveland Clinic Foundation, Desk A90, Cleveland, Ohio 441955038, USA. E-mail: [email protected] Received 17 January 2000; received in revised form 6 April 2000; accepted for publication 21 April 2000 2000 Academic Press 1043–4666/00/091348+08 $35.00/0 1348
than wild-type mice.5 IL-10 is decreased in the bronchoalveolar lavage fluid (BAL) of patients with inflammatory diseases such as cystic fibrosis and asthma as compared to healthy controls.6–8 Furthermore, low concentrations of IL-10 in BAL in the early stages of acute respiratory distress syndrome (ARDS) patients are associated with increased mortality.8 Thus, IL-10 may function as a counter regulatory, antiinflammatory agent in the lung. In the human lung, the alveolar macrophage is a major source of inflammatory cytokines and very little is known about the regulation of this activity. Peripheral blood monocytes, which belong to the same lineage as macrophages, are a readily obtainable population and have often been used to study the properties of macrophages. However, numerous differences in both cytokine production and responses have been demonstrated between alveolar macrophages and monocytes.9,10 For example, IL-4 suppresses IL-1- and TNF in LPS-stimulated-monocytes, but not in LPS-stimulated alveolar macrophages.11,12 We previously demonstrated that IL-10 had no significant CYTOKINE, Vol. 12, No. 9 (September), 2000: pp 1348–1355
Effect of IL-10 on alveolar macrophages / 1349
effect on IL-1ra secretion of alveolar macrophages.1 In contrast, significant effect on IL-1ra is enhanced by IL-10 in blood monocytes.12,13 Such discrepancies point to the importance of examining specific cell types with regard to cytokine regulation and control of their activities. The purpose of the present study was to investigate whether IL-10 modifies cytokine production of human alveolar macrophages by interference with transcriptional pathways.
A TNF
LPS LPS + IL-10
IL-10 inhibits activation of NF-B The reduction in cytokine mRNA levels suggested that transcription might be affected by IL-10. Because the transcription factors NF-B and AP-1 are involved in cytokine gene transcription,14,15 we examined whole cell extracts from alveolar macrophages incubated with LPS and IL-10 for binding to the consensus sequences of NF-B and AP-1. The time course of NF-B activation was first determined in whole cell extracts at 1, 2, 4, and 6 h post LPS-stimulation. Peak stimulation occurred at 2–4 h with a marked decline at 6 h. The effect of IL-10 on transcription factor activation was determined in whole cell extracts after 4 h exposure of alveolar macrophages to LPS or LPS+IL-10 from three different volunteers which all demonstrated decreased DNA binding activity of NF-B at 20 ng/ml IL-10 (Fig. 2A). Supershift assay revealed that the complex contains both p50 and p65 rel components. LPS induced only a slight increase in AP-1 binding activity and IL-10 did not affect this low level of AP-1 binding (Fig. 2B). TNF secretion from LPS-treated alveolar macrophages at 4 h was 33591267 pg/ml vs 1893713 with LPS+IL-10-treated (44% mean inhibition; n=3).
IL-10 suppresses NF-B activation induced by staphylococcal toxins Alveolar macrophages were exposed to TSST-1 or SEB in the presence or absence of IL-10 to determine whether IL-10 suppressed TNF release induced by
IL-1 mRNA/actin mRNA
To determine whether IL-10 regulated cytokine production by altering mRNA levels, total RNA was isolated from alveolar macrophages after 24 h treatment with LPS with or without IL-10 and assayed by slot blots. TNF and IL-1- mRNA was reduced significantly in response to IL-10 treatment (P=0.02, TNF; P=0.01, IL-1-; Fig. 1). TNF secretion from LPS-treated alveolar macrophages was 7150661 pg/ ml vs 1143250 with LPS+IL-10-treated macrophages (84% mean inhibition; n=5).
B
1.0
0.5
0.0
US
LPS
LPS + IL10
US
LPS
LPS + IL10
0.075 TNF mRNA/actin mRNA
IL-10 decreases steady state cytokine mRNA levels
Actin
US
1.5
RESULTS
IL-1
0.050
0.025
0.000 Figure 1.
IL-10 decreases IL-1 and TNF gene expression.
Human alveolar macrophages from five different individuals were incubated with LPSIL-10 for 24 h. RNA was extracted and slot blots were carried out. Figure 1A shows results from one of five donors. The meanSEM ratio of cytokine mRNA/actin mRNA as determined by phosphoimaging of slot blots for the five donors is shown (B).
stimuli other than LPS. The TNF stimulated by both toxins was dose dependently inhibited with maximum inhibition at 20 ng/ml IL-10; Figure 3; P=0.04, SEB, n=8; P=0.01, TSST, n=8. Ligands that bind to MHC class II molecules have been shown to induce IL-1 and TNF gene transcription.16 The staphylococcal toxins induce NF-B activation in the human monocytic cell line THP-1.17 To determine if the staphylococcal toxin activated NF-B in human alveolar macrophages, EMSA were carried out on whole cell extracts from alveolar macrophages incubated with SEBIL-10. The kinetics of SEB stimulated NF-B activation differed from LPS.
750 A
TNF (pg/ml)
LPS
US
A
Competition
CYTOKINE, Vol. 12, No. 9 (September, 2000: 1348–1355)
LPS + IL-10
1350 / Raychaudhuri et al.
500
250
2
3
4
LPS
LPS + IL-10
Competition
0 1
2
3
4
Figure 2. IL-10 decreases NF-B binding activity in LPS-stimulated human alveolar macrophages. Whole cell extracts were analysed by electrophoretic gel mobility shift assays using a 32P labelled oligonucleotide containing the B consensus sequence and analysed on 4% non-denaturing acrylamide gel. [Lane 1—unstimulated (US), lane 2—LPS-stimulated, lane 3—LPS+IL-10 and lane 4—competition (excess cold NF-B oligonucleotide)]. B. IL-10 has no effect on AP-1 binding activity in LPS-stimulated human alveolar macrophages. Whole cell extracts were analysed by electrophoretic gel mobility shift assays using a 32P labelled oligonucleotide containing the AP-1 consensus sequence and analysed on 4% non-denaturing acrylamide gel. [Lane 1— unstimulated (US), lane 2—LPS-stimulated, lane 3—LPS+ IL-10 and lane 4—competition (excess cold AP-1 oligonucleotide)].
NF-B activation with SEB was most intense at 15 min with a decrease at 30 and 60 min followed by a return to baseline at 120 min. IL-10 decreased NF-B activation in alveolar macrophages from two different volunteers (Fig. 4).
IL-10 does not affect the degradation of IB LPS stimulation of alveolar macrophages resulted in the loss of IB protein and IL-10 did not prevent this loss of IB at 45 min post LPS-stimulation (Fig. 5A). In order to determine whether IL-10 delays the degradation of IB the kinetics of IB degradation were followed after LPS-stimulationIL-10 (Fig. 5B). IB was still visible at 15 min post LPSstimulation+IL-10 whereas LPS alone resulted in almost complete degradation of IB at 15 min. With
5 IL-10 (ng/ml)
10
20
0
0.5
5 IL-10 (ng/ml)
10
20
B
1000
500
0 1
0.5
1500
TNF (pg/ml)
US
B
0
Figure 3. IL-10 decreases TNF secreted by alveolar macrophages stimulated with staphylococcal toxins. Alveolar macrophages were stimulated with (A) TSST-1 (toxic shock syndrome toxin-1) or (B) SEB (staphylococcal enterotoxin B)IL10 (0–20 ng/ml) for 24 h. TNF secretion is significantly decreased by IL-10 (d5 ng/ml) for both TSST-1 and SEB-1 (P<0.05).
LPS treatment alone IB was diminished at 15 and 30 min, partial restoration was visible at 45 min with complete restoration at 60 and 120 min. In contrast, with LPS+IL-10, IB was clearly visible at 15 min, markedly diminished at 30 min with partial restoration at 45, 60 and 120 min. Thus, IL-10 slowed the degradation of IB and the restoration also appears delayed.
IL-10 decreases the nuclear translocation of p65 In order to examine whether IL-10 prevented the nuclear translocation of active NF-B, alveolar macrophages from three different volunteers were cultured on coverslips and exposed to LPS or LPS+IL-10, fixed after 4 h and stained with p65 antibody. Confocal microscopy analysis showed minimal nuclear staining in unstimulated alveolar macrophages (Fig. 6A) and IL-10 alone had no effect (Fig. 6B). LPS-stimulated macrophages revealed intense nuclear staining (Fig. 6C), with decreased nuclear staining in the LPS+IL-10 treated cultures (Fig. 6D), confirming a decrease in NF-B activation. Image quantification
Effect of IL-10 on alveolar macrophages / 1351
Figure 4.
IL-10 decreases NF-B binding activity in SEB-stimulated human alveolar macrophages.
Whole cell extracts were analysed by electrophoretic gel mobility shift assays using a 32P labelled oligonucleotide containing the B consensus sequence and analysed on 4% non-denaturing acrylamide gel. Supershift analysis with antibody to p50 and p65 demonstrated that the NF-B complex contains p50 and p65. Whole cell extracts were made 4 h after LPS-stimulation and 15 min after SEB stimulation.
confirmed the reduction in p65 nuclear translocation (Fig. 6E). TNF secretion from LPS-treated alveolar macrophages at 4 h was 42261190 pg/ml vs 2427607 with LPS+IL-10-treated macrophages (43% mean inhibition, n=3).
DISCUSSION Previously, we demonstrated that IL-10 decreases the LPS-stimulated production of inflammatory cytokines (TNF, IL-1, IL-6, IL-8) by human alveolar macrophages.1 In the present study, we found that IL-10 decreases TNF and IL-1- mRNA. Armstrong et al. also demonstrated decreased LPS-stimulated TNF mRNA in alveolar macrophages following IL-10 treatment.2 These results suggested that IL-10 may decrease transcription. The transcriptional regulation of many inflammatory cytokine genes in numerous cell types is controlled by NF-B.14 The primary form of NF-B is a heterodimer of two Rel homology family proteins, p50 and p65 which are bound to an inhibitory protein IB in the cytoplasm.14 NF-B activation induced by LPS or staphylococcal toxin was decreased by IL-10. The NF-B complex in human alveolar macrophages contains both p50 and p65. IL-10 did not prevent the LPS-induced loss of IB. Activation of NF-B is controlled by sequential phosphorylation,
ubiquitination, and proteasome-mediated degradation of IB.18,19 This process causes the release of NF-B heterodimer which then translocates to the nucleus and binds to the promoter element of many genes and induces transcription. IL-10 may interfere with translocation of the NF-B complex to the nucleus by delaying the degradation of IB. Most known NF-B blockers such as glucocorticosteroids and nitric oxide have been shown to block NF-B activation by interfering with IB degradation and/or stimulating IB synthesis.20–22 NF-B is a ubiquitous transcription factor but species-specific differences and cell-specific differences have been demonstrated.14 In rat alveolar macrophages, IgG immune complex-stimulated NF-B activation was shown to be blocked by IL-10 but IB was not degraded, suggesting species specific differences in mechanisms.23 LPS-stimulated TNF and IL-1- production are downregulated by IL-4 in peripheral blood monocytes, whereas alveolar macrophage production is not affected by IL-4.11 Many of the monocyte/ macrophage differences are related to the state of maturation.24 Both monocyte and alveolar macrophage LPS-stimulated cytokine production are inhibited by IL-10 suggesting that similar mechanisms may be involved in IL-10 mediated inhibition in both cell types. However, reports regarding mechanisms of IL-10 cytokine inhibition in monocytes differ. Wang
1352 / Raychaudhuri et al.
CYTOKINE, Vol. 12, No. 9 (September, 2000: 1348–1355)
scription by impeding the nuclear translocation of NF-B by delaying the degradation of IB. These observations suggest that exogenous IL-10 delivered to the lung may have a role in certain pulmonary inflammatory disease states.
A LPS
+
+
IL-10
+
IkBa
MATERIALS AND METHODS
B
Reagents
LPS
LPS + IL-10 US Figure 5.
15'
30'
45'
60'
120'
IL-10 delays IB- degradation.
Immunoblotting of whole cell lysates using IB-a antibody showing the fate of IB after 45 min stimulation with LPSIL-10 (A). Kinetic analysis of the fate of IB- after LPS treatmentIL-10 (B).
et al. using whole mononuclear preparations (PBMC) and purified monocytes from peripheral blood, report that IL-10 inhibits NF-B with no effect on AP-1 from PBMC.4 In contrast, Dokter et al., using purified monocyte preparations, found no inhibition by IL-10 of LPS-induced NF-B binding activity, however, IL-10 inhibited AP-1 activity.25 The reason for the discrepancies between the two studies is not clear. Differing results between these studies may be due to methodological differences which include LPS concentrations and timing of IL-10 treatment (Wang et al. pretreated for 5 min with IL-10 and Dokter et al. pretreated for 3 h). In our studies, AP-1 binding was only slightly induced by LPS in human alveolar macrophages and IL-10 had no effect on this low level AP-1 binding. An AP-1 site is present in the promoter region of a number of cytokines including TNF.26 The lack of induction by LPS suggests that AP-1 is not an essential regulatory element in human alveolar macrophages. Several reports have demonstrated that AP-1 is stimulated by LPS in monocytes,25,26 whether this differential effect is related to the state of maturation remains to be investigated. IL-10 is an important endogenous regulator in the lung. Pulmonary deficiencies are associated with a number of inflammatory diseases including asthma, cystic fibrosis and ARDS.6–8 Furthermore, blocking IL-10 with monoclonal antibodies increases the lethality following endotoxin or SEB challenge in murine systems.27–30 In summary, both endotoxin and staphylococcal toxin stimulated cytokine release from human alveolar macrophages is blocked by IL-10. We have demonstrated for the first time in human alveolar macrophages that IL-10 antagonizes cytokine tran-
Salmonella typhimurium lipopolysaccharide (LPS) was obtained from Sigma (St Louis, MO, USA) and used at 0.5 g/ml for all experiments. Toxic shock syndrome toxin-1 (TSST) and staphylococcus enterotoxin-B (SEB) were obtained from Toxin Technology, Inc. (Sarasota, FL, USA). Recombinant human IL-10 was from Schering-Plough (Kenilworth, NJ, USA).
Study population and alveolar macrophage preparation This protocol was approved by the Institutional Review Board and all volunteers provided written informed consent. Normal individuals had no history of lung disease and were not on medication. Alveolar macrophages were obtained by fiberoptic bronchoscopy with bronchoalveolar lavage as previously described.31 The tip of the bronchoscope was wedged into the right middle lobe or the lingula. Saline warmed to 37C was instilled by gravity in 50 ml aliquots (total 300 ml) and immediately withdrawn by gentle aspiration. Lavage fluid was filtered and the cells washed with Hanks’ balanced salt solution HBSS (Gibco, Grand Island, NY, USA). Cell number was determined on a haemocytometer, and differential cell counts were performed with a modified Wright’s stain (Hema-3 stain; Biochemical Sciences, Inc., Bridgeport, NJ, USA). Cells were resuspended in RPMI 1640 media supplemented with 5% human AB serum (Gemini, Calabasas, CA, USA), L-glutamine and antibiotics. Macrophages were plated at 3105 cells per well in 24-well culture plates or at 4–5106 cells in 100 mm culture plates and allowed to adhere for 1 h at 37C in a moist 5% CO2 incubator. Non-adherent cells were removed by washing with warmed RPMI. The adherent cell population was >99% alveolar macrophages.
Preparation of whole cell extracts (WCE) Extracts were prepared from freshly isolated bronchoalveolar lavage cells. Macrophages were first adhered and rested for 24 h prior to indicated treatments and then extracts were prepared. For extraction, cells were resuspended in extraction buffer [20 mM Tris (pH 8.0), 150 mM MgCl2, 1% Triton 100], containing protease inhibitor cocktail and kept 20 min on ice. The samples were then centrifuged at 18 000g for 20 min at 4C to clear debris, and supernatants representing WCE were collected. WCE were aliquoted in small volume in order to minimize repeated freeze thaw and kept at 80C for further use. Protein content of WCE was determined by the bicinchoninic acid (BCA) protein assay (Pierce, Rockford, IL, USA).
Effect of IL-10 on alveolar macrophages / 1353
Figure 6.
IL-10 inhibits the nuclear translocation of the p65 component of NF-B in human alveolar macrophages stimulated with LPS.
Alveolar macrophages plated on glass coverslips were left untreated (unstimulated—incubated media alone) or treated with LPSIL-10 for 4 h. After treatment, the cells were fixed and the intracellular location of p65 was determined by indirect immunofluorescence with anti-p65 (Santa Cruz) and counterstained with propidium iodide which stains DNA and RNA (nuclei appear red). If cells are not activated the p65 (NF-B) staining (green) remains localized to the cytoplasm (unstimulated) (A). IL-10 alone had no effect (B). When cells are activated (LPS-stimulated) the NF-B migrates to the nucleus and nuclei appear yellow (C) and in LPS+IL-10 treated less yellow indicates p65 is decreased in the nuclei (D). Scale bar=20 m. Quantification of decreased nuclear p65 by BIOQUANT imaging (E).
1354 / Raychaudhuri et al.
TNF assay Previous studies have shown that IL-10 inhibits LPSstimulated TNF, IL-1-, IL-6 and IL-8 secretion from alveolar macrophages.4 In order to monitor cytokine secretion, TNF levels were measured from cell free supernatants of all experiments. The supernatants were collected at indicated times and assayed for TNF by enzyme-linked immunosorbent assay (ELISA) (Endogen, Cambridge, MA, USA). The sensitivity of the assay was 26–1000 pg/ml. The coefficient of variation was <10%. All assays were carried out in duplicate.
Electrophoretic mobility shift assay (EMSA) For EMSA, 10–20 g of the WCE were incubated in binding buffer (8 mM HEPES pH 7.0, 10% glycerol, 20 mM KCl, 4 mM MgCl2, 1 mM sodium pyrophosphate) containing 1.0 g of poly dI-dC and 32P end labelled probe. Probes have sequences as follows: NF-B: AACTCCGGGAATTTCCCTGGCCCTTGAGGC CCTTAAAGGGACCGGG; AP-1: CGCTTGATGACTCA GCCGGAAGCGAACTACTGAGTCGGCCTT For competition experiments 1000-fold excess of cold oligonucleotide was used. For the supershift assay the WCE was incubated with p65 or p50 antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 30 min at room temperature prior to the addition of the probe. Following incubation with the probe for 20 min, the reaction mixture was analysed on a 4% non-denaturing acrylamide gel. The gels were then dried and exposed for autoradiography. Cells were treated either with LPS or LPS+20 ng/ml IL-10 or left untreated for 4 h before harvesting to make WCE. EMSA was then carried out as described. Autoradiograms were quantified using Image Quant analysis.
Western blot analysis WCE containing 10 g of protein from alveolar macrophages incubated in media alone (unstimulated) or LPS20 ng/ml IL-10 were analysed by 10% SDS polyacrylamide gel electrophoresis and transferred to Immobilon-P membranes and blocked with 5% non-fat dry milk in TBST (10 mM TrisCl, pH 8.0, 150 mM NaCl, 0.1% Tween 20) at 4C overnight. The blot was rinsed twice with TBST followed by 2 h incubation at room temperature with anti-IB- antibody (Santa Cruz Biotechnology) in TBST-containing milk. The membrane was washed for 40 min with TBST and incubated with goat anti-rabbit IgG conjugated with horseradish peroxidase in 5% milk for 1 h then washed four times with TBST and developed with ECL reagent (Amersham, Arlington, IL, USA).
CYTOKINE, Vol. 12, No. 9 (September, 2000: 1348–1355)
stored at 20C until stained. Prior to staining, coverslips were rinsed in PBS pH 7.4 for 10 min. The coverslips were blocked with 2% goat serum in PBS for 15 min. Coverslips were briefly rinsed in PBS and stained with p65 antibody (Santa Cruz Biotechnology) for 60 min in a humid chamber. Coverslips were washed three times in PBS. Fluorescein goat anti-rabbit IgG in PBS supplemented with 2% goat serum was added and the coverslips were incubated in a humid chamber for 45 min in the dark. Coverslips were washed three times in PBS, mounted on slides with Vectashield containing propidium iodide (Vector Laboratories, Burlingame, CA, USA) and then sealed with clear nail polish. Simultaneous two colour fluorescence images were collected on a Leica TCS-SP laser scanning confocal microscope. Nuclear p65 was then quantified by the BIOQUANT True Color windows 95 system, version 2.0 (R & M Biometrics, Inc., Nashville, TN, USA). This system provides advanced image analysis routines for morphometry. Two colour images from dual-labelled immunofluorescent staining (p65 antibody—fluorescein green, DNA—propidium iodide red) were used. The amount of red fluorescence in the cell was the area of the nucleus (denominator) and the amount of yellow (fluorescein green p65 antibody+propidium iodide red DNA) was the amount of antibody (p65) in the nucleus (numerator). Approximately 5–10 random fields containing 20–40 cells each were scanned for each sample. All samples from an individual experiment were stained and analysed at the same time to avoid variations in staining intensity or laser intensity.
Isolation of RNA and slot blot analysis Steady state mRNA level was analysed as described.32 Total RNA was extracted by RNAzol followed by extraction with chloroform and precipitation with isopropanol. For slot blots 5 g of total RNA was heat-denatured and applied to nylon membrane. The membrane was hybridized with 32P dCTP labelled DNA probe (TNF, IL-1-, actin) and then analysed with a phosphoimager (Molecular Dynamics, Sunnyvale, CA, USA).
Statistical analysis All values are reported as meansSEM. Statistical analysis was performed by Student’s t-test. Significance was defined as P<0.05.
Acknowledgements This work was supported in part by Schering Plough. We thank Mary Jane Connors and Lisa Buhrow for technical assistance.
Immunofluorescence staining Alveolar macrophages obtained as described above were plated (1106) in each well of 6-well plates containing glass coverslips. Cells were allowed to adhere for 1 h, washed with media and then incubated for 24 h in media. Media was aspirated and cells were replaced with media alone (unstimulated), LPS-treated, or LPS+20 ng/ml IL-10. Coverslips were rinsed with PBS, then fixed for 2 min in cold acetone and
REFERENCES 1. Thomassen MJ, Divis LT, Fisher CJ (1996) Regulation of human alveolar macrophage inflammatory cytokine production by interleukin-10. Clinical Immunol Immunopathol 80:321–324. 2. Armstrong L, Jordan N, Millar A (1996) Interleukin-10 (IL-10) regulation of tumor necrosis factor (TNF-) from human
Effect of IL-10 on alveolar macrophages / 1355 alveolar macrophages and peripheral blood monocytes. Thorax 51:143–149. 3. de Waal Malefyt R, Abrams J, Bennett B, Figdor CG, de Vries JE (1991) Interleukin-10 (IL-10) inhibits cytokine synthesis by human monocytes: An autoregulatory role of IL-10 produced by monocytes. J Exp Med 174:1209–1220. 4. Wang P, Wu P, Siegel MI, Egan RW, Billah MM (1995) Interleukin (IL)-10 inhibits nuclear factor B (NFB) activation in human monocytes. J Biol Chem 270:9558–9563. 5. Gudmundsson G, Bosch A, Davidson BL, Berg DJ, Hunninghake GW (1998) Interleukin-10 modulates the severity of hypersenstivity pneumonitis in mice. Am J Respir Cell Mol Biol 19:812–818. 6. Bonfield TL, Panuska JR, Hilliard KA, Hilliard JB, Ghnaim H, Berger M (1995) Inflammatory cytokines in cystic fibrosis lungs. Am J Respir Crit Care Med 152:2111–2118. 7. Borish L, Aarons A, Rumbyrt J, Cvietusa P, Negri J, Wenzel S (1996) Interleukin-10 regulation in normal subjects and patients with asthma. J Allergy Clin Immunol 97:1288–1296. 8. Donnelly SC, Strieter RM, Kunkel SL, Burdick MD, Armstrong I, Mackenzie A, Haslett C (1996) The association between mortality rates and decreased concentrations of interleukin-10 and interleukin-1 receptor antagonist in the lung fluids of patients with the adult respiratory distress syndrome. Ann Intern Med 125:191–196. 9. Thomassen MJ, Barna BP, Rankin D, Wiedemann HP, Ahmad M (1989) Differential effect of recombinant granulocyte macrophage colony-stimulating factor on human monocytes and alveolar macrophages. Cancer Res 49:4086–4089. 10. Martinet Y, Yamauchi K, Crystal RG (1988) Differential expression of the tumor necrosis factor/cachectin gene by blood and lung mononuclear phagocytes. Am Rev Respir Dis 138:659–665. 11. Galve-de Rochemonteix B, Nicod LP, Chicheportiche R, Lacraz S, Baumberger C, Dayer JM (1993) Regulation of interleukin-1ra, interleukin-1, and interleukin-1 production by human alveolar macrophages with phorbol myristate acetate, lipopolysaccharide, and interleukin-4. Am J Respir Cell Mol Biol 8:160–168. 12. de Waal Malefyt R, Figdor CG, Huijbens R, MohanPeterson S, Bennett B, Culpepper J, Dang W, Zuraski G, de Vries JE (1993) Effects of IL-13 on phenotype, cytokine production, and cytotoxic function of human monocytes. J Immunol 151:6370–6381. 13. Jenkins JK, Malyak M, Arend WP (1994) The effects of interleukin-10 on interleukin-1 receptor antagonist and interleukin-1 production in human monocytes and neutrophils. Lymphokine Cytokine Res 13:47–54. 14. Baeuerle PA, Henkel T (1994) Function and activation of NF-B in the immune system. Annu Rev Immunol 12:141–179. 15. Schulze-Osthoff K, Bauer M, Vogt M, Wesselborg S, Baeuerle PA (1997) Reactive Oxygen Intermediates As Primary Signals and Second Messengers in Activation of Transcription Factors. In: Forman HJ, Cadenas E (eds) Oxidative Stress and Signal Transduction. Chapman & Hall, New York, 239–259. 16. Scholl PR, Trede N, Chatila TA, Geha RS (1992) Role of protein tyrosine phosphorylation in monokine induction by staphylococcal superantigen toxic shock syndrome toxin-1. J Immunol 148:2237–2241.
17. Trede NS, Castigli E, Geha RS, Chatila T (1993) Microbial superantigens induce NF-B in the human monocytic cell line THP-1. J Immunol 150:5604–5613. 18. Stancovski I, Baltimore D (1997) NF-B activation: The IB kinase revealed? Cell 91:299–302.. 19. Thanos D, Maniatis T (1995) NF-B: A lesson in family values. Cell 80:529–532. 20. Auphan N, DiDonato JA, Rosette C, Helmberg A, Karin M (1995) Immunosuppression by glucocorticoids: inhibition of NF-B activity through induction of IB synthesis. Science 270:286– 290. 21. Scheinman RI, Cogswell PC, Lofquist AK, Baldwin Jr AS (1995) Role of transcriptional activation of IB- in mediation of immunosuppression by glucocorticoids. Science 270:283–286. 22. Raychaudhuri B, Dweik RA, Connors M, Buhrow L, Malur A, Drazba J, Arroliga AC, Erzurum SC, Kavuru M, Thomassen MJ (1999) Nitric oxide blocks nuclear factor-B activation in alveolar macrophages. Am J Respir Cell Mol Biol 21:311–316. 23. Lentsch AB, Shanley TP, Sarma V, Ward PA (1997) In vivo suppression of NF-B and preservation of IB by interleukin-10 and interleukin-13. J Clin Invest 100:2443–2448. 24. Andreesen R, Brugger W, Scheibenbogen C, Kreutz M, Leser H-G, Rehm A, Lo¨ hr GW (1990) Surface phenotype analysis of human monocyte to macrophage maturation. J Leukocyte Biol 7:490–497. 25. Dokter WHA, Koopmans SB, Vellenga E (1996) Effects of IL-10 and IL-4 on LPS-induced transcription factors (AP-1, NF-IL6 and NF-B) which are involved in IL-6 regulation. Leukemia 10:1308–1316. 26. Hawiger J (1994) Lipopolysaccharide-Induced Signal Transduction and Gene Transcription. In: Brigham KL (ed.) Endotoxin and the Lungs. Marcel Dekker, Inc, New York, 69–82. 27. Standiford TJ, Strieter RM, Lukacs NW, Kunkel SL (1995) Neutralization of IL-10 increases lethality in endotoxemia. J Immunol 155:2222–2229. 28. van der Poll T, Marchant A, Buurman W, Berman L, Keogh CV, Lazarus DD, Nguyen L, Goldman M, Moldawer LL, Lowry SF (1995) Endogenous interleukin-10 protects mice from death during septic peritonitis. J Immunol 155:5397–5401. 29. Florquin S, Amraoui Z, Abramowicz D, Goldman M (1994) Systemic release and protective role of IL-10 in staphylococcal enterotoxin B-induced shock in mice. J Immunol 153:2618–2623. 30. Hasko´ G, Vira´ g L, Egnaczyk G, Salzman AL, Szabo´ C (1998) The crucial role of IL-10 in the suppression of the immunological response in mice exposed to staphylococcal enterotoxin B. Eur J Immunol 28:1417–1425. 31. Thomassen MJ, Boxerbaum B Demko CA, Kuchenbrod PJ, Dearborn DG, Wood RE (1979) Inhibitory effect of cystic fibrosis serum on pseudomonas phagocytosis by rabbit and human alveolar macrophages. Pediatr Res 13:1085–1088. 32. Thomassen MJ, Antal JM, Connors MJ, Meeker DP, Wiedemann HP (1994) Characterization of exosurf (surfactant)mediated suppression of stimulated human alveolar macrophage cytokine responses. Am J Respir Cell Mol Biol 10:399–404.
INTERLEUKIN 10 (IL-10)-MEDIATED INHIBITION OF INFLAMMATORY CYTOKINE PRODUCTION BY HUMAN ALVEOLAR MACROPHAGES Baisakhi Raychaudhuri,1 Charles J. Fisher,5 Carol F. Farver,2 Anagha Malur,1 Judith Drazba,3 Mani S. Kavuru,1 Mary Jane Thomassen1,4 Alveolar macrophages are an important source of inflammatory cytokines in the lung. IL-10 has been shown to inhibit inflammatory cytokine production by human alveolar macrophages, but mechanisms are unclear. The purpose of the present study was to investigate whether IL-10 modified cytokine production by interference with transcriptional pathways. Alveolar macrophages were obtained from healthy controls by fiberoptic bronchoscopy and incubated with LPSIL-10. Results indicated that steady state mRNA levels of tumour necrosis factor- (TNF) and interleukin 1- (IL-1) decreased in the presence of IL-10. Consequently, electrophoretic mobility shift assays were performed using end-labelled nuclear factor-B (NF-B) or activator protein-1 (AP-1) probe. NF-B binding was decreased in extracts from macrophages incubated for 4 h with LPS+IL-10 in comparison to those incubated with LPS alone. IL-10 also inhibited TNF secretion and NF-B activation induced by another stimulus, staphylococcal toxin. Supershift assays revealed the presence of both p50 and p65 subunits of NF-B. AP-1 was not affected by IL-10. Further examination of mechanisms indicated that IL-10 delayed the LPS-mediated degradation of the inhibitor protein IB, thus delaying the nuclear translocation of the p65 subunit. These observations provide the first evidence that IL-10 antagonizes cytokine transcription in human alveolar macrophages by impeding the nuclear translocation of NF-B by delaying the degradation of IB. 2000 Academic Press
Interleukin 10 (IL-10) inhibits the production of a wide range of inflammatory cytokines from both monocytes and alveolar macrophages.1–4 Recent evidence suggests that IL-10 is important in the maintenance of pulmonary homeostasis. Deficiencies in pulmonary IL-10 are associated with tissue injury and inflammation. IL-10 knock-out mice exhibit dysregulated inflammatory responses including a more severe inflammatory response and granuloma formation with experimentally-induced hypersensitivity pneumonitis From the Departments of 1Pulmonary and Critical Care Medicine, 2 Anatomic Pathology, 3Neurosciences and 4Cell Biology, The Cleveland Clinic Foundation, 9500 Euclid Avenue Cleveland, Ohio 44195-5038, 5Lilly Research Laboratories, a division of Eli Lilly and Company, Lilly Corporate Center, Indianapolis, Indiana 46285, USA Correspondence to: Dr Mary Jane Thomassen, Department of Pulmonary and Critical Care Medicine, 9500 Euclid Avenue, Cleveland Clinic Foundation, Desk A90, Cleveland, Ohio 441955038, USA. E-mail: [email protected] Received 17 January 2000; received in revised form 6 April 2000; accepted for publication 21 April 2000 2000 Academic Press 1043–4666/00/091348+08 $35.00/0 1348
than wild-type mice.5 IL-10 is decreased in the bronchoalveolar lavage fluid (BAL) of patients with inflammatory diseases such as cystic fibrosis and asthma as compared to healthy controls.6–8 Furthermore, low concentrations of IL-10 in BAL in the early stages of acute respiratory distress syndrome (ARDS) patients are associated with increased mortality.8 Thus, IL-10 may function as a counter regulatory, antiinflammatory agent in the lung. In the human lung, the alveolar macrophage is a major source of inflammatory cytokines and very little is known about the regulation of this activity. Peripheral blood monocytes, which belong to the same lineage as macrophages, are a readily obtainable population and have often been used to study the properties of macrophages. However, numerous differences in both cytokine production and responses have been demonstrated between alveolar macrophages and monocytes.9,10 For example, IL-4 suppresses IL-1- and TNF in LPS-stimulated-monocytes, but not in LPS-stimulated alveolar macrophages.11,12 We previously demonstrated that IL-10 had no significant CYTOKINE, Vol. 12, No. 9 (September), 2000: pp 1348–1355
Effect of IL-10 on alveolar macrophages / 1349
effect on IL-1ra secretion of alveolar macrophages.1 In contrast, significant effect on IL-1ra is enhanced by IL-10 in blood monocytes.12,13 Such discrepancies point to the importance of examining specific cell types with regard to cytokine regulation and control of their activities. The purpose of the present study was to investigate whether IL-10 modifies cytokine production of human alveolar macrophages by interference with transcriptional pathways.
A TNF
LPS LPS + IL-10
IL-10 inhibits activation of NF-B The reduction in cytokine mRNA levels suggested that transcription might be affected by IL-10. Because the transcription factors NF-B and AP-1 are involved in cytokine gene transcription,14,15 we examined whole cell extracts from alveolar macrophages incubated with LPS and IL-10 for binding to the consensus sequences of NF-B and AP-1. The time course of NF-B activation was first determined in whole cell extracts at 1, 2, 4, and 6 h post LPS-stimulation. Peak stimulation occurred at 2–4 h with a marked decline at 6 h. The effect of IL-10 on transcription factor activation was determined in whole cell extracts after 4 h exposure of alveolar macrophages to LPS or LPS+IL-10 from three different volunteers which all demonstrated decreased DNA binding activity of NF-B at 20 ng/ml IL-10 (Fig. 2A). Supershift assay revealed that the complex contains both p50 and p65 rel components. LPS induced only a slight increase in AP-1 binding activity and IL-10 did not affect this low level of AP-1 binding (Fig. 2B). TNF secretion from LPS-treated alveolar macrophages at 4 h was 33591267 pg/ml vs 1893713 with LPS+IL-10-treated (44% mean inhibition; n=3).
IL-10 suppresses NF-B activation induced by staphylococcal toxins Alveolar macrophages were exposed to TSST-1 or SEB in the presence or absence of IL-10 to determine whether IL-10 suppressed TNF release induced by
IL-1 mRNA/actin mRNA
To determine whether IL-10 regulated cytokine production by altering mRNA levels, total RNA was isolated from alveolar macrophages after 24 h treatment with LPS with or without IL-10 and assayed by slot blots. TNF and IL-1- mRNA was reduced significantly in response to IL-10 treatment (P=0.02, TNF; P=0.01, IL-1-; Fig. 1). TNF secretion from LPS-treated alveolar macrophages was 7150661 pg/ ml vs 1143250 with LPS+IL-10-treated macrophages (84% mean inhibition; n=5).
B
1.0
0.5
0.0
US
LPS
LPS + IL10
US
LPS
LPS + IL10
0.075 TNF mRNA/actin mRNA
IL-10 decreases steady state cytokine mRNA levels
Actin
US
1.5
RESULTS
IL-1
0.050
0.025
0.000 Figure 1.
IL-10 decreases IL-1 and TNF gene expression.
Human alveolar macrophages from five different individuals were incubated with LPSIL-10 for 24 h. RNA was extracted and slot blots were carried out. Figure 1A shows results from one of five donors. The meanSEM ratio of cytokine mRNA/actin mRNA as determined by phosphoimaging of slot blots for the five donors is shown (B).
stimuli other than LPS. The TNF stimulated by both toxins was dose dependently inhibited with maximum inhibition at 20 ng/ml IL-10; Figure 3; P=0.04, SEB, n=8; P=0.01, TSST, n=8. Ligands that bind to MHC class II molecules have been shown to induce IL-1 and TNF gene transcription.16 The staphylococcal toxins induce NF-B activation in the human monocytic cell line THP-1.17 To determine if the staphylococcal toxin activated NF-B in human alveolar macrophages, EMSA were carried out on whole cell extracts from alveolar macrophages incubated with SEBIL-10. The kinetics of SEB stimulated NF-B activation differed from LPS.
750 A
TNF (pg/ml)
LPS
US
A
Competition
CYTOKINE, Vol. 12, No. 9 (September, 2000: 1348–1355)
LPS + IL-10
1350 / Raychaudhuri et al.
500
250
2
3
4
LPS
LPS + IL-10
Competition
0 1
2
3
4
Figure 2. IL-10 decreases NF-B binding activity in LPS-stimulated human alveolar macrophages. Whole cell extracts were analysed by electrophoretic gel mobility shift assays using a 32P labelled oligonucleotide containing the B consensus sequence and analysed on 4% non-denaturing acrylamide gel. [Lane 1—unstimulated (US), lane 2—LPS-stimulated, lane 3—LPS+IL-10 and lane 4—competition (excess cold NF-B oligonucleotide)]. B. IL-10 has no effect on AP-1 binding activity in LPS-stimulated human alveolar macrophages. Whole cell extracts were analysed by electrophoretic gel mobility shift assays using a 32P labelled oligonucleotide containing the AP-1 consensus sequence and analysed on 4% non-denaturing acrylamide gel. [Lane 1— unstimulated (US), lane 2—LPS-stimulated, lane 3—LPS+ IL-10 and lane 4—competition (excess cold AP-1 oligonucleotide)].
NF-B activation with SEB was most intense at 15 min with a decrease at 30 and 60 min followed by a return to baseline at 120 min. IL-10 decreased NF-B activation in alveolar macrophages from two different volunteers (Fig. 4).
IL-10 does not affect the degradation of IB LPS stimulation of alveolar macrophages resulted in the loss of IB protein and IL-10 did not prevent this loss of IB at 45 min post LPS-stimulation (Fig. 5A). In order to determine whether IL-10 delays the degradation of IB the kinetics of IB degradation were followed after LPS-stimulationIL-10 (Fig. 5B). IB was still visible at 15 min post LPSstimulation+IL-10 whereas LPS alone resulted in almost complete degradation of IB at 15 min. With
5 IL-10 (ng/ml)
10
20
0
0.5
5 IL-10 (ng/ml)
10
20
B
1000
500
0 1
0.5
1500
TNF (pg/ml)
US
B
0
Figure 3. IL-10 decreases TNF secreted by alveolar macrophages stimulated with staphylococcal toxins. Alveolar macrophages were stimulated with (A) TSST-1 (toxic shock syndrome toxin-1) or (B) SEB (staphylococcal enterotoxin B)IL10 (0–20 ng/ml) for 24 h. TNF secretion is significantly decreased by IL-10 (d5 ng/ml) for both TSST-1 and SEB-1 (P<0.05).
LPS treatment alone IB was diminished at 15 and 30 min, partial restoration was visible at 45 min with complete restoration at 60 and 120 min. In contrast, with LPS+IL-10, IB was clearly visible at 15 min, markedly diminished at 30 min with partial restoration at 45, 60 and 120 min. Thus, IL-10 slowed the degradation of IB and the restoration also appears delayed.
IL-10 decreases the nuclear translocation of p65 In order to examine whether IL-10 prevented the nuclear translocation of active NF-B, alveolar macrophages from three different volunteers were cultured on coverslips and exposed to LPS or LPS+IL-10, fixed after 4 h and stained with p65 antibody. Confocal microscopy analysis showed minimal nuclear staining in unstimulated alveolar macrophages (Fig. 6A) and IL-10 alone had no effect (Fig. 6B). LPS-stimulated macrophages revealed intense nuclear staining (Fig. 6C), with decreased nuclear staining in the LPS+IL-10 treated cultures (Fig. 6D), confirming a decrease in NF-B activation. Image quantification
Effect of IL-10 on alveolar macrophages / 1351
Figure 4.
IL-10 decreases NF-B binding activity in SEB-stimulated human alveolar macrophages.
Whole cell extracts were analysed by electrophoretic gel mobility shift assays using a 32P labelled oligonucleotide containing the B consensus sequence and analysed on 4% non-denaturing acrylamide gel. Supershift analysis with antibody to p50 and p65 demonstrated that the NF-B complex contains p50 and p65. Whole cell extracts were made 4 h after LPS-stimulation and 15 min after SEB stimulation.
confirmed the reduction in p65 nuclear translocation (Fig. 6E). TNF secretion from LPS-treated alveolar macrophages at 4 h was 42261190 pg/ml vs 2427607 with LPS+IL-10-treated macrophages (43% mean inhibition, n=3).
DISCUSSION Previously, we demonstrated that IL-10 decreases the LPS-stimulated production of inflammatory cytokines (TNF, IL-1, IL-6, IL-8) by human alveolar macrophages.1 In the present study, we found that IL-10 decreases TNF and IL-1- mRNA. Armstrong et al. also demonstrated decreased LPS-stimulated TNF mRNA in alveolar macrophages following IL-10 treatment.2 These results suggested that IL-10 may decrease transcription. The transcriptional regulation of many inflammatory cytokine genes in numerous cell types is controlled by NF-B.14 The primary form of NF-B is a heterodimer of two Rel homology family proteins, p50 and p65 which are bound to an inhibitory protein IB in the cytoplasm.14 NF-B activation induced by LPS or staphylococcal toxin was decreased by IL-10. The NF-B complex in human alveolar macrophages contains both p50 and p65. IL-10 did not prevent the LPS-induced loss of IB. Activation of NF-B is controlled by sequential phosphorylation,
ubiquitination, and proteasome-mediated degradation of IB.18,19 This process causes the release of NF-B heterodimer which then translocates to the nucleus and binds to the promoter element of many genes and induces transcription. IL-10 may interfere with translocation of the NF-B complex to the nucleus by delaying the degradation of IB. Most known NF-B blockers such as glucocorticosteroids and nitric oxide have been shown to block NF-B activation by interfering with IB degradation and/or stimulating IB synthesis.20–22 NF-B is a ubiquitous transcription factor but species-specific differences and cell-specific differences have been demonstrated.14 In rat alveolar macrophages, IgG immune complex-stimulated NF-B activation was shown to be blocked by IL-10 but IB was not degraded, suggesting species specific differences in mechanisms.23 LPS-stimulated TNF and IL-1- production are downregulated by IL-4 in peripheral blood monocytes, whereas alveolar macrophage production is not affected by IL-4.11 Many of the monocyte/ macrophage differences are related to the state of maturation.24 Both monocyte and alveolar macrophage LPS-stimulated cytokine production are inhibited by IL-10 suggesting that similar mechanisms may be involved in IL-10 mediated inhibition in both cell types. However, reports regarding mechanisms of IL-10 cytokine inhibition in monocytes differ. Wang
1352 / Raychaudhuri et al.
CYTOKINE, Vol. 12, No. 9 (September, 2000: 1348–1355)
scription by impeding the nuclear translocation of NF-B by delaying the degradation of IB. These observations suggest that exogenous IL-10 delivered to the lung may have a role in certain pulmonary inflammatory disease states.
A LPS
+
+
IL-10
+
IkBa
MATERIALS AND METHODS
B
Reagents
LPS
LPS + IL-10 US Figure 5.
15'
30'
45'
60'
120'
IL-10 delays IB- degradation.
Immunoblotting of whole cell lysates using IB-a antibody showing the fate of IB after 45 min stimulation with LPSIL-10 (A). Kinetic analysis of the fate of IB- after LPS treatmentIL-10 (B).
et al. using whole mononuclear preparations (PBMC) and purified monocytes from peripheral blood, report that IL-10 inhibits NF-B with no effect on AP-1 from PBMC.4 In contrast, Dokter et al., using purified monocyte preparations, found no inhibition by IL-10 of LPS-induced NF-B binding activity, however, IL-10 inhibited AP-1 activity.25 The reason for the discrepancies between the two studies is not clear. Differing results between these studies may be due to methodological differences which include LPS concentrations and timing of IL-10 treatment (Wang et al. pretreated for 5 min with IL-10 and Dokter et al. pretreated for 3 h). In our studies, AP-1 binding was only slightly induced by LPS in human alveolar macrophages and IL-10 had no effect on this low level AP-1 binding. An AP-1 site is present in the promoter region of a number of cytokines including TNF.26 The lack of induction by LPS suggests that AP-1 is not an essential regulatory element in human alveolar macrophages. Several reports have demonstrated that AP-1 is stimulated by LPS in monocytes,25,26 whether this differential effect is related to the state of maturation remains to be investigated. IL-10 is an important endogenous regulator in the lung. Pulmonary deficiencies are associated with a number of inflammatory diseases including asthma, cystic fibrosis and ARDS.6–8 Furthermore, blocking IL-10 with monoclonal antibodies increases the lethality following endotoxin or SEB challenge in murine systems.27–30 In summary, both endotoxin and staphylococcal toxin stimulated cytokine release from human alveolar macrophages is blocked by IL-10. We have demonstrated for the first time in human alveolar macrophages that IL-10 antagonizes cytokine tran-
Salmonella typhimurium lipopolysaccharide (LPS) was obtained from Sigma (St Louis, MO, USA) and used at 0.5 g/ml for all experiments. Toxic shock syndrome toxin-1 (TSST) and staphylococcus enterotoxin-B (SEB) were obtained from Toxin Technology, Inc. (Sarasota, FL, USA). Recombinant human IL-10 was from Schering-Plough (Kenilworth, NJ, USA).
Study population and alveolar macrophage preparation This protocol was approved by the Institutional Review Board and all volunteers provided written informed consent. Normal individuals had no history of lung disease and were not on medication. Alveolar macrophages were obtained by fiberoptic bronchoscopy with bronchoalveolar lavage as previously described.31 The tip of the bronchoscope was wedged into the right middle lobe or the lingula. Saline warmed to 37C was instilled by gravity in 50 ml aliquots (total 300 ml) and immediately withdrawn by gentle aspiration. Lavage fluid was filtered and the cells washed with Hanks’ balanced salt solution HBSS (Gibco, Grand Island, NY, USA). Cell number was determined on a haemocytometer, and differential cell counts were performed with a modified Wright’s stain (Hema-3 stain; Biochemical Sciences, Inc., Bridgeport, NJ, USA). Cells were resuspended in RPMI 1640 media supplemented with 5% human AB serum (Gemini, Calabasas, CA, USA), L-glutamine and antibiotics. Macrophages were plated at 3105 cells per well in 24-well culture plates or at 4–5106 cells in 100 mm culture plates and allowed to adhere for 1 h at 37C in a moist 5% CO2 incubator. Non-adherent cells were removed by washing with warmed RPMI. The adherent cell population was >99% alveolar macrophages.
Preparation of whole cell extracts (WCE) Extracts were prepared from freshly isolated bronchoalveolar lavage cells. Macrophages were first adhered and rested for 24 h prior to indicated treatments and then extracts were prepared. For extraction, cells were resuspended in extraction buffer [20 mM Tris (pH 8.0), 150 mM MgCl2, 1% Triton 100], containing protease inhibitor cocktail and kept 20 min on ice. The samples were then centrifuged at 18 000g for 20 min at 4C to clear debris, and supernatants representing WCE were collected. WCE were aliquoted in small volume in order to minimize repeated freeze thaw and kept at 80C for further use. Protein content of WCE was determined by the bicinchoninic acid (BCA) protein assay (Pierce, Rockford, IL, USA).
Effect of IL-10 on alveolar macrophages / 1353
Figure 6.
IL-10 inhibits the nuclear translocation of the p65 component of NF-B in human alveolar macrophages stimulated with LPS.
Alveolar macrophages plated on glass coverslips were left untreated (unstimulated—incubated media alone) or treated with LPSIL-10 for 4 h. After treatment, the cells were fixed and the intracellular location of p65 was determined by indirect immunofluorescence with anti-p65 (Santa Cruz) and counterstained with propidium iodide which stains DNA and RNA (nuclei appear red). If cells are not activated the p65 (NF-B) staining (green) remains localized to the cytoplasm (unstimulated) (A). IL-10 alone had no effect (B). When cells are activated (LPS-stimulated) the NF-B migrates to the nucleus and nuclei appear yellow (C) and in LPS+IL-10 treated less yellow indicates p65 is decreased in the nuclei (D). Scale bar=20 m. Quantification of decreased nuclear p65 by BIOQUANT imaging (E).
1354 / Raychaudhuri et al.
TNF assay Previous studies have shown that IL-10 inhibits LPSstimulated TNF, IL-1-, IL-6 and IL-8 secretion from alveolar macrophages.4 In order to monitor cytokine secretion, TNF levels were measured from cell free supernatants of all experiments. The supernatants were collected at indicated times and assayed for TNF by enzyme-linked immunosorbent assay (ELISA) (Endogen, Cambridge, MA, USA). The sensitivity of the assay was 26–1000 pg/ml. The coefficient of variation was <10%. All assays were carried out in duplicate.
Electrophoretic mobility shift assay (EMSA) For EMSA, 10–20 g of the WCE were incubated in binding buffer (8 mM HEPES pH 7.0, 10% glycerol, 20 mM KCl, 4 mM MgCl2, 1 mM sodium pyrophosphate) containing 1.0 g of poly dI-dC and 32P end labelled probe. Probes have sequences as follows: NF-B: AACTCCGGGAATTTCCCTGGCCCTTGAGGC CCTTAAAGGGACCGGG; AP-1: CGCTTGATGACTCA GCCGGAAGCGAACTACTGAGTCGGCCTT For competition experiments 1000-fold excess of cold oligonucleotide was used. For the supershift assay the WCE was incubated with p65 or p50 antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 30 min at room temperature prior to the addition of the probe. Following incubation with the probe for 20 min, the reaction mixture was analysed on a 4% non-denaturing acrylamide gel. The gels were then dried and exposed for autoradiography. Cells were treated either with LPS or LPS+20 ng/ml IL-10 or left untreated for 4 h before harvesting to make WCE. EMSA was then carried out as described. Autoradiograms were quantified using Image Quant analysis.
Western blot analysis WCE containing 10 g of protein from alveolar macrophages incubated in media alone (unstimulated) or LPS20 ng/ml IL-10 were analysed by 10% SDS polyacrylamide gel electrophoresis and transferred to Immobilon-P membranes and blocked with 5% non-fat dry milk in TBST (10 mM TrisCl, pH 8.0, 150 mM NaCl, 0.1% Tween 20) at 4C overnight. The blot was rinsed twice with TBST followed by 2 h incubation at room temperature with anti-IB- antibody (Santa Cruz Biotechnology) in TBST-containing milk. The membrane was washed for 40 min with TBST and incubated with goat anti-rabbit IgG conjugated with horseradish peroxidase in 5% milk for 1 h then washed four times with TBST and developed with ECL reagent (Amersham, Arlington, IL, USA).
CYTOKINE, Vol. 12, No. 9 (September, 2000: 1348–1355)
stored at 20C until stained. Prior to staining, coverslips were rinsed in PBS pH 7.4 for 10 min. The coverslips were blocked with 2% goat serum in PBS for 15 min. Coverslips were briefly rinsed in PBS and stained with p65 antibody (Santa Cruz Biotechnology) for 60 min in a humid chamber. Coverslips were washed three times in PBS. Fluorescein goat anti-rabbit IgG in PBS supplemented with 2% goat serum was added and the coverslips were incubated in a humid chamber for 45 min in the dark. Coverslips were washed three times in PBS, mounted on slides with Vectashield containing propidium iodide (Vector Laboratories, Burlingame, CA, USA) and then sealed with clear nail polish. Simultaneous two colour fluorescence images were collected on a Leica TCS-SP laser scanning confocal microscope. Nuclear p65 was then quantified by the BIOQUANT True Color windows 95 system, version 2.0 (R & M Biometrics, Inc., Nashville, TN, USA). This system provides advanced image analysis routines for morphometry. Two colour images from dual-labelled immunofluorescent staining (p65 antibody—fluorescein green, DNA—propidium iodide red) were used. The amount of red fluorescence in the cell was the area of the nucleus (denominator) and the amount of yellow (fluorescein green p65 antibody+propidium iodide red DNA) was the amount of antibody (p65) in the nucleus (numerator). Approximately 5–10 random fields containing 20–40 cells each were scanned for each sample. All samples from an individual experiment were stained and analysed at the same time to avoid variations in staining intensity or laser intensity.
Isolation of RNA and slot blot analysis Steady state mRNA level was analysed as described.32 Total RNA was extracted by RNAzol followed by extraction with chloroform and precipitation with isopropanol. For slot blots 5 g of total RNA was heat-denatured and applied to nylon membrane. The membrane was hybridized with 32P dCTP labelled DNA probe (TNF, IL-1-, actin) and then analysed with a phosphoimager (Molecular Dynamics, Sunnyvale, CA, USA).
Statistical analysis All values are reported as meansSEM. Statistical analysis was performed by Student’s t-test. Significance was defined as P<0.05.
Acknowledgements This work was supported in part by Schering Plough. We thank Mary Jane Connors and Lisa Buhrow for technical assistance.
Immunofluorescence staining Alveolar macrophages obtained as described above were plated (1106) in each well of 6-well plates containing glass coverslips. Cells were allowed to adhere for 1 h, washed with media and then incubated for 24 h in media. Media was aspirated and cells were replaced with media alone (unstimulated), LPS-treated, or LPS+20 ng/ml IL-10. Coverslips were rinsed with PBS, then fixed for 2 min in cold acetone and
REFERENCES 1. Thomassen MJ, Divis LT, Fisher CJ (1996) Regulation of human alveolar macrophage inflammatory cytokine production by interleukin-10. Clinical Immunol Immunopathol 80:321–324. 2. Armstrong L, Jordan N, Millar A (1996) Interleukin-10 (IL-10) regulation of tumor necrosis factor (TNF-) from human
Effect of IL-10 on alveolar macrophages / 1355 alveolar macrophages and peripheral blood monocytes. Thorax 51:143–149. 3. de Waal Malefyt R, Abrams J, Bennett B, Figdor CG, de Vries JE (1991) Interleukin-10 (IL-10) inhibits cytokine synthesis by human monocytes: An autoregulatory role of IL-10 produced by monocytes. J Exp Med 174:1209–1220. 4. Wang P, Wu P, Siegel MI, Egan RW, Billah MM (1995) Interleukin (IL)-10 inhibits nuclear factor B (NFB) activation in human monocytes. J Biol Chem 270:9558–9563. 5. Gudmundsson G, Bosch A, Davidson BL, Berg DJ, Hunninghake GW (1998) Interleukin-10 modulates the severity of hypersenstivity pneumonitis in mice. Am J Respir Cell Mol Biol 19:812–818. 6. Bonfield TL, Panuska JR, Hilliard KA, Hilliard JB, Ghnaim H, Berger M (1995) Inflammatory cytokines in cystic fibrosis lungs. Am J Respir Crit Care Med 152:2111–2118. 7. Borish L, Aarons A, Rumbyrt J, Cvietusa P, Negri J, Wenzel S (1996) Interleukin-10 regulation in normal subjects and patients with asthma. J Allergy Clin Immunol 97:1288–1296. 8. Donnelly SC, Strieter RM, Kunkel SL, Burdick MD, Armstrong I, Mackenzie A, Haslett C (1996) The association between mortality rates and decreased concentrations of interleukin-10 and interleukin-1 receptor antagonist in the lung fluids of patients with the adult respiratory distress syndrome. Ann Intern Med 125:191–196. 9. Thomassen MJ, Barna BP, Rankin D, Wiedemann HP, Ahmad M (1989) Differential effect of recombinant granulocyte macrophage colony-stimulating factor on human monocytes and alveolar macrophages. Cancer Res 49:4086–4089. 10. Martinet Y, Yamauchi K, Crystal RG (1988) Differential expression of the tumor necrosis factor/cachectin gene by blood and lung mononuclear phagocytes. Am Rev Respir Dis 138:659–665. 11. Galve-de Rochemonteix B, Nicod LP, Chicheportiche R, Lacraz S, Baumberger C, Dayer JM (1993) Regulation of interleukin-1ra, interleukin-1, and interleukin-1 production by human alveolar macrophages with phorbol myristate acetate, lipopolysaccharide, and interleukin-4. Am J Respir Cell Mol Biol 8:160–168. 12. de Waal Malefyt R, Figdor CG, Huijbens R, MohanPeterson S, Bennett B, Culpepper J, Dang W, Zuraski G, de Vries JE (1993) Effects of IL-13 on phenotype, cytokine production, and cytotoxic function of human monocytes. J Immunol 151:6370–6381. 13. Jenkins JK, Malyak M, Arend WP (1994) The effects of interleukin-10 on interleukin-1 receptor antagonist and interleukin-1 production in human monocytes and neutrophils. Lymphokine Cytokine Res 13:47–54. 14. Baeuerle PA, Henkel T (1994) Function and activation of NF-B in the immune system. Annu Rev Immunol 12:141–179. 15. Schulze-Osthoff K, Bauer M, Vogt M, Wesselborg S, Baeuerle PA (1997) Reactive Oxygen Intermediates As Primary Signals and Second Messengers in Activation of Transcription Factors. In: Forman HJ, Cadenas E (eds) Oxidative Stress and Signal Transduction. Chapman & Hall, New York, 239–259. 16. Scholl PR, Trede N, Chatila TA, Geha RS (1992) Role of protein tyrosine phosphorylation in monokine induction by staphylococcal superantigen toxic shock syndrome toxin-1. J Immunol 148:2237–2241.
17. Trede NS, Castigli E, Geha RS, Chatila T (1993) Microbial superantigens induce NF-B in the human monocytic cell line THP-1. J Immunol 150:5604–5613. 18. Stancovski I, Baltimore D (1997) NF-B activation: The IB kinase revealed? Cell 91:299–302.. 19. Thanos D, Maniatis T (1995) NF-B: A lesson in family values. Cell 80:529–532. 20. Auphan N, DiDonato JA, Rosette C, Helmberg A, Karin M (1995) Immunosuppression by glucocorticoids: inhibition of NF-B activity through induction of IB synthesis. Science 270:286– 290. 21. Scheinman RI, Cogswell PC, Lofquist AK, Baldwin Jr AS (1995) Role of transcriptional activation of IB- in mediation of immunosuppression by glucocorticoids. Science 270:283–286. 22. Raychaudhuri B, Dweik RA, Connors M, Buhrow L, Malur A, Drazba J, Arroliga AC, Erzurum SC, Kavuru M, Thomassen MJ (1999) Nitric oxide blocks nuclear factor-B activation in alveolar macrophages. Am J Respir Cell Mol Biol 21:311–316. 23. Lentsch AB, Shanley TP, Sarma V, Ward PA (1997) In vivo suppression of NF-B and preservation of IB by interleukin-10 and interleukin-13. J Clin Invest 100:2443–2448. 24. Andreesen R, Brugger W, Scheibenbogen C, Kreutz M, Leser H-G, Rehm A, Lo¨ hr GW (1990) Surface phenotype analysis of human monocyte to macrophage maturation. J Leukocyte Biol 7:490–497. 25. Dokter WHA, Koopmans SB, Vellenga E (1996) Effects of IL-10 and IL-4 on LPS-induced transcription factors (AP-1, NF-IL6 and NF-B) which are involved in IL-6 regulation. Leukemia 10:1308–1316. 26. Hawiger J (1994) Lipopolysaccharide-Induced Signal Transduction and Gene Transcription. In: Brigham KL (ed.) Endotoxin and the Lungs. Marcel Dekker, Inc, New York, 69–82. 27. Standiford TJ, Strieter RM, Lukacs NW, Kunkel SL (1995) Neutralization of IL-10 increases lethality in endotoxemia. J Immunol 155:2222–2229. 28. van der Poll T, Marchant A, Buurman W, Berman L, Keogh CV, Lazarus DD, Nguyen L, Goldman M, Moldawer LL, Lowry SF (1995) Endogenous interleukin-10 protects mice from death during septic peritonitis. J Immunol 155:5397–5401. 29. Florquin S, Amraoui Z, Abramowicz D, Goldman M (1994) Systemic release and protective role of IL-10 in staphylococcal enterotoxin B-induced shock in mice. J Immunol 153:2618–2623. 30. Hasko´ G, Vira´ g L, Egnaczyk G, Salzman AL, Szabo´ C (1998) The crucial role of IL-10 in the suppression of the immunological response in mice exposed to staphylococcal enterotoxin B. Eur J Immunol 28:1417–1425. 31. Thomassen MJ, Boxerbaum B Demko CA, Kuchenbrod PJ, Dearborn DG, Wood RE (1979) Inhibitory effect of cystic fibrosis serum on pseudomonas phagocytosis by rabbit and human alveolar macrophages. Pediatr Res 13:1085–1088. 32. Thomassen MJ, Antal JM, Connors MJ, Meeker DP, Wiedemann HP (1994) Characterization of exosurf (surfactant)mediated suppression of stimulated human alveolar macrophage cytokine responses. Am J Respir Cell Mol Biol 10:399–404.