Interleukin-10 induces senescence of activated hepatic stellate cells via STAT3-p53 pathway to attenuate liver fibrosis

Journal Pre-proof Interleukin-10 induces senescence of activated hepatic stellate cells via STAT3-p53 pathway to attenuate liver fibrosis Yue-Hong Huang, Ming-Hua Chen, Qi-Lan Guo, Zhi-Xin Chen, Qing-Duo Chen, Xiao-Zhong Wang

PII:

S0898-6568(19)30241-4

DOI:

https://doi.org/10.1016/j.cellsig.2019.109445

Reference:

CLS 109445

To appear in: Received Date:

13 August 2019

Revised Date:

16 October 2019

Accepted Date:

20 October 2019

Please cite this article as: Huang Y-Hong, Chen M-Hua, Guo Q-Lan, Chen Z-Xin, Chen Q-Duo, Wang X-Zhong, Interleukin-10 induces senescence of activated hepatic stellate cells via STAT3-p53 pathway to attenuate liver fibrosis, Cellular Signalling (2019), doi: https://doi.org/10.1016/j.cellsig.2019.109445

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Title: Interleukin-10 induces senescence of activated hepatic stellate cells via STAT3-p53 pathway to attenuate liver fibrosis Yue-Hong HUANG#, Ming-Hua CHEN#, Qi-Lan GUO, Zhi-Xin CHEN, Qing-Duo CHEN, Xiao-Zhong WANG* Department of Gastroenterology, Fujian Medical University Union Hospital, Fuzhou, Fujian, 350001, China. [email protected]

ro of

Yue-Hong HUANG:

Ming-Hua CHEN: [email protected] Qi-Lan GUO: [email protected]

-p

Zhi-Xin CHEN: [email protected]

#, Contributed equally

lP

Xiao-Zhong WANG: [email protected]

re

Qing-Duo CHEN: [email protected]

Jo

ur

na

*, Corresponding author: Xiao-Zhong WANG: [email protected]

1

re

-p

ro of

Graphical abstract

Highlight

lP

The senescence of activated HSCs restricts the liver fibrosis IL-10 induces directly the senescence of activated HSCs to attenuate liver fibrosis IL-10 induced senescence of activated HSCs via STAT3-p53 pathway in vitro

Jo

ur

na

  

2

Abstract Hepatic fibrosis is a wound healing process which results in deposition of excessive abnormal extracellular matrix (ECM) in response to various liver injuries. Activated hepatic stellate cells (HSCs) are the major sources of ECM and induction of senescence of activated HSCs is an attractive therapeutic strategy for liver fibrosis. Our previous studies have shown that interleukin-10 (IL-10) attenuates the carbon tetrachloride (CCL4) - and porcine serum-induced

ro of

liver fibrosis in rats. However, little is known about the mechanisms of IL-10 regulating the

senescence of activated HSCs. The aim of this study is to uncover the underlying pathway by

which IL-10 mediates activated HSCs senescence to attenuate liver fibrosis. In vivo, we found

-p

that IL-10 gene by hydrodynamics-based transfection attenuated CCL4-induced liver fibrosis

re

associated with senescence of activated HSCs in rats. In vitro experiment confirmed that IL-10 could induce senescence of activated HSCs via inhibiting cell proliferation, inducing

lP

cell cycle arrest, increasing the SA-β-Gal activity and enhancing expression of senescence

na

marker protein p53 and p21. Treatment with Pifithrin-α, a specific inhibitor of p53, could abrogate IL-10-increased SA-β-Gal activity and expression of P53 and P21in activated HSCs.

ur

Lastly, IL-10 also increased the expression of total and phosphorylated signal transducers and activators of transcription 3(STAT3) and promoted phosphorylated STAT3 translocation from

Jo

cytoplasm to nucleus. Treatment with cryptotanshinone, a specific inhibitor of STAT3, could inhibit the phosphorylation of STAT3 and its downstream proteins p53 and p21 expression and decrease the activity of SA-β-Gal in activated HSCs induced by IL-10. Taken together, IL-10 induced senescence of activated HSCs via STAT3-p53 pathway to attenuate liver fibrosis in rats and present study will provide a new mechanism of antifibrotic effects of

3

IL-10.

Keywords: Interleukin-10; senescence; signal pathway; hepatic stellate cells; liver fibrosis

1.

Introduction

Liver fibrosis is a wound healing response which results in the abnormal deposition of

ro of

extracellular matrix (ECM) in response to various liver injuries including viral infections, toxic damage, metabolic and genetic diseases [1].Advance liver fibrosis results in liver

cirrhosis or hepatic carcinoma, which is estimated to affect 1% to 2% of global population

-p

and results in over 1 million deaths annually worldwide[2]. Activation of hepatic stellate cells

re

(HSCs) is recognized as a vital step in liver fibrosis and activated HSCs were the major source of ECM in liver fibrosis [3]. Beside of phenotypic reversion [4] and apoptosis [5] of

lP

activated HSCs, accumulating studies have showed that senescence of activated HSCs limits

na

hepatic fibrosis [6, 7]. Senescent activated HSCs reduced secretion of ECM components and enhanced immune surveillance, which facilitating the resolution of liver fibrosis [6]. These

ur

studies suggest that induction of senescence of activated HSCs may be a promoting strategy for antifibrotic therapy.

Jo

Interleukin 10 (IL-10) is a typical anti-inflammatory factor that controls neutrophil infiltration and suppresses various pro-inflammatory mediators [8]. It has shown to possess the antifibrotic effects as demonstrated by its capacity to suppress fibrogenic and pro-inflammatory gene expression [9]. Our previous study shows that IL-10 gene treatment attenuates liver fibrosis by inhibiting the activation of HSCs and promoting degeneration of

4

collagen [10]. Whether the inhibition effects of IL-10 on activated HSCs are associated with senescence of activated HSCs? Our previous study shows that IL-10 promotes the senescence of primary activated HSCs via up-regulation expression of senescent associated protein p53 and p21 [11]. Here, we hypothesized that IL-10 induced senescence of activated HSCs to attenuate the liver fibrosis. Firstly, we analyzed the relationship between antifibrotic effects of IL-10 and senescence of activated HSCs; secondly, a special pharmacologic inhibitor of p53

ro of

or STAT3 was used to analyze the underlying signaling pathway in senescent activated HSCs

after IL-10 treatment. Present study will elucidate the underlying pathway in which IL-10

induced senescence of activated HSCs and provide a new mechanism for antifibrotic effects

2.1.

Methods Reagents and Antibodies

re

2.

-p

of IL-10.

lP

Reagents for isolation of primary HSCs were used in this study: Collagenase type I

na

(Worthington Biochemical Corporation, Lakewood, NJ, USA), Histodenz (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany), Dulbecco’s modified Eagle’s medium (DMEM) and

ur

fetal bovine serum (FBS) (Hyclone; GE Healthcare Life Sciences, Logan, UT, USA), D-Hanks buffer (PYG-0079, Boster Biological Technology, Wuhan, China). Antibodies were

Jo

used in this study: collagen type I, p53, p-STAT3, STAT3 and Laminb1 (cell signaling Technology Company), α-smooth muscle Actin (α-SMA) (ab32575) and p21 (109199) (Abcam Company, Hong Kong, China), Horseradish peroxidase-conjugated homologous secondary antibody (ZSGB-BIO; Beijing, China). Cytokines and reagent kit were used as follow: recombinant rat IL-10 (PeproTech, New Jersey , USA ), Etoposide (EPO),

5

Cryptotanshinone (CPT) and Pifithin-α (PFT) (MedChem Express, New Jersey, USA), Endofree plasmid Maxi kit (Qiagen, Beijing, China; USA), Senescence β-Galactosidase Staining kit and enhance BCA protein assay kit (Beyotime Institute of Biotechnology, Shanghai, China), Cell Counting Kit-8 (Dojindo Molecular Technologies, Kumamoto, Japan), enhanced chemiluminescence kit (Santa Cruz Biotechnology, Inc., Dallas, TX, USA), 4',6-diamidino-2-phenlindole dihydrochloride (Roche Diagnostics, Indianapolis, IN, USA),

2.2.

ro of

SYBR-Green master mix kit (Takara Biotechnology Co., Ltd, Japan). Animal model and experimental protocols

-p

Clean male Sprague-Dawley rats with a body weight of 180 ± 20 g purchased from the

Shanghai Experimental Animal Center (Shanghai, China) were bred at a room temperature of

re

23±3˚C, humidity of 50-70%, with a 12-h alternating light/dark cycle and access to water and

lP

food ad libitum. The totals of 36 rats were divided randomly into control group (group C), pcDNA3 empty vector control group (group P) and pcDNA3-rIL-10 plasmid treatment group

na

(group T). Rats in group P and T were injected 40% solution of carbon tetrachloride (CCL4) dissolved in olive oil twice a week by intraperitoneal injection for 8 weeks while rats in group

ur

C injected olive oil only. From the 4th week, rats in group C, P and T were injected weekly

Jo

with Ringer’s solution, pcDNA3 empty plasmid or pcDNA3-rIL-10 plasmid through tail vein, respectively. All of rats were sacrificed under anesthesia of 10% chloral hydrate at the end of the 8th week. Partly liver tissues were fixed in 10% formalin solution for histological analysis of liver fibrosis and immunostaining analysis. Animal procedures were performed under the control of the animal care committee of Fujian Medical University in accordance with the Guidelines on Animal Experiments in Fujian Medical University. 6

2.3.

Plasmid DNA preparation and injection

Large-scale plasmid DNA preparation was performed using the alkaline lysis method according to protocol. Injection of plasmid DNA was performed through hydrodynamic-based transfection (HBT) as described by our previous study [10].

2.4.

Liver histological analysis

ro of

Liver tissues were fixed in 10% formalin and embedded with paraffin. After deparaffinization with xylene and rehydrate with graded ethanol, sections were stained with hematoxylin and

eosin (H&E) and Masson’s trichrome stain and then evaluated the degree of liver fibrosis by

-p

two pathologists; according to modified HAI score [12]. Deposition of collagen type I and III

re

was measured by Sirius Red stain, collagen area was quantified by using Image-Pro Plus software (version 6.0; Media Cybernetics, Inc., Rockville, MD, USA), as we previously

Cellular senescence assay

na

2.5.

lP

reported [10].

The senescence-associated β-galactosidase (SA-β-Gal) activity in liver tissue or activated

ur

HSCs was detected by SA-β-Gal Staining kit. In brief, liver sections or activated HSCs were

Jo

fixed with the staining fixative for 30 min at room temperature, washed with PBS and stained overnight with X-Gal solution at 37˚C. Liver sections were counterstained with Sirius Red or Eosin staining for 2 min at room temperature; activated HSCs were counterstained with 4', 6-diamidino-2-phenlindole dihydrochloride (DAPI) (500ng/ml) for 10 min at room temperature. Relative SA-β-Gal+ area (%) in fibrotic and SA-β-Gal+ rate in activated HSCs

7

were detected in at least three fields with phase contrast microscope (magnification, x200) using Image-Pro Plus software (version 6.0; Media Cybernetics, Inc., Rockville, MD, USA).

2.6.

Immunohistochemistry (IHC) analysis

Liver tissues section after deparaffinization with xylene and dehydration with graded ethanol, were incubated in PBS containing 30 ml/l H2O2 to remove endogenous peroxidase and in PBS

ro of

containing 0.1mol/l citrate to microwave antigen retrieval and then incubation with 2.5% normal goat serums to block the nonspecific binding sites. After incubation with primary

antibodies, the sections were treated with instant S-P immunohistochemical reagents and then

-p

incubated in a buffer solution containing 3, 3-diaminobenzidine tetrahydrochloride (DAB) to

re

produce a brown reaction product, Finally, sections were counterstained with hematoxylin Staining Solution, dehydrated, plated on coverslips and visualized under a microscopy

lP

(magnification, x200), α-SMA-positive area were quantified by using Image-Pro Plus Version 6.0 software.

SA-β-Gal and α-SMA double staining

na

2.7.

ur

Liver section were performed the expression of α-SMA by IHC after detecting the SA-β-Gal

Jo

activity and then counterstained with eosin.

2.8.

Isolation of primary rat HSCs and cell culture protocol

The protocol for primary rat HSCs isolation as described previously [11], in brief, liver was perfusion in situ by collagenase and primary HSCs were acquired after 12% Histodenz® density gradient centrifugation. Primary HSCs were cultured in DMEM with 20% FBS for

8

first 24 h and then changed to new culture medium (DMEM with 10% FBS) for further culture for 6 days. The immortalization rat HSCs line HSC-T6 cells were cultured in DMEM with 10% FBS. After 24h incubation in serum-free medium, activated HSCs were divided into control and treatment groups: Control group HSCs ( Con) were cultured with DMEM supplemented with 10% FBS for 24 h; IL-10 treatment group HSCs (IL-10) were cultured with IL-10(20ng/ml) for 24 h; Inhibitor control group HSCs were culture with CPT(10μM) or

ro of

PFT(20μM) for 24 h, IL-10 and inhibitor co-treatment HSCs were cultured with

IL-10(20ng/ml) after pretreatment with inhibitor of PFT or CPT for 24 h. Cells were collected

Cell proliferation and cell cycle assay

re

2.9.

-p

for detection of cellular senescence and senescence marker protein.

Primary rat HSCs cells were seeded in 96-well (3x103 cells/well) plates and 6-well (2x105

lP

cells/well) plates respectively and cultured in DMEM supplemented with 10% FBS. After 24h incubation in serum-free medium, primary activated HSCs were treated with or without IL-10

na

(20ng/ml) for additional 24 h. The Cell Counting Kit-8 and flow cytometry analysis were used to detect the cell proliferation and the distribution of cell cycle, respectively. The cell

ur

cycle data were analyzed by using the ModFit LT software.

Jo

2.10. Real-time Polymerase Chain Reaction (real-time PCR)

Real-time PCR was performed as described previously [11]. The primers are listed in Table 1. In brief, total RNA was extracted by TRIzol® reagent and reverse transcribed to cDNA and then amplified using the SYBR-Green master mix kit. The PCR cycling conditions were as follows:95˚Cfor 2 min and 45 cycles of 95˚C for 15 sec, 63˚C for 15 sec,72˚C for 20 sec. All 9

procedures were performed in triplicate. The mRNA levels were calculated relative to the control β-actin using the 2-ΔΔCq method.

2.11. Western Blot analysis

The protocol of western bolt analysis was described in previous study [11]. In brief, the whole proteins were extracted from primary HSCs or HSC-T6 cells in different groups. The

ro of

concentration of protein was evaluated by enhance BCA protein assay kit. Total amounts (20-40 µg) of protein were separated on a 8%-12% SDS-polyacrylamide gel and transferred onto nitrocellulose membranes. After blocking with 5% skim milk( diluted in Tris-buffered

-p

saline/Tween-20) for 1 h at room temperature, the membranes were incubated primary

re

antibodies (a-SMA, Col-1, p53, GAPDH, p-STAT3: concentration, 1:1000) (STAT3, laminB1 and p21: concentration, 1:500) at 4˚C overnight, then followed by incubation with secondly

lP

antibody for 1 h at room temperature. The signals were visualized using an enhanced chemiluminescence kit. The band density was determined by densitometry and quantified

na

using ChemiDoc™ Touch Imageing System with Image Lab™ Touch Software 5.2 version.

ur

2.12. Statistical analysis

Jo

Data were presented as mean ± SD, and results were analyzed using SPSS19.0 software. The significance of difference was determined by one-way ANOVA with the post-hoc Dunnett’s test or by unpaired Test. Values of P<0.05 or less were considered to be statistically significant.

3. 3.1.

Results IL-10 gene treatment attenuated CCL4-induced liver fibrosis in rats 10

Our previous study has demonstrated that IL-10 gene treatment by HBT could attenuate porcine serum-induced liver fibrosis in rats via inhibiting activation of HSCs [10]. In order to further verify the mechanisms of antifibrotic effects of IL-10, we explored this phenomenon in CCL4-induced liver fibrosis rats. Liver biopsy is a gold-standard method for evaluation of liver fibrosis. H&E and Masson stains showed that the structure of liver lobule was normal and a few collagen fibers located in portal area and central vein in group C, and that

ro of

hepatocytes degeneration, inflammatory cells infiltration around portal area and collagen

deposition in group T were significantly reduced compared to group P (Fig.1 A). The semi-quantitative evaluation of liver biopsy showed that grading of inflammatory and staging

-p

of fibrosis in group T was markedly declined compared to group P (Fig.1 B). These data

re

showed that IL-10 gene treatment could inhibit the inflammation and collagen deposition and restrict the progression of fibrosis in fibrotic rats. Collagen type I and III were the main

lP

component of ECM. Sirius Red staining, a typical staining for collagen type I and III, further

na

showed that the deposition of interstitial collagen type I and III in group T was dramatically reduced compared with group P (Fig.1 C). The results indicated that IL-10 treatment could

ur

promote degradation of ECM. Together, these data indicate that IL-10 gene treatment attenuated CCL4-induced liver fibrosis in rats. IL-10 promoted senescence of activated HSCs in fibrotic rats

Jo

3.2.

Above results showed IL-10 promoted the degradation of ECM. It is known that activated HSCs are the main source of ECM deposition. IHC stain showed that numbers of α-SMA (marker of activated HSCs) [11] positive cells in group T were dramatically decreased compared with rats in group P (Fig. 1D). These data indicate that IL-10 gene treatment

11

promotes the clearance of activated HSCs. In addition to apoptosis and phenotype reversion, it has been known that senescent HSCs enhance immune surveillance and increase clearance of activated HSCs by natural killer cells [6], so we speculated that decrease number of activated HSCs may due to a senescence induction of activated HSCs. Senescent cellular characterized by increasing SA-β-Gal activity, here, the SA-β-gal staining was used to detect the senescent cellular in liver. The results revealed that positive stain for SA-β-gal was

ro of

accumulated in fibrotic liver and located along fibrous septa. The areas of SA-β-gal positive

stain in group T were dramatically increased compared with group P (Fig. 1E). The location of SA-β-gal positive stain was similar to α-SMA positive stain. These results indicate that

-p

IL-10 treatment increased SA-β-gal activity in fibrotic rat liver and SA-β-gal+ cells may be

re

activated HSCs. Lastly, the SA-β-gal and α-SMA immunohistochemistry double staining revealed that mostly areas of SA-β-gal+ cells were the α-SMA positive cells (Fig. 1F).

lP

Together, these data indicated that senescent cells in fibrotic liver were the activated HSCs

IL-10 induced senescence of primary activated HSCs in vitro

ur

3.3.

na

and IL-10 promoted the senescence of activated HSCs.

Cellular senescence, a stable form of cell cycle arrest, presents elevated activity of SA-β-gal

Jo

and halts cell proliferation in response to various stressors [13]. In vivo experiment has revealed that the antifibrotic effects of IL-10 were associated with senescence of activated HSCs. To further clarify whether IL-10 has a direct effect on senescence of activated HSCs, primary HSCs isolated from rats were cultured on plastic plates for 7d in order to spontaneously activate HSCs. The activation of HSCs is characterized by expressing α-SMA

12

and secreting the collagen. Here, Real-Time PCR (Fig. 2A) and Western Blot (Fig. 2 B) assay revealed that primary HSCs were totally activated after cultured on plastic plate for 7d and activated HSCs expressed highly levels of α-SMA and collagen type I. Then we explored the effects of IL-10 on senescence of activated HSCs. After primary activated HSCs treated with or without IL-10 for 24 h, we evaluated the SA-β-gal activity, cell proliferation and cell cycle in primary activated HSCs. Etoposide (ETO) is a DNA damage reagent, as the positive

ro of

control for senescence stain [14]. SA-β-gal staining revealed that the numbers of SA-β-gal

positive stain in IL-10 treatment group were higher than control group (Fig. 2C). It meant that

IL-10 treatment dramatically elevated the activity of SA-β-gal in activated HSCs. CCK8

-p

assay showed that the ability of activated HSCs proliferation was significantly inhibited by

re

IL-10 (Fig. 2D). The typical phenomenon of cellular senescence is cell cycle arrest. Here, flow cytometry assay showed that numbers of G1-arrested activated HSCs in IL-10 treatment

lP

group exhibited marked increase compared with the control group (Fig. 2E); the results

na

confirmed that IL-10 could induce senescence of activated HSCs. Taken together; IL-10 had a

3.4.

ur

direct effect on activated HSCs and could induce senescence of primary activated HSCs.

IL-10 induced senescence of activated HSCs in p53-dependent manner

Jo

Cellular senescence is mainly mediated by p53/p21-dependent pathway [15]. To explore the underlying signal pathway of IL-10 promoting activated HSCs senescence, real-time PCR and Western bolt were used to detect the expression of senescence marker protein p53 and its downstream target protein p21 in activated HSCs treated with or without IL-10. The results showed that IL-10 up-regulated the mRNA and protein expression of senescence marker

13

protein P53 and P21 (Fig. 3A and 3B). To further explore whether IL-10 had a direct effect on the expression of p53 and p21 in vitro, pifithrin-α (PFT), which is P53 special pharmacologic inhibitor, was used to abrogate expression of P53 in primary activated HSCs or HSC-T6 cells. Western Blot assay revealed that the expression of p53 and its downstream target protein p21 were significantly decreased in PFT-α pretreatment primary activated HSCs compared to IL-10 treatment alone (Fig. 3C). Similar results were presented in HSC-T6 cells (Fig. 3D);

ro of

these results indicated that IL-10 elevated the expression of p21 through p53 pathway. Lastly, SA-β-gal stain further confirmed that cell numbers of the SA-β-gal positive primary activated HSCs in pretreatment with PFT-α dramatically decreased compared with IL-10 treatment

-p

alone (Fig. 3E). Together, these data indicate that IL-10 induced senescence of activated

IL-10 induced the senescence of activated HSCs in STAT3-dependent manner

lP

3.5.

re

HSCs via p53 signal pathway.

na

Signal transducer and activator of transcription 3(STAT3) is a key downstream transcription factor of IL-10 [16]. It has been reported to regulate cellular senescence via up-regulation of

ur

P53 and P21 [17]. Firstly, we detected the expression of total and phosphorylated STAT3 (p-STAT3) in primary activated HSCs treated with IL-10. The results showed that the levels

Jo

of total STAT3 and p-STAT3 in primary activated HSCs were increased after IL-10 treatment for 24 h (Fig. 4A); Immunofluorescence stain showed p-STAT3 positive stain was mainly in nucleus for IL-10 treatment for 24h and indicated that IL-10 promotes the translocation of STAT3 from cytoplasm to nucleus(Fig. 4B). To confirm this phenotype, we extracted the nucleus protein after different concentration of IL-10 treatment for 24 h and detected the

14

expression of p-STAT3 in nucleus of activated HSCs. The results showed that the expression of p-STAT3 was increased in nucleus of primary activated HSCs and HSC-T6 cells after IL-10 treatment (Fig. 4C). Next, we want to know whether STAT3 is a key regulator of activated HSCs senescence. To confirm the role of STAT3 in IL-10 inducing senescence of activated HSCs, activated HSCs were pretreatment with CPT, which is a STAT3 special inhibitor and abrogating phosphorylation of STAT3, or IL-10 alone. Western Blot analysis

ro of

showed that CPT not only dramatically inhibited the expression of p-STAT3 and total STAT but also markedly decreased the expression of p53 and p21 in primary activated HSCs (Fig.

4D). Similar results were showed in HSC-T6 cells (Fig. 4E), these results indicated that the

-p

p53 and p21 is the downstream target gene of STAT3 and CPT could inhibit expression of p53

re

and p21 induced by IL-10; Lastly, SA-β-gal stain showed that the numbers of SA-β-gal positive cells in CPT pretreatment group were significantly decreased compared to IL-10

lP

treatment alone (Fig. 4F), this data confirmed that abrogating phosphorylation of STAT3

na

could inhibit the activated HSCs senescence induced by IL-10. Together, these data indicate that IL-10 could increase the expression of STAT3 and promote the phosphorylation and

Discussion

Jo

4.

ur

translocation of STAT3 and then induce senescence of activated HSCs.

Activated HSCS are major contributor to development of hepatic fibrosis and effective prevention or reversal of HSCs activation, or promoting of HSCs apoptosis, senescence and immune clearance may prevent or inhibit or even reverse hepatic fibrosis [18]. Cellular senescence is complicated in several pathological responses in tumor suppression, aging and

15

wound healing [13]. Studies indicate that promoting senescence of activated HSCs is a new strategy for therapy of liver fibrosis. Senescence of activated HSCs enhances immune surveillance and facilitates the resolution of fibrosis [6]. IL-10 is a pleiotropic cytokine that regulates the synthesis of various pro- and anti-inflammatory cytokines and chemokine and also processes the antifibrotic effects in different fibrotic tissue [19, 20]. Our previous study has showed hydrodynamics-based

ro of

transfection of rat IL-10 gene attenuates porcine serum-induced liver fibrosis in rats and that

the numbers of activated HSCs were decreased after IL-10 treatment. Whether the decreasing numbers of activated HSCs were associated with senescence of activated HSCs? Kong’s

-p

study showed that IL-22, a member of IL-10 family, induced HSCs senescence and restricted

re

the CCL4-induced liver fibrosis in mice [17]. This study indicates that IL-10 cytokine family plays an important role in HSCs senescence. We previous study has showed that IL-10 has a

lP

directly effect on primary HSCs senescence by up-regulating expression of p53 and p21 [11].

na

Therefore, we speculated that the antifibrotic effects of IL-10 may be associated with the senescence of activated HSCs. Present study showed that IL-10 gene treatment reduced the

ur

degree of CCL4-induced liver fibrosis in rats accompanied with decreasing numbers of a-SMA (marker of activated HSCs) positive cells and reduction of collagen deposition, results

Jo

indicates that IL-10 could reduce the number of activated HSCs by its anti-inflammatory nature, similar to previous study [10]. Whether these decreasing numbers of activated HSCs were also associated with senescence of activated HSCs? The SA-β-gal stain is widely used to detect the signal of cellular senescence. Herein, results showed that the SA-β-gal+ cells in fibrotic liver were mostly located along the area of collagen deposition and IL-10 increased

16

SA-β-gal activity. Combine SA-β-gal and a-SMA stain results, we speculated that SA-β-gal positive cells may be activated HSCs. Double staining confirmed that the cells of SA-β-gal positive stain were activated HSCs and indicate that IL-10 could also up-regulate the SA-β-gal activity in activated HSCs. Together, these data proved our hypothesis that IL-10 attenuated liver fibrosis via inducing accumulation of senescent activated HSCs. Further studies should explore that how IL-10 promotes the clearance of senescent activated HSCs by

ro of

immune surveillance.

To further clarify the effects of IL-10 on activated HSCs senescence and it’s underlying signal

pathway, primary activated HSCs or HSC-T6 cells was used to analyze the cellular

-p

senescence of activated HSCs. Krizhanovsky’s study shows that senescent activated HSCs

re

stopped proliferation and accumulated the SA-β-gal activity [6]. In this study, we found that IL-10 induced senescence of activated HSCs by increasing SA-β-gal activity and inhibiting

lP

activated HSCs proliferation, results are similar to previous study [11]. Cell cycle arrest is

na

another typical character of senescence [21]. Present study showed that IL-10 treatment can block cell cycle arrest at G1 phrase in primary activated HSCs, which partly accounted for the

ur

growth inhibition in activated HSCs after IL-10 treatment. Many signal pathways involve in the regulation of cellular senescence, p53 plays a vital roles

Jo

in regulation of activated HSCs senescence. Studies show that cellular senescence wasn’t induced in mice HSCs lacking or down-regulating the key senescence regulator p53 [22, 23]. Increasing studies show that overexpression of p53 could enhance the SA-β-gal activity, increase levels of p21 and p16 and induce cell cycle arrest [24] . In this study, we found that senescence of activated HSCs induced by IL-10 was markedly related with expression of p53.

17

IL-10 could up-regulate the expression of p53 and its downstream protein p21 and promote senescence of activated HSCs. Interrupted the expression of p53 by pharmacologic inhibitor, the expression of p53 and p21 were markedly decrease accompanied by the decreased numbers of activated HSCs senescence. These results indicated that IL-10 promoted the senescence of activated HSCs in p53-dependant manner. STAT3 plays a crucial role in various physiological processes including cell growth,

ro of

differentiation, apoptosis and cellular senescence. Okinaga’s study demonstrated that STAT3

is an important in the induction of G1 cell cycle arrest in murine macrophages [25]. Kong’s study showed that IL-22 induced senescence of activated HSCs in STAT3-dependent

-p

mechanism via up-regulation expression of p53 and p21 [17]. Nakamura’s study showed that

re

ageing increased IL-10 expression and enhanced IL-10-mediated STAT3 signaling in macrophages [26]. Taken together, STAT3 is a key regulator of cellular senescence and

lP

activation of STAT3 pathway is involved various cells senescence. In this study, we

na

demonstrated that senescence of activated HSCs was marked associated with phosphorylation of STAT3. IL-10 treatment could up-regulate the expression of STAT3 and promote the

ur

phosphorylation and translocation of STAT3 and that inhibiting phosphorylation of STAT3 resulted in the down-regulation of the SA-β-gal activity and expression of senescent marker

Jo

protein p53 and p21 in primary HSCs or HSC-T6 cells, suggesting the crucial roles of STAT3 in IL-10-induced senescence of activated HSCs. However, the underlying mechanism in which how STAT3 regulate the expression of p53 is need to further explore in the future. In conclusion, present study indicated that IL-10 induced senescence of activated HSCs to attenuate CCL4-induced liver fibrosis (Fig. 5). In brief, IL-10 treatment attenuated the

18

CCL4-induced fibrosis via inducing accumulation of senescent activated HSCs in rats; IL-10 induced cell cycle arrest and senescence of activated HSCs via STAT3-p53 signal pathway in cell model. In summary, our findings could provide a novel mechanism for the antifibrotic effects of IL-10. 5.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (grant number

ro of

81600486); Natural Science Foundation of Fujian Province (grant number 2016J01462);

Middle-Aged and Young Talents Training Fund of Fujian Provincial Health Commission (grant number 2018-ZQN-38) and the Key Clinical Specialty Discipline Construction

re

-p

Program of Fujian ,China (Grant no. Min Wei Ke Jiao 2012 No. 49)

lP

References

[1] K.S. Nallagangula, S.K. Nagaraj, L. Venkataswamy, M. Chandrappa, Liver fibrosis: a compilation on the biomarkers status and their significance during disease progression, Future Science

na

OA 4 (2018) O250.

[2] T. Higashi, S.L. Friedman, Y. Hoshida, Hepatic stellate cells as key target in liver fibrosis, ADV

ur

DRUG DELIVER REV 121 (2017) 27-42.

[3] R. Wells, R. Schwabe, Origin and Function of Myofibroblasts in the Liver, SEMIN LIVER DIS

Jo

35 (2015) 97-106.

[4] J.S. Troeger, I. Mederacke, G.Y. Gwak, D.H. Dapito, X. Mu, C.C. Hsu, J.P. Pradere, R.A.

Friedman, R.F. Schwabe, Deactivation of Hepatic Stellate Cells During Liver Fibrosis Resolution in Mice, GASTROENTEROLOGY 143 (2012) 1073-1083. [5] M.E. Shaker, A. Ghani, G.E. Shiha, T.M. Ibrahim, W.Z. Mehal, Nilotinib induces apoptosis and autophagic cell death of activated hepatic stellate cells via inhibition of histone deacetylases, Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1833 (2013) 1992-2003. 19

[6] V. Krizhanovsky, M. Yon, R.A. Dickins, S. Hearn, J. Simon, C. Miething, H. Yee, L. Zender, S.W. Lowe, Senescence of activated stellate cells limits liver fibrosis, CELL 134 (2008) 657-667. [7] K.H. Kim, C.C. Chen, R.I. Monzon, L.F. Lau, Matricellular Protein CCN1 Promotes Regression of Liver Fibrosis through Induction of Cellular Senescence in Hepatic Myofibroblasts, MOL CELL BIOL 33 (2013) 2078-2090. [8] Y.C. Zhou, S. Chen, J.J. Cao, S.Y. Chen, Y.F. Xie, Q.X. Niu, Adenovirus-mediated viral interleukin-10 gene transfer prevents concanavalin A-induced liver injury, Dig Liver Dis 44 (2012) 398-405.

ro of

[9] Y.H. Huang, Y.X. Chen, L.J. Zhang, Z.X. Chen, X.Z. Wang, Hydrodynamics-based transfection of rat interleukin-10 gene attenuates porcine serum-induced liver fibrosis in rats by inhibiting the activation of hepatic stellate cells, INT J MOL MED 34 (2014) 677-686.

[10] Y.H. Huang, M.H. Chen, Q.L. Guo, Y.X. Chen, L.J. Zhang, Z.X. Chen, X.Z. Wang, Interleukin‑

and p21, MOL MED REP 17 (2018) 5700-5707.

-p

10 promotes primary rat hepatic stellate cell senescence by upregulating the expression levels of p53

re

[11] K. Ishak, A. Baptista, L. Bianchi, F. Callea, J. De Groote, F. Gudat, H. Denk, V. Desmet, G. Korb, R.N.M. MacSween, M.J. Phillips, B.G. Portmann, H. Poulsen, P.J. Scheuer, M. Schmid, H. Thaler,

lP

Histological grading and staging of chronic hepatitis, J HEPATOL 22 (1995) 696-699. [12] A. Banito, S.W. Lowe, A New Development in Senescence, CELL 155 (2013) 977-978.

na

[13] J. Chen, T. Xu, D. Zhu, J. Wang, C. Huang, L. Lyu, B. Hu, W. Sun, Y. Duan, Egg antigen p40 of Schistosoma japonicum promotes senescence in activated hepatic stellate cells by activation of the STAT3/p53/p21 pathway, Cell Death and Disease 7 (2016) e2315.

ur

[14] A. Sagiv, A. Bar-Shai, N. Levi, M. Hatzav, L. Zada, Y. Ovadya, L. Roitman, G. Manella, O. Regev, J. Majewska, E. Vadai, R. Eilam, S.W. Feigelson, M. Tsoory, M. Tauc, R. Alon, V.

Jo

Krizhanovsky, p53 in Bronchial Club Cells Facilitates Chronic Lung Inflammation by Promoting Senescence, CELL REP 22 (2018) 3468-3479. [15] D. Rizzuti, M. Ang, C. Sokollik, T. Wu, M. Abdullah, L. Greenfield, R. Fattouh, C. Reardon, M. Tang, J. Diao, C. Schindler, M. Cattral, N.L. Jones, Inhibits Dendritic Cell Maturation via Interleukin-10-Mediated Activation of the Signal Transducer and Activator of Transcription 3 Pathway, J INNATE IMMUN 7 (2015) 199-211. [16] X. Kong, D. Feng, H. Wang, F. Hong, A. Bertola, F.S. Wang, B. Gao, Interleukin-22 induces 20

hepatic stellate cell senescence and restricts liver fibrosis in mice, HEPATOLOGY 56 (2012) 1150-1159. [17] Y. Huang, X. Deng, J. Liang, Modulation of hepatic stellate cells and reversibility of hepatic fibrosis, EXP CELL RES 352 (2017) 420-426. [18] E.A. Shamskhou, M.J. Kratochvil, M.E. Orcholski, N. Nagy, G. Kaber, E. Steen, S. Balaji, K. Yuan, S. Keswani, B. Danielson, M. Gao, C. Medina, A. Nathan, A. Chakraborty, P.L. Bollyky, P.V. De Jesus, Hydrogel-based delivery of Il-10 improves treatment of bleomycin-induced lung fibrosis in

ro of

mice, BIOMATERIALS 203 (2019) 52-62. [19] E. Sziksz, D. Pap, R. Lippai, N.J. Béres, A. Fekete, A.J. Szabó, Á. Vannay, Fibrosis Related Inflammatory Mediators: Role of the IL-10 Cytokine Family, MEDIAT INFLAMM 2015 (2015) 1-15.

[20] Y. Ovadya, V. Krizhanovsky, Strategies targeting cellular senescence, J CLIN INVEST 128

-p

(2018) 1247-1254.

[21] H. Nishizawa, G. Iguchi, H. Fukuoka, M. Takahashi, K. Suda, H. Bando, R. Matsumoto, K.

re

Yoshida, Y. Odake, W. Ogawa, Y. Takahashi, IGF-I induces senescence of hepatic stellate cells and limits fibrosis in a p53-dependent manner, SCI REP-UK 6 (2016).

lP

[22] H. Jin, N. Lian, F. Zhang, L. Chen, Q. Chen, C. Lu, M. Bian, J. Shao, L. Wu, S. Zheng, Activation of PPARγ/P53 signaling is required for curcumin to induce hepatic stellate cell senescence, Cell Death and Disease 7 (2016) e2189.

na

[23] J. Yang, Y. Lu, P. Yang, Q. Chen, Y. Wang, Q. Ding, T. Xu, X. Li, C. Li, C. Huang, X. Meng, J. Li, L. Zhang, X. Wang, MicroRNA-145 induces the senescence of activated hepatic stellate cells

ur

through the activation of p53 pathway by ZEB2, J CELL PHYSIOL 234 (2019) 7587-7599. [24] T. Okinaga, W. Ariyoshi, S. Akifusa, T. Nishihara, Essential role of JAK/STAT pathway in the

Jo

induction of cell cycle arrest in macrophages infected with periodontopathic bacterium Aggregatibacter actinomycetemcomitans, MED MICROBIOL IMMUN 202 (2013) 167-174. [25] R. Nakamura, A. Sene, A. Santeford, A. Gdoura, S. Kubota, N. Zapata, R.S. Apte, IL10-driven STAT3 signalling in senescent macrophages promotes pathological eye angiogenesis, NAT COMMUN 6 (2015) 7847.

21

22

ro of

-p

re

lP

na

ur

Jo

Fig. 1IL-10 attenuates hepatic fibrosis via inducing senescence of activated HSCs in rats. (A) H&E and Masson stain were used to evaluate the degree and grade of liver fibrosis, magnification,100x ; (B) Semi-quantitative evaluation of grading of inflammatory and staging of fibrosis; (C) Sirius Red stain was used to detect deposition of collagen type I and III, magnification,100x; (D) Immunohistochemistry stain of α-smooth muscle actin (α-SMA) was used to detect the numbers of activated HSCs, magnification,100x; (E) Senescence associated β-galactosidase (SA-β-gal) stain was used to detect cellular senescence, counterstain with Sirius Red, magnification,200x; (F) SA-β-gal and α-SMA

ro of

double stain was used to identify activated HSCs sencescence in rats, magnification, 200x. Group C: control group, Group P: pcDNA3 empty vector control group, Group T:

pcDNA3-rIL-10 plasmid treatment group. Data were represented as mean ±S.D.

Jo

ur

na

lP

re

-p

Compared with control, * p<0.5; ***p<0.001.

Fig.2 IL-10 induced the senescence of primary activated HSCs in vitro. (A and B) Identification of activation of primary HSCs cultured for 3 or 7 days on plastic plates: 23

(A)Real-Time PCR analyses of the mRNA levels of α-smooth muscle actin (α-SMA) and collagenase type I (Col-1), (B) Western Blot analyses of protein expression of α-SMA and Col-1 in primary HSCs; (C) After 24h incubation in serum-free medium , primary activated HSCs were treated with DMEM, IL-10(20ng/ml) or Etoposide (ETO, 2μM ), which is a DNA damage reagent, as a positive control for senescence stain; SA-β-gal stain was used to detect the senescence of primary activated HSCs, counterstain with DAPI; (D and E) After 24h incubation in serum-free medium , primary activated HSCs were incubated with or without IL-10(20ng/ml) for additional 24 h, (D) CCK8 assay was

ro of

used to detect proliferation ability of primary activated HSCs; (E) Flow cytometry analyses was used to evaluate the cell cycle arrest in primary activated HSCs. Data were

represented as mean ± S.D. Compared with control group, * p<0.5; **p<0.01;***p<0.00

Jo

ur

na

lP

re

-p

1.

Fig.3 IL-10 induced the senescence of activated HSCs in p53-dependent manner. (A and B), After 24h incubation in serum-free medium , primary activated HSCs were 24

incubated with or without IL-10(20ng/ml) for additional 24 h, different methods were used to measure the effects of IL-10 on the expression of senescence marker: (A) Real-Time PCR analyses the mRNA expression of p53 and p21; (B) Western Blot analyses the protein expression of p53 and p21; (C and D), Western Blot analyzed the effects of pifithrin-α (PFT, a pharmacological inhibitor of p53) on expression of p53 and p21 in activated HSCs incubated with IL-10; (C) Primary activated HSCs, (D) Rat immortalization hepatic stellate cells line (HSC-T6 cells); (E) SA-β-gal stain analyzed the effects of PFT-α on the senescence of primary activated HSCs treated with or

ro of

without IL-10. Data were represented as mean ± S.D. Con: control group, IL-10 (20ng/ml): IL-10 treatment group, PFT (20μM): p53 inhibitor group, IL-10+PFT: IL-10 and

PFT

co-treatment

group.

Compared

with

control

group,

*

p<0.5;

**p<0.01;***p<0.001. Compared with group IL-10 treatment group, # p<0.5; ## p<0.01; ###

Jo

ur

na

lP

re

-p

p<0.001.

Fig.4 IL-10 induced the senescence of activated HSCs in STAT3-dependent manner. (A) 25

Western Blot analyzed expression levels of total and phosphorylated STAT3 in primary activated HSCs treated with or without IL-10; (B) Immunofluorescence stain analyzed the distribution of phosphorylated STAT3 in primary HSCs treated with or without IL-10; (C) Western Blot analyzed the expression levels of phosphorylated STAT3 in nucleus of primary HSCs and HSC-T6 cells treated with or without IL-10; (D, E) Western Blot analyzed the effect of CPT (a special inhibitor of STAT3 phosphorylation) on expression of senescence marker proteins p53 and p21 in activated HSCs, (D) primary activated HSCs, (E) HSC-T6 cells; (F) SA-β-gal stain analyzed the effects of

ro of

CPT on the senescence of primary activated HSCs treated with or without IL-10. Data were represented as mean ± S.D. Con: control group, IL-10 (20ng/ml): IL-10 treatment

group, CPT (10μM): STAT3 inhibitor group, IL-10+CPT: IL-10 and CPT co-treatment

group. Compared with control group, * p<0.5; **p<0.01;***p<0.001. Compared with

Jo

ur

na

lP

re

-p

group IL-10 treatment group, # p<0.5; ## p<0.01; ###p<0.001.

Fig. 5 Schema of the underlying mechanism of IL-10-induced senescence of activated 26

HSCs. IL-10 treatment induced the accumulation of senescent activated HSCs in CCL4-induced fibrotic liver and promoted cell cycle arrest and senescence of activated

na

lP

re

-p

ro of

HSCs via STAT3-p53 pathway.

Table 1 Primer sequences for real-time PCR Reverse primer (5’…3’)

GCTCTGGTGTGTGACAATGG

CTTTTCCATGTCGTCCCAGT

TGTTCAGCTTTGTGGACCTC

GCCATTGTGGCAGATACAGA

CTCCTCTCCCCAGCAAAAG

CCTGCTGTCTCCTGACTCCT

p21

TGTGGTAGTTGGAGCTGGT

TGACCTGCTGTGTCGAGAAT

Actin

GGCATCCTGACCCTGAAGTA

AGGCATACAGGGACAACACA

α-SMA Col-1

Jo

p53

ur

Forward primer (5’…3’)

genes

27