Interleukin-13 interferes with CFTR and AQP5 expression and localization during human airway epithelial cell differentiation

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 3 ( 2 00 7 ) 2 6 9 5 –27 0 2

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / y e x c r

Research Article

Interleukin-13 interferes with CFTR and AQP5 expression and localization during human airway epithelial cell differentiation Marie Skowron-zwarga , Sonja Bolanda , Nathalie Carusoa , Christelle Coraux b , Francelyne Maranoa , Frédéric Tournier a,⁎ a

Laboratoire de Cytophysiologie et Toxicologie Cellulaire, Université Paris 7, Tour 53-54, 3ème étage, case 7073, 2 place Jussieu, 75251 Paris cedex 05, France b INSERM U514, CHU Maison Blanche, Reims, France

ARTICLE INFORMATION

ABS T R AC T

Article Chronology:

Interleukin-13 (IL-13) is a central regulator of Th2-dominated respiratory disorders such as

Received 12 December 2006

asthma. Lesions of the airway epithelial barrier frequently observed in chronic respiratory

Revised version received

inflammatory diseases are repaired through proliferation, migration and differentiation of

8 February 2007

epithelial cells. Our work is focused on the effects of IL-13 in human cellular models of

Accepted 13 February 2007

airway epithelial cell regeneration. We have previously shown that IL-13 altered epithelial

Available online 21 March 2007

cell polarity during mucociliary differentiation of human nasal epithelial cells. In particular, the cytokine inhibited ezrin expression and interfered with its apical localization during

Keywords:

epithelial cell differentiation in vitro. Here we show that CFTR expression is enhanced in the

IL-13

presence of the cytokine, that two additional CFTR protein isoforms are expressed in IL-13-

Human nasal epithelial cells

treated cells and that part of the protein is retained within the endoplasmic reticulum. We

Mucociliary differentiation

further show that aquaporin 5 expression, a water channel localized within the apical

AQP5

membrane of epithelial cells, is completely abolished in the presence of the cytokine. These

CFTR

results show that IL-13 interferes with ion and water channel expression and localization

Primary cell culture

during epithelial regeneration and may thereby influence mucus composition and hydration. © 2007 Elsevier Inc. All rights reserved.

Introduction Numerous studies have shown that interleukin-13 (IL-13) is a central regulator of Th2-dominated disorders such as asthma. Studies in animal models provided compelling evidence that IL-13, independent of other Th2 cytokines, was both necessary and sufficient to induce all features of allergic asthma. In particular, IL-13 blockade prevented

allergen-induced airway inflammation [1]. In vivo, the cytokine is secreted predominantly by activated Th2 cells. IL-13 was shown to be able to act directly on epithelial cells rather than through traditional effector pathways involving eosinophils and IgE-mediated events. An alteration of the airway pseudostratified epithelium is observed in several pathophysiological conditions, in asthma and other respiratory diseases such as cystic fibrosis. It is therefore of crucial

⁎ Corresponding author. Fax: +33 1 44 27 69 99. E-mail address: [email protected] (F. Tournier). Abbreviations: ALI, air–liquid interface; AQP, aquaporin; CF, cystic fibrosis; CFTR, cystic fibrosis transmembrane regulator; EBP50, ezrinradixin-moesin-binding phosphoprotein 50; ER, endoplasmic reticulum; IL-13, interleukin-13; MCD, mucociliary differentiation; PDZ, PSD95/Dlg/ZO-1; RA, retinoic acid; TGFβ, Transforming growth Factor beta; ZO-1, zonula occludens-1 0014-4827/$ – see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2007.02.035

2696

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 2 6 9 5 –27 0 2

importance to study the mechanisms by which IL-13 might mediate its cellular features. The global effects of IL-13 on gene expression in airway epithelial cells were analyzed using gene arrays or differential cDNA analyses. The most prominent genes induced by IL-13 on human airway epithelial cells were genes whose products are involved in production and turnover of the extra-cellular matrix [2]. IL13 also increased the expression of signaling receptors and effectors such as eotaxin [3], IL-8 [4] and transforming growth factor-beta 2 (TGFβ2) [5]. Besides these IL-13 effects, we have focused on another feature of the cytokine that may be of major pathophysiological importance. The expression of several proteins involved in cell polarization was down-regulated in IL-13-treated human nasal epithelial (HNE) cells. Ezrin was inhibited at both mRNA and protein expression levels. Moreover, the cytokine interfered with its apical localization which occurs during ciliated cell differentiation [6], thereby potentially influencing the membrane localization of membrane-associated proteins, such as CFTR, via a PDZ-interacting domain [7]. The polarized localization of channels is crucial to maintain both the epithelium homeostasis and mucus hydration. CFTR is normally located in the apical membrane of epithelial cells where it acts as a cAMP-dependent chloride channel [8]. Mutations identified in the cystic fibrosis disorder are associated with retention of mutant protein within the endoplasmic reticulum [9]. Other channels, such as aquaporin water channels (AQPs), involved in fluid transport, play important roles in lung and airways [10]. Interestingly, other studies reported the effect of IL-13 on the ion transport phenotype of the bronchial epithelium. IL-13 was able to convert the human bronchial epithelium from its normal absorptive state to a secretory phenotype [11]. We hypothesized that a persistent inflammatory environment may perturb the regeneration of the upper airway epithelium. Airway epithelial cells in primary culture are able to differentiate into secretory and ciliated cells [12,13], thus providing in vitro assays to test the direct effect of IL-13 on epithelial cells. In this paper, we compared the expression and the localization of two channels, CFTR and AQP5, normally localized within apical membranes of fully differentiated epithelial cells in the presence and in the absence of IL-13 during the differentiation of human nasal epithelial cells in vitro.

then added to neutralize the enzyme. After washing, aggregates were discarded and dissociated cells were filtered on a 30-μm diameter filter. The cell suspension was then preplated for 2 h at 37 °C on plastic dishes (Falcon MerckEurolab, Strasbourg, France) to eliminate contaminating fibroblasts and epithelial cells were counted. After centrifugation, cells were plated for air–liquid interface culture (ALI). The method was adapted from Million et al. [13]. Briefly, cells were resuspended in a 1/1 BEGM/DMEM/F12 (Clonetics (Biowhittaker, Emerainville, France), Gibco) mixture supplemented with insulin (5 μg/ml), hydrocortisone (0.5 μg/ml), epinephrin (0.5 μg/ml), triiodothyronin (6.5 ng/ml), transferrin (10 ng/ml), human epidermal growth factor (0.5 ng/ml), bovine pituitary extract (0.13 mg/ml), gentamicin (50 μg/ml), amphotericin (50 ng/ml), all from Clonetics, bovine serum albumin (BSA) (Sigma, 1.5 μg/ml) and retinoic acid (RA, Sigma, 10− 7 M). Cells were plated in 300 μl medium at a density of 3.104 cells cm− 2 onto type IV collagen (Human placenta collagen, Sigma)-coated semi permeable membranes (Transwell; Costar, Dominique Deutscher, Brumath, France). 700 μl of medium was deposited on the basolateral side. Medium was changed every 2 days. Cells were grown submerged until confluence (day 0), when ALI was created to allow mucociliary differentiation. Cultures were maintained in humidified 95% air with 5% CO2 at 37 °C. IL-13 (10 ng/ml) was added during mucociliary differentiation (continuous treatment).

Cytokines and antibodies Human recombinant IL-13 was a kind gift from Dr A. Minty (Sanofi-Aventis, Labège, France). Anti-CFTR mAb was from R&D (ref 24-1, Lille, France), anti-MUC5AC mAb was from NeoMarkers (45M1, Fremont, USA), anti-ZO1 mAb was from Zymed Laboratories (1A12, San Francisco, USA) and goat antiAQP5 Ab (G-19) was from Santa Cruz Biotechnology (USA). Anti-ezrin pAb was a kind gift from Dr M. Arpin (Institut Curie, Paris, France). A polyclonal antibody raised against a set of proteins localized within the ER [14] was a kind gift from Dr E. Coudrier (Institut Curie, Paris, France). Anti-glutamylated tubulin mAb (GT335) was a kind gift from Pr. P. Denoulet (Université Paris 6, France). Anti-α-tubulin (DM1A) was purchased from Sigma. FITC-coupled pAb, RPE-coupled pAb, TRITC-coupled mAb and mouse IgGs were purchased from DakoCytomation (Glostrup, Denmark).

RT-PCR

Materials and methods Cell culture Human nasal turbinates were obtained from patients undergoing turbinectomy (Pr P. Herman, CHU Lariboisiere, Paris, and Pr J. Soudant, Hopital Pitie-Salpetriere, Paris). Epithelial cells were dissociated from the tissue by using 2 mg/ml of pronase (Protease XIV; Sigma, Saint Quentin Fallavier, France) in DMEM/F12 (GIBCO BRL, Grand Island, NY) supplemented with 50 U–50 mg/ml of penicillin–streptomycin at 4 °C for 16–20 h under slow rotary agitation. 10% FCS was

Total cellular RNA was isolated from cultures by using Tri Reagent according to manufacturer instructions. The amount of RNA in aqueous solution was determined by absorbance at 260 nm. Equal amounts (1 μg) of total cellular RNA were reverse-transcribed using OligodT Primer and RevertAid™ H Minus M-MuLV Reverse transcriptase (both from Fermentas, Hanover, USA). PCR reactions were performed on 2 μl of cDNA using the DyNAzyme EXT™ (Finnzymes, Espoo, Finland) in a PTC-100 thermocycler (MJ Research, Inc., Watertown, South Dakota). The amplification conditions were as follows: 25–35 cycles (GAPDH: 25 cycles, AQP3, AQP4, AQP5: 30 cycles, CFTR: 35 cycles) of denaturation (94 °C, 1 min), annealing (58 °C, 30 s),

2697

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 3 ( 2 00 7 ) 2 6 9 5 –27 0 2

Table 1 – Sequences of primers used for RT-PCR analyses

GAPDH Ezrin CFTR AQP3 AQP4 AQP5

5′ primer

3′ primer

ACCACAGTCCATGCCATCAC CCGAGATGAGAATAAGAGGAC GGAAAGCCTTTGGAGTGATAC CACTCTGGGCATCCTCATC TGGTCATGGTCTCCTGGTTG TACCATCCTGCAGATCGCG

TCCACCACCCTGTTGCTGTA AGAACAAGTATGGCACAGATG ACACAAGTGGTAAATCTTCAAG CTCCTTGTGCTTCACATGGG GTCTGCTTTCAGTGCGATCT ATGGCCACACGCTCACTCA

and extension (72 °C, 30 s), 10 μM primers. The sequences used for each primer are shown in Table 1. PCR products were analyzed by electrophoresis on 2% agarose gel stained with ethidium bromide.

was performed using anti-CFTR mAb (1:1000), anti-AQP5 mAb (1:500), GT335 (1:10000) or DM1A (1:1000). Secondary Abs coupled to peroxidase and a chemiluminescence revelation ECL kit were used (Amersham, France).

Immunofluorescence

Results Cell cultures were washed with PBS (GIBCO BRL) and fixed in methanol at − 20 °C for at least 20 min. Cultures were permeabilized by incubation for 1 min in PBS containing 0.05% Tween 20 and washed in PBS containing 0.01% Tween 20 and 3% BSA. Cells were incubated for 1 h with 100 μl of primary antibodies in PBS containing 0.01% Tween 20 and 3% BSA. Primary antibodies were used at the following dilutions: antiCFTR (1:100), anti-MUC5AC (1:100), anti-ZO1 (1:100), anti-AQP5 (1:100), anti-ezrin (1:600), and anti-ER proteins (1:100). Cultures were rinsed 3 times and incubated for 30 min in 100 μl of secondary antibody (1:100) in PBS containing 0.01% Tween 20 and 3% BSA. After extensive washing, cells were mounted in Citifluor (Citifluor Ltd., London, Great Britain) and analyzed on a LEICA SP2 AOBS confocal microscope.

IL-13 alters CFTR expression and localization during mucociliary differentiation We have previously observed that IL-13 impaired epithelial cell polarization in a spheroid culture model. In particular,

Immunohistochemistry Immunostaining for AQP5 was performed on paraffinembedded normal human bronchial tissues, using the LSAB 2 system, HRP kit (DAKO). The tissues were rehydrated in ethanol, treated in a microwave (350 W, 4 cycles of 5 min each) in buffer containing citric acid 0.1 M and sodium citrate 0.1 M, and washed with PBS. Endogenous peroxidase was blocked by quenching with H2O2. After preblocking with PBS containing 3% BSA for 15 min, tissues were sequentially treated as follows: they were exposed to goat anti-AQP5 antibody (1:10 in PBS) for 1 h at room temperature, washed in PBS, exposed to the biotinylated-goat antibody for 20 min, washed by PBS, exposed to the streptavidin–peroxidase reagent for 20 min, washed in PBS, and exposed to the substrate for 10 min. After washing in PBS, the tissues were counterstained with hematoxylin and mounted in Aquamount.

Protein analysis Total protein extracts were prepared from epithelial cells in Laemmli buffer (1×) containing 1 mM phenylmethylsulfonyl fluoride (PMSF). Protein samples were quantified using the Micro BCA assay kit (Pierce, Perbio Science, Bezons, France). Following addition of 5% beta-mercaptoethanol, the samples were boiled and then loaded onto a 10% polyacrylamide gel. After transfer onto a nitrocellulose filter, immunodetection

Fig. 1 – IL-13 affects CFTR expression and localization. (A) Semi-quantitative RT-PCR analysis of ezrin and CFTR gene expression (14 and 21 days after confluence) in the absence and in the presence of IL-13. Ezrin and CFTR gene expression is induced during MCD (compare 0 and 14 days). A continuous treatment with IL-13 does not modify CFTR expression, whereas it down-regulates ezrin expression in fully differentiated cells (+IL-13, day 21). (B) CFTR protein expression during MCD. CFTR protein expression is induced during MCD (arrowhead, compare day 0 and day 14). Treatment with 1 ng/ml of IL-13 does not affect CFTR expression, while two additional polypeptides are detected when cells are treated with 10 ng/ml of IL-13 (asterisks). IL-13 alters ciliated cell differentiation in a dose-dependent manner, as shown by GT335 staining see Ref. [6]. 10 μg of total protein extracts was deposited per lane. In these experimental conditions, the total tubulin content is constant.

2698

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 2 6 9 5 –27 0 2

and membrane-associated proteins, such as CFTR [7]. We confirmed that ezrin gene expression was induced during mucociliary differentiation (MCD) in another model of primary culture of HNE cells, an air–liquid interface (ALI) culture model, and that it was down-regulated by IL-13 after 3 weeks of differentiation in fully differentiated epithelial cells (Fig. 1A). CFTR mRNA was not detected at cell confluence (day 0) but was further expressed during differentiation in the presence or in the absence of the cytokine (Fig. 1A). This result was confirmed in Western blot. Two polypeptides were detected in HNE cells during differentiation, while no signal was observed at cell confluence (Fig. 1B). Interestingly, two additional polypeptides were detected in cells treated with 10 ng ml− 1 of IL-13 (Fig. 2B). In differentiated cells, ezrin was enriched at the apical membrane within the microvilli of polarized cells. CFTR was detected in most epithelial cells and it was both localized in ezrin-positive cells and ezrin-negative ones (Fig. 2A). By contrast, ezrin was localized at the apical membrane in only few cells after IL-13 treatment (Figs. 2A and B). In the presence of the cytokine, a large amount of CFTR protein remained in the cytoplasm. Notably, part of the protein pool was co-localized with protein markers of the endoplasmic reticulum (Fig. 2C).

IL-13 abolished AQP5 expression

Fig. 2 – IL-13 affects CFTR sub-localization. (A, B) Localization of ezrin and CFTR is affected by IL-13. Differentiated epithelial cells (26 days after confluence) were labeled with anti-ezrin Ab (red) in combination with anti-CFTR Ab (green). In control conditions, ezrin is mainly localized at the apical membrane of ciliated cells (Z section in B). CFTR is expressed at low level in most cells and it is localized within the apical domain of differentiated cells. In IL-13-treated cells, ezrin is observed at the cell lateral membrane and within the cytoplasm. CFTR is also localized at the cell lateral membrane and, in most epithelial cells, remains within the cytoplasm (Z section in B). (C) A double staining with a polyclonal antibody raised against a set of proteins localized within the ER [15] shows that CFTR is largely localized in ER (+IL-13). Scale bar= 6 μm.

the cytokine interfered with the expression and the localization of ezrin in ciliated epithelial cells [6]. Ezrin has been proposed to mediate association between actin cytoskeleton

CFTR has been reported to regulate other channels, such as aquaporin 3 (AQP3) [15]. AQP3, AQP4 and AQP5 are the main aquaporins expressed in airway epithelial cells, and they were shown to be differentially localized in polarized epithelial cells. We confirmed that, in sections of human bronchial epithelia, AQP5 was localized in epithelial cells and specifically enriched in the apical domain of ciliated cells (Fig. 3). In vitro, AQP3 and AQP4 gene expression was increased during differentiation and it was not affected by IL-13 treatment (Fig. 4A). AQP5 mRNA expression was also increased during differentiation but it was completely inhibited by IL-13 (Fig. 4A). The same effect was observed at the protein level. AQP5 protein expression was gradually increased during MCD while it was totally abolished in IL-13-treated cells (Fig. 4B). In differentiated cells, AQP5 was localized at the apical membrane, and no specific staining was observed in the presence of IL-13 (Fig. 4C). In the absence of the cytokine, all ezrin-

Fig. 3 – In situ localization of AQP5 in airway epithelial cells. AQP5 is localized at the apical membrane of ciliated cells in sections of human bronchial epithelium (AQP5, arrowhead). No staining is observed in negative control conditions. Scale bar = 20 μm.

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 3 ( 2 00 7 ) 2 6 9 5 –27 0 2

2699

Fig. 4 – IL-13 totally inhibits AQP5 expression. (A) Semi-quantitative RT-PCR analysis of AQP3, AQP4 and AQP5 gene expression (14 and 21 days after confluence) in the absence and in the presence of IL-13. AQP3, AQP4 and AQP5 expression is induced during MCD (compare day 0 and day 14). IL-13 does not affect AQP3 or AQP4 expression, but it abolishes AQP5 expression. (B) Western blot. AQP5 protein expression is induced during MCD, and it is totally inhibited in the presence of IL-13. Alpha-tubulin expression is constant in these experimental conditions (see Fig. 1). 10 μg of total protein extract per lane. These results (A, B) are representative of 3 independent experiments. (C) AQP5 localization. In control conditions (−IL-13, 25 days after confluence), anti-ZO1 Ab (red) decorates the subapical membrane domain of each individual cell (tight junctions), whereas anti-AQP5 Ab (green) detects the channel at the apical plasma membrane (see AQP5/ZO-1 and Z section). In the presence of the cytokine, ZO-1 detects an irregular pattern compared with control conditions and AQP5 staining is not distinguishable. Scale bar = 20 μm.

positive cells expressed AQP5, suggesting that this channel was localized within ciliated epithelial cells (Fig. 5A). In most ezrin-negative cells, AQP5 was located at the lateral mem-

brane within the apical domain of the cell (Fig. 5A). Moreover, most secretory cells (MUC5AC-positive cells) did not express AQP5 (Fig. 5B).

2700

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 2 6 9 5 –27 0 2

Discussion Respiratory diseases are characterized by lesions of the airway epithelium. IL-13 has emerged as a key regulator of Th2 inflammation, responsible for affecting remodeling of inflamed airways [1]. First, IL-13 is able to initiate a proliferative response of human airway epithelial cells [16]. Moreover, the cytokine alters both ciliated cell differentiation and ciliary beat frequency, while it increases the proportion of secretory cells [6]. To better understand the pathophysiological role of IL-13 in inflammation, we developed cellular models of epithelial cell regeneration, using primary cultures of human nasal epithelial (HNE) cells [6,13]. In this study, we show that IL-13 affects CFTR and AQP5 expression. As a consequence, the cytokine may strongly alter epithelial homeostasis. CFTR protein is both localized in the cytoplasm and at the apical membrane of respiratory epithelial cells [17]. Numerous studies have shown that targeting of CFTR to the apical membrane domain is directly linked to the process of cellular polarization. CFTR interacts with proteins containing PDZ domains such as ezrin, EBP50, actin, and ZO-1. PDZ domain interactions have been shown to play a key role in the apical polarization of channels in epithelial cells. Confinement of CFTR at the apical membrane, critical for its channel and regulatory functions, depends on interactions with this cytosolic protein network [7,18]. In particular, ezrin is critical for stabilizing CFTR at the apical membrane [7]. We show that, in fully differentiated epithelial cells, ezrin and part of CFTR are localized at the apical membrane. In the presence of IL-13, apical localization of ezrin is altered, whereas CFTR strikingly

remained within the endoplasmic reticulum (ER). Interestingly, a similar phenotype is observed in cystic fibrosis (CF) epithelium expressing the major ΔF508 mutation: epithelial cells express a defective protein unable to acquire mature conformation and consequently to exit from the ER to reach the cell surface [9]. In this work, we detected two unidentified additional isoforms in the presence of the cytokine, suggesting that IL-13 affects CFTR maturation. Airway surface remodeling and inflammation are thus associated with abnormal expression or distribution of CFTR [19]. On the other hand, CFTR can affect the activity of other apical membrane proteins. In particular, CFTR activates Cl− conductance, such as ORCC (Outward Rectifying Chloride Channel) [20], and inhibits Na+ channels [21], such as ENaC. By modifying ezrin and CFTR localization, IL-13 should thus be responsible for altering secreting capacity of the nasal epithelium. This result is in agreement with previous studies showing that IL-13 converted the human bronchial epithelium from an absorptive to a secretory phenotype by significantly reducing the basal shortcircuit current [Isc] and inhibiting the amiloride-sensitive current [11]. CFTR has also been demonstrated to be associated with enhanced osmotic water permeability, notably because it regulates AQP3 [15]. Several different types of aquaporin water channels are expressed in the airways, mainly AQP3, AQP4 and AQP5. In the superficial epithelium, AQP3 is present on basal cells, AQP4 in basolateral membranes and AQP5 at the apical membrane [10]. Here we show that AQP3, AQP4 and AQP5 expression is induced during MCD of HNE cells. IL-13 did not affect AQP3 or AQP4 expression, whereas it completely inhibited AQP5 expression both at mRNA and protein levels. TNF-α has also been reported to inhibit AQP5 expression [22].

Fig. 5 – AQP5 localization in airway epithelial cells. (A, B) Differentiated cells (25 days after confluence) were labeled with anti-AQP5 Ab (green) in combination with either anti-ezrin Ab (A, red) or anti-MUC5AC Ab (B, red). AQP5 is localized at the cell apical membrane. The staining is detectable in ezrin-positive cells, corresponding to ciliated cells, as well as in ezrin-negative ones (see AQP5/EZRIN). Note that most MUC5AC positive cells do not express AQP5 (see AQP5/MUC5AC). Scale bar = 20 μm.

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 3 ( 2 00 7 ) 2 6 9 5 –27 0 2

As IL-13 is able to stimulate TNF-α secretion in HNE cells [16], it is possible that IL-13 could mediate AQP5 inhibition by activating TNF-α. AQP5 is an essential target for modulating the fluid content of upper airway and nasopharyngeal secretions in disorders such as CF [23]. Mice lacking AQP5 show increased bronchoconstriction of the airways and reduced membrane water permeability in the epithelia of the submucosal glands [24]. In humans, mutations in AQP5 that result in incorrect subcellular localization of the channel in the apical plasma membrane have been detected in individuals with Sjogren's syndrome, a disorder that includes decreased salivary and lachrymal secretions [25]. Thus, in the absence of AQP5 apical localization in fully differentiated cells, as observed in the presence of IL-13, mucus hydration may be affected. Moreover, IL-13 alters the mucin expression pattern, notably by increasing muc5AC expression [26]. A recent study has further shown that the cytokine may induce transdifferentiation of ciliated to goblet cells, which may participate in goblet cell metaplasia [27]. Mucins, CFTR and AQP5 participate in the formation and composition of the airway surface liquid, which is essential for proper mucociliary clearance. Our results show that IL-13 may interfere with mucus composition and hydration and modify cellular permeability and polarization during epithelial repair. Thus, controlling the expression of direct or indirect IL-13 target genes may contribute to new insights towards a therapy for respiratory diseases.

[4]

[5]

[6]

[7]

[8]

[9]

[10]

Acknowledgments [11]

We warmly thank Adrian Minty (Sanofi-Aventis, Labege, France) for critical reading of the manuscript and François Besnard (Sanofi-Aventis, Rueil-Malmaison, France) for scientific discussions and financial support. We also thank Aude Jobart (Plate-forme d'Imagerie PDBCBD, Institut Jacques Monod, Paris) and Marie-Claude Gendron (Institut Jacques Monod, Paris) for their expert assistance in confocal microscopy and flow cytometry analyses, respectively, and Philippe Herman (Hopital Lariboisiere, Paris) and Jacques Soudant (Hopital Pitie-Salpetriere, Paris) for providing us with human nasal turbinates. This work has been supported by grants to FT from Vaincre La Mucoviscidose (VLM, France) and MSZ was a recipient of VLM.

[12]

[13]

[14]

[15]

REFERENCES [16] [1] G. Grünig, M. Warnock, A.E. Wakil, R. Venkayya, F. Brombacher, D.M. Rennick, D. Sheppard, M. Mohrs, D.D. Donaldson, R.M. Locksley, D.B. Corry, Requirement for IL-13 independently of IL-4 in experimental asthma, Science 282 (1998) 2261–2263. [2] J.H. Lee, N. Kaminski, G. Dolganov, G. Grünig, L. Koth, C. Solomon, D.J. Erle, D. Sheppard, Interleukin-13 induces dramatically different transcriptional programs in three human airway cell types, Am. J. Respir. Cell Mol. Biol. 25 (2001) 474–485. [3] S. Matsukura, C. Stellato, S.N. Georas, V. Casolaro, J.R. Plitt, K. Miura, S. Kurosawa, U. Schindler, R.P. Schleimer,

[17]

[18]

2701

Interleukin-13 upregulates eotaxin expression in airway epithelial cells by a STAT6-dependent mechanism, Am. J. Respir. Cell Mol. Biol. 24 (2001) 755–761. I. Striz, T. Mio, Y. Adachi, R.A. Robbins, D.J. Romberger, S.I. Rennard, IL-4 and IL-13 stimulate human bronchial epithelial cells to release IL-8, Inflammation 23 (1999) 545–555. F.Q. Wen, T. Kohyama, X. Liu, Y.K. Zhu, H. Wang, H.J. Kim, T. Kobayashi, S. Abe, J.R. Spurzem, S.I. Rennard, Interleukin-4-and interleukin-13-enhanced transforming growth factor-beta2 production in cultured human bronchial epithelial cells is attenuated by interferon-gamma, Am. J. Respir. Cell Mol. Biol. 26 (2002) 484–490. J. Laoukili, E. Perret, T. Willems, A. Minty, E. Parthoens, O. Houcine, A. Coste, M. Jorissen, F. Marano, D. Caput, F. Tournier, IL-13 alters mucociliary differentiation and ciliary beating of human respiratory epithelial cells, J. Clin. Invest. 108 (2001) 1817–1824. B.D. Moyer, J. Denton, K.H. Karlson, D. Reynolds, S. Wang, J.E. Mickle, M. Milewski, G.R. Cutting, W.B. Guggino, M. Li, B.A. Stanton, A PDZ-interacting domain in CFTR is an apical membrane polarization signal, J. Clin. Invest. 104 (1999) 1353–1361. E. Puchelle, D. Gaillard, D. Ploton, J. Hinnrasky, C. Fuchey, M.C. Boutterin, J. Jacquot, D. Dreyer, A. Pavirani, W. Dalemans, Differential localization of the cystic fibrosis transmembrane conductance regulator in normal and cystic fibrosis airway epithelium, Am. J. Respir. Cell Mol. Biol. 7 (1992) 485–491. S.H. Cheng, R.J. Gregory, J. Marshall, S. Paul, D.W. Souza, G.A. White, C.R. O'Riordan, A.E. Smith, Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis, Cell 63 (1990) 827–834. S.M. Kreda, M.C. Gynn, D.A. Fenstermacher, R.C. Boucher, S.E. Gabriel, Expression and localisation of epithelial aquaporins in the adult human lung, Am. J. Respir. Cell Mol. Biol. 24 (2001) 224–234. H. Danahay, H. Atherton, G. Jones, R.J. Bridges, C.T. Poll, Interleukin-13 induces a hypersecretory ion transport phenotype in human bronchial epithelial cells, Am. J. Physiol., Lung Cell. Mol. Physiol. 282 (2000) L226–L236. M.J. Whitcutt, K.B. Adler, R. Wu, A biphasic chamber system for maintaining polarity of differentiation of cultured respiratory tract epithelial cells, In Vitro Cell. Dev. Biol. 24 (1988) 420–428. K. Million, F. Tournier, O. Houcine, P. Ancian, U. Reichert F; Marano, Effects of retinoic acid receptor-selective agonists on human nasal epithelial cell differentiation, Am. J. Respir. Cell Mol. Biol. 25 (2001) 744–750. D. Louvard, H. Reggio, G. Warren, Antibodies to the Golgi complex and the rough endoplasmic reticulum, J. Cell Biol. 92 (1982) 92–107. R. Schreiber, R. Nitschke, R. Greger, K. Kunzelmann, The cystic fibrosis transmembrane conductance regulator activates aquaporin 3 in airway epithelial cells, J. Biol. Chem. 274 (1999) 11811–11816. B.W. Booth, K.B. Adler, J.C. Bonner, F. Tournier, L.D. Martin, Interleukin-13 induces proliferation of human airway epithelial cells in vitro via a mechanism mediated by transforming growth factor-alpha, Am. J. Respir. Cell Mol. Biol. 25 (2001) 739–743. G.M. Denning, L.S. Ostedgaard, M.J. Welsh, Abnormal localization of cystic fibrosis transmembrane conductance regulator in primary cultures of cystic fibrosis airway epithelia, J. Cell Biol. 118 (1992) 551–559. M.I. Milewski, J.E. Mickle, J.K. Forrest, D.M. Stafford, B.D. Moyer, J. Cheng, W.B. Guggino, B.A. Stanton, G. Cutting, A PDZ-binding motif is essential but not sufficient to localize the C terminus of CFTR to the apical membrane, J. Cell. Sci. 114 (2000) 719–726.

2702

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 2 6 9 5 –27 0 2

[19] D.B. Short, K.W. Trotter, D. Reczek, S.M. Kreda, A. Bretscher, R.C. Boucher, M.J. Stutts, S.L. Milgram, An apical PDZ protein anchors the cystic fibrosis transmembrane conductance regulator to the cytoskeleton, J. Biol. Chem. 273 (1998) 19797–19801. [20] S.E. Gabriel, L.L. Clarke, R.C. Boucher, M.J. Stutts, CFTR and outward rectifying chloride channels are distinct proteins with a regulatory relationship, Nature 363 (1993) 263–268. [21] M.J. Stutts, C.M. Canessa, J.C. Olsen, M. Hamrick, J.A. Cohn, B.C. Rossier, R.C. Boucher, CFTR as a cAMP-dependent regulator of sodium channels, Science 269 (1995) 847–850. [22] J.E. Towne, C.M. Krane, C.J. Bachurski, A.G. Menon, Tumor necrosis factor-alpha inhibits aquaporin 5 expression in mouse lung epithelial cells, J. Biol. Chem. 276 (2001) 18657–18664. [23] F. Yang, F.J.D. Kawedia, A.G. Menon, Cyclic AMP regulates aquaporin 5 expression at both transcriptional and

[24]

[25]

[26]

[27]

post-transcriptional levels through a protein kinase A pathway, J. Biol. Chem. 278 (2003) 32173–32180. T. Ma, N. Fukuda, Y. Song, M.A. Matthay, A.S. Verkman, Lung fluid transport in aquaporin-5 knockout mice, J. Clin. Invest. 105 (2000) 93–100. K. Tsubota, S. Hirai, L.S. King, P. Agre, N. Ishida, Defective cellular trafficking of lacrimal gland aquaporin-5 in Sjogren's syndrome, Lancet 357 (2001) 688–689. M. Zuhdi Alimam, F.M. Piazza, D.M. Selby, N. Letwin, L. Huang, M.C. Rose, Muc-5/5ac mucin messenger RNA and protein expression is a marker of goblet cell metaplasia in murine airways, Am. J. Respir. Cell Mol. Biol. 22 (2000) 253–260. J.W. Tyner, E.Y. Kim, K. Ide, M.R. Pelletier, W.T. Roswit, J.D. Morton, J.T. Battaile, A.C. Paatel, G.A. Patterson, M. Castro, M. S. Spoor, Y. You, S.L. Brody, M.J. Holtzman, Blocking airway mucous cell metaplasia by inhibiting EGFR antiapoptosis and IL-13 transdifferentiation signals, J. Clin. Invest. 116 (2006) 309–321.