Interleukin-33 Protects Ischemic Brain Injury by Regulating Specific Microglial Activities

Accepted Manuscript Research Article Interleukin-33 protects ischemic brain injury by regulating specific microglial activities Qianping Luo, Yong Fan, Lili Lin, Jingjing Wei, Zuanfang Li, Yongkun Li, Susumu Nakae, Wei Lin, Qi Chen PII: DOI: Reference:

S0306-4522(18)30406-8 https://doi.org/10.1016/j.neuroscience.2018.05.047 NSC 18484

To appear in:

Neuroscience

Received Date: Accepted Date:

10 February 2018 31 May 2018

Please cite this article as: Q. Luo, Y. Fan, L. Lin, J. Wei, Z. Li, Y. Li, S. Nakae, W. Lin, Q. Chen, Interleukin-33 protects ischemic brain injury by regulating specific microglial activities, Neuroscience (2018), doi: https://doi.org/ 10.1016/j.neuroscience.2018.05.047

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Interleukin-33 protects ischemic brain injury by regulating specific microglial activities Qianping Luo 1*, Yong Fan1*, Lili Lin1, Jingjing Wei 1, Zuanfang Li2, Yongkun Li3, Susumu Nakae4，Wei Lin2, 5¶, and Qi Chen1¶ 1

Fujian Key Laboratory of Innate Immune Biology, Biomedical Research Center of

South China, College of Life Science, Fujian Normal University Qishan Campus, College Town, Fuzhou, Fujian Province 350117, China 2

Academy of Integrative Medicine, Fujian University of Traditonnal Chinese

Medicine,1 Qiuyang Road, College Town, Fuzhou, Fujian 350122, P.R. China 3

Department of Neurology, Fujian Provincial Hospital, Provincial Clinical

Department of Fujian Medical University, Fuzhou, China 350001, P.R. China 4

Laboratory of Systems Biology, Center for Experimental Medicine and Systems

Biology, Institute of Medical Science, University of Tokyo, Tokyo, Japan 5

Fujian

Key

Laboratory

of

Integrative

Medicine

on

Geriatrics,

1 Qiuyang Road, College Town, Fuzhou, Fujian 350122, P.R. China

*

These authors contributed equally to this work

¶

Correspondence to:

Dr. Qi Chen, Fujian Key Laboratory of Innate Immune Biology, Biomedical Research Center of South China, College of Life Science, Fujian Normal University Qishan Campus, College Town, Fuzhou, Fujian Province 350117, China;Email: [email protected] Dr. Wei Lin, Academy of Integrative Medicine, Fujian University of Traditional Chinese Medicine, 1 Qiuyang Road, College Town, Fuzhou, Fujian 350122, China; Email: [email protected]

Abstract Interleukin-33 (IL-33), a novel member of the IL-1 family, expressed in many tissue and cell types, and is involved in inflammation and immune functions. Previous studies suggest that IL-33 may play a role in ischemic stroke. We tried to investigate the role of IL-33 in cerebral ischemia-reperfusion-induced injury and its underlying mechanism. Our data indicated that IL-33 deficiency exacerbated the neurological dysfunction caused by cerebral ischemia-reperfusion injury in mice and led to the formation of larger cerebral infarct volume as shown by 2,3,5-triphenyltetrazolium chloride (TTC) staining and magnetic resonance imaging. Furthermore, the M1- and M2 macrophage-like microglial immune responses with decreased expression of the corresponding cytokines were seen in IL-33-deficient mice. IL-33 deficiency led to more biased to M2-like activities. The aggravated cerebral ischemia-reperfusion injury in IL-33-deficient mice is partially restored by intracerebroventricular injection of IL-33, which suggested that IL-33 promotes the amplification of macrophage polarization and cytokine production associated with M2 macrophage-like microglial immune phenotype, which may contribute to the protective effects in the ischemic stroke IL-33 may become a potential therapeutic target for ischemic stroke.

Key words: IL-33; Stroke; M1 Macrophage; M2 Macrophage; Cytokines.

Introduction Stroke is a major public health problem worldwide. Ischemic stroke, which cause by cerebral ischemia is the major type of stroke in human population. Inflammatory response following cerebral ischemia usually lead to the deterioration of primary brain injury and is related to the activation of microglia and perivascular macrophages and the infiltration of peripheral inflammatory cells [Shichita et al., 2009; Mizuma and Yenari, 2017]. Microglia, as the resident macrophages central neuron system, act as the first line of innate immune defense [Prinz et al., 2014]. Similar to macrophages, microglial immune response is characterized by pro-inflammatory (M1) and alternative anti-inflammatory (M2) activation [Hu et al., 2015; Yang et al., 2017]. Upon activation to M1 phenotype, microglia elaborate pro-inflammatory cytokines and neurotoxic molecules promoting inflammation and cytotoxic responses [Prinz and Priller, 2014]. In contrast, the activation of M2 phenotype microglia leads to the secretion of anti-inflammatory gene products and trophic factors that promote repair, regeneration, and restore homeostasis [Guerrero., 2012; Kigerl., 2009]. Thus, to discriminate the M1- or M2-type activation may be useful for defining the pro- or anti-inflammatory function of microglia in ischemic stroke. IL-33, a novel member of the IL-1-related cytokines family, is widely expressed in many tissues including brain and spinal cord, and plays an important role on immune responses during tissue injury [Schmitz et al., 2005; Haraldsen et al., 2009; Lamkanfi and Dixit, 2009]. Upon tissue damage, IL-33 is released by immune cells

and forms a protein complex with accessory proteins by binding to the ST2/IL-1 receptor, which in turn activates various cell types involved in the regulation of both innate and adaptive immune functions [Tjota et al., 2013; Hardman et al., 2013; Yasuoka et al., 2011]. A recent study has shown that IL-33 gene single nucleotide polymorphisms are associated with ischemic stroke in north Chinese population [Guo et al., 2013], suggesting that IL-33 may play an important role by regulating pathophysiology and inflammatory responses during ischemic stroke. In order to understand the mechanism of IL-33 in the pathophysiology of ischemic stroke, we evaluated the IL-33 expression in middle cerebral artery occlusion (MCAO) mouse models and examined inflammatory cytokines in ischemic brain of IL-33 WT or KO mice. The role of IL-33 on ischemic brain injury and its functional impact along with possible immunological mechanism by explored.

Methods Animals Male C57BL/6 mice, purchased from Silaike Experimental Animal LLC (Shanghai, China), C57BL/6 IL-33-deficient mice, obtained from CDB Laboratory for Animal Resources and Genetic Engineering (accession number CDB0631K ， http://www.cbd.riken.jp/arg/mutant%20mice%20list.html),

were

housed

under

pathogen-free conditions in individual cages under controlled temperature, humidity and light conditions. All animal procedures were in adherence to the Guide for the Care and Use of Laboratory Animals approved by Fujian Provincial Office for Managing Laboratory Animals and were guided by the Fujian Normal University Animal Care and Use Committee. IL-33-deficient mice were fertile and did not show any apparent phenotypic abnormalities. Verification of IL-33-deficient mice was done by polymerase chain reaction (PCR) genotyping using mouse tail genomic DNAs. Following were the PCR genotyping primers: ex2-F (5’-CACTAAGACTACTCAGCCTCAG-3’), WT-R (5’-CGGTGATGCTGTGAAGTCTG-3’),

and

KO-R

(5’-GTGTTCTGCTGGTAGTGGTCG). The ex2-F and WT-R primers were used for detection of the wild-type alleles, and the ex2-F and KO-R primers were used for detection of the mutant alleles [Oboki et al., 2010]. Each experimental group contained at least 6 mice, weighted 20-25g each. All experiments were repeated at least three times.

Cerebral ischemia-reperfusion (I/R) surgery Anesthesia was performed using sodium pentobarbital (60mg/kg). A laser Doppler flowmetry (moorVMS–LDF2) was used to measure local cortical blood flow supplied by the middle cerebral artery (MCA) during operation. Mouse body temperature was controlled by a homeothermic blanket. The right MCA was occluded with a 7-0 nylon monofilament to achieve 80% reduction of the blood flow. Sixty minutes after MCA occlusion, the filament was withdrawn to allow reperfusion to the right MCA. Mice of sham group went through the same surgery procedure except the occlusion of MCA. The mice were returned to their home cages after surgery and recovery from anesthesia [Fan et al., 2017]. The dead mice due to the surgical procedure and that were unable to live until neurological function assessment after surgery were not collected and excluded in the experiments.

Neurological function assessment Neurological injury of middle cerebral artery occlusion/reperfusion mice were assessed by Zea Longa five-point scale [Longa et al., 1989]: score 0, no neurological deficit; score 1, do not extend the contralateral fore paw; score 2, circle to the lateral ; score 3, fall to the contralateral; score 4, no walk spontaneously and had a depressed level of consciousness.

2,3,5-Triphenyltetrazolium chloride (TTC) staining and Magnetic resonance imaging (MRI)

TTC staining and measurements: The mice were anesthetized as described above. The brains were sectioned coronal and cut consecutively at 1mm thick, and stained with 1% 2,3,5-triphenyltetrazolium chloride (TTC, Biosharp, USA) at 37℃ for 20 min followed by immersion in 4% formaldehyde for 24 hours. Magnetic resonance imaging (MRI) was applied to determine the infarct volume in vivo at 24h or 72h after ischemia using a 7T MRI Bruker scanner. The infarct areas were analyzed by NIH Image J software. The infarct size was calculated using the following formula [Lin et al., 1993]: Infarct volume (%) = [(volume of the normal hemisphere

－

non-infarct

volume of the infarct

hemisphere)/volume of the normal hemisphere] ×100%

RNA isolation, reverse transcription and real-time quantitative polymerase chain reaction (qRT-PCR) Total RNA was extracted from brain tissues using TRIzol Reagent (Thermo Fisher Scientific, CA, USA). The reverse transcription reaction was performed by using 1 µg of total RNA with PrimeScript® RT reagent Kit plus gDNA Eraser (TAKARA, Dalian, China). The mRNA expression levels were quantified by the real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) by using SYBR® Premix Ex Taq II (Tli RNaseH Plus) (TAKARA, Dalian, China) at the following conditions: 95°C 30 s, followed by 40 cycles of 95°C 5 s, 55°C 30 s and 72°C 30 s, on ABI Step One Plus Fast real-time PCR system (Applied Biosystems, CA, USA). The primers used for PCR were listed in Table 1. The

changes in expression were calculated by using the 2-△△CT method [Livak and Schmittgen, 2001] .

Western blotting The brain infarct area of each mouse was collected at 24 or 72h time point after ischemia-reperfusion (I/R) and homogenized with the protein extraction buffer containing 150 mM NaCl, 10 mM Tris (pH 7.2), 5 mM ethylenediaminetetraacetic acid (EDTA), 0.1% Triton X-100, 5% glycerol, and 2% SDS 1mM PMSF, and proteinase inhibitors (Roche, Switzerland). The samples were centrifuged at 12,000 rpm for 15 min at 4oC, then the supernatants were collected. Protein concentrations were determined by using a BCA kit (Beyotime, ). Equal amounts (50 μg) of protein were electrophoresed onto a 10% or 15% SDS/polyacrylamidegels (SDS/PAGE) and transferred to polyvinylidene fluorid membranes, then blocked for 2 h at room temperature in TBS buffer containing 150 mM NaCl, 10 mM Tris, plus 0.1% Tween-20 and 5%(W/V) BSA. The membranes were incubated over night at 4 oC with TBS buffer containing the primary antibody. The antibodies and the dilution factor for each antibody were following: mouse anti-IL-33 (1:1000, Abcam, ab54385, monoclonal antibody), rabbit anti-CD163 (1:500, Bioss, bs-2527R, polyclonal antibody), rabbit anti-Arg-1 (1:1000, Protein Tech, 16001-1-AP, polyclonal antibody), mouse anti-CD206 (1:1000, Santa Cruz, sc-58986, monoclonal antibody), rabbit anti-MCP1(1:2000, Abcam, ab25124, polyclonal antibody). The membrane was washed 3 times with 0.1% Tween-20 in TBS buffer, then incubated with TBS buffer

containing the IRDye 800CW secondary antibody (1:1000,Odyssey) and visualized by Odyssey CLx Western Blot Detection System (Westburg, Netherlands). β-actin (1:500, Santa Cruz, CA, USA) was used as a loading control.

Immunofluorescent staining Mice were sacrificed at either 24 or 72h after I/R as described above. The brains were removed, post-fixed in 4% paraformaldehyde for 20-22 h and cryoprotected in 30% sucrose for 48 h. The brains were embedded in optimum cutting temperature compound (OCT) and cut to 10 μm-thick sections using a freezing microtome. The sections were blocked by incubating with 10% BSA at room temperature for 2 hours, followed by incubation with FITC rat anti-mouse CD16/CD32 (1:100, BD, 553144) and Alexa Fluor® 647 rat anti-mouse CD206 (1:100, BD, 565250 monoclonal antibody) at 4°C overnight. The next day, the slides were washed with PBS for 3 times, each for 10 min, then nuclei stained with DAPI. A 425x425 μm penumbre area from the corresponding cortical area was predefined and the images were taken by using 20x magnification on an inverted LSM 780/Axio Imager confocal microscope (ZEISS, Germany). The distribution and number of CD16/32 and CD206 immunoreactivities in the above predefined peri-ischemic areas were quantified based on the averaged fluorescence intensity (arbitrary units) blinded to the study groups by using NIH Image J software, over 3 independent experiments, as described previously [Chen et al, 2015; Korhonen et al, 2015].

Intracerebroventricular treatments of IL-33 protein Recombinant mouse IL-33 protein (Novoprotein, CG73) was dissolved in 1x PBS (pH 7.4). The IL-33 KO mice were anesthetized with 5% chloral hydrate and then set in a standard stereotaxic apparatus (RWD, 68016). A stainless-steel micro-injector was stereotaxically implanted into right lateral ventride of each mouse at the following stereotaxic coordinates [Paxinos and Franklin, 2001]: 0.22mm posterior to bregma, 1mm right from midsagittal line and 2.2mm below bregma. Control solution(PBS, 10

) or recombinant mouse IL-33 protein solution (0.2 mg/ml, 10

was injected into indicated area in 10 min period of time at 30 min before I/R or sham operation.

Statistical analysis. All data were presented as mean ± SEM. One way analysis of variance (AVOVA) with Dunnett post-hoc T-test were used to assess differences between groups. Statistical significance was assumed if p value was less than 0.05. All statistical analyses were performed using the GraphPad Prism software 6 (GraphPad Software, La Jolla, CA, USA).

Results Cerebral ischemia elevated IL-33 expression in ischemic brain To identify the roles of IL-33 in ischemic stroke, we examined the expression of IL-33 mRNA and protein in ischemic brain tissues after I/R. Compared to the sham-operated groups, both IL-33 mRNA and protein levels were increased significantly at 24h and 72h after I/R injury, respectively (Fig. 1A–C) (***p<0.001, **p<0.01, *p<0.05, n=6). Compared to 24 hours, the expression of IL-33 at 72 hours was in a downward trend. These data suggest that IL-33 may play a role in regulating the progress in brain damage during cerebral I/R injury.

Cerebral infarct increased in IL-33 KO mice Next, we examined changes of the cerebral infarct sizes in WT and IL-33 KO mice after I/R injury induced by MCAO. Histological analyses of infarct sizes after the cerebral I/R injury were performed by TTC staining. The infarct areas were analyzed by NIH Image J software and the data are shown in Fig. 2A. The ratio of the infarct area relative to the whole brain was calculated and shown in Fig. 2B. Relative to the I/R group of WT mice (27.38 ± 1.78% and 37.31 ± 3.17%) (*p<0.05, n=6), the infarct area of whole brain was increased in the IL-33 KO mice at 24h and 72h following I/R injury (34.78 ± 2.22% and 49.43 ± 4.45%) (*p<0.05, n=6), respectively. The infarct sizes after the cerebral I/R injury in the WT and IL-33 KO mice were further examined by MRI scanning using a Bruker MRI scanner. The infarct areas were analyzed by NIH Image J software and the data are shown in Fig. 2C. The ratio

of the infarct area relative to the whole brain was calculated and shown in Fig. 2D. In line with TTC staining results, the infarct area of whole brain was increased in the IL-33 KO mice at 24h and 72h following I/R injury (36.78 ± 3.10% and 46.83 ± 4.01%) (**p<0.01, *p<0.05, n=6) in comparison with the I/R WT group (22.91 ± 1.39% and 31.57 ± 1.91%) (**p<0.01, *p<0.05, n=6). Both TTC staining and MRI scanning data suggest that the infract size of brain in IL-33 KO mice increases relative to that of WT mice following the I/R injury.

Cerebral ischemia of both WT and IL-33 KO mice had similar neurological function The neurological scores of WT and IL-33 KO mice have no significantly difference right after I/R. The neurological scores after 24 hours showed similar neurological function that in WT mice which had 20% in grade 2, 70% in grade 3 and 10% in grade 4 (n=10 for each group), while in IL-33 KO mice which had 10% in grade 2, 70% in grade 3 and 20% in grade 4 (n=10 for each group). The neurological scores were also no significantly differet at 72 hours, with WT mice had 10% in grade 2, 60% in grade 3 and 30% in grade 4 (n=10), while IL-33 KO mice had 10% in grade 2, 70% in grade 3, and 20% in grade 4 (n=10)..

IL-33 deficiency impaired I/R induced pro-inflammatory cytokines expression To investigate the effects of IL-33 on the inflammatory responses induced by I/R injury, the changes of the mRNA expression of IL-6, TNF-α and IL-1β following

cerebral I/R injury were tested by qRT-PCR. The results show that the expression of IL-6, TNF-α and IL-1β mRNAs was increased by the I/R injury (Fig. 3A-C) (**p<0.01, *p<0.05, n=6). However, this increase was significantly attenuated by IL-33 deficiency. These data suggest that IL-33 affects the production of inflammatory cytokines, such as IL-6, TNF-α and IL-1β in the early phase of cerebral I/R injury.

IL-33 deficiency impaired I/R induced M1 and M2 macrophages in the lesion area We next examined microglia-mediated M1- and M2-type activation induced by I/R injury in both WT and IL-33 KO mice. The specific markers such as CD16 and CD32 are highly expressed in M1 macrophages/microglia and used for indication of pro-inflammatory activation, while the specific markers such as CD163, CD206 are highly expressed in M2 macrophages/microglia and used for indication of anti-inflammatory activation [Mackinnon et al., 2008]. We performed qRT-PCR and compared the mRNA expression of above M1 and M2 specific markers in the lesion areas of the sham-operated WT and IL-33 KO mice at 24h and 72h following I/R injury, respectively. We found that, in the I/R injury brains of WT mice, both of M1 (CD16 and CD32) and M2 (CD206 and CD163) specific markers were increased at 24h and 72h (Fig. 4A-D) (****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, n=6), respectively. But in the I/R injury brains of IL-33 KO mice, the expression of M2 macrophage specific markers (CD206, CD163) were significantly decreased almost to

the level seen in the sham-operated group at 24h and 72h (Fig. 4C-D) (****p<0.0001, ***p<0.001, n=6), respectively. In contrast, IL-33 affects little in the expression of M1 specific markers, CD16 and CD32 (Fig. 4A-B) (**p<0.01, *p<0.05, n=6). In addition, we also found that their expression at 72h were higher than that at 24h. These data suggest that IL-33 may affect the brain injury by regulating the microglial functions, particularly the M2 activation pathway and the effective phase of IL-33 on microglia may act at a delayed mode. To further verify the effects of IL-33 on the expression of M2 specific markers, we examined the expression of CD206 and CD163 proteins by Western blotting. We found that the expression of CD206 and CD163 proteins was significantly attenuated in the groups of IL-33 KO mice relative to the WT group following I/R injury. The expression of CD206 and CD163 proteins in the brain of IL-33 KO mice were almost attenuated to the level in the sham-operated group (Fig. 4E-H) (*p<0.05, n=6), in consistent with the above qRT-PCR data. These data indicate that in the absence of IL-33 causes a decrease in the M2 specific protein expression.

IL-33 deficiency impaired M1/M2-type macrophages/microglia in the penumbra area We further assessed the presence of M1/M2-type macrophages/microglia by CD16/32 and CD206 co-immunostaining in the ischemic penumbra area of cortex (Fig. 5A). Compared to the sham group, the expression of CD16/32 and CD206 was significantly up-regulated in the WT group following I/R injury (Fig. 5B-D)

(**p<0.01, *p<0.05, n=5) at 24h and 72h, respectively, while in IL-33 KO group, it induced much less CD16/32 and CD206 response in the ischemic penumbra area (Fig. 5B-D) (**p<0.01, *p<0.05, n=5). Furthermore, the number of CD206-positive cells was much more than that of CD16/32 in both the WT and IL-33 KO groups following I/R injury (Fig. 5B-D). In addition, in some cells, CD16/32 were co-expressed with CD206 (Fig. 5E) (n=5). These results suggest that in the penumbra area, the M2-type cells play a dominant role during I/R-induced injury in the presence of IL-33 and that less M1/M2-type cells presented in ischemic penumbra region in the I/R group without IL-33.

IL-33 altered the levels of MCP1, IL-12b, NOS2, Arg-1, IL-10 and TGF-β in the brain after I/R injury To further ask if changes on the specific cytokine expression were correlated with the expression of macrophage/microglia specific markers in IL-33 KO mice, we analyzed the mRNA expression of MCP1, IL-12b, NOS2, Arg-1, IL-10 and TGF-β in the brain after I/R injury by qRT-PCR. The signs for M1 activation involved in initiating and maintaining the inflammatory response include the induction of pro-inflammatory factors, such as MCP1 and IL-12, NOS2, etc. The signs for M2 activation involved in the inflammation palliation and tissue remodeling include the production of Arg-1, IL-10, TGF-β, etc. [Biswas et al., 2012]. In the IL-33 KO mice, the expression of MCP1, IL-12b, NOS2, IL-10 and TGF-β mRNA was all decreased at 24h and 72h (Fig. 6A-F) ( ***p<0.001, **p<0.01, *p<0.05, n=6) following I/R

injury. Among these cytokines, the levels of MCP1, NOS2, Arg-1 and TGF-β expression were higher at 72h than that at 24h, while the levels of IL-12b and IL-10 were crosscurrent, which reduced at 72h relative to 24h. Consistent with the qRT-PCR results, the expression of MCP1 and Arg-1 proteins in the brain was also down regulated in the IL-33 KO mice (Fig. 6G-J) (**p<0.01, *p<0.05, n=6). These data suggest that the absence of IL-33 causes the dysfunction of normal immune response and IL-33 may play an important role on the immunoreaction in the ischemia stroke. Particularly IL-33 may regulate the expression of IL-12b and IL-10, while the effect of IL-33 on MCP1, NOS2, Arg-1 and TGF-β may act at a delayed mode.

Exogenous IL-33 delivery decreased I/R infarct Next, we asked if treatments by delivering the exogenous IL-33 protein could compensate for the brain injury exacerbated by the IL-33 deficiency following I/R injury. After intracerebroventricular injection of recombinant IL-33 protein, we analyzed the infarct volume by TTC staining and MRI at 24h and 72h, respectively. TTC staining data showed that the infarct volume of IL-33-treated group was significantly decreased relative to that in the PBS-treated group at 24h (28.98 ± 3.12% and 13.53 ± 1.89%, respectively) and 72h (40.18 ± 4.37% and 16.31 ± 1.59%, respectively) (Fig. 7A-B) (**p<0.01, n=6). In consistent with the TTC staining results, the MRI data showed that the infarct area of whole brain was significantly decreased in the IL-33-treated mice at 24h and 72h following I/R injury (13.61 ± 1.12% and

15.27 ± 1.88%) in comparison to that in the I/R group of PBS-treated mice (28.73 ± 3.77% and 36.78 ± 3.10%) (Fig. 7C-D) (***p<0.001, **p<0.01, n=6). And there is no significant difference between 24h and 72h after injection of IL-33 in both TTC and MRI. These data suggest that the effective phase of IL-33 for tissue repairing may start in 24h after I/R injury.

Exogenous IL-33 delivery ameliorated I/R neurological severity After intracerebroventricular injection of recombinant IL-33 protein, we also found that the neurological severity scores were significantly improved. After 24 hours, IL-33-treated mice had 10% in grade 1, 70% in grade 2 and 20% in grade 3 (n=10 for each group), while PBS-treated mice had none in grade 1, 10% in grade 2, 70% in grade 3 and 20% in grade 4 (n=10 for each group). The effects of exogenous IL-33 treatments on the neurological functions in IL-33-treated mice were similar at 72 hours, with 70% in grade 2, 30% in grade 3 (n=10), while PBS-treated mice had 10% in grade 2, 60% in grade 3, and 30% in grade 4 (n=10) (Fig. 7E). These datas suggest that IL-33 injection reduced I/R-induced brain damage and improved functional outcomes, which provided evidence that IL-33 could be a promising therapeutic target for treating ischemia stroke.

Exogenous IL-33 delivery restored brain M1 and M2 brain macrophages of IL-33 KO mice The qRT-PCR data showed that the mRNA expression levels of both of specific

M1 (CD16 and CD32) and M2 (CD206 and CD163 ) markers were significantly increased in the IL-33-treated I/R injury brains relative to the untreated group at 24h and 72h (Fig. 8A-D) (****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, n=6), respectively. But no apparent difference was observed on the expression levels of CD16 and CD32 between these two groups at 24h (Fig. 8A-B) (**p<0.01, *p<0.05, n=6). These data suggest that IL-33 indeed can affect the progress of cerebral ischemia injury by affecting microglial M1/M2 activities. And the effective phase may occur between 24h and 72h, the significant effect of IL-33 on the expression of downstream cytokines may function in 72h.

Exogenous IL-33 delivery restored M1/M2-type macrophages/microglia in the lesion area We also performed the CD16/32 and CD206 immunostaining in ischemic penumbra area of the cortex after exogenous IL-33 treatments (Fig. 5A). Compared to the PBS-treated group, the CD16/32 and CD206-positive cells were significantly increased in the IL-33-treated group following I/R injury (Fig. 9A-C) (**p<0.01, *p<0.05, n=5) at 24h and 72h. And consistent with the previous results, the presence of CD16/32-positive cells was much less than the presence of CD206-positive cells. We also found the co-expression of both the CD16/32 and CD206 in some cells (Fig. 9D) (n=5). These data indicate again that IL-33 indeed can affect the progress of cerebral ischemia injury by affecting microglial M1/M2 activities.

Discussion In the present study, we constructed I/R models in WT mice and IL-33-deficient mice and studied the effects of the IL-33 deficiency on I/R induced brain injury. We investigated the involvement of M1 and M2 type microglial activities and the expression of related cytokines to explore the underlying mechanism regulated by IL-33. The inflammatory response is a prominent and pivotal feature of ischemic stroke and is related to the activation of microglia and the infiltration of peripheral macrophages [Skaper et al., 2014]. The functions of microglia and macrophage cells are largely overlapped or indistinguishable although recent microglial genetic sensome studies have revealed a set of unique genes only expressed in microglia [Hickman et al., 2013; Ginhoux et al., 2013]. Microglial activation occurs rapidly within minutes in the acute phase of ischemic stroke, but can last for several weeks [Taylor and Sansing, 2013; Denes et al., 2007]. In the other hand, macrophage infiltration is thought to take place after the activation of microglia, usually 3-7 days after stroke [Schilling et al., 2009]. Our studies collected the brain samples from various groups of mice including IL-33 KO sham and I/R-treated mice at 24h and 72h after I/R injury. Therefore, the immune responses in these brain tissues are likely to represent the early events after I/R-induced injury which is mainly relied on microglia-mediated activities. IL-33 has shown neuroprotective effects and is able to prevent further damages caused by stroke [Schilling et al., 2009; Nakae et al., 2013; Kurowska et al., 2011]. Interestingly, it has been suggested previously that IL-33 induced neuroprotection is

indirect and is mediated by decreased astrocytic activation or modulation in microglial/macrophage phenotype [Korhonen et al., 2015]. IL-33 has also been shown to be released into the extracellular space during cell damage or tissue injury and acts as an endogenous danger signal to alert adjacent cells and tissues [Liew et al., 2010]. We observed an increase in IL-33 expression in response to I/R injury as shown by TTC staining and MRI imaging. The IL-33 deficiency leads to the increase in the infarct volume, thus exacerbates I/R-induced brain damage. These data are consistent with IL-33-mediated neuroprotective effects against I/R-induced brain injury. Inflammation is thought to participate in progressive cerebral ischemic injury at the early stage [Hallenbeck, 1996]. The balance between inflammatory and anti-inflammatory factors significantly affects the prognosis of patients with cerebral infarction. IL-33 has been shown to enhance the LPS-induced secretion of TNF-α, IL-6, and IL-1β by mouse macrophages [Mantovani et al., 2004]. Excessive release of TNF-α can change the permeability of blood-brain barrier and stimulate the release of free radicals leading to neuronal damage [He et al., 2004]. IL-6 is a cytokine produced in cerebral ischemia in response to damaged brain cells and acts as an important mediator of inflammation in secondary brain injury [Offner et al., 2006]. IL-1β is an early produced proinflammatory cytokine to further stimulate the production of inflammatory mediators [Kushima et al., 1992; Hayakata et al., 2004]. IL-33 binds to its receptor ST2 and induces a series of reaction to regulate the immune response and affects inflammation processes [Schmitz et al., 2005; Cayrol and Girard, 2014]. Our data show that I/R-induced mRNA expression of the inflammatory factors (TNF-α,

IL-6, and IL-1β) are significantly decreased in IL-33 KO mice relative to WT mice, in consistent with the change of IL-33 levels and suggest that IL-33 can significantly affect the inflammatory cytokines on regulating the inflammation process in cerebral ischemia. We further determined the possible involvement of IL-33 in the regulation of microglial M1 and M2 activities in response to I/R-induced brain damages which are generally considered to diverge the pro- or anti-inflammation response [Varnum and Ikezu, 2012]. M1 macrophages/microglia participate in the immune surveillance through secretion of inflammatory cytokines and chemokines while

M2

macrophages/microglia exert the anti-inflammation response and promote tissue repair process through the secretion of inhibitory cytokine IL-10 and/or TGF-β [Van et al., 2006; Ohno et al., 2012]. IL-33 can regulate several pathways including Th2 skewing and mast cell, eosinophil, and macrophage activation [Smith.,2011]. IL-33 has shown to promote macrophage polarization from M1-type to M2-type skewing, and induce production of anti-inflammatory cytokines [Schmitz et al., 2005; Jiang et al., 2012; Pomeshchik et al., 2014]. Macrophage-derived IL-33 seems to induce M2 macrophage polarization in a paracrine and autocrine manner and IL-33/ST2 activation can mediate macrophage M2 polarization under pathological conditions [Fock et al., 2013; Li et al., 2014]. It is reporeted that in adipose and lung tissue, the treatment of recombinant IL-33 also induces macrophages to be polarized into an alternatively activated M2 phenotype [Kurowska-Stolarska et al., 2008; Miller et al., 2010]. Li et al found that without IL-33, bleomycin alone can not induce M2

macrophage polarization in St2-/- mice, and cause fibrosis in St2-/- mice [Li et al., 2014] In vitro, IL-33 can synergize with IL-4 to drive the polarization of M2 macrophages [Kurowska et al., 2009]. IL-33 has also shown its protective effect mediated by the activation of ILC2, which produces M2 type cytokines which in turn polarizes anti-inflammatory M2 macrophages [Besnard et al., 2015]. In our observation, M1 specific markers including CD16 and CD32 were significantly induced at 24h and continued to rise at 72h after I/R injury in WT mice, but were not significantly affected by IL-33 knockout at 24h. In contrast, M2 specific markers including CD206 and CD163 were significantly induced at both 24h and 72h after I/R injury only in WT, but not in IL-33 KO mice. We also found co-expression of M1/M2 phenotypes induced by I/R injury in some cells. Therefore, the reciprocal transformation and ratio of M1/M2 macrophages/microglia precisely regulate the microenvironment of the intra-organization in the penumbra area of brain, the dynamic variation of the polarization process from M1 to M2 macrophages, from proinflammatory to anti-inflammatory

can

protect

brain

cells

from

continuous

injury.

Immunofluorescence results show that in the penumbra area and the numbers of M1-type

macrophages/microglia

were

less

than

that

of

M2-type

macrophages/microglia, while in IL-33 KO mice, the expression of M1/M2 macrophages/microglia was less than that in WT. Thus, the IL-33 deficiency leads to the suppression of microglial M2-like activities, in consistent with the role of IL-33 in promoting microglial polarization from M1- to M2-transition [Korhonen et al., 2015; Yang et al., 2017].

The expression of CD206 and Arg-1 by M2-like activities is important for the brain cell function [Hu et al., 2012; Schroeter and Jander, 2005]. IL-33 does not change the overall number of microglia/macrophages but instead induces a shift towards M2-type activation as detected by an increased number of Arg1immunopositive cells in the proximity of the lesion [Korhonen et al., 2015]. We observed the decreased expression of CD206 and Arg-1 in the absent of IL-33, which suggest that IL-33 plays an important role in the M2-like activation. In addition to M2 specific markers, IL-33 can also lead to the corresponding expression of anti-inflammatary cytokines and chemokines IL-10 and TGF-β. For example, IL-10 has been shown to reduce the cerebral infarction volume in rodent models of stroke [Spera Pet al., 1998; Lakhan et al., 2009]. The anti-inflammatory effects of IL-10 may be related to its ability to inhibit the production of inflammatory cytokines, to regulate the infiltration of neutrophils and the expression of intercellular adhesion molecules, to inhibit the apoptosis of monocytes and macrophages [Downing et al., 1998; Pinderski et al., 2002]. TGF-β is a pleiotropic cytokine in the brain, and plays a role in regulating cell proliferation, differentiation, and survival [Tesseur et al., 2006; Logan et al., 1994; Lindholm et al., 1992; Falk et al., 2008]. Therefore, our data are consistent with the important role of IL-33 involved in the M2-like activation [Amantea et al., 2015; Jha et al., 2016; Jimenez et al., 2008; Colton et al., 2006]. In our studies, IL-33 also affects the inflammatary cytokines and chemokines that related to M1 phenotype, including MCP1, IL-12b and NOS2. Among them, MCP1 is a important chemokine to recruit and activate monocytes and macrophages,

and expressed in neurons, astrocytes and microglia cells [Banisadr et al., 2005]. IL-12b is a subunit of IL-12, which plays a key role in activating NK cells and T cells to secrete large amounts of IFN-

[Nikitina et al., 2005; Li et al., 2008; Nagashima

et al., 2008; Amemiya et al., 2006]. It has been shown that inhibition of iNOS reduced infarct size and improved neurological outcomes [Zhao et al., 2000]. Hence, IL-33 may also be involved in down regulation of pro-inflammatory cytokines associated with M1-like activities. In conclusion, our present study demonstrate that IL-33 play a role in regulating the process of ischemic brain damage by modulating the microglial polarization toward neuroprotective and tissue-reparative M2 phenotype in the ischemic brain and exogenous administration of IL-33 can notably facilitate the recovery of ischemic injury. Thus, shifting microglia from the M1 phenotype toward M2 by IL-33 manipulation may become an effective therapeutic target for treating ischemic stroke.

Acknowledgments This study was supported by a grant from Fujian Provincial Industrial Technology Development and Application Project (2016Y01010210), Fujian Key Laboratories Funds, and Young and Middle-Age Backbone Talents Training Project of Fujian Provincial Health System (2015-ZNQ-ZD-06). Disclosure/conflict of interest The authors declare that there is no conflict of interests regarding the publication of this article. Authors’ contributions QC: conception, design and data generation (expression studies), manuscript writing; WL: conception, design and data generation, (MCAO model), manuscript writing; QPL: experimental design, data generation, manuscript writing; YF: data generation and analysis; LLL: experimental design, data generation, data interpretation; JJW: data generation; ZFL: data generation (MRI analysis in ischemic mice); YKL: data generation; SN: data generation

Table 1. The primers used for PCR

Gene

Forward (5’-3’)

Reverse (5’-3’)

CD16

AATGCACACTCTGGAAGCCAA

CACTCTGCCTGTCTGCAAAAG

CD32

TGGACAGCCGTGCTAAATCTT

GGTCCCTTCGCATGTCAGTG

CD206

CTCTGTTCAGCTATTGGACGC

CGGAATTTCTGGGATTCAGCTTC

CD163

ATGGGTGGACACAGAATGGTT

CAGGAGCGTTAGTGACAGCAG

Arg-1

CTCCAAGCCAAAGTCCTTAGAG

AGGAGCTGTCATTAGGGACATC

MCP1

GAGGACAGATGTGGTGGGTTT

AGGAGTCAACTCAGCTTTCTCTT

IL-12b

TGGTTTGCCATCGTTTTGCTG

ACAGGTGAGGTTCACTGTTTCT

NOS2

GTTCTCAGCCCAACAATACAAGA

GTGGACGGGTCGATGTCAC

IL-10

CTTACTGACTGGCATGAGGATCA

GCAGCTCTAGGAGCATGTGG

TGF-β

CCACCTGCAAGACCATCGAC

CTGGCGAGCCTTAGTTTGGAC

IL-6

CTGCAAGAGACTTCCATCCAG

AGTGGTATAGACAGGTCTGTTGG

TNF-α

CTGTGAAGGGAATGGGTGTT

CAGGGAAGAATCTGGAAAGGTC

IL-1β

CTTCAGGCAGGCAGTATCAC

CAGCAGGTTATCATCATCATCC

GAPDH

CCCTGAGCTGAACGGGAAGCTCAC

CTTGCTGTAGCCAAATTCGTTGCT

Figure Legends Figure 1. IL-33 levels are increased in the brain of cerebral ischemia mice. (A) qRTPCR of IL-33 mRNA in brain of sham-operated groups and the ischemic brain tissue after I/R of WT mice at the 24h and 72h, respectively. (B) Western blotting of IL-33 protein in brain of sham-operated groups and the ischemic brain tissue after I/R of WT mice at the 24h and 72h, respectively.The fold change of expression were quantified in (C). All the values are expressed as mean ± SEM. ***p<0.001, **p<0.01, *p<0.05, versus the I/R group, n=6 for each experimental group.

Figure 2. IL-33 KO mice have increased infarct sizes than WT mice. (A) Representative illustrations of cerebral sections stained with TTC. The infarct region was stained white. (B) The infarct size was evaluated as the percentage of infarct area to whole area. (C) Representative photomicrographs taken by MRI scanning. Infarct region was showed with white dotted line. (D) The infarct size was scanned with MRI and evaluated as the percentage of infarct area to whole area. All the values are expressed as mean ± SEM. **p<0.01, *p<0.05, versus I/R group; n=6 for each experimental group.

Figure 3. IL-33 regulated inflammatory cytokines IL-6, TNF-α and IL-1β in the brain following I/R injury. (A)-(C) Reduction of the IL-1β, IL-6 and TNF-α expression in the brain of IL-33 KO mice after I/R by qRT-PCR. All the values are expressed as

mean ± SEM. **p<0.01, *p<0.05, versus I/R group; n=6 for each experimental group.

Figure 4. Expression of M1 and M2 macrophage specific markers in the lesion area are down-regulated at the absent of IL-33. (A)-(D) The mRNA levels of M1 (CD16 and CD32) and M2 (CD206 and CD163) macrophage specific markers in the brain lesion areas after I/R were analyzed by qRT-PCR (E)-(F) Western blotting of M2 macrophage specific markers CD206 and CD163. The fold change of expression were quantified in (G)-(H). All the values are expressed as mean ± SEM. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, versus I/R group; n=6 for each experimental group.

Figure 5. Immunostained ischemic penumbra areas of the cortex of the WT and IL-33 KO mice after I/R. (A) The lesion area is circled by the white solid line, while the penumbre area of cortex is marked by the red square. (B) and (E) CD16/32 and CD206 were stained by their corresponding antibodies, respectively. Nuclei were stained by DAPI (blue). M1 macrophages/microglia were assessed by staining CD16/32 (green). M2 macrophages/microglia were assessed by staining CD206 (red). Scale bars = 50μm. Scale bars = 10μm. The areas of CD16/32 and CD206 were quantified in (C)-(D). (E) Co-localization of CD16/32 (green) and CD206 (red) positive cells, as indicated by arrows. Scale bars = 10μm. All the values are expressed as mean ± SEM. **p<0.01, *p<0.05, versus I/R group; n=5 for each experimental group.

Figure 6. IL-33 altered the levels of MCP1, IL-12b, NOS2, Arg-1, IL-10 and TGF-β in the brain after I/R injury. (A)-(F) qRT-PCR analyses of the levels of MCP1, IL-12b, NOS2, Arg-1, IL-10 and TGFβ in the brain after focal cerebral ischemia at 24h and 72h, respectively. All the cytokines decreased at the absence of IL-33. (G)-(H) Western blot analyses of cytokines MCP1 and Arg-1.The fold change of expression were quantified in (I)-(J). All the values are expressed as mean ± SEM. ***p<0.001, **p<0.01, *p<0.05, versus I/R group; n=6 for each experimental group.

Figure 7. Intracerebroventricular injection of IL-33 protein significantly decreased the infract area and improved the neurological severity scores. (A) Representative illustrations of cerebral sections stained with TTC. Infarct region was stained white. (B) The infarct size was evaluated as the percentage of infarct area to whole area. (C) Representative photomicrographs taken MRI scanning. Infarct region was showed with white dotted line. (D) The infarct size was scanned with MRI and evaluated as the percentage of infarct area to whole area.(E) Neurological severity scores. All the values are expressed as mean ± SEM. ***p<0.001, **p <0.01, versus I/R group; n=6-10 for each experimental group.

Figure 8. IL-33 treatments restored the levels of M1 and M2 macrophage specific markers in the brain of IL-33 KO mice after I/R injury. (A)-(D) qRT-PCR analyses of

the levels of M1 (CD16 and CD32) and M2 (CD206 and CD163) macrophage specific markers in the brain lesion areas. All the values are expressed as mean ± SEM. ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, versus I/R group; n=6 for each experimental group.

Figure 9. Immunostaining analyses of the ischemic penumbra areas of the cortex of the PBS- and IL-33 KO-treated mice after I/R. (A) CD16/32 and CD206 were stained by their corresponding antibodies, respectively. Nuclei were stained by DAPI (blue). M1 macrophages/microglia were assessed by staining CD16/32 (green). M2 macrophages/microglia were assessed by staining CD206 (red). Scale bars = 50μm. Scale bars = 10μm. The areas of CD16/32 and CD206 were quantified in (B)-(C). (D) The co-localization of CD16/32 (green) and CD206 (red) positive cells, as indicated by arrows. Scale bars = 10μm. All the values are expressed as mean ± SEM. **p<0.01, *p<0.05, versus I/R group; n=5 for each experimental group.

References Amantea D, Micieli G, Tassorelli C, Cuartero MI, Ballesteros I, Certo M, Moro MA, Lizasoain I, Bagetta G (2015) Rational modulation of the innate immune system for neuroprotection in ischemic stroke. Front Neurosci 9:147. Amemiya K, Meyers JL, Trevino SR, Chanh TC, Norris SL, Waag DM (2006) Interleukin-12 induces a Th1-like response to Burkholderia mallei and limited protection in BALB/c mice. Vaccine 24(9):1413-1420. Banisadr G, Gosselin RD, Mechighel P, Kitabgi P, Rostène W, Parsadaniantz SM (2005) Highly regionalized neuronal expression of monocyte chemoattractant protein-1 ( MCP-1 /CCL2) in rat brain: Evidence for its colocalization with neurotransmitters and neuropeptides. J Comp Neurol 489(3):275-292． Besnard

AG, Guabiraba

R, Niedbala

W, Palomo

J, Reverchon

F, Shaw

TN, Couper KN, Ryffel B, Liew FY (2015) IL-33-Mediated Protection against Experimental Cerebral Malaria Is Linked to Induction of Type 2 Innate Lymphoid Cells, M2 Macrophages and Regulatory T Cell. PLoS Pathog 11(2):e1004607. Biswas SK,Chittezhath M, Shalova IN, Lim JY (2012) Macrophage polarization and plasticity in health and disease. Immunol Res 53 ( 1-3):11-24. Cayrol C, Girard JP (2014) IL-33: an alarmin cytokine with crucial roles in innate immunity, inflammation and allergy. Curr Opin Immunol 31:31–7. Chen HJ, Shen YC, Shiao YJ, Liou KT, Hsu WH, Hsieh PH, Lee CY, Chen YR, Lin YL (2015). Multiplex brain proteomic analysis revealed the molecular therapeutic effects of buyang huanwu decoction on cerebral ischemic stroke

mice. Plos One 10(10): e0140823. Colton CA1, Mott RT, Sharpe H, Xu Q, Van Nostrand WE, Vitek MP (2006) Expression profiles for macrophage alternative activation genes in AD and in mouse models of AD. J Neuroinflammation 3:27. Denes A, Vidyasagar R, Feng J, Narvainen J, McColl BW, Kauppinen RA, Allan SM (2007) Proliferating resident microglia after focal cerebral ischaemia in mice. J. Cereb Blood Flow Metab 27(12):1941–1953. Downing LJ, Strieter RM, Kadell AM, Wilke CA, Austin JC, Hare BD, Burdick MD, Greenfield LJ, Wakefield TW (1998) IL-10 regulates thrombus-induced vein wall inflammation and thrombosis. Journal of Immunology 161(3):1471–1476. Falk S, Wurdak H, Ittner LM, Ille F, Sumara G, Schmid MT, Draganova K, Lang KS, Paratore C, Leveen P, Suter U, Karlsson S, Born W, Ricci R, Götz M, Sommer L (2008) Brain areaspecific effect of TGF-beta signaling on Wnt-dependent neural stem cell expansion. Cell Stem Cel 2(5):472–83. Fan Y, Luo Q, Wei J, Lin R, Lin L, Li Y, Chen Z, Lin W, Chen Q (2017) Mechanism of Salvianolic Acid B Neuroprotection against Ischemia/Reperfusion Induced Cerebral Injury. Brain Res. S0006-8993(17)30522-X. Fock V, Mairhofer M, Otti GR, Hiden U, Spittler A, Zeisler H, Fiala C, Knofler M, Pollheimer J (2013) Macrophage-derived IL-33 is a critical factor for placental growth. J Immunol 191:3734-3743. Ginhoux F, Lim S, Hoeffel G, Low D, Huber T (2013) Origin and differentiation of microglia. Front Cell Neurosci 7:45.

Guerrero AR, Uchida K, Nakajima H, Watanabe S, Nakamura M,Johnson WE, Baba H (2012) Blockade of interleukin-6 signaling inhibits theclassic pathway and promotes an alternative pathway of macrophage activation after spinal cord injury in mice. J Neuroinflammation 9:40. Guo L, Zhou X, Guo X, Zhang X, Sun Y (2013) Association of interleukin-33 gene single nucleotide polymorphisms with ischemic stroke in north Chinese population. BMC Med Genet 14:109. Hallenbeck JM (1996) Significance of the inflammatory response in brain ischemia. Acta Neurochir Suppl 66:27–31. Haraldsen G, Balogh J, Pollheimer J, Sponheim J, Kuchler AM (2009) Interleukin-33—cytokine of dual function or novel alarmin. Trends Immunol 30(5):227–233. Hardman CS, Panova V, McKenzie AN (2013) IL-33 citrine reporter mice reveal the temporal and spatial expression of IL-33 during allergic lung inflammation. Eur J Immunol 43:488–98. Hayakata T, Shiozaki T, Tasaki O, Ikegawa H, Inoue Y, Toshiyuki F, Hosotubo H, Kieko F, Yamashita T, Tanaka H, Shimazu T, Sugimoto H (2004) Changes in CSF S100B and cytokine concentration in early-phase severe traumatic brain injury. Shock 22(2):102-107. He J, Evans CO, Hoffman SW, Oyesiku NM, Stein DG (2004) Progesterone and allopregnanolone reduce inflammatory cytokines after traumatic brain injury. Exp Neurol 189(2):404-412.

Hickman SE, Kingery ND, Ohsumi TK, Borowsky ML, Wang LC, Means TK, El Khoury J (2013) The microglial sensome revealed by direct RNA sequencing. Nature neuroscience 16(12):1896-1905. Hu X, Leak RK, Shi Y, Suenaga J, Gao Y, Zheng P, Chen J (2015) Microglial and macrophage polarization-new prospects for brain repair. Nat Rev Neurol 11: 56–64. Hu X, Li P, Guo Y, Wang H, Leak RK, Chen S, Chen J (2012) Microglia/macrophage polarization dynamics reveal novel mechanism of injury expansion after focal cerebral ischemia. Stroke 43(11):3063–3070. Jha MK, Lee WH, Suk K (2016) Functional polarization of neuroglia: Implications in neuroinflammation and neurological disorders. Biochem Pharmacol 103:1–16. Jiang HR, Milovanovic M, Allan D, Niedbala W, Besnard AG, Fukada SY, Liew FY (2012) IL-33 attenuates EAE by suppressing IL-17 and IFN-gamma production and inducing alternatively activated macrophages. Eur J Immunol 42(7):1804–1814. Jimenez S, Baglietto-Vargas D, Caballero C, Moreno-Gonzalez I, Torres M, Sanchez-Varo R, Ruano D, Vizuete M, Gutierrez A, Vitorica J (2008) Inflammatory response in the hippocampus of PS1M146L/APP751SL mouse model of Alzheimer’s disease: age-dependent switch in the microglial phenotype from alternative to classic. J Neurosci 28:11650–11661. Kigerl KA, Gensel JC, Ankeny DP, Alexander JK, Donnelly DJ,Popovich PG (2009) Identification of two distinct macrophage subsets with divergent effects causing either neurotoxicity or regeneration in the injured mouse spinal cord. J

Neurosci 29:13435–44. Korhonen P, Kanninen KM, Lehtonen Š, Lemarchant S, Puttonen KA, Oksanen M, Dhungana H, Loppi S, Pollari E, Wojciechowski S, Kidin I,García-Berrocoso T, Giralt D, Montaner J, Koistinaho J, Malm T (2015) Immunomodulation by interleukin-33 is protective in stroke through modulation of inflammation. Brain Behavior Immunity 49: 322-336. Kurowska-Stolarska M, Kewin P, Murphy G, Russo RC, Stolarski B, Garcia CC, Komai-Koma M, Pitman N, Li Y, Niedbala W, McKenzie AN, Teixeira MM, Liew FY, Xu D (2008) IL-33 induces antigen-specific IL-5+ T cells and promotes allergic-induced

airway

inflammation

independent

of

IL-4.

J

Immunol

181:4780-4790. Kurowska-Stolarska M, Hueber A, Stolarski B, McInnes I (2011) Interleukin-33: a novel mediator with a role in distinct disease pathologies. J Intern Med 269(1):29–35. Kurowska-Stolarska M, Stolarski B, Kewin P, Murphy G, Corrigan CJ, Ying S, Liew FY (2009) IL-33 amplifies the polarization of alternatively activated macrophages that contribute to airway inflammation. J Immunol 183(10):6469–6477. Kushima Y, Hama T, Hatanaka H (1992) Interleukin-6 as Neurotrophic Factor for Promoting the Survival of Culture Catecholminergic Neurons in a Chemically Define Medium from Fetal and Postnatal Rat Mid Brain. Neurosci Res 13(4):267-280. Lakhan SE, Kirchgessner A, Hofer M (2009) Inflammatory mechanisms in ischemic stroke: Therapeutic approaches.Journal of Translational Medicine 7:97.

Lamkanfi M, Dixit VM (2009) IL-33 raises alarm. Immunity 31 (1), 5–7. Li D, Guabiraba R, Besnard AG, Komai-Koma M, Jabir MS, Zhang L, Graham GJ, Kurowska-Stolarska M, Liew FY, Mcsharry C, Xu D (2014) IL-33 promotes ST2-dependent lung fibrosis by the induction of alternatively activated macrophages and innate lymphoid cells in mice. The Journal of allergy and clinical immunology 134:1422-1432e1411. Li D, Yu H, Xu TF, Li JH, Sun YF, Zhang WQ (2008) Interleukin-12 gene modification exerts anti-tumor effects on murine mammary sarcoma cell line in vivo. Cell Mol Immunol 5(3):225-230. Liew FY, Pitman NI, McInnes IB (2010) Disease-associated functions of IL-33: the new kid in the IL-1 family. Nat Rev Immunol 10,103–110. Lin TN, He YY, Wu G, Khan M, Hsu CY (1993) Effect of brain edema on infarct volume in a focal cerebral ischemia model in rats. Stroke 24 (1):117–121. Lindholm D, Castren E, Kiefer R, Zafra F, Thoenen H (1992) Transforming growth factor-beta 1 in the rat brain: increase after injury and inhibition of astrocyte proliferation. J Cell Biol 117(2):395–400. Livak KJ and Schmittgen TD (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2 −ΔΔ C T Method. Methods 25(4):402-408. Logan A, Berry M, Gonzalez AM, Frautschy SA, Sporn MB, Baird A (1994) Effects of transforming growth factor beta 1 on scar production in the injured central nervous system of the rat. Eur J Neurosci 6(3):355–63.

Longa EZ, Weinstein PR, Carlson S, Cummins R (1989) Reversible middle cerebral artery occlusion without craniectomy in rats. Stroke 20(1): 84-91. Mackinnon AC, Farnworth SL, Hodkinson PS, Henderson NC, Atkinson KM, Leffler H, Nilsson UJ, Haslett C, Forbes SJ, Sethi T (2008) Regulation of alternative macrophage activation by galectin-3. J Immunol 180(4): 2650-8. Mantovani A,

Sica A, Sozzani S, Allavena P, Vecchi A, Locati M (2004) The

chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol 25(12):677-686． Miller AM, Asquith DL, Hueber AJ, Anderson LA, Holmes WM, McKenzie AN, Xu D, Sattar N, McInnes IB, Liew FY (2010) Interleukin-33 induces protective effects in adipose tissue inflammation during obesity in mice. Circulation research 107:650-658. Mizuma A, Yenari MA (2017) Anti-Inflammatory Targets for the Treatment of Reperfusion Injury in Stroke. Front Neurol 8:467. Nagashima N, Nakayama Y, Inoue Y, Nagata J, Matsumoto K, Minagawa N, Katsuki T, Shibao K, Hirata K, Sako T, Hamada T, Nagata N (2008) Prognostic significance of the local expression of interleukin-12 in patients with advanced gastric cancer. Anticancer Res 28(2B):1277-1283 . Nakae S, Morita H, Ohno T, Arae K, Matsumoto K, Saito H (2013) Role of interleukin-33 in innate-type immune cells in allergy. Allergol Int 62:13–20. Nikitina EY, Desai SA, Zhao X, Song W, Luo AZ, Gangula RD, Slawin KM, Spencer DM (2005) Versatile prostate cancer treatment with inducible caspase and

interleukin-12. Cancer Res 65(10):4309-4319. Oboki K,

Ohno T, Kajiwara N, Arae K, Morita H, Ishii A, Nambu A, Abe T,

Kiyonari H, Matsumoto K, Sudo K, Okumura K, Saito H, Nakae S (2010) IL-33 is a crucial amplifier of innate rather than acquired immunity. PNAS 107(43):18581-6. Offner H, Subramanian S, Parker SM, Afentoulis ME, Vandenbark AA, Hurn PD (2006) Experimental stroke induces massive, rapid activation of the peripheral immune system. J Cereb Blood Flow Meta. 26(5): 654-665. Ohno T, Morita H, Arae K, Matsumoto K, Nakae S (2012) Interleukin-33 in allergy. Allergy 67:1203–14. Paxinos G, Franklin K (2001) The Mouse Brain in Stereotaxic Coordinates, second ed. Academic Press, San Diego, CA, USA. Pinderski LJ, Fischbein MP, Subbanagounder G, Fishbein MC, Kubo N, Cheroutre H, Curtiss LK, Berliner JA, Boisvert WA (2002) Overexpression of interleukin-10 by activated T lymphocytes inhibits atherosclemsis in LDL receptordeficient mice by altering lymphocyte and macrophage phenotypes. Circ Res 90(10):1064-1071. Pomeshchik Y, Kidin I, Korhonen P, Savchenko E, Jaronen M, Lehtonen S, Malm T (2014) Interleukin-33 treatment reduces secondary injury and improves functional recovery after contusion spinal cord injury. Brain Behav Immun 44(2015):68-81. Prinz M, Priller J (2014) Microglia and brain macrophages in the molecular age: from origin to neuropsychiatric disease. Nat Rev Neurosci 15:300–312.

Prinz M, Tay TL, Wolf Y, Jung S (2014) Microglia: Unique and common features with other tissue macrophages. Acta Neuropathologica 128 (3): 319–31. Schilling M, Strecker JK, Schäbitz WR, Ringelstein EB, Kiefer R (2009) Effects of monocyte chemoattractant protein 1 on blood -borne cell recruitment after transient focal cerebral ischemia in mice. Neuroscience 161 (3): 806 -812. Schmitz J,

Owyang A, Oldham E, Song Y, Murphy E, McClanahan TK,

Zurawski G, Moshrefi M, Qin J, Li X, Gorman DM, Bazan JF, Kastelein RA (2005) IL-33, an interleukin-1-like cytokine that signals via the IL-1 receptor-related protein ST2 and induces T helper type 2-associated cytokines. Immunity 23:479–490. Schroeter M, Jander S (2005) T-cell cytokines in injury-induced neural damage and repair. Neuromol Med 7(3):183–195. Shichita T, Sugiyama Y, Ooboshi H, Sugimori H, Nakagawa R, Takada I, Iwaki T, Okada Y, Iida M, Cua DJ, Iwakura Y, Yoshimura A (2009) Pivotal role of cerebral interleukin-17-producing gamma delta T cells in the delayed phase of ischemic brain injury. Nat Med 15(8): 946–950. Skaper SD, Facci L, Giusti P (2014) Neuroinflammation, microglia and mast cells in the pathophysiology of neurocognitive disorders: A review. CNS Neurol Disord Drug Targets 13:1654–1666. Smith DE(2011) The biological paths of IL-1 family members IL-18 and IL-33. J Leukoc Biol 89(3)383-392. Spera PA, Ellison JA, Feuerstein GZ, Barone FC (1998) IL-10 reduces rat brain injury following focal stroke. Neuroscience Letter 251(3):189–192.

Taylor RA,Sansing LH (2013) Microglial responses after ischemic stroke and intracerebral hemorrhage. Clin Dev Immunol 2013:746068. Tesseur I, Zou K, Esposito L, Bard F, Berber E, Can JV, Lin AH, Crews L, Tremblay P, Mathews P, Mucke L, Masliah E, Wyss-Coray T (2006) Deficiency in neuronal TGF-beta signaling promotes neurodegeneration and Alzheimer’s pathology. J Clin Invest 116(11):3060–9. Tjota MY, Williams JW, Lu T, Clay BS, Byrd T, Hrusch CL,Decker DC, de Araujo CA, Bryce PJ, Sperling AI (2013) IL-33-dependent induction of allergic lung inflammation by FcgammaRIII signaling. J Clin Invest 123:2287–97. Van Ginderachter JA , Movahedi K , Hassanzadeh Ghassabeh G, Meerschaut S, Beschin A, Raes G, De Baetselier P (2006) Classical and alternative activation of mononuclear phagocytes: picking the best of both worlds for tumor promotion. Immunobiology 211:487-501. Varnum MM, Ikezu T (2012) The classification of microglial activation phenotypes on neurodegeneration and regeneration in Alzheimer's disease brain. Arch Immunol Ther Exp (Warsz) 60(4):251-66. Yang Y, Liu H, Zhang H, Ye Q, Wang J, Yang B, Mao L, Zhu W, Leak RK, Xiao B, Lu B, Chen J, Hu X (2017). St2/IL-33-dependent microglial response limits acute ischemic brain injury. Journal of Neuroscience 37(18): 4692-4704. Yasuoka, S, Kawanokuchi J, Parajuli B, Jin S, Doi Y, Noda M, Sonobe Y, Takeuchi H, Mizuno T, Suzumura A (2011) Production and functions of IL-33 in the central nervous system. Brain Res 1385, 8–17.

Zhao X, Haensel C, Araki E, Ross ME, Iadecola C (2000) Gene-dosing effect and persistence of reduction in ischemic brain injury in mice lacking inducible nitric oxide synthase. Brain Res 872(1–2):215–8.

Research highlights Compare difference between WT and IL-33 KO mice after I/R injury at 24h and 72h. The M1- and M2 macrophage were decreased in IL-33 KO mice after I/R. Decreased expression of the corresponding cytokines were seen in IL-33 KO mice. Exogenous IL-33 restored brain M1 and M2 macrophages of IL-33 KO mice.