- Email: [email protected]
Intermittent compressive stress regulates Notch target gene expression via transforming growth factor-β signaling in murine pre-osteoblast cell line
Archives of Oral Biology 82 (2017) 47–54
Contents lists available at ScienceDirect
Archives of Oral Biology journal homepage: www.elsevier.com/locate/archoralbio
Intermittent compressive stress regulates Notch target gene expression via transforming growth factor-β signaling in murine pre-osteoblast cell line Jeeranan Manokawinchokea, Prasit Pavasanta, Thanaphum Osathanona,b, a b
MARK
⁎
Mineralized Tissue Research Unit and Department of Anatomy, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand Craniofacial Genetics and Stem Cell Research Group, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand
A R T I C L E I N F O
A B S T R A C T
Keywords: Intermittent stress Osteoblasts Sclerostin Notch signaling Transforming growth factor-β
Objective: Different mechanical stimuli regulate behaviors of various cell types, including osteoblasts, osteocytes, and periodontal ligament fibroblasts. Notch signaling participates in the mechanical stress-regulated cell responses. The present study investigated the regulation of Notch target gene and sclerostin (Sost) expression in murine pre-osteoblast cell line (MC3T3-E1) under intermittent compressive stress. Methods: MC3T3-E1 were subjected to the intermittent compressive force under the computerized controlled machine. In some experiments, cells were pretreated with chemical inhibitors for Notch and transforming growth factor (TGF)-β signaling prior to mechanical stimuli. To evaluate role of Notch signaling in MC3T3-E1 cells under unloaded condition, cells were seeded on indirect immobilized Notch ligand (Jagged1). Gene expression was determined using real-time quantitative polymerase chain reaction. Results: The intermittent compressive stress significantly upregulated Notch target gene expression (Hes Family BHLH transcription factor 1; Hes1 and Hairy/enhancer-of-split related with YRPW motif protein1; Hey1). The intermittent stress-induced Hes1 and Hey1 mRNA expression could be inhibited by a γ-secretase inhibitor (DAPT) or a TGF-β superfamily type I activing receptor-like kinase receptors inhibitor (SB431542). The results imply that intermittent compressive stress regulates Notch signaling via TGF-β pathway. Further, the intermittent compressive stress reduced Sost mRNA expression and this phenomenon could be rescued by a DAPT pretreatment, implying the involvement of Notch signaling. However, activation of Notch signaling under the unloaded condition resulted in the increase of Sost expression and the reduction of osteogenic marker genes. Conclusions: These results imply the involvement of Notch signaling in the homeostasis maintaining of osteogenic cells under mechanical stress stimuli.
1. Introduction Alveolar bone and periodontal ligament consistently receive a cyclic compressive force during normal mastication. Influence of mechanical force on osteoblast and periodontal ligament cell has widely been reported. Various publications demonstrated that cells response differently to different force types (Basso & Heersche, 2002; Cardwell et al., 2015). In this regard, it has been shown that intermittent mechanical force treatment promoted higher receptor activator of nuclear factor kappa-B ligand (RANKL) expression in periodontal ligament cells than those treated with continuous force treatment (Nakao et al., 2007). Continuous shear stress significantly enhanced in vitro osteogenic differentiation than intermittent shear stress in rat calvarial derived osteoblasts as determined by the increase of alkaline phosphatase expression and mineralization (Ban et al., 2011). Previous studies demonstrated that intermittent compressive stress induced insulin-like
⁎
growth factor-1 (IGF-1), periostin (POSTN), transforming growth factorβ (TGF-β), and sclerostin (SOST) mRNA expression in human periodontal ligament cells (hPDLs) (Manokawinchoke et al., 2015; Pumklin, Manokawinchoke, Bhalang, & Pavasant, 2015). Nevertheless, the static continuous force and intermittent force regulated different cell responses (Manokawinchoke, Sumrejkanchanakij, Pavasant, & Osathanon, 2017). The effect of intermittent compressive stress on periodontal ligament cells and osteoblasts remains limited. Mechanical stress regulates Notch signaling and further influence cell’s behaviors. Cyclic strain increased Notch receptor expression and Notch subsequently promoted network formation by endothelial cells (Morrow, Cullen, Cahill, & Redmond, 2007). On the contrary, cyclic strain inhibited Notch receptor expression in vascular smooth muscle cells and the reduction of Notch signaling, in part, attenuated cell growth and enhanced apoptosis (Morrow et al., 2005). Notch signaling also participated in the intermittent regulated SOST expression in
Corresponding author at: Department of Anatomy, Faculty of Dentistry, Chulalongkorn University, Bangkok, 10330, Thailand. E-mail addresses: [email protected] (J. Manokawinchoke), [email protected] (P. Pavasant), [email protected] (T. Osathanon).
http://dx.doi.org/10.1016/j.archoralbio.2017.05.020 Received 17 February 2017; Received in revised form 8 May 2017; Accepted 29 May 2017 0003-9969/ © 2017 Elsevier Ltd. All rights reserved.
Archives of Oral Biology 82 (2017) 47–54
J. Manokawinchoke et al.
hPDLs (Manokawinchoke et al., 2017). In this regard, Notch signaling inhibition resulted in the reduction of intermittent stress-induced SOST expression by hPDLs (Manokawinchoke et al., 2017). Together, these evidences suggest the participation of Notch signaling in the mechanical force-regulated cell response. Although, there are some similar responses between periodontal ligament cells and osteoblasts. Several distinct regulations of mechanical stimuli on these two cell types were reported (Nettelhoff et al., 2016; Ngan et al., 1990). For example, compressive force treatment enhanced osteopontin expression in human osteoblasts but not in hPDLs (Nettelhoff et al., 2016). Thus, an investigation regarding the specific role of intermittent stress on specific aspect for these cells is indeed necessitated. The present study aimed to investigate the regulation of Notch target gene expression in murine pre-osteoblast cell line (MC3T3E1) under intermittent compressive stress in vitro.
Table 1 Primer sequences. Gene
Sequences (F; forward, R; reverse)
Reference
18s
F R F R F R F R F R F R F R F R F R
NR_003278.3
Runx2 Osx Alp Sost Hes1 Hey1 Dlx5
2. Methods Tgf-β1
2.1. Cell culture and treatment Murine osteoblastic cells, MC3T3-E1, were maintained in Minimum Essential Medium (MEM/EBSS, Hyclone, Logan, Utah, USA) containing 10% fetal bovine serum (Hyclone, Cramlington, Northumberland, UK), 100 unit/ml penicillin and 100 μg/ml streptomycin, 250 ng/ml amphotericin B, and 2 mM L-glutamine (Gibco BRL, Carlsbad, CA, USA). Cells were maintained in humidified atmosphere and 5% CO2, at 37 °C. The medium was changed every 2 days. For osteogenic induction, the growth medium was supplemented with 50 μg/ml L-ascorbic acid and 5 mM β-glycerophosphate. An intermittent compressive stress treatment was performed according to our previous published protocol (Manokawinchoke et al., 2015). Briefly, cells were seeded in 6-wells tissue culture plate at density of 37,500 cells/cm2. Serum starvation was performed for 8 h and cells were subsequently subjected to the intermittent compressive stress treatment using a computerized controlled apparatus at a force of 1.5 g/cm2 with 14 cycles per minute. For Notch signaling treatment, cells were seeded on Jagged-1 immobilized surface according to our previous publications (Osathanon, Nowwarote, Manokawinchoke, & Pavasant, 2013; Osathanon, Ritprajak et al., 2013; Sukarawan, Peetiakarawach, Pavasant, & Osathanon, 2016). Briefly, tissue culture surfaces were incubated with recombinant protein G (50 μg/mL, Invitrogen, USA), bovine serum albumin (10 mg/ ml, Invitrogen, USA), and recombinant human Jagged-1/Fc (R & D systems, USA), respectively. The surfaces were rinsed three times with sterile PBS between each step. Human IgG, Fc fragment (hFc, Jackson ImmunoResearch Laboratory, USA) was used as the control. In some experiments, cells were pre-treated with the following inhibitors for 30 min prior to treatment. The agents used in the present study were 4 μM SB431542 (a TGF-β inhibitor; Sigma-Aldrich Chemical, St. Louis, MO, USA) and 20 μM N-[N-(3,5Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT, Sigma-Aldrich Chemical). To confirm the influence of Tgf-β1, MC3T3E1 cells were treated with recombinant human Tgf-β1 at concentration of 10 ng/ml in serum-free culture condition.
5′CTTAGAGGGACAAGTGGCG3′ 5′ACGCTGAGCCAGTCAGTGTA3′ 5′CGGGCTACCTGCCATCAC3′ 5′GGCCAGAGGCAGAAGTCAGA3′ 5′CTCGTCTGACTGCCTGCCTAG3′ 5′GCGTGGATGCCTGCCTTGTA3′ 5′GCCCTCTCCAAGACATATA3′ 5′CCATGATCACGTCGATATCC3′ 5′GGAATGATGCCACAGAGGTCAT3′ 5′CCCGGTTCATGGTCTGGTT3′ 5′GCAGACATTCTGGAAATGACTGTGA3′ 5′GAGTGCGCACCTCGGTGTTA3′ 5′GCAGGAGGGAAAGGTTATTTTGA3′ 5′CGAAACCCCAAACTCCGATAG3′ 5′GCCCCTACCACCAGTACG3′ 5′TCACCATCCTCACCTCTG3′ 5′GCCCTCGGGAGCCACAAACC3′ 5′GCAGCAGGAGTCGCGGTGAG3′
NM_001145920.1 NM_130458.3 NM_007431.2 NM_024449.6 NM_008235.2 NM_010423.2 NM_010056.3 NM_011577.2
2.3. Mineralization assay Samples were fixed with cold methanol and rinsed with deionized water. Further, samples were incubated in 1% Alizarin red S solution (Sigma-Aldrich Chemical) and the excess staining was washed with deionized water. Mineral deposition was quantified by solubilizing alizarin red staining in 10% cetylpyridinium chloride monohydrate. The solution’s absorbance was examined at 570 nm.
2.4. Statistical analysis Results are demonstrated as box and whisker plots. Nonparametric statistical analysis (IBM SPSS Statistics for Mac, Version 22, Armonk, NY, USA) was employed to evaluate a statistically significant difference at the p value < 0.05.
3. Results 3.1. Intermittent compressive stress regulated Notch target gene expression via Tgf-β Cells were treated with intermittent compressive stress for 24 h. The results demonstrated that intermittent compressive stress significantly upregulated Notch target genes, Hes Family BHLH transcription factor 1 (Hes1) and Hairy/enhancer-of-split related with YRPW motif protein1 (Hey1), mRNA expression in MC3T3-E1 cells (Fig. 1A and B). When cells were pretreated with a γ-secretase inhibitor (DAPT) prior to the stimulation of intermittent compressive force. The stress-induced Hes1 and Hey1 mRNA expression was attenuated (Fig. 1C and D). Previous study reported that intermittent compressive stress upregulated TGF-β1 expression in hPDLs and this mechanism participated in the regulation of Notch signaling under intermittent compressive stress (Manokawinchoke et al., 2017). MC3T3-E1 cells were treated with intermittent compressive stress for 24 h. The significant upregulation of Tgf-β1 was observed (Fig. 2A). Inhibition of Tgf-β pathway by SB431542 attenuated the intermittent compressive stress-induced Hes1 and Hey1 mRNA expression (Fig. 2B and C). Correspondingly, the addition of exogenous rhTgf-β1 resulted in the significant increase of Hes1 and Hey1 mRNA levels at 24 h (Fig. 2D and C). Taken all evidences together, the intermittent compressive stress induced Notch target gene expression via Tgf-β signaling pathway.
2.2. Polymerase chain reaction (PCR) RNA isolation was done using RiboEx total RNA isolation solution (GeneAll, Seoul, Korea). One microgram of RNA was converted to cDNA using a reverse transcriptase kit (Promega, Madison, WI, USA). Quantitative real-time PCR was performed using FastStart® Essential DNA Green Master (Roche Applied Science, Indianapolis, IN, USA) in a Lightcycler Nano RT-PCR machine (Roche Applied Science). Expression levels were normalized to the reference gene (18S) and the control. The primer sequences are shown in Table 1. 48
Archives of Oral Biology 82 (2017) 47–54
J. Manokawinchoke et al.
Fig. 1. Intermittent compressive stress induced Notch target gene expression. Cells were treated with the intermittent stress for 24 h. Hes1 and Hey1 mRNA levels were evaluated using real-time polymerase chain reaction (A and B). In some conditions, cells were pretreated with a γ-secretase inhibitor (DAPT) for 30 min prior to mechanical stimuli (C and D). Bars indicated the statistically significant difference (p < 0.05). Black dots (•) represented the outlying data points. Asterisk (∗) indicated the extreme data point.
Fig. 2. TGF-β involved in the intermittent stress-induced Notch target gene expression. Cells were treated with the intermittent stress for 24 h (A). Cells were pretreated with a TGF-β signaling inhibitor (SB431542) for 30 min prior to mechanical stimuli (B and C). Cells were treated with exogeneous rhTGF-β1 under unloaded condition for 24 h (D and E). The mRNA expression was evaluated using real-time polymerase chain reaction. Bars indicated the statistically significant difference (p < 0.05). Black dots (•) represented the outlying data points. Asterisk (∗) indicated the extreme data point.
49
Archives of Oral Biology 82 (2017) 47–54
J. Manokawinchoke et al.
Fig. 3. Intermittent compressive stress induced Sost mRNA expression. Cells were treated with the intermittent stress for 24 h (A). In some conditions, cells were pretreated with a γ-secretase inhibitor (DAPT) or a TGF-β signaling inhibitor (SB431542) for 30 min prior to mechanical stimuli, respectively (B and C). Cells were treated with exogeneous rhTGF-β1 under unloaded condition for 24 h (D). Bars indicated the statistically significant difference (p < 0.05).
day 3 (Fig. 5A and B). The significant reduction of Alp, Runx2, and Osx mRNA levels were observed in Jagged1 treated condition (Fig. 5C–E). No change was noted for Dlx5 mRNA expression (Fig. 5F). At day 12, the mineral deposition was evaluated using alizarin red s staining. The results demonstrated that Jagged1 did not influence mineral deposition in MC3T3-E1 cells (Fig. 5G and H).
3.2. Notch signaling participated in the intermittent compressive stressregulated Sost expression Previous work demonstrated that the intermittent compressive stress promoted SOST expression in hPDLs (Manokawinchoke et al., 2017). In the present study, the influence of intermittent compressive stress-regulated Sost expression in MC3T3-E1 was investigated. Interestingly, the results demonstrated that intermittent stress significantly inhibited Sost expression (Fig. 3A). DAPT pretreatment rescued the intermittent stress-attenuated Sost expression (Fig. 3B). However, SB431542 pretreatment slightly attenuated intermittent stress-suppressed Sost expression. However, there is no statistically significant difference (Fig. 3C). However, the exogenous rhTgf-β1 inhibited Sost mRNA expression in unloaded condition (Fig. 3D). These results indicate that the intermittent compressive stress regulated Sost via Notch signaling pathway.
3.4. Notch signaling activation differentially regulated gene expression in MC3T3-E1 cells under intermittent compressive stress and unloaded condition To compare the differential regulation of Notch signaling activation between loaded and unloaded condition, cells were seeded on Jagged-1 immobilized surface for 24 h and subsequently subjected to intermittent compressive stress in serum-free culture condition for 24 h. Cells maintained under unloaded condition were used as the control. The results demonstrated that Jagged-1 induced Sost expression under unloaded condition. However, the stimulation of Notch signaling under loaded condition resulted in the attenuation of Jagged1 induced Sost mRNA expression (Fig. 6A). For osteogenic marker gene expression, Jagged-1 significantly reduced Runx2 mRNA levels in unloaded condition, while there is no significant difference in intermittent compressive force loaded condition (Fig. 6B).
3.3. Notch signaling activation in unloaded condition increased Sost expression but reduced osteogenic marker gene expression MC3T3-E1 cells were seeded on Jagged1 immobilized surface to activate intracellular Notch signaling pathway. Cells were maintained in normal growth medium for 3 days. Notch activation significantly enhanced Hes1 and Hey1 mRNA expression (Fig. 4A and B). However, the reduced osteogenic marker gene expression was observed. In this regard, runt-related transcriptional factor 2 (Runx2), osterix (Osx), and distal-less homeobox 5 (Dlx5) mRNA levels were attenuated in those cells treated with Jagged1 (Fig. 4C–E). Though, no change in alkaline phosphatase (Alp) mRNA levels was observed (Fig. 4F). Interestingly, Jagged1 promoted Sost expression by MC3T3-E1 cells (Fig. 4G). In osteogenic medium, similar trend was observed. Hes1 and Hey1 mRNA levels were significantly increased in Jagged1 treated cells at
4. Discussion Influences of mechanical stimuli on Notch signaling regulation depended on various factors, including cell types, force types, force magnitude, and duration of force application (Manokawinchoke et al., 2017; Morrow et al., 2005, 2007). In this respect, cyclic strain enhanced and inhibited Notch receptor expression in endothelial cells and vascular smooth muscle cells, respectively (Morrow et al., 2005, 2007). In 50
Archives of Oral Biology 82 (2017) 47–54
J. Manokawinchoke et al.
Fig. 4. Activation of Notch signaling inhibited osteogenic marker gene expression but increased Sost mRNA expression. Cells were seeded on indirect immobilized Jagged1 and maintained in growth medium for 3 days. The mRNA expression of osteogenic differentiation markers and Sost was examined using real-time polymerase chain reaction (A–G). Bars indicated the statistically significant difference (p < 0.05). Black dots (•) represented the outlying data points.
mechanical stimuli is known to promote osteoblast differentiation and bone formation (Jiang, Wang, & Tang, 2016; Shirazi-Fard, Alwood, Schreurs, Castillo, & Globus, 2015; Wang, Wang, Gao, Wang, & Dong, 2017). Therefore, the reduction of Sost expression in osteoblast after stimulated by mechanical force may participate in anabolic effects of mechanical stimuli on bone formation. Regulation of SOST by Notch signaling was previously reported. In this regard, Notch signaling regulated SOST expression in intermittent stress-treated hPDLs (Manokawinchoke et al., 2017). Further, the study in transgenic mice demonstrated that Notch activation in osteocytes lead to the inhibition of Sost expression, subsequently affects the suppression of bone resorption and the increase of bone volume (Canalis, Bridgewater, Schilling, & Zanotti, 2016). In the present study, we demonstrated that Notch signaling regulating Sost expression might be a context dependent. In this regard, Notch signaling participated in intermittent mechanical stress-attenuated Sost mRNA expression. On the other hands, Notch signaling activation under unloaded condition resulted in the increase of Sost mRNA levels. Sost upregulation after Notch activation concurred with the reduction of osteogenic markers. These results imply that Notch signaling impairs osteogenic differentiation of MC3T3-E1 cells under unloaded condition. The present study illustrated that an activation of Notch signaling in MC3T3-E1 cells using immobilized Jagged1 led to the attenuation of osteogenic marker gene expression but did not markedly influence mineralization. Firstly, it should be noted that the present study employed human Jagged1 to activate Notch signaling in murine pre-osteoblast cell line. However, Notch is a high conserved signaling pathway. Human Jagged1 has 97% amino acid identical to mouse Jagged1. In addition, our results demonstrated the upregulation of Notch target gene (Hes1 and Hey1) mRNA expression after MC3T3-E1 cells were seeded on human Jagged1, indicating that human Jagged is able to activate intracellular Notch signaling in mouse cells. Previous report showed that Notch ligand (Delta-like 1; Dll1) overexpressing MC3T3-E1 cells abolished the effect of oncostatin M-induced osteogenic differentiation (Ni, Yuan, Yao, & Peng, 2015). Correspondingly, Notch target gene, Hes1 was shown as a negative regulator of osteogenic differentiation in MC3T3-E1 cells. In this regard, Hes1 mRNA expression was decreased during the osteogenic induction and Hes1 overexpression resulted in the decrease of osteocalcin (Ocn) mRNA levels in MC3T3-E1 cells (Y. Zhang, Lian, Stein, van Wijnen, & Stein, 2009).
addition, the static continuous compressive force exhibited less potency to upregulate Notch target gene expression in hPDLs (Manokawinchoke et al., 2017). The present study demonstrated the regulation of Notch target gene expression by intermittent compressive force via Tgf-β signaling pathway. Similarly, the study in hPDLs demonstrated that the intermittent stress upregulated the mRNA expression of Notch target genes and receptors (Manokawinchoke et al., 2017). Pretreatment with SB431542 abolished intermittent stress-induced Notch expression (Manokawinchoke et al., 2017). These evidences indicate the involvement of TGF-β signaling in intermittent stress-induced Notch signaling. Sclerostin is an antagonist of Wnt signaling pathway by binding to LDL receptor related protein 5 (LRP5), resulting in the attenuation of canonical Wnt signaling (Li et al., 2005). Sost inhibited mineralization in human primary osteoblasts (Atkins et al., 2011). Another work reported that sclerostin inhibited bone morphogenetic protein activity (Kusu et al., 2003). Correspondingly, the injection of sclerostin antibody facilitated bone healing in murine femoral bone defects as well as murine distraction osteogenesis defects (Jawad et al., 2013; Makhdom, Rauch, Lauzier, & Hamdy, 2014). These evidences demonstrated the inhibition function of sclerostin on osteogenic differentiation as well as bone formation. It was shown that Sost could be regulated by mechanical force in various cell types. However, different force types resulted in different regulation of Sost expression. The present study demonstrated that the intermittent compressive force inhibited Sost expression in MC3T3-E1 cells. Correspondingly, previous work reported that vibration reduced sclerostin expression in MC3T3-E1 cells (Hou, Zhu, Zhou, Zhang, & Yu, 2011). Oscillatory fluid flow force decreased Sost expression in UMR 106.1 cell line (Papanicolaou, Phipps, Fyhrie, & Genetos, 2009). Further, a fluid shear stress reduced Sost mRNA expression in a mouse osteocyte cell line, however, a microgravity culture resulted in the significant increase of Sost expression (Spatz et al., 2015). On the contrary, the intermittent compressive stress promoted SOST expression in hPDLs (Manokawinchoke et al., 2017). We hypothesize that the intermittent compressive stress differentially regulates Sost expression in periodontal ligament fibroblasts and osteoblasts due to the nature of tissue homeostasis. Periodontal ligament normally exposes to mechanical force from mastication and other functions. The mechanical force-induced SOST expression could inhibit bone formation, thus preventing calcification in the ligament tissues as well as maintaining periodontal ligament space. On the contrary, 51
Archives of Oral Biology 82 (2017) 47–54
J. Manokawinchoke et al.
Fig. 5. Activation of Notch signaling inhibited osteogenic differentiation in MC3T3-E1. Cells were seeded on indirect immobilized Jagged1 and maintained in osteoinductive medium for 3 days. The mRNA expression of osteogenic differentiation markers was examined using real-time polymerase chain reaction (A–F). Mineral deposition was evaluated using alizarin red s staining (G) and the absorbance of de-stained solution was demonstrated (H). Bars indicated the statistically significant difference (p < 0.05).
teeth, human adipose stem cells, and human bone marrow mesenchymal stem cells (Dishowitz et al., 2014; Lough et al., 2016; Osathanon, Nowwarote et al., 2013; Osathanon, Ritprajak et al., 2013; Zhu, Sweetwyne, & Hankenson, 2013). Interestingly, previous report illustrated the different influence of Jagged1 on osteogenic differentiation in human and mouse cells. In this respect, Jagged1 immobilization promoted osteogenic differentiation in human mesenchymal stem cells but inhibit this process in mouse bone marrow mesenchymal stem cells (Zhu et al., 2013). Thus, the influence of intermittent compressive stress induced Notch signaling in the present study is required further investigation. The present study investigated the different cell response after Notch signaling activation under loaded and unloaded condition. Results demonstrated distinct regulation of Sost and Runx2 mRNA expression by Notch signaling under loaded and unloaded conditions. Although, the results were contradicted between the loaded and unloaded condition. It should be noted that various genes were regulated by mechanical force. It is hypothesized that there are other cross-talk
Notch intracellular domain (NICD) overexpressing ST2 stromal cells exhibited the decrease of Alp and Ocn expression (Deregowski, Gazzerro, Priest, Rydziel, & Canalis, 2006). Further, bone morphogenetic protein-2 (Bmp-2) induced osteogenic marker gene expression was attenuated in the present of Hey1 in primary murine calvarial cells (Minamizato et al., 2007). Together, these evidences may imply the negative effect of Notch signaling in osteogenic differentiation of MC3T3-E1 cells. However, it was demonstrated that Jagged1 or Dll1 treatment did not markedly influence osteogenic differentiation in MC3T3-E1 cells but these treatments promoted Bmp-2 induced osteogenic marker expression (Nobta et al., 2005). In human cells, the conflict evidences of the potential influence of Notch signaling in osteogenic differentiation were reported. NICD or Jagged1 overexpression in human dental pulp stem cells inhibited odonto/osteogenic differentiation (C. Zhang, Chang, Sonoyama, Shi, & Wang, 2008). On the contrary, Jagged1 immobilization was shown to enhance osteogenic differentiation in various human cell types, for example human periodontal ligament stem cells, stem cells isolated from human exfoliated deciduous 52
Archives of Oral Biology 82 (2017) 47–54
J. Manokawinchoke et al.
Fig. 6. Notch signaling activation differentially regulated gene expression under intermittent compressive stress and unloaded condition. MC3T3-E1 cells were seeded on Jagged-1 immobilized surface for 24 h and subsequently subjected to intermittent compressive stress in serum-free culture condition for 24 h. Cells maintained under unloaded condition were used as the control. The mRNA expression was evaluated using real-time polymerase chain reaction. Bars indicated the statistically significant difference (p < 0.05). Asterisk (∗) indicated the extreme data point. Ban, Y., Wu, Y. Y., Yu, T., Geng, N., Wang, Y. Y., Liu, X. G., & Gong, P. (2011). Response of osteoblasts to low fluid shear stress is time dependent. Tissue and Cell, 43(5), 311–317. Basso, N., & Heersche, J. N. (2002). Characteristics of in vitro osteoblastic cell loading models. Bone, 30(2), 347–351. Canalis, E., Bridgewater, D., Schilling, L., & Zanotti, S. (2016). Canonical Notch activation in osteocytes causes osteopetrosis. American Journal of Physiology Endocrinology and Metabolism, 310(2), E171–182. Cardwell, R. D., Kluge, J. A., Thayer, P. S., Guelcher, S. A., Dahlgren, L. A., Kaplan, D. L., & Goldstein, A. S. (2015). Static and cyclic mechanical loading of mesenchymal stem cells on elastomeric, electrospun polyurethane meshes. Journal of Biomechanical Engineering, 137(7). Deregowski, V., Gazzerro, E., Priest, L., Rydziel, S., & Canalis, E. (2006). Role of the RAM domain and ankyrin repeats on notch signaling and activity in cells of osteoblastic lineage. Journal of Bone and Mineral Research, 21(8), 1317–1326. Dishowitz, M. I., Zhu, F., Sundararaghavan, H. G., Ifkovits, J. L., Burdick, J. A., & Hankenson, K. D. (2014). Jagged1 immobilization to an osteoconductive polymer activates the Notch signaling pathway and induces osteogenesis. Journal of Biomedical Materials Research Part A, 102(5), 1558–1567. Hou, W. W., Zhu, Z. L., Zhou, Y., Zhang, C. X., & Yu, H. Y. (2011). Involvement of Wnt activation in the micromechanical vibration-enhanced osteogenic response of osteoblasts. Journal of Orthopaedic Science, 16(5), 598–605. Jawad, M. U., Fritton, K. E., Ma, T., Ren, P. G., Goodman, S. B., Ke, H. Z., ... Genovese, M. C. (2013). Effects of sclerostin antibody on healing of a non-critical size femoral bone defect. Journal of Orthopaedic Research, 31(1), 155–163. Jiang, Y., Wang, Y., & Tang, G. (2016). Cyclic tensile strain promotes the osteogenic differentiation of a bone marrow stromal cell and vascular endothelial cell co-culture system. Archives of Biochemistry and Biophysics, 607, 37–43. Kusu, N., Laurikkala, J., Imanishi, M., Usui, H., Konishi, M., Miyake, A., ... Itoh, N. (2003). Sclerostin is a novel secreted osteoclast-derived bone morphogenetic protein antagonist with unique ligand specificity? Journal of Biological Chemistry, 278(26), 24113–24117. Li, X., Zhang, Y., Kang, H., Liu, W., Liu, P., Zhang, J., ... Wu, D. (2005). Sclerostin binds to LRP5/6 and antagonizes canonical Wnt signaling. Journal of Biological Chemistry, 280(20), 19883–19887. Lough, D. M., Chambers, C., Germann, G., Bueno, R., Reichensperger, J., Swanson, E., ... Neumeister, M. W. (2016). Regulation of ADSC osteoinductive potential using notch pathway inhibition and gene rescue: A potential on/off switch for clinical applications in bone formation and reconstructive efforts. Plastic and Reconstructive Surgery, 138(4), 642e–652e. Makhdom, A. M., Rauch, F., Lauzier, D., & Hamdy, R. C. (2014). The effect of systemic administration of sclerostin antibody in a mouse model of distraction osteogenesis. Journal of Musculoskeletal and Neuronal Interactions, 14(1), 124–130. Manokawinchoke, J., Limjeerajarus, N., Limjeerajarus, C., Sastravaha, P., Everts, V., & Pavasant, P. (2015). Mechanical force-induced TGFB1 increases expression of SOST/ POSTN by hPDL cells. Journal of Dental Research, 94(7), 983–989. Manokawinchoke, J., Sumrejkanchanakij, P., Pavasant, P., & Osathanon, T. (2017). Notch signaling participates in TGF-beta-induced SOST expression under intermittent compressive stress. Journal of Cellular Physiology, 232(8), 2221–2230. Minamizato, T., Sakamoto, K., Liu, T., Kokubo, H., Katsube, K., Perbal, B., ... Yamaguchi, A. (2007). CCN3/NOV inhibits BMP-2-induced osteoblast differentiation by interacting with BMP and Notch signaling pathways? Biochemical and Biophysical Research Communications, 354(2), 567–573. Morrow, D., Sweeney, C., Birney, Y. A., Cummins, P. M., Walls, D., Redmond, E. M., & Cahill, P. A. (2005). Cyclic strain inhibits Notch receptor signaling in vascular smooth
signalings under loaded condition which interfere the influence of Jagged1 on Sost and Runx2 expression. Further investigation should be further performed to identified these regulatory mechanisms. 5. Conclusion The present study reported the effect of intermittent compressive stress on Notch target gene expression in murine pre-osteoblast cell line. This regulation was occurred via the regulation of Tgf-β signaling pathway. Further, the intermittent stress-induced Notch signaling was shown to control the expression of Sost. However, the role of Notch signaling on Sost expression under intermittent stress and unloaded condition was different. Further investigation is required to determine the influence of intermittent compressive stress-induced Notch signaling in the regulation in bone and periodontal tissue homeostasis. Conflict of interest Authors declare no conflict of interest Author contributions statement J.M. contributed to experimental design, data acquisition and analysis, critical manuscript revision. P.P contributed to data interpretation, critical manuscript revision. T.O. contributed to conception and experimental design, data analysis and interpretation, manuscript preparation. Acknowledgements This study was supported by the Faculty Research Fund, Faculty of Dentistry, Chulalongkorn University (DRF 60001) and in part by the Ratchadapisek Sompoch Endowment Fund (2016), Chulalongkorn University (CU-59-002-HR). PP was supported by the 2012 Research Chair Grant, Thailand National Science and Technology Development Agency (NSTDA). References Atkins, G. J., Rowe, P. S., Lim, H. P., Welldon, K. J., Ormsby, R., Wijenayaka, A. R., ... Findlay, D. M. (2011). Sclerostin is a locally acting regulator of late-osteoblast/preosteocyte differentiation and regulates mineralization through a MEPE-ASARM-dependent mechanism. Journal of Bone and Mineral Research, 26(7), 1425–1436.
53
Archives of Oral Biology 82 (2017) 47–54
J. Manokawinchoke et al.
differentiation of human periodontal ligament-derived mesenchymal stem cells. Journal of Biomedical Materials Research Part A, 101(2), 358–367. Papanicolaou, S. E., Phipps, R. J., Fyhrie, D. P., & Genetos, D. C. (2009). Modulation of sclerostin expression by mechanical loading and bone morphogenetic proteins in osteogenic cells. Biorheology, 46(5), 389–399. Pumklin, J., Manokawinchoke, J., Bhalang, K., & Pavasant, P. (2015). Intermittent compressive stress enhanced insulin-like growth factor-1 expression in human periodontal ligament cells. International Journal of Cell Biology, 2015, 369874. Shirazi-Fard, Y., Alwood, J. S., Schreurs, A. S., Castillo, A. B., & Globus, R. K. (2015). Mechanical loading causes site-specific anabolic effects on bone following exposure to ionizing radiation. Bone, 81, 260–269. Spatz, J. M., Wein, M. N., Gooi, J. H., Qu, Y., Garr, J. L., Liu, S., ... Pajevic, P. D. (2015). The wnt inhibitor sclerostin is up-regulated by mechanical unloading in osteocytes in vitro. Journal of Biological Chemistry, 290(27), 16744–16758. Sukarawan, W., Peetiakarawach, K., Pavasant, P., & Osathanon, T. (2016). Effect of Jagged-1 and Dll-1 on osteogenic differentiation by stem cells from human exfoliated deciduous teeth. Archives of Oral Biology, 65, 1–8. Wang, D., Wang, H., Gao, F., Wang, K., & Dong, F. (2017). ClC-3 promotes osteogenic differentiation in MC3T3-E1 cell after dynamic compression. Journal of Biological Chemistry, 118(6), 1606–1613. Zhang, C., Chang, J., Sonoyama, W., Shi, S., & Wang, C. Y. (2008). Inhibition of human dental pulp stem cell differentiation by Notch signaling. Journal of Dental Research, 87(3), 250–255. Zhang, Y., Lian, J. B., Stein, J. L., van Wijnen, A. J., & Stein, G. S. (2009). The Notchresponsive transcription factor Hes-1 attenuates osteocalcin promoter activity in osteoblastic cells. Journal of Cellular Biochemistry, 108(3), 651–659. Zhu, F., Sweetwyne, M. T., & Hankenson, K. D. (2013). PKCdelta is required for Jagged-1 induction of human mesenchymal stem cell osteogenic differentiation. Stem Cells, 31(6), 1181–1192.
muscle cells in vitro. Circulation Research, 96(5), 567–575. Morrow, D., Cullen, J. P., Cahill, P. A., & Redmond, E. M. (2007). Cyclic strain regulates the Notch/CBF-1 signaling pathway in endothelial cells: Role in angiogenic activity. Arteriosclerosis, Thrombosis, and Vascular Biology, 27(6), 1289–1296. Nakao, K., Goto, T., Gunjigake, K. K., Konoo, T., Kobayashi, S., & Yamaguchi, K. (2007). Intermittent force induces high RANKL expression in human periodontal ligament cells? Journal of Dental Research, 86(7), 623–628. Nettelhoff, L., Grimm, S., Jacobs, C., Walter, C., Pabst, A. M., Goldschmitt, J., & Wehrbein, H. (2016). Influence of mechanical compression on human periodontal ligament fibroblasts and osteoblasts. Clinical Oral Investigations, 20(3), 621–629. Ngan, P., Saito, S., Saito, M., Lanese, R., Shanfeld, J., & Davidovitch, Z. (1990). The interactive effects of mechanical stress and interleukin-1 beta on prostaglandin E and cyclic AMP production in human periodontal ligament fibroblasts in vitro: Comparison with cloned osteoblastic cells of mouse (MC3T3-E1). Archives of Oral Biology, 35(9), 717–725. Ni, J., Yuan, X. M., Yao, Q., & Peng, L. B. (2015). OSM is overexpressed in knee osteoarthritis and Notch signaling is involved in the effects of OSM on MC3T3-E1 cell proliferation and differentiation. International Journal of Molecular Medicine, 35(6), 1755–1760. Nobta, M., Tsukazaki, T., Shibata, Y., Xin, C., Moriishi, T., Sakano, S., ... Yamaguchi, A. (2005). Critical regulation of bone morphogenetic protein-induced osteoblastic differentiation by Delta1/Jagged1-activated Notch1 signaling. Journal of Biological Chemistry, 280(16), 15842–15848. Osathanon, T., Nowwarote, N., Manokawinchoke, J., & Pavasant, P. (2013). bFGF and JAGGED1 regulate alkaline phosphatase expression and mineralization in dental tissue-derived mesenchymal stem cells. Journal of Biological Chemistry, 114(11), 2551–2561. Osathanon, T., Ritprajak, P., Nowwarote, N., Manokawinchoke, J., Giachelli, C., & Pavasant, P. (2013). Surface-bound orientated Jagged-1 enhances osteogenic
54
Contents lists available at ScienceDirect
Archives of Oral Biology journal homepage: www.elsevier.com/locate/archoralbio
Intermittent compressive stress regulates Notch target gene expression via transforming growth factor-β signaling in murine pre-osteoblast cell line Jeeranan Manokawinchokea, Prasit Pavasanta, Thanaphum Osathanona,b, a b
MARK
⁎
Mineralized Tissue Research Unit and Department of Anatomy, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand Craniofacial Genetics and Stem Cell Research Group, Faculty of Dentistry, Chulalongkorn University, Bangkok 10330, Thailand
A R T I C L E I N F O
A B S T R A C T
Keywords: Intermittent stress Osteoblasts Sclerostin Notch signaling Transforming growth factor-β
Objective: Different mechanical stimuli regulate behaviors of various cell types, including osteoblasts, osteocytes, and periodontal ligament fibroblasts. Notch signaling participates in the mechanical stress-regulated cell responses. The present study investigated the regulation of Notch target gene and sclerostin (Sost) expression in murine pre-osteoblast cell line (MC3T3-E1) under intermittent compressive stress. Methods: MC3T3-E1 were subjected to the intermittent compressive force under the computerized controlled machine. In some experiments, cells were pretreated with chemical inhibitors for Notch and transforming growth factor (TGF)-β signaling prior to mechanical stimuli. To evaluate role of Notch signaling in MC3T3-E1 cells under unloaded condition, cells were seeded on indirect immobilized Notch ligand (Jagged1). Gene expression was determined using real-time quantitative polymerase chain reaction. Results: The intermittent compressive stress significantly upregulated Notch target gene expression (Hes Family BHLH transcription factor 1; Hes1 and Hairy/enhancer-of-split related with YRPW motif protein1; Hey1). The intermittent stress-induced Hes1 and Hey1 mRNA expression could be inhibited by a γ-secretase inhibitor (DAPT) or a TGF-β superfamily type I activing receptor-like kinase receptors inhibitor (SB431542). The results imply that intermittent compressive stress regulates Notch signaling via TGF-β pathway. Further, the intermittent compressive stress reduced Sost mRNA expression and this phenomenon could be rescued by a DAPT pretreatment, implying the involvement of Notch signaling. However, activation of Notch signaling under the unloaded condition resulted in the increase of Sost expression and the reduction of osteogenic marker genes. Conclusions: These results imply the involvement of Notch signaling in the homeostasis maintaining of osteogenic cells under mechanical stress stimuli.
1. Introduction Alveolar bone and periodontal ligament consistently receive a cyclic compressive force during normal mastication. Influence of mechanical force on osteoblast and periodontal ligament cell has widely been reported. Various publications demonstrated that cells response differently to different force types (Basso & Heersche, 2002; Cardwell et al., 2015). In this regard, it has been shown that intermittent mechanical force treatment promoted higher receptor activator of nuclear factor kappa-B ligand (RANKL) expression in periodontal ligament cells than those treated with continuous force treatment (Nakao et al., 2007). Continuous shear stress significantly enhanced in vitro osteogenic differentiation than intermittent shear stress in rat calvarial derived osteoblasts as determined by the increase of alkaline phosphatase expression and mineralization (Ban et al., 2011). Previous studies demonstrated that intermittent compressive stress induced insulin-like
⁎
growth factor-1 (IGF-1), periostin (POSTN), transforming growth factorβ (TGF-β), and sclerostin (SOST) mRNA expression in human periodontal ligament cells (hPDLs) (Manokawinchoke et al., 2015; Pumklin, Manokawinchoke, Bhalang, & Pavasant, 2015). Nevertheless, the static continuous force and intermittent force regulated different cell responses (Manokawinchoke, Sumrejkanchanakij, Pavasant, & Osathanon, 2017). The effect of intermittent compressive stress on periodontal ligament cells and osteoblasts remains limited. Mechanical stress regulates Notch signaling and further influence cell’s behaviors. Cyclic strain increased Notch receptor expression and Notch subsequently promoted network formation by endothelial cells (Morrow, Cullen, Cahill, & Redmond, 2007). On the contrary, cyclic strain inhibited Notch receptor expression in vascular smooth muscle cells and the reduction of Notch signaling, in part, attenuated cell growth and enhanced apoptosis (Morrow et al., 2005). Notch signaling also participated in the intermittent regulated SOST expression in
Corresponding author at: Department of Anatomy, Faculty of Dentistry, Chulalongkorn University, Bangkok, 10330, Thailand. E-mail addresses: [email protected] (J. Manokawinchoke), [email protected] (P. Pavasant), [email protected] (T. Osathanon).
http://dx.doi.org/10.1016/j.archoralbio.2017.05.020 Received 17 February 2017; Received in revised form 8 May 2017; Accepted 29 May 2017 0003-9969/ © 2017 Elsevier Ltd. All rights reserved.
Archives of Oral Biology 82 (2017) 47–54
J. Manokawinchoke et al.
hPDLs (Manokawinchoke et al., 2017). In this regard, Notch signaling inhibition resulted in the reduction of intermittent stress-induced SOST expression by hPDLs (Manokawinchoke et al., 2017). Together, these evidences suggest the participation of Notch signaling in the mechanical force-regulated cell response. Although, there are some similar responses between periodontal ligament cells and osteoblasts. Several distinct regulations of mechanical stimuli on these two cell types were reported (Nettelhoff et al., 2016; Ngan et al., 1990). For example, compressive force treatment enhanced osteopontin expression in human osteoblasts but not in hPDLs (Nettelhoff et al., 2016). Thus, an investigation regarding the specific role of intermittent stress on specific aspect for these cells is indeed necessitated. The present study aimed to investigate the regulation of Notch target gene expression in murine pre-osteoblast cell line (MC3T3E1) under intermittent compressive stress in vitro.
Table 1 Primer sequences. Gene
Sequences (F; forward, R; reverse)
Reference
18s
F R F R F R F R F R F R F R F R F R
NR_003278.3
Runx2 Osx Alp Sost Hes1 Hey1 Dlx5
2. Methods Tgf-β1
2.1. Cell culture and treatment Murine osteoblastic cells, MC3T3-E1, were maintained in Minimum Essential Medium (MEM/EBSS, Hyclone, Logan, Utah, USA) containing 10% fetal bovine serum (Hyclone, Cramlington, Northumberland, UK), 100 unit/ml penicillin and 100 μg/ml streptomycin, 250 ng/ml amphotericin B, and 2 mM L-glutamine (Gibco BRL, Carlsbad, CA, USA). Cells were maintained in humidified atmosphere and 5% CO2, at 37 °C. The medium was changed every 2 days. For osteogenic induction, the growth medium was supplemented with 50 μg/ml L-ascorbic acid and 5 mM β-glycerophosphate. An intermittent compressive stress treatment was performed according to our previous published protocol (Manokawinchoke et al., 2015). Briefly, cells were seeded in 6-wells tissue culture plate at density of 37,500 cells/cm2. Serum starvation was performed for 8 h and cells were subsequently subjected to the intermittent compressive stress treatment using a computerized controlled apparatus at a force of 1.5 g/cm2 with 14 cycles per minute. For Notch signaling treatment, cells were seeded on Jagged-1 immobilized surface according to our previous publications (Osathanon, Nowwarote, Manokawinchoke, & Pavasant, 2013; Osathanon, Ritprajak et al., 2013; Sukarawan, Peetiakarawach, Pavasant, & Osathanon, 2016). Briefly, tissue culture surfaces were incubated with recombinant protein G (50 μg/mL, Invitrogen, USA), bovine serum albumin (10 mg/ ml, Invitrogen, USA), and recombinant human Jagged-1/Fc (R & D systems, USA), respectively. The surfaces were rinsed three times with sterile PBS between each step. Human IgG, Fc fragment (hFc, Jackson ImmunoResearch Laboratory, USA) was used as the control. In some experiments, cells were pre-treated with the following inhibitors for 30 min prior to treatment. The agents used in the present study were 4 μM SB431542 (a TGF-β inhibitor; Sigma-Aldrich Chemical, St. Louis, MO, USA) and 20 μM N-[N-(3,5Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT, Sigma-Aldrich Chemical). To confirm the influence of Tgf-β1, MC3T3E1 cells were treated with recombinant human Tgf-β1 at concentration of 10 ng/ml in serum-free culture condition.
5′CTTAGAGGGACAAGTGGCG3′ 5′ACGCTGAGCCAGTCAGTGTA3′ 5′CGGGCTACCTGCCATCAC3′ 5′GGCCAGAGGCAGAAGTCAGA3′ 5′CTCGTCTGACTGCCTGCCTAG3′ 5′GCGTGGATGCCTGCCTTGTA3′ 5′GCCCTCTCCAAGACATATA3′ 5′CCATGATCACGTCGATATCC3′ 5′GGAATGATGCCACAGAGGTCAT3′ 5′CCCGGTTCATGGTCTGGTT3′ 5′GCAGACATTCTGGAAATGACTGTGA3′ 5′GAGTGCGCACCTCGGTGTTA3′ 5′GCAGGAGGGAAAGGTTATTTTGA3′ 5′CGAAACCCCAAACTCCGATAG3′ 5′GCCCCTACCACCAGTACG3′ 5′TCACCATCCTCACCTCTG3′ 5′GCCCTCGGGAGCCACAAACC3′ 5′GCAGCAGGAGTCGCGGTGAG3′
NM_001145920.1 NM_130458.3 NM_007431.2 NM_024449.6 NM_008235.2 NM_010423.2 NM_010056.3 NM_011577.2
2.3. Mineralization assay Samples were fixed with cold methanol and rinsed with deionized water. Further, samples were incubated in 1% Alizarin red S solution (Sigma-Aldrich Chemical) and the excess staining was washed with deionized water. Mineral deposition was quantified by solubilizing alizarin red staining in 10% cetylpyridinium chloride monohydrate. The solution’s absorbance was examined at 570 nm.
2.4. Statistical analysis Results are demonstrated as box and whisker plots. Nonparametric statistical analysis (IBM SPSS Statistics for Mac, Version 22, Armonk, NY, USA) was employed to evaluate a statistically significant difference at the p value < 0.05.
3. Results 3.1. Intermittent compressive stress regulated Notch target gene expression via Tgf-β Cells were treated with intermittent compressive stress for 24 h. The results demonstrated that intermittent compressive stress significantly upregulated Notch target genes, Hes Family BHLH transcription factor 1 (Hes1) and Hairy/enhancer-of-split related with YRPW motif protein1 (Hey1), mRNA expression in MC3T3-E1 cells (Fig. 1A and B). When cells were pretreated with a γ-secretase inhibitor (DAPT) prior to the stimulation of intermittent compressive force. The stress-induced Hes1 and Hey1 mRNA expression was attenuated (Fig. 1C and D). Previous study reported that intermittent compressive stress upregulated TGF-β1 expression in hPDLs and this mechanism participated in the regulation of Notch signaling under intermittent compressive stress (Manokawinchoke et al., 2017). MC3T3-E1 cells were treated with intermittent compressive stress for 24 h. The significant upregulation of Tgf-β1 was observed (Fig. 2A). Inhibition of Tgf-β pathway by SB431542 attenuated the intermittent compressive stress-induced Hes1 and Hey1 mRNA expression (Fig. 2B and C). Correspondingly, the addition of exogenous rhTgf-β1 resulted in the significant increase of Hes1 and Hey1 mRNA levels at 24 h (Fig. 2D and C). Taken all evidences together, the intermittent compressive stress induced Notch target gene expression via Tgf-β signaling pathway.
2.2. Polymerase chain reaction (PCR) RNA isolation was done using RiboEx total RNA isolation solution (GeneAll, Seoul, Korea). One microgram of RNA was converted to cDNA using a reverse transcriptase kit (Promega, Madison, WI, USA). Quantitative real-time PCR was performed using FastStart® Essential DNA Green Master (Roche Applied Science, Indianapolis, IN, USA) in a Lightcycler Nano RT-PCR machine (Roche Applied Science). Expression levels were normalized to the reference gene (18S) and the control. The primer sequences are shown in Table 1. 48
Archives of Oral Biology 82 (2017) 47–54
J. Manokawinchoke et al.
Fig. 1. Intermittent compressive stress induced Notch target gene expression. Cells were treated with the intermittent stress for 24 h. Hes1 and Hey1 mRNA levels were evaluated using real-time polymerase chain reaction (A and B). In some conditions, cells were pretreated with a γ-secretase inhibitor (DAPT) for 30 min prior to mechanical stimuli (C and D). Bars indicated the statistically significant difference (p < 0.05). Black dots (•) represented the outlying data points. Asterisk (∗) indicated the extreme data point.
Fig. 2. TGF-β involved in the intermittent stress-induced Notch target gene expression. Cells were treated with the intermittent stress for 24 h (A). Cells were pretreated with a TGF-β signaling inhibitor (SB431542) for 30 min prior to mechanical stimuli (B and C). Cells were treated with exogeneous rhTGF-β1 under unloaded condition for 24 h (D and E). The mRNA expression was evaluated using real-time polymerase chain reaction. Bars indicated the statistically significant difference (p < 0.05). Black dots (•) represented the outlying data points. Asterisk (∗) indicated the extreme data point.
49
Archives of Oral Biology 82 (2017) 47–54
J. Manokawinchoke et al.
Fig. 3. Intermittent compressive stress induced Sost mRNA expression. Cells were treated with the intermittent stress for 24 h (A). In some conditions, cells were pretreated with a γ-secretase inhibitor (DAPT) or a TGF-β signaling inhibitor (SB431542) for 30 min prior to mechanical stimuli, respectively (B and C). Cells were treated with exogeneous rhTGF-β1 under unloaded condition for 24 h (D). Bars indicated the statistically significant difference (p < 0.05).
day 3 (Fig. 5A and B). The significant reduction of Alp, Runx2, and Osx mRNA levels were observed in Jagged1 treated condition (Fig. 5C–E). No change was noted for Dlx5 mRNA expression (Fig. 5F). At day 12, the mineral deposition was evaluated using alizarin red s staining. The results demonstrated that Jagged1 did not influence mineral deposition in MC3T3-E1 cells (Fig. 5G and H).
3.2. Notch signaling participated in the intermittent compressive stressregulated Sost expression Previous work demonstrated that the intermittent compressive stress promoted SOST expression in hPDLs (Manokawinchoke et al., 2017). In the present study, the influence of intermittent compressive stress-regulated Sost expression in MC3T3-E1 was investigated. Interestingly, the results demonstrated that intermittent stress significantly inhibited Sost expression (Fig. 3A). DAPT pretreatment rescued the intermittent stress-attenuated Sost expression (Fig. 3B). However, SB431542 pretreatment slightly attenuated intermittent stress-suppressed Sost expression. However, there is no statistically significant difference (Fig. 3C). However, the exogenous rhTgf-β1 inhibited Sost mRNA expression in unloaded condition (Fig. 3D). These results indicate that the intermittent compressive stress regulated Sost via Notch signaling pathway.
3.4. Notch signaling activation differentially regulated gene expression in MC3T3-E1 cells under intermittent compressive stress and unloaded condition To compare the differential regulation of Notch signaling activation between loaded and unloaded condition, cells were seeded on Jagged-1 immobilized surface for 24 h and subsequently subjected to intermittent compressive stress in serum-free culture condition for 24 h. Cells maintained under unloaded condition were used as the control. The results demonstrated that Jagged-1 induced Sost expression under unloaded condition. However, the stimulation of Notch signaling under loaded condition resulted in the attenuation of Jagged1 induced Sost mRNA expression (Fig. 6A). For osteogenic marker gene expression, Jagged-1 significantly reduced Runx2 mRNA levels in unloaded condition, while there is no significant difference in intermittent compressive force loaded condition (Fig. 6B).
3.3. Notch signaling activation in unloaded condition increased Sost expression but reduced osteogenic marker gene expression MC3T3-E1 cells were seeded on Jagged1 immobilized surface to activate intracellular Notch signaling pathway. Cells were maintained in normal growth medium for 3 days. Notch activation significantly enhanced Hes1 and Hey1 mRNA expression (Fig. 4A and B). However, the reduced osteogenic marker gene expression was observed. In this regard, runt-related transcriptional factor 2 (Runx2), osterix (Osx), and distal-less homeobox 5 (Dlx5) mRNA levels were attenuated in those cells treated with Jagged1 (Fig. 4C–E). Though, no change in alkaline phosphatase (Alp) mRNA levels was observed (Fig. 4F). Interestingly, Jagged1 promoted Sost expression by MC3T3-E1 cells (Fig. 4G). In osteogenic medium, similar trend was observed. Hes1 and Hey1 mRNA levels were significantly increased in Jagged1 treated cells at
4. Discussion Influences of mechanical stimuli on Notch signaling regulation depended on various factors, including cell types, force types, force magnitude, and duration of force application (Manokawinchoke et al., 2017; Morrow et al., 2005, 2007). In this respect, cyclic strain enhanced and inhibited Notch receptor expression in endothelial cells and vascular smooth muscle cells, respectively (Morrow et al., 2005, 2007). In 50
Archives of Oral Biology 82 (2017) 47–54
J. Manokawinchoke et al.
Fig. 4. Activation of Notch signaling inhibited osteogenic marker gene expression but increased Sost mRNA expression. Cells were seeded on indirect immobilized Jagged1 and maintained in growth medium for 3 days. The mRNA expression of osteogenic differentiation markers and Sost was examined using real-time polymerase chain reaction (A–G). Bars indicated the statistically significant difference (p < 0.05). Black dots (•) represented the outlying data points.
mechanical stimuli is known to promote osteoblast differentiation and bone formation (Jiang, Wang, & Tang, 2016; Shirazi-Fard, Alwood, Schreurs, Castillo, & Globus, 2015; Wang, Wang, Gao, Wang, & Dong, 2017). Therefore, the reduction of Sost expression in osteoblast after stimulated by mechanical force may participate in anabolic effects of mechanical stimuli on bone formation. Regulation of SOST by Notch signaling was previously reported. In this regard, Notch signaling regulated SOST expression in intermittent stress-treated hPDLs (Manokawinchoke et al., 2017). Further, the study in transgenic mice demonstrated that Notch activation in osteocytes lead to the inhibition of Sost expression, subsequently affects the suppression of bone resorption and the increase of bone volume (Canalis, Bridgewater, Schilling, & Zanotti, 2016). In the present study, we demonstrated that Notch signaling regulating Sost expression might be a context dependent. In this regard, Notch signaling participated in intermittent mechanical stress-attenuated Sost mRNA expression. On the other hands, Notch signaling activation under unloaded condition resulted in the increase of Sost mRNA levels. Sost upregulation after Notch activation concurred with the reduction of osteogenic markers. These results imply that Notch signaling impairs osteogenic differentiation of MC3T3-E1 cells under unloaded condition. The present study illustrated that an activation of Notch signaling in MC3T3-E1 cells using immobilized Jagged1 led to the attenuation of osteogenic marker gene expression but did not markedly influence mineralization. Firstly, it should be noted that the present study employed human Jagged1 to activate Notch signaling in murine pre-osteoblast cell line. However, Notch is a high conserved signaling pathway. Human Jagged1 has 97% amino acid identical to mouse Jagged1. In addition, our results demonstrated the upregulation of Notch target gene (Hes1 and Hey1) mRNA expression after MC3T3-E1 cells were seeded on human Jagged1, indicating that human Jagged is able to activate intracellular Notch signaling in mouse cells. Previous report showed that Notch ligand (Delta-like 1; Dll1) overexpressing MC3T3-E1 cells abolished the effect of oncostatin M-induced osteogenic differentiation (Ni, Yuan, Yao, & Peng, 2015). Correspondingly, Notch target gene, Hes1 was shown as a negative regulator of osteogenic differentiation in MC3T3-E1 cells. In this regard, Hes1 mRNA expression was decreased during the osteogenic induction and Hes1 overexpression resulted in the decrease of osteocalcin (Ocn) mRNA levels in MC3T3-E1 cells (Y. Zhang, Lian, Stein, van Wijnen, & Stein, 2009).
addition, the static continuous compressive force exhibited less potency to upregulate Notch target gene expression in hPDLs (Manokawinchoke et al., 2017). The present study demonstrated the regulation of Notch target gene expression by intermittent compressive force via Tgf-β signaling pathway. Similarly, the study in hPDLs demonstrated that the intermittent stress upregulated the mRNA expression of Notch target genes and receptors (Manokawinchoke et al., 2017). Pretreatment with SB431542 abolished intermittent stress-induced Notch expression (Manokawinchoke et al., 2017). These evidences indicate the involvement of TGF-β signaling in intermittent stress-induced Notch signaling. Sclerostin is an antagonist of Wnt signaling pathway by binding to LDL receptor related protein 5 (LRP5), resulting in the attenuation of canonical Wnt signaling (Li et al., 2005). Sost inhibited mineralization in human primary osteoblasts (Atkins et al., 2011). Another work reported that sclerostin inhibited bone morphogenetic protein activity (Kusu et al., 2003). Correspondingly, the injection of sclerostin antibody facilitated bone healing in murine femoral bone defects as well as murine distraction osteogenesis defects (Jawad et al., 2013; Makhdom, Rauch, Lauzier, & Hamdy, 2014). These evidences demonstrated the inhibition function of sclerostin on osteogenic differentiation as well as bone formation. It was shown that Sost could be regulated by mechanical force in various cell types. However, different force types resulted in different regulation of Sost expression. The present study demonstrated that the intermittent compressive force inhibited Sost expression in MC3T3-E1 cells. Correspondingly, previous work reported that vibration reduced sclerostin expression in MC3T3-E1 cells (Hou, Zhu, Zhou, Zhang, & Yu, 2011). Oscillatory fluid flow force decreased Sost expression in UMR 106.1 cell line (Papanicolaou, Phipps, Fyhrie, & Genetos, 2009). Further, a fluid shear stress reduced Sost mRNA expression in a mouse osteocyte cell line, however, a microgravity culture resulted in the significant increase of Sost expression (Spatz et al., 2015). On the contrary, the intermittent compressive stress promoted SOST expression in hPDLs (Manokawinchoke et al., 2017). We hypothesize that the intermittent compressive stress differentially regulates Sost expression in periodontal ligament fibroblasts and osteoblasts due to the nature of tissue homeostasis. Periodontal ligament normally exposes to mechanical force from mastication and other functions. The mechanical force-induced SOST expression could inhibit bone formation, thus preventing calcification in the ligament tissues as well as maintaining periodontal ligament space. On the contrary, 51
Archives of Oral Biology 82 (2017) 47–54
J. Manokawinchoke et al.
Fig. 5. Activation of Notch signaling inhibited osteogenic differentiation in MC3T3-E1. Cells were seeded on indirect immobilized Jagged1 and maintained in osteoinductive medium for 3 days. The mRNA expression of osteogenic differentiation markers was examined using real-time polymerase chain reaction (A–F). Mineral deposition was evaluated using alizarin red s staining (G) and the absorbance of de-stained solution was demonstrated (H). Bars indicated the statistically significant difference (p < 0.05).
teeth, human adipose stem cells, and human bone marrow mesenchymal stem cells (Dishowitz et al., 2014; Lough et al., 2016; Osathanon, Nowwarote et al., 2013; Osathanon, Ritprajak et al., 2013; Zhu, Sweetwyne, & Hankenson, 2013). Interestingly, previous report illustrated the different influence of Jagged1 on osteogenic differentiation in human and mouse cells. In this respect, Jagged1 immobilization promoted osteogenic differentiation in human mesenchymal stem cells but inhibit this process in mouse bone marrow mesenchymal stem cells (Zhu et al., 2013). Thus, the influence of intermittent compressive stress induced Notch signaling in the present study is required further investigation. The present study investigated the different cell response after Notch signaling activation under loaded and unloaded condition. Results demonstrated distinct regulation of Sost and Runx2 mRNA expression by Notch signaling under loaded and unloaded conditions. Although, the results were contradicted between the loaded and unloaded condition. It should be noted that various genes were regulated by mechanical force. It is hypothesized that there are other cross-talk
Notch intracellular domain (NICD) overexpressing ST2 stromal cells exhibited the decrease of Alp and Ocn expression (Deregowski, Gazzerro, Priest, Rydziel, & Canalis, 2006). Further, bone morphogenetic protein-2 (Bmp-2) induced osteogenic marker gene expression was attenuated in the present of Hey1 in primary murine calvarial cells (Minamizato et al., 2007). Together, these evidences may imply the negative effect of Notch signaling in osteogenic differentiation of MC3T3-E1 cells. However, it was demonstrated that Jagged1 or Dll1 treatment did not markedly influence osteogenic differentiation in MC3T3-E1 cells but these treatments promoted Bmp-2 induced osteogenic marker expression (Nobta et al., 2005). In human cells, the conflict evidences of the potential influence of Notch signaling in osteogenic differentiation were reported. NICD or Jagged1 overexpression in human dental pulp stem cells inhibited odonto/osteogenic differentiation (C. Zhang, Chang, Sonoyama, Shi, & Wang, 2008). On the contrary, Jagged1 immobilization was shown to enhance osteogenic differentiation in various human cell types, for example human periodontal ligament stem cells, stem cells isolated from human exfoliated deciduous 52
Archives of Oral Biology 82 (2017) 47–54
J. Manokawinchoke et al.
Fig. 6. Notch signaling activation differentially regulated gene expression under intermittent compressive stress and unloaded condition. MC3T3-E1 cells were seeded on Jagged-1 immobilized surface for 24 h and subsequently subjected to intermittent compressive stress in serum-free culture condition for 24 h. Cells maintained under unloaded condition were used as the control. The mRNA expression was evaluated using real-time polymerase chain reaction. Bars indicated the statistically significant difference (p < 0.05). Asterisk (∗) indicated the extreme data point. Ban, Y., Wu, Y. Y., Yu, T., Geng, N., Wang, Y. Y., Liu, X. G., & Gong, P. (2011). Response of osteoblasts to low fluid shear stress is time dependent. Tissue and Cell, 43(5), 311–317. Basso, N., & Heersche, J. N. (2002). Characteristics of in vitro osteoblastic cell loading models. Bone, 30(2), 347–351. Canalis, E., Bridgewater, D., Schilling, L., & Zanotti, S. (2016). Canonical Notch activation in osteocytes causes osteopetrosis. American Journal of Physiology Endocrinology and Metabolism, 310(2), E171–182. Cardwell, R. D., Kluge, J. A., Thayer, P. S., Guelcher, S. A., Dahlgren, L. A., Kaplan, D. L., & Goldstein, A. S. (2015). Static and cyclic mechanical loading of mesenchymal stem cells on elastomeric, electrospun polyurethane meshes. Journal of Biomechanical Engineering, 137(7). Deregowski, V., Gazzerro, E., Priest, L., Rydziel, S., & Canalis, E. (2006). Role of the RAM domain and ankyrin repeats on notch signaling and activity in cells of osteoblastic lineage. Journal of Bone and Mineral Research, 21(8), 1317–1326. Dishowitz, M. I., Zhu, F., Sundararaghavan, H. G., Ifkovits, J. L., Burdick, J. A., & Hankenson, K. D. (2014). Jagged1 immobilization to an osteoconductive polymer activates the Notch signaling pathway and induces osteogenesis. Journal of Biomedical Materials Research Part A, 102(5), 1558–1567. Hou, W. W., Zhu, Z. L., Zhou, Y., Zhang, C. X., & Yu, H. Y. (2011). Involvement of Wnt activation in the micromechanical vibration-enhanced osteogenic response of osteoblasts. Journal of Orthopaedic Science, 16(5), 598–605. Jawad, M. U., Fritton, K. E., Ma, T., Ren, P. G., Goodman, S. B., Ke, H. Z., ... Genovese, M. C. (2013). Effects of sclerostin antibody on healing of a non-critical size femoral bone defect. Journal of Orthopaedic Research, 31(1), 155–163. Jiang, Y., Wang, Y., & Tang, G. (2016). Cyclic tensile strain promotes the osteogenic differentiation of a bone marrow stromal cell and vascular endothelial cell co-culture system. Archives of Biochemistry and Biophysics, 607, 37–43. Kusu, N., Laurikkala, J., Imanishi, M., Usui, H., Konishi, M., Miyake, A., ... Itoh, N. (2003). Sclerostin is a novel secreted osteoclast-derived bone morphogenetic protein antagonist with unique ligand specificity? Journal of Biological Chemistry, 278(26), 24113–24117. Li, X., Zhang, Y., Kang, H., Liu, W., Liu, P., Zhang, J., ... Wu, D. (2005). Sclerostin binds to LRP5/6 and antagonizes canonical Wnt signaling. Journal of Biological Chemistry, 280(20), 19883–19887. Lough, D. M., Chambers, C., Germann, G., Bueno, R., Reichensperger, J., Swanson, E., ... Neumeister, M. W. (2016). Regulation of ADSC osteoinductive potential using notch pathway inhibition and gene rescue: A potential on/off switch for clinical applications in bone formation and reconstructive efforts. Plastic and Reconstructive Surgery, 138(4), 642e–652e. Makhdom, A. M., Rauch, F., Lauzier, D., & Hamdy, R. C. (2014). The effect of systemic administration of sclerostin antibody in a mouse model of distraction osteogenesis. Journal of Musculoskeletal and Neuronal Interactions, 14(1), 124–130. Manokawinchoke, J., Limjeerajarus, N., Limjeerajarus, C., Sastravaha, P., Everts, V., & Pavasant, P. (2015). Mechanical force-induced TGFB1 increases expression of SOST/ POSTN by hPDL cells. Journal of Dental Research, 94(7), 983–989. Manokawinchoke, J., Sumrejkanchanakij, P., Pavasant, P., & Osathanon, T. (2017). Notch signaling participates in TGF-beta-induced SOST expression under intermittent compressive stress. Journal of Cellular Physiology, 232(8), 2221–2230. Minamizato, T., Sakamoto, K., Liu, T., Kokubo, H., Katsube, K., Perbal, B., ... Yamaguchi, A. (2007). CCN3/NOV inhibits BMP-2-induced osteoblast differentiation by interacting with BMP and Notch signaling pathways? Biochemical and Biophysical Research Communications, 354(2), 567–573. Morrow, D., Sweeney, C., Birney, Y. A., Cummins, P. M., Walls, D., Redmond, E. M., & Cahill, P. A. (2005). Cyclic strain inhibits Notch receptor signaling in vascular smooth
signalings under loaded condition which interfere the influence of Jagged1 on Sost and Runx2 expression. Further investigation should be further performed to identified these regulatory mechanisms. 5. Conclusion The present study reported the effect of intermittent compressive stress on Notch target gene expression in murine pre-osteoblast cell line. This regulation was occurred via the regulation of Tgf-β signaling pathway. Further, the intermittent stress-induced Notch signaling was shown to control the expression of Sost. However, the role of Notch signaling on Sost expression under intermittent stress and unloaded condition was different. Further investigation is required to determine the influence of intermittent compressive stress-induced Notch signaling in the regulation in bone and periodontal tissue homeostasis. Conflict of interest Authors declare no conflict of interest Author contributions statement J.M. contributed to experimental design, data acquisition and analysis, critical manuscript revision. P.P contributed to data interpretation, critical manuscript revision. T.O. contributed to conception and experimental design, data analysis and interpretation, manuscript preparation. Acknowledgements This study was supported by the Faculty Research Fund, Faculty of Dentistry, Chulalongkorn University (DRF 60001) and in part by the Ratchadapisek Sompoch Endowment Fund (2016), Chulalongkorn University (CU-59-002-HR). PP was supported by the 2012 Research Chair Grant, Thailand National Science and Technology Development Agency (NSTDA). References Atkins, G. J., Rowe, P. S., Lim, H. P., Welldon, K. J., Ormsby, R., Wijenayaka, A. R., ... Findlay, D. M. (2011). Sclerostin is a locally acting regulator of late-osteoblast/preosteocyte differentiation and regulates mineralization through a MEPE-ASARM-dependent mechanism. Journal of Bone and Mineral Research, 26(7), 1425–1436.
53
Archives of Oral Biology 82 (2017) 47–54
J. Manokawinchoke et al.
differentiation of human periodontal ligament-derived mesenchymal stem cells. Journal of Biomedical Materials Research Part A, 101(2), 358–367. Papanicolaou, S. E., Phipps, R. J., Fyhrie, D. P., & Genetos, D. C. (2009). Modulation of sclerostin expression by mechanical loading and bone morphogenetic proteins in osteogenic cells. Biorheology, 46(5), 389–399. Pumklin, J., Manokawinchoke, J., Bhalang, K., & Pavasant, P. (2015). Intermittent compressive stress enhanced insulin-like growth factor-1 expression in human periodontal ligament cells. International Journal of Cell Biology, 2015, 369874. Shirazi-Fard, Y., Alwood, J. S., Schreurs, A. S., Castillo, A. B., & Globus, R. K. (2015). Mechanical loading causes site-specific anabolic effects on bone following exposure to ionizing radiation. Bone, 81, 260–269. Spatz, J. M., Wein, M. N., Gooi, J. H., Qu, Y., Garr, J. L., Liu, S., ... Pajevic, P. D. (2015). The wnt inhibitor sclerostin is up-regulated by mechanical unloading in osteocytes in vitro. Journal of Biological Chemistry, 290(27), 16744–16758. Sukarawan, W., Peetiakarawach, K., Pavasant, P., & Osathanon, T. (2016). Effect of Jagged-1 and Dll-1 on osteogenic differentiation by stem cells from human exfoliated deciduous teeth. Archives of Oral Biology, 65, 1–8. Wang, D., Wang, H., Gao, F., Wang, K., & Dong, F. (2017). ClC-3 promotes osteogenic differentiation in MC3T3-E1 cell after dynamic compression. Journal of Biological Chemistry, 118(6), 1606–1613. Zhang, C., Chang, J., Sonoyama, W., Shi, S., & Wang, C. Y. (2008). Inhibition of human dental pulp stem cell differentiation by Notch signaling. Journal of Dental Research, 87(3), 250–255. Zhang, Y., Lian, J. B., Stein, J. L., van Wijnen, A. J., & Stein, G. S. (2009). The Notchresponsive transcription factor Hes-1 attenuates osteocalcin promoter activity in osteoblastic cells. Journal of Cellular Biochemistry, 108(3), 651–659. Zhu, F., Sweetwyne, M. T., & Hankenson, K. D. (2013). PKCdelta is required for Jagged-1 induction of human mesenchymal stem cell osteogenic differentiation. Stem Cells, 31(6), 1181–1192.
muscle cells in vitro. Circulation Research, 96(5), 567–575. Morrow, D., Cullen, J. P., Cahill, P. A., & Redmond, E. M. (2007). Cyclic strain regulates the Notch/CBF-1 signaling pathway in endothelial cells: Role in angiogenic activity. Arteriosclerosis, Thrombosis, and Vascular Biology, 27(6), 1289–1296. Nakao, K., Goto, T., Gunjigake, K. K., Konoo, T., Kobayashi, S., & Yamaguchi, K. (2007). Intermittent force induces high RANKL expression in human periodontal ligament cells? Journal of Dental Research, 86(7), 623–628. Nettelhoff, L., Grimm, S., Jacobs, C., Walter, C., Pabst, A. M., Goldschmitt, J., & Wehrbein, H. (2016). Influence of mechanical compression on human periodontal ligament fibroblasts and osteoblasts. Clinical Oral Investigations, 20(3), 621–629. Ngan, P., Saito, S., Saito, M., Lanese, R., Shanfeld, J., & Davidovitch, Z. (1990). The interactive effects of mechanical stress and interleukin-1 beta on prostaglandin E and cyclic AMP production in human periodontal ligament fibroblasts in vitro: Comparison with cloned osteoblastic cells of mouse (MC3T3-E1). Archives of Oral Biology, 35(9), 717–725. Ni, J., Yuan, X. M., Yao, Q., & Peng, L. B. (2015). OSM is overexpressed in knee osteoarthritis and Notch signaling is involved in the effects of OSM on MC3T3-E1 cell proliferation and differentiation. International Journal of Molecular Medicine, 35(6), 1755–1760. Nobta, M., Tsukazaki, T., Shibata, Y., Xin, C., Moriishi, T., Sakano, S., ... Yamaguchi, A. (2005). Critical regulation of bone morphogenetic protein-induced osteoblastic differentiation by Delta1/Jagged1-activated Notch1 signaling. Journal of Biological Chemistry, 280(16), 15842–15848. Osathanon, T., Nowwarote, N., Manokawinchoke, J., & Pavasant, P. (2013). bFGF and JAGGED1 regulate alkaline phosphatase expression and mineralization in dental tissue-derived mesenchymal stem cells. Journal of Biological Chemistry, 114(11), 2551–2561. Osathanon, T., Ritprajak, P., Nowwarote, N., Manokawinchoke, J., Giachelli, C., & Pavasant, P. (2013). Surface-bound orientated Jagged-1 enhances osteogenic
54