Interspersed repetitive sequence polymerase chain reaction (IRS PCR) for generation of human DNA fragments from complex sources

METHODS: A Companion to Methods in Enzymology Vol. 2, No. 1, February, pp. 60-74, 1991

Interspersed Repetitive Sequence Polymerase Chain Reaction (IRS PCR) for Generation of Human DNA Fragments from Complex Sources David L. Nelson Institute for Molecular Genetics, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030

Methods for the production and use of human DNA fragments using the polymerase chain reaction and oligonucleotide primers directed to repetitive sequences are described. Primers using the human Alu and LIHs repeat elements, including a number of different Alu primers, are delineated and compared. Interpretation of patterns of amplification in somatic cell hybrids by ethidium bromide staining and hybridization analysis is discussed, with particular attention to use of repeat-containing DNA fragments as hybridization probes. The method can also be applied to DNAs cloned into Escherichia coil and yeast vector systems, and primer sequences from yeast artificial chromosome, ~,, and cosmid vectors useful for these experiments are provided.

complex mixture of DNA (such as t h a t present in somatic cell hybrids or cloned fragments in microbial vectors). In this article, I describe the use of human-specific repeat sequence primers for the amplification of h u m a n D N A from both somatic :cell hybrid and cloned sources. T h e generation of amplified products from these sources allows not only the isolation of fragments present in the original mixed DNA but also the characterization of t h a t mixture for a m o u n t and variety. This aspect of IRS P C R allows "fingerprinting" of somatic cell hybrids and cloned DNAs, as well as the characterization of DNA b y in situ hybridization (5).

© 1991 Academic Press, Inc.

Repeat Sequences in Mammalian Genomes

T h e development of the polymerase chain reaction (PCR) has revolutionized the practice of molecular biology, as documented extensively in this issue and elsewhere (1). Amplification using known sequences from complex genomes allows ready access to the nucleic acids without the tedium of preparation and screening of rec o m b i n a n t libraries. This aspect of the P C R has greatly expanded our ability to sample numerous genomes for variability at the DNA sequence level (2). However, the requirement of specific oligonucleotide primers directed to known DNA sequence limits the P C R to regions previously characterized in fine detail. T h e development of oligonucleotide primers directed to repetitive sequences has allowed PCR-based amplification of DNA fragments with no prior knowledge of the region to be isolated. This is known in the s h o r t - h a n d as "Alu P C R " (3) (Alu is the most c o m m o n repetitive element found in the h u m a n genome and the sequence t h a t has received the most attention for this purpose), although the more formal term "interspersed repetitive sequence P C R " (IRS PCR) (4) has also been coined. T h e use of primers t h a t recognize repeat sequences in a species-specific m a n n e r has provided the ability to isolate fragments exclusively from one genome present in a 60

Repeated DNA sequences constitute between 25 and 30% of the h u m a n genome (6). Two elements have been used in the studies described here to generate oligonucleotide primers for P C R amplification. These are the A l u and LINE-1 families of repeats. T h e A l u repeat sequence has been extensively studied, as it alone composes ~ 1 0 % of the h u m a n genome. Approximately 900,000 copies of the A l u repeat are present in the haploid genome, with each copy slightly less t h a n 300 nucleotides in length. Thus, nearly 3 X l0 s bp of human DNA are A l u repeats, with one repeat found every 4000 bp on average. T h e sequence of the A l u repeat was originally determined by Deninger et al. in 1981 (7), and since t h e n a considerable n u m b e r have been sequenced, leading to the current consensus sequence (8) (Fig. 1). T h e repeat is a dimer of two ~ 130-bp monomers, usually separated by a poly(A) sequence, T h e second m o n o m e r in h u m a n and other primate A l u repeats contains a 31bp insertion not found in the first monomer. T h e 3' end of the A l u also demonstrates a poly(A) tract. T h e 5'-3' orientation of the repeat has been established by convention t h a t the 3' end is polyadenylated. Some copies of the A l u repeat are transcriptionally active and appear to use the RNA polymerase pol III. T h e Alu repeat is homologous to a functional RNA, the 7sl RNA (9); the genes for this RNA (or cDNAs derived from them) likely formed the 1046-2023/91 $3.00 Copyright © 1991 by Academic Press, Inc. All rights of reproduction in a n y form reserved.

IRS PCR FOR AMPLIFICATION OF HUMAN DNA

61

first Alu repeat elements. Alu-equivalent repetitive se- quence probes (21) or by FACS sorting of specific chroquences are also found in other mammalian genomes (10). mosomes and library preparation (22). While the former In the mouse genome, the B1 and B2 repeats have been method is limited to specific chromosome regions only by best characterized (11). These are single 130-bp repeats the hybrid cell lines available, it does require the prepaand are also polyadenylated. These mouse repeats occur ration of a complete library for each hybrid cell line. less frequently than the human Alu, with one found on Chromosome sorting can only provide whole chromosome libraries; however, it requires very specialized resources. average every 8-10 kb. The human LINE-1 element (L1Hs), also referred to Alu PCR allows direct access to a portion of the sequences as the Kpn or HindIII (1.8 kb) family, is repeated 10,000 present in somatic cell hybrids and is limited by the availto 100,000 times in the haploid genome in either a com- able hybrids. Also, complete coverage of the region is not plete or truncated form of a 6.4-kb sequence (12). Due to achieved; however, it should be possible to use the Alu the frequent truncation, fewer copies of the 5' end of the PCR products to identify large-insert-containing clones repeat are found, so that probes derived from the two from total human libraries in a region-specific manner. ends of a complete copy recognize a variable number of In any case, the ability to identify DNA fragments rapidly fragments in the genome (13). The L1Hs element contains from specific chromosomal regions is an important and two conserved open reading frames and is found to be necessary tool for positional cloning of disease and other transcribed (14). As with the Alu repeat, the likely mode loci. The extension of the Alu PCR method to cloned DNA of dispersal of elements is reverse transcription of RNA transcripts derived from active copies of the repeat fol- allows more rapid analysis of clones and provides ready lowed by integration into novel genomic sites (14). The access to the cloned material without the need for DNA presence of poly(A) sequences at the 3' end of L1Hs preparation or subcloning. This is seen most readily in members supports this explanation. Significant sequence the case of yeast artificial chromosomes (YAC (23)), from divergence is found between L1Hs and its equivalents in which large fragments (100-1000 kb) of human DNA can rodent genomes (65% identity between mouse and human be isolated but which are difficult to work with due to the consensus) (15); however, the general organization is complexity of the host cell (15 Mb) and the lack of efficient similar. A 208-bp region in the 3' end of the human L1Hs means to separate the cloned DNA from that of the host. is conserved among copies of the human repeat, but is Alu PCR allows human insert DNA to be isolated from not found in repeats from other species. The oligonucle- crude lysates or purified DNA from YAC-containing yeast otide used for human-specific amplification from this re- cells. With the use of primers directed to vector sequences, peat was designed to recognize sequences within these vector-adjacent fragments can be generated from a high percentage of YAC inserts (24). Once again, Alu PCR 208 bp (15). Human-specific amplification using the Alu and LINE- provides only a small fraction of the insert sequences, but 1 repeats is described here. Additional repetitive elements these fragments can serve as probes for a variety of purin mammalian genomes may also be of use in PCR-based poses, such as clone localization in somatic cell hybrids methods for amplification of specific regions or genomes. or in situ hybridization and identification of overlapping Among these are the centromere-localized satellite se- clones. While the number of Alu repeats in the human genome quences (16), the repetitive sequences specific to telomeres predicts the presence of an element roughly every 4 kb, (17), and "short tandem repeats" or microsatellites such this is high enough to have been useful in the identification as the CA dinucleotide repeats or the tri- and tetranuof human-containing h clones from recombinant libraries cleotide repeats recently described (18-20). Species specificity for such repeats may be difficult to achieve (this is derived from somatic cell hybrids. An estimated 95% of generally not an issue with DNAs cloned in Escherichia 18 kb inserts contains one or more Alu repeats (25). Taking advantage of this frequency, Alu-vector PCR in }, and coli vectors); however, their use in defining specific regions cosmid clones has also been developed. Again, the method or polymorphic variation may justify the development of provides subfragments of the insert in the recombinant strategies for their amplification. clone that can be used for a number of purposes. While methods for the isolation of insert sequences from }, and Somatic Cell Hybrids and Cloned Human DNAs cosmid clones exist in abundance, the Alu-vector PCR The original inspiration for Alu PCR was to enable method is very fast and simple and can be accomplished direct amplification and isolation of human DNA sewith very crude materials (such as scraped colonies or quences contained in somatic cell hybrids retaining spepicked plaques). This is a tremendous advantage over the cific human chromosomes in rodent cell backgrounds. purification of DNA from such clones. Prior to the development of PCR, access to human DNAs in a chromosome- or region-specific manner was achieved The Polymerase Chain Reaction and Repetitive through preparation of recombinant libraries from DNA Sequence Primers PCR is usually carried out with specific pairs of primers prepared from somatic cell hybrids followed by identification of human clones using species-specific repeat se- designed to amplify a single template from a complex

62

DAVID L. NELSON

DNA. In reactions with repeat sequence primers, one or more primers t h a t can recognize and amplify numerous different templates are used. T h e finding t h a t a single primer (from Alu, for example) could provide specific and reproducible amplification was something of a surprise, since the primer sequences at the end of each product represent an inverted repeat. This apparently has little or no effect on the reaction. T h e availability of large numbers of potential templates in Alu and other IRS P C R reactions does have some interesting consequences. Competition between templates is observed, with some products amplified to greater levels t h a n others. This effect is most obvious when a highly amplified template is removed from the reaction (e.g., when a number of somatic cell hybrids with progressively smaller fragments of a single chromosome are being used), allowing other products that were previously outcompeted and invisible to appear. Although such less competitive templates can be shown to be amplified by more sensitive methods such as hybridization, their visualization in ethidium bromide-stained gels is not possible when the highly amplified template is present. Reactions using total genomic DNA contain the highest possible n u m b e r of templates; in such reactions no product tends to dominate, and thus far, all products generated from reactions involving lower complexity substrates can be found by hybridization to amplification products from total h u m a n DNA.

Suppression of Repeat Sequence Hybridization Considerable effort has been devoted to the identification of single-copy fragments of cloned h u m a n sequences for use as hybridization probes. By their nature, Alu and other IRS P C R products contain repetitive sequences. This would severely limit their use if not for the development of effective means of blocking hybridization of repeat sequences (26, 27). T h e capacity to perform hybridization analyses with repeat-containing probes constitutes a major advance in h u m a n genetic research and has allowed IRS P C R fragments to be used as probes. This ability has made possible the methods described below for using Alu P C R fragments as probes to detect Alu P C R products. This technique provides added sensitivity to hybridization reactions through the reduced complexity of the target sequences.

has been observed with buffers prepared from the same stock solutions, each new buffer should be tested prior to use.

IOX PCR Buffer GeneAmp 10X P C R Buffer, P e r k i n - E l m e r Cetus N8010006 100 mM Tris-HC1, p H 8.4 500 mM KC1 15 mM MgC12 0.01% w/v Gelatin (optional) W h e n buffers are being prepared, the MgC12 concentration can be varied and tested for effectiveness. As others have observed (28), different primers and sets of primers appear to have different optimum magnesium concentrations. For the repetitive primers and the d N T P concentrations suggested here, concentrations of 1.2 to 1.5 mM MgC12 (final) appear to provide the best and most consistent amplifications. T h e 5X or 10X buffers are stable at 4 or - 2 0 ° C . It is best to prepare numerous aliquots to lessen the impact of contamination; however, this appears unnecessary for stability. Other P C R buffer systems (such as the DMSO-containing ammonium sulfate buffer (29)) have not performed well in these reactions under the same cycling conditions. Deoxynucleotide Triphosphates Ultrapure d N T P set, P h a r m a c i a 27-2035-01 These are conveniently prepared and packaged 100 mM stocks of the four required d N T P s , d A T P , d C T P , d G T P , and d T T P . T h e y are quite stable (several m o n t h s with repeated freeze/thaw cycles) individually or mixed and stored at - 2 0 ° C . We prepare a 1:1:1:1 stock (25 mM each d N T P ) and use it as a 100X stock in P C R for a final reaction concentration of 250 #M. Again, this concentration can be varied to find an optimum for given reactions. Generally, 250 #M works well with 1.5 mM MgC12. If the magnesium concentration is decreased, the d N T P concentration should also be reduced. Another combination t h a t has been generally useful is 1.2 mM MgC12 with 125 #M of each d N T P .

Materials Required

Enzyme AmpliTaq, P e r k i n - E l m e r Cetus N801-0060 This enzyme is supplied at 5 u/#l, and we use it according to the recommendations of the manufacturer at 0.025 u/#l. T h e enzyme is used as a 200X stock. Other preparations of Taq polymerase from P e r k i n - E l m e r Cetus or P h a r m a c i a appear to work as well as AmpliTaq in Alu PCR.

Alu P C R does not differ in any significant fashion from "single-copy" P C R in its material requirements. T h e reactions use standard P C R buffer as described by Cetus (28) and the commercially available 10× buffer from Perk i n - E l m e r Cetus is adequate. We prepare our own buffers to reduce the cost. Because some batch-to-batch variation

Oligonucleotide Primers Primers are prepared by our core DNA facility on Applied Biosystems 380B DNA synthesizers according to the directions of the manufacturer. Primers are deprotected by heat t r e a t m e n t and dried in vacuo. These are

DESCRIPTION OF THE METHOD

IRS PCR FOR AMPLIFICATION OF HUMAN DNA resuspended in sterile-filtered ddH20 and an optical density at 260 n m is determined. T h e concentration of the primer is determined by the formula [

] (,M) =

OD2~o × D × 30,000, L × 330

where D is the dilution factor and L is the length of the primer in nucleotides. This formula is based on the estimate of an OD260 representing a concentration of 30 #g/ ml, and t h a t an average nucleotide is 330 Da. P r i m e r stocks of 100 #M are prepared from this concentrated stock and both are stored at - 7 0 ° C . T h e concentrated stock is maintained for both stability and contamination considerations. T h e 100 #M stock can be thawed and refrozen m a n y times without visible effect. New oligonucleotides are tested at 1 /~M final concentration in the PCR, and adjusted for optimum amplification. Generally, repetitive sequence primers are used in the range 0.1-1 #M.

Water We use double:deionized water (Millipore Milli-Q) that has been filtered through a 0.2-#m filter. Oil Overlay Paraffin oil from Fisher has been used. Reaction Tubes GeneAmp Reaction Tubes, P e r k i n - E l m e r Cetus N8010180 We have found little variation among 0.5-ml tubes used for PCR, but have utilized the P e r k i n - E l m e r Cetus tubes the most. One anecdotal note: We have generally not autoclaved the reaction tubes prior to use, as we have found it to be unnecessary. However, on one occasion, the failure to generate P C R products by one of our researchers was traced (with some difficulty) to a batch of reaction tubes t h a t had been autoclaved. Reactions were uniformly unsuccessful in tubes from this batch, while the same DNA and reaction mixes worked well in other tubes. While unconfirmed, our presumption was t h a t a foreign substance responsible for inhibition of the P C R reactions was deposited in the tubes during the autoclaving. Thermal Cycler We have used exclusively the P e r k i n - E l m e r Cetus thermal cycler. We have noticed some variation in reaction quality between copies of this machine. This is likely due to differences in the time taken by the machine to change temperatures, because measurements of the block temperatures on different machines set to identical temperatures are within 0.5°C. Other groups at Baylor and elsewhere have reported difficulty with Alu P C R reactions in other manufacturers' thermal cyclers, and alterations to the times and t e m p e r a t u r e s have been required to re-

63

produce the results we have reported. All parameters quoted here are for the P e r k i n - E l m e r Cetus thermal cycler.

Agarose Gel Electrophoresis We use standard agarose from S e a K e m (LE) at 1.1% in T r i s - b o r a t e - E D T A buffer for most gels of Alu P C R reactions. As specified below, for some amplification products, higher percentage gels or different agarose preparations (such as NuSieve from SeaKem) are used. The most important parameters for obtaining sharp bands appear to be the gel boxes and combs used. We favor the M P H and H R H models from IBI (catalog 52000 and 54000, respectively), and 1-mm combs with 10 or 20 teeth, respectively. The wide-lane, thin combs appear to sharpen bands considerably, and this is i m p o r t a n t in analyzing the complex patterns t h a t result from Alu PCR. Gels are run at 80-100 V in the medium gel box ( M P H ) and at 100-150 V in the large box ( H R H ) for 2-5 h.

Human Placental DNA For use as hybridization probes, hybridization of repetitive sequences present on Alu P C R products must be suppressed with an excess of h u m a n DNA. A convenient source of large amounts of human DNA is placenta. While h u m a n placental DNA is available commercially (e.g., Sigma D3287), again due to cost considerations, we obtain placentas from the local hospitals for DNA extraction. It is important to begin the preparation of D N A within 1224 h of birth. Storage at 4°C is adequate for this length of time, and no preservatives should be used. Placentas can also be frozen at - 8 0 ° C and used at a later date; however, it is most convenient to remove membranes and dice the tissue prior to freezing. T h e following protocol for the preparation of placental DNA is a modified version of a protocol obtained from Ray White's group at the University of Utah: Placental DNA Purification Method

Solutions Cell lysis buffer: 0.32 M sucrose 10 mM Tris-HC1, p H 7.5 5 mM MgC12 1% T r i t o n X-100 Nuclei dropping buffer: 75 mM NaC1 24 mM EDTA, p H 8.0 TE: 10 mM Tris-HC1, p H 7.6 1 mM EDTA, p H 7.6 3 M Na acetate Redistilled, TE-equilibrated phenol Chloroform:iso-amyl alcohol (24:1) Isopropanol

64

DAVID L. NELSON

Procedure 1. Using a scalpel or razor blade, remove membranes from placentas and cut into small pieces (1 cm2). 2. Blend in a commercial blender for 1.5 min using 200 ml lysis buffer per 300 ml tissue. 3. Pour into l-liter centrifuge bottles and let stand 5 min while cell membranes are lysed. 4. Spin for 10 min at 2400 rpm at 4°C to pellet the nuclei. 5. Pour off the supernatant. Resuspend the pellets in 250 ml lysis buffer per 300 ml starting tissue. Let stand 5 min to complete lysis. 6. Spin as before (4) and pour offthe supernatant. Pellets can be frozen at this point. 7. Resuspend pellets in 180 ml nuclei dropping buffer per 300 ml starting tissue. All chunks must be broken up; blending for a few seconds can be useful. 8. Add proteinase K to a final concentration of 0.1 rag/ ml and SDS to a final concentration of 0.5%. Incubate overnight at 37°C with gentle agitation. 9. Add one-half volume of TE-equilibrated phenol and mix for 1 h at 37°C. 10. Spin at 2400 rpm for 20 min at room temperature. 11. Remove the aqueous phase with a plastic pipet. The use of house vacuum with a clean l-liter flask greatly speeds up this process. 12. Add an equal volume of chloroform; mix and then spin as before for 10 min. 13. Aspirate off the upper aqueous phase. Add 0.1 vol of 3 M sodium acetate and mix. 14. Precipitate the DNA by adding 1.5 vol of isopropanol and mixing vigorously until the DNA is fairly dehydrated. Th e DNA can be fished out with a hooked Pasteur pipet. 15. Resuspension of this DNA can take some time. Agitation and warm temperatures are both helpful. 16. To denature and reduce the DNA in length, autoclave DNA for 5 min. Solutions of 10-20 mg/ml lose most of their viscosity from this treatment, and this correlates with good activity in repeat sequence blocking. 17. Store DNA at 4°C. Yield from one average sized placenta should be 800-1000 mg.

Amplification Reactions For amplification of somatic cell hybrid DNAs, the following reaction mix is prepared: 1 teg DNA 10 tel 10X PCR buffer (10X PCR buffer: 100 mM T ri sHC1, pH 8.4, 500 mM KC1, 15 mM MgC12, 0.1% w/v gelatin) 1 tel 25 mM solution of all four dN T Ps (final concentration of 250 #M each dNTP) (25 mM solution is prepared with an equal volume of a 100 mM stock of each of dATP, dCTP, dGTP, and d T T P - - w e use Pharmacia nucleotides purchased in solution at 100 mM). 1 tel 100X primer (see concentration below)

0.5 tel AmpliTaq polymerase (Perkin-Elmer Cetus) water to 100 #l Overlay with ~ 8 0 #1 light mineral oil. The following set of reaction conditions is used for all primers: 95°C--4 min (initial denaturation) 94°C--1 min 55°C--1 min 72°C--4 min (30-35 cycles) 72°C--7 min (final extension) Sterile pipet tips are used for all manipulations. It is most convenient to prepare a mix of components to distribute to all tubes receiving the same primers. To prepare the mix, add components in the following order: water, 10X buffer, dNTPs, primer(s), enzyme. Mix well by vortexing. Distribute the mix to reaction tubes (95-100 tel per tube, depending on the concentrations of the DNA. (Variations of a few microliters in the amount of DNA added do not have an effect). Add DNA to each tube. Leaving manipulation of DNA until the last step minimizes cross-contamination. Add 80-100 tel mineral oil (be sure to change pipet tips between reaction tubes). Place tubes in the thermal cycler programmed with the above conditions.

Choice of Primers Figure I shows the consensus sequence of the Alu repeat element and the locations and sequences of a number of A l u primers described in the literature. Table 1 gives the sequences of the primers shown in Fig. I along with characteristics of each. Shown in Table 2 are primers from the human LINE-1 repeat and a variety of primers from cloning vectors. For human-specific amplification from somatic cell hybrids, we have employed the L1Hs primer (4) and a number of A l u primers. Typically, A l u primers 517, TC-65, and pDJ34 have been used. We have also used primers similar to A1 and Alu IV to generate products in a human-specific manner, but have much less experience with these sequences. Primer 278, while used extensively for cloned DNAs, is not human specific, and therefore is not used for somatic cell hybrids. Many other A l u primers have been described, and some are also demonstrated to amplify human DNA specifically (see Fig. 1 and Table 1). The three primers 517, TC-65, and pDJ34 will be the focus of this article. The number of amplification products obtained fr(~m a specific primer is also an important consideration. The circumstances of the particular experiment determine the choice of primer. Often, the objective is to generate the most products from a region. This is usually the case with small human fragments in hybrid cells and in cloned DNAs, and is often desired if recombinant libraries are to be constructed. However, if analysis of hybrids is the objective, and if the hybrids have whole or multiple human chromosomes, it is better to generate fewer discrete prod-

IRS PCR FOR AMPLIFICATION OF HUMAN DNA

65

TABLE 1 List of Published Amplification Primers Derived from Human Alu Repeat Alu Primer

Alu 5 pDJ33

278 Alu III 101-123 Alu II 517

TC-65 (559) pDJ34

OL OL OL Alu

1 3 5 I

pDJ83

Alu IV Alu 3 A1 A1S

S e q u e n c e (5'-3')

Length

position

20 35 33 21 23 27 27 30 35

20-1 47-13 47-23 84-62 a 101-123 192-169 236-220 220-236 226-260

20 20 20 27 28 31 20 18 28

231-250 231-250 232-251 232-258 240-256 260-282 263-282 268-285 268-285

GTGAGCCACCGCGCCCGGCC GCCTCCCAAAGTGCTGGGATTACAGG(C/T) (G/A)TGAGCCA CCGAATTCGCCTCCCAAAGTGCTGGATTACAG TCTTGATCTCTTGACCTCGTG GGTGAAACCCCGTCTCTACTAAA GGATCCTGCCTCAGCCTCCCGAGTAGC CGACCTCGAGATCT(C/T) (G/A)GCTCACTGCAA AAGTCGCGGCCGCTTGCAGTGAGCCGAGAT TGAGC(C/T)(G/A)(A/T)GAT(C/T)(G/A)(C/T)(G/A)CC(A/T) CTGCACTCCAGCCTGGG AGAGATCGCGCCACTGCACA CCAGATCGCGCCACTTCACT GTGATTGTTCCACTGCACTG GAATTCACGCCACTGCACTCCAGCCTG GATGGTAGTAGGCCACTGCACTCCAGCC CAGAATTCGCGACAGAGCGAGACTCCGTCTC ACAGAGCGAGACTCCGTCTC GCGAGACTCCATCTCAAA TCATGTCGACGCGAGACTCCATCTCAAA

Human specific

Ref.

?

(44) (44) (3) (36) (40) (36) (3) (3) (44)

No No No ? No Yes Yes Yes ? ? ?

(43) (43) (43) (36) (45) (36) (44) (32) (32)

No Yes Yes ? Yes Yes

Note. U n d e r l i n i n g i n d i c a t e s Alu-unrelated 5' tail s e q u e n c e s w i t h r e s t r i c t i o n e n z y m e r e c o g n i t i o n s e q u e n c e s . P o s i t i o n s in Alu are d e r i v e d f r o m t h e c o n s e n s u s o f K a r i y a et al. (8), a n d o r i e n t a t i o n o f p r i m e r s is i n d i c a t e d b y t h e 5' a n d 3' e n d s o f t h e p r i m e r r e l a t i v e to t h e Alu c o n s e n s u s . H u m a n s p e c i f i c i t y refers to w h e t h e r t h e p r i m e r h a s b e e n d e m o n s t r a t e d to a m p l i f y s o l e l y h u m a n s e q u e n c e s in m i x t u r e s of h u m a n a n d r o d e n t D N A s . M i s m a t c h e d w i t h c o n s e n s u s o f K a r i y a et al. (8).

ucts that can be easily interpreted. The four primers discussed here, in order from most amplification per unit template sequence to least, are pDJ34, 517, TC-65, and L1Hs. Combinations of primers can also be used. We have used L1Hs with 517 and pDJ34 with 517 with good results. L1Hs + 517 gives more amplification than 517 alone, but less than pDJ34, while pDJ34 combined with 517 gives the most amplification. From our limited experience, and from published data, it appears that the A1 and Alu IV primers give comparable amounts of amplification to TC65. In cloned DNA, the 278 primer can also be employed alone or in combination. Because results with this primer are similar to those obtained with 517, it is often substituted for 517 as it generates products with much less Alu sequence on their ends. Figure 2 shows an example of L1Hs, 517, and both primers combined applied to a number of somatic cell hybrids retaining various amounts of human chromosomes 4 and 5. It is immediately apparent that the L1Hs primer alone gives the least number of products from each cell line, whereas the most product is obtained with the two primers in combination. The use of 517 alone gives an intermediate number of fragments. The hybrids in this panel range from single chromosome 4 (HHW416) and 5 (HHW599) hybrids to radiation hybrids (HD 500-1-HD 8000-3) produced with X-irradiation doses anywhere from 500 to 8000 rads. As described above, for analysis of the sequences present in the hybrids with whole chromo-

somes, the LIHs and 517 primers are more useful because interpretable patterns of fragments are generated. For the radiation hybrids, more amplification is required (few or no bands are found with L1Hs alone in the high dose lines). The use of 517 and the combined primers provides interpretable results from these lines. Some additional features of the results in Fig. 2 are noteworthy. The products obtained in IRS PCR reactions 14 I

Alu 5

#278

I 14 I I

i

19

I I~ AIoHI Sinnettet al. I a'l CAGGAGTICAAG CCA~CATGGTGAAACCC~ACTAKAAATACAAAAATTAGCCC, GG All 1~ 125 75 AIu HI

pDJ33

]

A|u II

Iq

C~ I~~AATCCCAIC~A Iq I

I

#517 I

I !

TC-65 ]

,

~I

I

175~AC~AC~AGGAIGAATC 2C~TOAACCCC~AGG Alu I ,

i

pDJ34

,L :

pDJ83 ',

,

AI

I ~i

~I [

Alu 3

Alu IV

Drf P I

~I

F I G . 1. C o n s e n s u s Alu r e p e a t s e q u e n c e (8) a n d p o s i t i o n s o f oligon u c l e o t i d e p r i m e r s u s e d for I R S P C R in a n u m b e r o f p u b l i c a t i o n s (for s e q u e n c e a n d r e f e r e n c e s , see T a b l e 1). A r r o w s d e n o t e d i r e c t i o n o f extension in P C R r e a c t i o n s u s i n g e a c h p r i m e r (those t h a t e x t e n d "leftward" are t h e r e v e r s e c o m p l e m e n t o f t h e s e q u e n c e s h o w n ) . T h e d a s h e d v e r t i c a l lines denote the ends of homology with the consensus sequence. Some p r i m e r s c o n t a i n s e q u e n c e s differing f r o m t h e c o n s e n s u s a n d / o r d e g e n e r a t e p o s i t i o n s . In addition, 5' e x t e n s i o n s u n r e l a t e d to t h e Alu s e q u e n c e are p r e s e n t o n s o m e p r i m e r s (see T a b l e 1).

66

DAVID L. NELSON

using a single primer are rarely seen in reactions to which an additional primer has been added. The addition of a second primer alters the reaction in such a way that the amplification that would be observed with either single primer is suppressed or eliminated. On a theoretical basis, one would expect to see the products from both primers used singly as well as those derived from the combination. However, the large variety of alternative templates available to the primers in IRS PCR has a profound effect on the observed products. A good example in Fig. 2 is the radiation hybrid HD 4000-1 amplified with either 517 or 517 with L1Hs. A single bright band is observed at ~900 bp with 517, while two smaller bands are found in the 517 + L1Hs product, with no visible 900-bp band. Clearly, the addition of the L1Hs primer changed the products of the reaction that are visible. It is often the case, however, that the "missing" product can be seen by hybridization. This "template competition" also complicates the analysis of somatic cell hybrids retaining overlapping portions of the same chromosome using a single primer. This phenomenon is also apparent in Fig. 2. The abovementioned 900-bp band seen with 517 in the radiation hybrids is not clearly visible in the product from other chromosome 4-containing hybrids (such as HHW416 or HD 1132b). Only after the other potential template sequences have been removed (by fractionation of the chromosome) from the amplification reaction is this 900-bp fragment observed. In this case the product is always found when hybridization analysis is employed (using the 900-bp product to hybridize the products from the other reactions). The complications of template competition have led to hybridization-based analysis of PCR products (see below).

Primer Concentration

For amplification of human sequences from somatic cell hybrids, primers 559 and L I H s are generally used at 1 #M, while 517 is used at 0.3 #M and pDJ34 at 0.1 #M. The primer concentrations are based on amplification of 100-1000 ng of hybrid DNA. Considerable variability with different primer concentrations is observed. The 517 primer, for example, can vary from a small number of bands from a single X chromosome when used at 0.1 #M to a dense smear of fragments when used at 1 #M. We typically use this primer at 0.3-0.5 #M; however, it is often useful to vary the concentration according to the substrate to be amplified. Higher concentrations of primer increase the risk of amplification from rodent sequences; thus, it is not always wise to use high primer concentrations. This is especially true for the pDJ34 primer, which will amplify rodent sequences at concentrations above 0.1 ttM. When significantly less DNA is being used, it may be necessary to reduce the primer concentration to avoid amplifying rodent sequences. If no rodent sequences are present, such as with amplification from cloned DNA, higher concentrations can be used to good effect to increase the number of products obtained.

Magnesium and dNTP Concentrations A surprising amount of variation between different batches of 10X buffer has been found even when the same stock solutions are used for preparation. The extent of variation ranges from excellent to no amplification. It is recommended that the buffer be made in at least 10-ml amounts. Each lot can then be tested and good ones stored in 1-ml aliquots at -20°C. Alterations to the MgC12 con-

TABLE 2

List of Primers from Other Repeat Sequences and Vector Sequences Primer LIHs T3 T7 ML RL YAC4L YAC4R YL3 YL5 1089 1207 1208 1091

Sequence (5'-3') CATGGCACATGTATACATATGTAAC (A/T)AACC ATTAACCCTCACTAAAGGGA CGAATGCGGCCGCTAATACGACTCACTATAGGG GACGTTGTAAAACGACGGCCAGT AACAGCTATGACCATGATTACG CGGAATTCGCCAAGTTGGTTTAAGGCGCAAGAC GGAAGCTTGGCGAGTCGAACGCCCGATCTCAAG AGTCGAACGCCCGATCTCAA AAGTACTCTCGGTAGCCAAG CACCCGTTCTCGGAGCACTGTCCGACCGC GTTGGTTTAAGGCGCAAG GTCGAACGCCCGATCTCAAG ATATAGGCGCCAGCAACCGCACCTGTGGCG

Length

Derivation

Ref.

30 20 33 23 22 33 33 20 20 29 18 20 30

Human LINE-1 Phage T3 (},Dash) Phage T7 (},Dash) p2CpG cosmid p2CpG cosmid pYAC4 (L) pYAC4 (R) pYAC4 (R) pYAC4 (L) pYAC4 (L) pYAC4 (L) pYAC4 (R) pYAC4 (R)

(4) (3) (3) (44) (44) (24) (24) (44) (44) (46) (46) (46) (46)

Note. Underlining indicates vector-unrelated 5' tail sequences with restriction enzyme recognition sequences. T3 and T7 sequences are found on a variety of ~,, cosmid, and plasmid vectors. Primers directed to the M13 universal and reverse sequences used for DNA sequence analysis can also be used in many plasmid vectors, p2CpG is a cosmid vector derived from pCpG and pKNUN1, pYAC4 (L) indicates primers directed to the "left" (centric) arm of pYAC4, pYAC4 (R) indicates primers directed to the "right" (acentric) arm of pYAC4.

IRS PCR FOR AMPLIFICATION OF H U M A N D N A

centration can be attempted, but the primer and dNTP concentrations will likely also require modification. The dNTP concentration can be titrated for each buffer aliquot by amplifying a known somatic cell hybrid and its rodent parent with final dNTP concentrations of 125, _=

+

,.4

L1Hs

6"/

250, and 300 gM. This allows comparison of the PCR pattern with the current buffer. In the ideal case, maximum amplification of the human material with no amplification of the rodent parent is found. If none of these concentrations give human specific amplification, it is worth trying a lower primer concentration. It should be possible to achieve human-specific amplification with TC-65, 517, pDJ34, and L1Hs at a 55°C annealing temperature by varying the dNTP concentration and/or the primer concentration. An example of variation of dNTP and magnesium concentrations is shown in Fig. 3. In this experiment, DNAs from the X3000-11.1 hybrid (30) and its hamster parent were amplified with TC-65 with either 1.5 or 5 mM MgC12 and with a range of dNTP concentrations (50-500 #M of each dNTP). The lower magnesium concentration is capable of supporting amplification at dNTP concentrations up to 300 #M each. However, at 500 #M, 1.5 mM MgC12 is insufficient. Generally, the higher dNTP and magnesium concentrations provide more (and higher molecular weight) amplification product, but the balance between the two concentrations must be maintained. At lower dNTP concentrations, the lower magnesium concentration is more effective. This can be readily seen in the hybridization analysis using the human H P R T cDNA probe shown in the lower panel of Fig. 3. A 4-kb PCR

z

~

d

e~

d

d

d

d

~

rq

" d eq

cq

- d m

~

u~

~

e~

e~

m

~

m

m

e~

m

×

#517

LIHs+#517 F I G . 2. E x a m p l e of IRS P C R with different repeat sequence p r i m e r s in a series of somatic cell hybrids retaining overlapping portions of h u m a n c h r o m o s o m e 4. D N A s from t h e cell lines labeled across t h e top were amplified with t h e p r i m e r s or c o m b i n a t i o n s s h o w n below each frame. T h e L I H s p r i m e r is human-specific a n d directed to t h e h u m a n L I N E 1 repeat (Table 2). T h e 517 primer is a n Alu p r i m e r (see Fig. 1 a n d Table 1). T h e hybrid cell lines H H W 4 1 6 , H H W 8 4 2 , H H W 1 0 7 1 , H64, H H W 5 9 9 , a n d H H W 8 4 7 retain fragments of h u m a n chromosome 4 (and 5 in some cases) on a h a m s t e r cell b a c k g r o u n d (50). HD1132B is a hybrid cell line retaining exclusively c h r o m o s o m e 4 (51). 8C10A5 a n d t h e H D series of hybrids are radiation-reduced hybrids retaining h u m a n c h r o m o s o m e 4 f r a g m e n t s (51). U C W 3 - 4 a is t h e h a m s t e r p a r e n t of t h e H H W cell lines.

Probe: HPRT cDNA F I G . 3. E x a m p l e of t h e effects of varying t h e deoxynucleotide trip h o s p h a t e ( d N T P ) a n d m a g n e s i u m c o n c e n t r a t i o n s in Alu P C R u s i n g t h e TC-65 primer in t h e hybrid cell line X3000-11.1 (retaining h u m a n X q 2 4 - q t e r as its only h u m a n material (30)) a n d h a m s t e r DNA. Conc e n t r a t i o n s of d N T P s (each of d A T P , d C T P , d G T P , a n d d T T P ) in t~M a n d of m a g n e s i u m in mM are given for each lane. A S o u t h e r n t r a n s f e r of t h e e t h i d i u m - s t a i n e d gel in t h e u p p e r frame is s h o w n in t h e lower frame after hybridization with a e D N A probe from t h e h u m a n H P R T gene in Xq26. A 3000-bp f r a g m e n t is identified from t h e t e r m i n a l exon of this gene (3). I n t e n s i t y of hybridization allows c o m p a r i s o n of t h e relative amplification of a specific fragment under t h e varying conditions.

68

DAVID L. NELSON

product containing the last exon of this gene is generated with TC-65 from the X3000-11.1 hybrid (3). This product is not seen on the ethidium bromide-stained gel, but can be visualized by hybridization. Its intensity of hybridization is diagnostic of the quality of the P C R reaction for length and a m o u n t of sequence. Optimizing for this band, the higher concentrations of both magnesium and d N T P s are best. Note the first two lanes, however, in which 50 #M d N T P s were used. Here, the lower magnesium concentration provides much more of the H P R T product. T h e other noteworthy lane is the hamster lane at 200 #M d N T P and 5 mM MgC12. Here, rodent sequences have amplified. Conditions t h a t minimize rodent amplification are usually employed, especially when the hybrid contains very small amounts of h u m a n DNA.

room temperature for 5 min, and then centrifuged for 10 min in a microfuge. T h e pellet is resuspended in about 80 ttl of TE. Gels are run with 5-10 #1 of the P C R product. A 1.3% agarose gel is chosen for any of the three primers used alone, and a 3% NuSieve (FMC) gel is used for reactions using L I H s and A l u primers together as fragments t e n d to be smaller. All gels contain 0.5 #g/ml ethidium bromide and are run in 1X T B E . T h e resolution will not be as good in T A E buffer and is very poor if the gel is run without EtBr. T h e gel should be photographed with Polaroid type 55 film (positive/negative) with a 30- to 45-s exposure on a short wave uv transilluminator. Type 57 film does not provide adequate resolution for detailed analysis, although it can be used to determine whether the P C R worked before going on to the Klenow step.

Reaction Conditions It is most convenient to identify reaction conditions t h a t allow amplification with numerous different primers under the same conditions. T h e primers discussed here can all be used at the same temperature and cycling times with the standard buffer, d N T P , and primer concentrations. This is convenient because reactions with different primers can be combined in the same run of the thermal cycler. It is sometimes necessary to increase the stringency of the reaction by raising the annealing temperature (some primers can have increased h u m a n specificity at higher stringency); however, the same effect can often be achieved by decreasing the primer concentration. Significant variation in the annealing temperature (45-60°C) does not appreciably change the p a t t e r n of products obtained from a hybrid with certain primers (TC-65 has been looked at most carefully).

Interpretation of IRS PCR from Somatic Cell Hybrids T h e IRS P C R p a t t e r n of a given chromosome is fairly constant both from reaction to reaction using the same chromosome as template (i.e., same somatic cell hybrid DNA) and between different copies of the same chromosome in different hybrid cells (31). Some variation in intensity of a given band can be seen in comparisons of different amplifications of the same chromosome but all bands are usually present. It is always best to include all controls in the same P C R experiment as the unknowns since the variations seem to be between different runs rather t h a n in the same run. T h e use of a master mix of all the reaction components except the DNA ensures t h a t the amplification is consistent insofar as the components are concerned; thus differences between samples must be due to the DNA added. Comparison of the ethidium bromide-stained IRS P C R patterns from somatic cell hybrids retaining differing amounts of the same chromosomal region can be used to define the a m o u n t and extent of DNA in the hybrid (3, 4, 31-35). Figure 2 shows clear examples in the radiation hybrids amplified either with 517 alone (e.g., compare H D 2000-3 and H D 2000-2--the extra bands in H D 2000-3 indicate additional sequences present in t h a t hybrid) or in combination with L 1 H s (compare H D 4000-1 and H D 4000-3). T h e ability to rapidly and easily compare IRS P C R products for a m o u n t and overlap of h u m a n sequences is a powerful tool for the definition of the sequences in the hybrid. In addition, because the P C R products can be isolated for further use, products can be chosen from either the sequences shared in c o m m o n or those t h a t are not overlapping. This can be very useful for the isolation of region-specific DNA sequences from appropriate hybrid cell lines. T h e p h e n o m e n o n of template competition described above can complicate these analyses when hybrids with very different amounts of human DNA are being compared. Another complicating factor is found in the comparison of the same chromosome derived from different sources. Polymorphic variation in the ability of a template to amplify (or in the size of the

Gel Analysis of IRS PaR Products M a x i m u m resolution for gel analysis of the complex patterns of hybrid amplification requires some p o s t - P C R manipulation. In particular, Klenow extension and precipitation of the P C R product give a much clearer gel with less background smear and sharper bands. T h e Klenow t r e a t m e n t allows completion of unfinished extension products and the precipitation eliminates most of the unincorporated d N T P s and primer. Both steps reduce the complex background seen in u n t r e a t e d products. This becomes particularly i m p o r t a n t in attempts to determine if a faint fragment is present or absent. Method Approximately 90 #l of the P C R product is transferred to a clean microcentrifuge tube, leaving the mineral oil behind. T h e P C R product is incubated with ~ 2 units of Klenow fragment of E. coli Pol I for 20 min at 37°C. Following the 37°C incubation the tube is placed at 65°C for 10 min to inactivate the enzyme. T h e P C R product is t h e n precipitated by adding an equal volume of 2 M ammonium acetate and 3 vol of 100% E t O H , incubated at

IRS PCR FOR AMPLIFICATION OF HUMAN DNA amplification product) has been observed (34) and can confuse these analyses. Therefore it is often desirable to confirm the localization of a particular fragment by hybridization analysis (see below). Hybrid cell lines with large amounts of human material (one or more chromosomes) can be very difficult to interpret in direct gel analysis of the IRS PCR pattern. Several strategies can be employed to reduce the complexity of the pattern to an interpretable one. The most straightforward of these is the use of different primers that give less amplification. The L1Hs primer used alone generates interpretable patterns from each of the human chromosomes (31). Another method is to alter the reaction conditions to generate fewer bands with Alu primers. The original report o f A l u PCR described the use of 517 at 0.1 #M concentration. At this concentration, fairly simple patterns are observed from entire human chromosomes (3). Similar results can be obtained with reductions in the concentration of other Alu primers as well. Another strategy for reducing the complexity of the pattern of amplification is fractionation of the template prior to the amplification. In "restricted Alu PCR," the template DNAs are first digested with one or more restriction endonucleases so that many of the templates are no longer capable of amplifying due to separation of the primer binding sites. This method has been used for the identification of region-specific fragments from chromosomes 17 (34) and 6 (35). In the study of Guzzetta et al. {34), restricted A l u PCR was used to isolate fragments amplified from a normal human chromosome 17 that were not amplified in a chromosome 17 with a deletion of 17p11.2. Two of the fragments identified were confirmed to be derived from the deletion, while two others represented polymorphic variation between the chromosomes. Zoghbi et al. (35) used restricted Alu PCR for comparing radiation hybrids retaining portions of chromosome 6p. Because all these clones were derived from the same original 6p, polymorphism did not play a role in the interpretation of the amplification patterns.

DNA Hybridization to Compare IRS PeR Products from Somatic Cell Hybrids Identification of fragments in specific chromosomal regions by analyzing the ethidium-stained PCR products directly on a gel is best accomplished with hybrids retaining single chromosomes (or fractions of a chromosome). Most regional mapping panels for a given chromosome contain translocations or deletions of the chromosome of interest; however, they frequently also contain additional chromosomes. The requirement for single chromosome hybrids for the PCR analysis can be obviated by Southern analysis of the PCR products from the mapping panel hybrids using labeled products from the hybrid containing only the region of interest. The capacity to use reduced complexity probe and target sequences for hybridization analyses provides rapid

69

results. Individual A l u PCR products can be detected in short exposure times (1-6 h) in reactions using total human DNA as template (32), and reduced complexity hybrids used as template give even stronger signals. If the presence or absence of signal is sufficient information, such analyses can often be transformed from Southern to "dot blot" hybridizations, reducing the labor involved ((31) and see below). Alu PCR product probes are also more suitable for in situ hybridization to determine the extent of human sequences in a hybrid than total hybrid DNA due to the reduction in probe complexity and elimination of rodent sequences (5). The drawback of the AIu PCR to Alu PCR hybridizations is the presence of homologous primer and repeat sequences on the ends of each molecule. This requires rather complete suppression of repeat sequence hybridization to obtain specific signals. Suppression of repeat sequence hybridization is also a challenge with the use of Alu PCR products as probes to unamplified genomic DNA. A variety of probes can be used for hybridization analysis of Alu PCR products. Since the complexity of the probe is reduced by the amplification, and often the complexity of the target is similarly reduced, it is possible to label the entire set of products from a PCR reaction. PCR products derived from hybrids with whole chromosomes have been used successfully for a variety of studies (3335). Individual Alu PCR products can also either be utilized as gel-isolated fragments (often reamplified to increase purity) or cloned into plasmid vectors (32, 36). Another strategy to reduce the complexity of the probe is size fractionation by gel isolation of a range of products of a defined size (33). When A l u PCR products are being used as probes and Alu PCR products as targets, it is vital that each set of products be derived from amplification with the same primer or combination of primers, because different primers amplify different fractions of the genome. Due to the great reduction in probe and target complexities, it is possible to convert hybridization analyses of A l u PCR products to dot blot assays. This has been used by Ledbetter et al. for the identification of "marker" chromosomes in somatic cell hybrids (31). In this study, Alu PCR products from hybrid cells containing cytogenetically unrecognizable human chromosome fragments were used as probes to dot blots containing Alu PCR products from defined hybrids retaining individual human chromosomes. The signals obtained allowed identification of the chromosome fragments present in the hybrids tested. This type of assay can also be used for assignment of individual Alu PCR fragments, such as those derived from cloned sequences, allowing simplified chromosome or regional localizations. Method

For preparation of Southern filters of A l u PCR products, the PCR to be used for hybridization analysis is run

70

DAVID L. NELSON

as above. The products are treated with Klenow and precipitated. The pellet from 90 #l of the original reaction is resuspended in 60 #1 T E for monochromosomal hybrids, 30 #1 for hybrids containing up to five additional chromosomes, and 15 #l for hybrids containing more than five chromosomes. Five microliters of each is run on a 1.3% agarose gel using a 1-mm comb. The gel should run until the dye front is at ~ 13 cm. Kodak type 57 film is used to minimize uv exposure. Denaturation is in two changes of 0.4 N NaOH for 20 min each (neutralization is not necessary) and the gels are transferred to GeneScreen Plus (DuPont/NEN) in 10X SSC. When the transfer is complete, the filter is placed in 0.4 N NaOH for ~ 1 min followed by 0.2 M Tris-HC1/2X SSC for 5 min. Baking at 80°C for 2 h is optional; air-drying is sufficient. For preparation of dot blot filters (31), 80 #1 of the PCR reaction is precipitated and resuspended in 30 #l of TE. One microliter is spotted onto GeneScreen Plus, and the filter is denatured for 10 min in 0.4 M NaOH, neutralized in 0.2 M Tris-HC1, pH 7.5/2X SSC for 10 min, and baked at 80°C for 2 h. Filters are prehybridized for at least 4 h in 1 M NaC1, 1% SDS, 10% dextran sulfate, and 0.5 mg/ml human placental DNA at 65°C. The PCR products of the hybrid to be used as probe are labeled (after precipitation as above) by the random primer method followed by spermine or ethanol precipitation to remove the unincorporated dNTPs. For entire PCR reaction probes, 3 #1 of the 100 #l reaction is used in a 30-#1 reaction (31). Preassociation of the probe (106 cpm/ml) is carried out in 2-3 ml of hybridization solution containing 0.5 mg/ml placental DNA by boiling for 5 min and then incubating at 65°C for 0.52 h. The length of preassociation is somewhat empirical for each probe. The probe is added to the prehybridized filter (without changing the prehybridization solution) and hybridized at 65°C overnight. The filter is washed for 30-45 min each in 2X SSC/0.1% SDS, 1X SSC/0.1%

A l u Primer:

Vector Primer:

278

278

559

559

+ Y A C 4 L +YAC4R +YAC4L +YAC4R M145 41 88 145 41 88 145 41 88 145 41 ,~,~

F I G . 4. Alu-vector PCR products from three overlapping YAC clones in Xq25 (24). Three YAC clones were subjected to Alu-vector PCR using the Alu and vector primers indicated (see Tables 1 and 2). The three clones (RS41, RS88, and RS145) overlap one another in Xq25. Four of the possible six end products are observed. The faint band in RS41 with 278 and YAC4R is an Alu-Alu product. Additional fainter bands c o m m o n to all lanes derive from yeast sequences. Marker is HindIII-digested ~ D N A mixed with HaeIII-digested ~bX174 DNA.

SDS and 0.1X SSC/1% SDS, at 65°C, and exposed to Kodak X-AR film with an intensifying screen for ~ 1 h. The filter can be stripped by boiling in 0.1% SDS/0.1X SSC for 30 min. This can be repeated if all of the probe is not removed. Some background is seen with some A l u PCR product probes, especially those from complex sources. This is often due to incomplete suppression of repeat sequences and can sometimes be reduced by longer preassociation of probes. In the dot blots, the background is generally less troubling, as the signals are usually quite strong and thus the signal-to-noise ratio high. In Southern filters, the background can be more of a problem because it can obscure the bands generating weaker signals. It is best to keep complex A l u PCR probes used against Southerns to one human chromosome or less. For probing restriction digests of total genomic DNA, it is always best to use individual A l u PCR fragments rather than complex mixtures. The amount of background observed with A l u PCR products depends in part on the primer used in generation of the product(s). We have observed more background with probes derived from pDJ34 amplification products than with TC-65 or 517. Primers that reduce the amount of A l u sequences present on the amplification product (such as A1) should also reduce background problems. IRS PeR from Cloned DNAs The application of IRS PCR to cloned human sequences offers three major advantages. The first is the rapidity with which fragments of the cloned sequences can be generated. The PCR can use quite crude starting templates, such as phage plaques, scraped bacterial colonies, and crude yeast lysates. This can eliminate the preparation and separation from host sequences of DNA from individual clones, allowing clones to be characterized more quickly. Second, through the use of primers directed to the vector sequences adjacent to the insertion site in conjunction with A l u primers, it is possible to generate fragments specifically from the ends of inserts. This allows "chromosome walking" experiments to be initiated from crude materials and without extensive characterization of the clone to identify end fragments. Finally, in the case of yeast artificial chromosomes, the application of A l u PCR and A l u - v e c t o r PCR provides a convenient means of generating insert sequences without resorting to pulsedfield gel electrophoretic isolation of the artificial chromosome or subcloning. The application o f A l u PCR to YAC clones allows rapid isolation of fragments of these large inserts for further analysis (identification of chromosomal location, overlapping clones, etc.). This is significant since YACs, unlike clones in E. coli vectors, cannot be readily purified from yeast host DNA. We have generated A l u PCR products from over 100 YAC clones derived from the human X chromosome in order to determine their chromosomal

IRS PCR FOR AMPLIFICATION OF HUMAN DNA sublocalization (3, 24). In these experiments, YACs of 100-120 kb average size generated an average of one or two PCR products with Alu primer 278, TC-65, or the two primers combined. Thus only a small number of the possible Alu sequences were capable of generating PCR products. The pDJ34 primer increased the number of products approximately twofold. The relative rarity of A l u - A l u products predicts that clones in cosmid (35 kb) or }, (18 kb) vectors will be unlikely to generate products with Alu primers alone. This is borne out by experiment, with only 10-15% of clones in }, generating A l u - A l u fragments. The addition of vector primers to Alu PCR reactions in cloned DNAs increases the fraction of clones demonstrating products significantly. Over 50% of }, inserts generate products with Alu-vector PCR using one or the other vector primer. Similar results are seen in cosmid clones. YAC clones can also be amplified with Alu-vector PCR, and both end fragments can be obtained from ~60% of clones. An example o f A l u : v e c t o r PCR applied to three overlapping YACs (RS41, RS88, and RS145) defining a translocation breakpoint associated with Lowe syndrome (37) in Xq25 is shown in Fig. 4. Four of the six ends were isolated from these clones using either 278 or 559 as Alu primer. These can be used for identification of overlapping clones by hybridization or PCR-based methods (38, 39). Another use of Alu PCR products derived from YACs is fingerprint analysis to compare overlapping clones. An example of this applied to the three Lowe syndrome YACs is shown in Fig. 5. Several bright products derived from amplification of these clones with either 278 or 278 combined with TC-65 (559) have been used to define regions of overlap among the three clones. As with similar anal-

A

278 M 145 88 41

71

yses of somatic cell hybrids by this approach, one significant benefit is the ability to isolate the amplification products with prior knowledge of their locations within the contig of clones. This Alu PCR fingerprinting method has been useful for definition of overlapping clones among our collection of regionally localized X chromosome YACs. It may prove valuable for fingerprint comparison of random clones; however, the information content with the current Alu primers is likely insufficient for large-scale random clone comparisons to be worthwhile. A number of vector primers are listed in Table 2. PCR is set up as with somatic cell hybrid DNAs. It is useful to set up reactions with Alu primers alone as well as in combination with either vector primer in order to distinguish A l u - A l u products from Alu-vector products. If the objective is primarily the generation of end fragments, Alu primers 278 and TC-65 should be used individually to maximize the likelihood of production of Alu-vector products. This requires six reactions per clone. In YAC clones in the pYAC4 vector (23), it is important not to use both vector primers (YAC4L and YAC4R) in the same reaction, as they are derived from sequences found in the yeast genome and will generate a PCR product unrelated to the YAC. For clones in ~ or cosmid vectors, the vector primers can be used together to reduce the number of reactions. Method

The only difference from the somatic cell hybrid protocol listed above is the starting material. YAC clones can be amplified from purified DNA or crude lysates. For crude lysates, a YAC-containing yeast colony (or 10-#1 aliquot of suspended yeast cells) is transferred to ~ 6 0 ttl lysis

278+559 145 88 41

93 ~:0l=

1.3~ 1.0..~ 0.9..-

B

Lowe-3breakpoint

0.6..~ 145

- -

een

e,f

d

I

I I l

l

~

=

88

I l

l

a,c,g

b

- -

41

tel

q

~200 kb

FIG. 5. (A) Alu P C R fingerprint of overlapping Xq25 YACs RS41, RS88, and RS145. DNA from the three YAC clones was amplified with the 278 and 278 + 559 (TC-65) primers as indicated. One-sixth of the reaction product was electrophoresed through a 1.1% agarose gel. Prominent bands are labeled a - g and used to construct a map of the clones as shown in B. Size markers are as in Fig. 4, with selected fragments labeled for size. (B) Map of three overlapping YACs, RS41, RS88, and RS145, defined by Alu PCR fingerprinting. Four regions are defined by the co-amplified products present in overlapping clones. Distance information between product regions is not implied. The position of fragment b is ambiguous and has been determined by knowledge gained from end fragments of RS145 and RS41 (data not shown).

72

DAVID L. NELSON

buffer (1× PCR buffer with 0.45% NP-40 and 0.45% Tween 20). Lyticase (Sigma) is added at 0.75-1 unit/#l, and the cells are allowed to spheroplast at 37°C for 1-1.5 h. Cells are boiled for 10 min, debris is pelleted for 3-5 min in a microfuge, and 1-5 #l is used for PCR. The lysates can be stably maintained at -20°C. For bacterial colonies, a very small amount (1-3 #l) of the colony can be scraped directly into the PCR reaction for amplification. The initial denaturation step lyses cells and destroys proteases and nucleases. Preboiling of cells is unnecessary, but can also be employed. For clones in ~, the phage plaque is picked with a toothpick, which is transferred to 50-100 #1 of TE. After 1 h, a small aliquot of the TE (1-5 #l) can be added directly to the PCR reaction. Alu Polymorphism

Several studies have reported methods for assaying polymorphic variation in Alu sequences with PCR (4043). Sinnett et al. (40) utilized a single Alu primer and amplification of genomic DNA with or without digestion with B s t X I to generate complex patterns (termed "Alumorphs") that demonstrated variation between individuals. The other three reports used three different methods to assay single locations in the genome with Alu primers. Zuliani and Hobbs (41) labeled the single-copy primer with 32p, enabling the product generated between it and the Alu primer to be specifically detected by autoradiography. Epstein et al. (42) amplified the specific location with primers directed to sequences flanking the Alu repeat. An aliquot of the first amplification reaction was then extended by one cycle with 32p-labeled pDJ34 to generate a small product that could be assayed for poly(A) tail variation. Economou et al. (43) also employed 32p to detect PCR products after amplification using single-copy and Alu primers either by labeling the single-copy primer in the same manner as that employed by Zuliani and Hobbs or by labeling the PCR product during the amplification reaction by incorporation of [32P]dCTP. To reduce the background of A l u - A l u amplification, Economou et al. adjusted the relative concentrations of the two primers in the reaction. They found that use of the A l u primer at a concentration 10-fold lower than that of the single-copy primer allowed quite specific identification of the desired product, without a significant background o f A l u - A l u PCR products. These studies clearly demonstrate the potential for use of Alu 3' poly(A) tail polymorphism for genetic marker studies. Six of fourteen Alu repeats studied showed polymorphism. If roughly half of Alu 3' poly(A) tails are polymorphic, then most Alu PCR products retaining two poly(A) tails (such as those produced with TC-65) would be useful genetic markers. Since isolation of such products from specific regions is rapid and simple, this class of polymorphism may be ideal for positional cloning studies.

Single-Copy to Alu Amplification The observation by Economou et al. (43) that specific amplification between Alu and single-copy primers could be achieved by reduction of the Alu primer concentration provides the theoretical basis for using A l u primers in combination with single-copy primers for amplification from total genomic DNA of specific regions where one sequence is known and the other unknown. This is similar in concept to A l u - v e c t o r PCR, but applied to a very complex mixture with significantly more potential for amplification between Alu repeats. Some applications of this approach would include chromosome walking, crossing translocation or deletion breakpoints, and isolation of sequences adjacent consensus sequences (splice sites, conserved promoter motifs, etc.). An example of Alu single-copy amplification applied to the region near the translocation breakpoint associated with Lowe syndrome in Xq25 is shown in Fig. 6. The objective of this study was possible amplification across the translocation breakpoint in 649-5. Sequence derived from an A l u PCR product (94-1) generated from YAC RS88 with TC-65 was used to generate a single-copy primer 2080 (24). The 2080 primer is located within 300

.= ~:

2080 l~tM+

2080 lpM+

~

#559 lgM

#559 O.lgM #559O.OlgM

2080lp.M+

+

F I G . 6. D e m o n s t r a t i o n of single-copy to Alu amplification from total h u m a n a n d cloned DNA. A region of h u m a n Xq25 involved in a t r a n s location with c h r o m o s o m e 3 associated with Lowe s y n d r o m e a n d cont a i n e d within YAC clone RS88 was sequenced a n d used in a n a t t e m p t to amplify across t h e translocation j u n c t i o n to Alu sequences on chrom o s o m e 3. T h e single-copy primer (2080) was u s e d at a c o n s t a n t 1/zM, while t h e concentration of t h e Alu primer (559 (TC-65)) was varied. Specific amplification is observed from t h e cloned D N A (total y e a s t D N A harboring t h e YAC insert in RS88) a n d from t h e h u m a n DNA. A hybrid cell line (649-5 (37)) c o n t a i n i n g t h e t r a n s l o c a t e d X c h r o m o s o m e does n o t amplify a specific product with t h e s e primers. Amplification conditions are as specified in t h e text, with t h e only alteration being t h e concentration of t h e Alu primer. T o t a l h a m s t e r D N A is included as a control for t h e hybrid cell line.

IRS PCR F O R A M P L I F I C A T I O N OF H U M A N DNA b p o f t h e t r a n s l o c a t i o n b r e a k p o i n t , a n d we d e s i r e d a m p l i f i c a t i o n b e t w e e n it a n d t h e n e x t a v a i l a b l e A l u s e q u e n c e in t h e t r a n s l o c a t e d r e g i o n o f c h r o m o s o m e 3. I n t h e s t u d y s h o w n in Fig. 6, t h e c o n c e n t r a t i o n o f t h e s i n g l e - c o p y p r i m e r (2080) is m a i n t a i n e d a t a c o n s t a n t 1 #M w h i l e t h e T C - 6 5 (559) p r i m e r is u s e d a t e i t h e r 1, 0.1, o r 0.01 #M. Four DNA samples were assayed: total human DNA; the Y A C c l o n e R S 8 8 f r o m w h i c h t h e s e q u e n c e o f 2080 w a s d e r i v e d ; 649-5, a s o m a t i c cell h y b r i d r e t a i n i n g t h e X;3 translocation chromosome from a Lowe syndrome patient (37); a n d h a m s t e r D N A . T h e p r o d u c t e x p e c t e d f r o m a n o r m a l X c h r o m o s o m e is t h e 8 0 5 - b p b a n d s e e n in R S 8 8 a n d t o t a l h u m a n D N A . U n f o r t u n a t e l y , specific p r o d u c t s were not observed from the translocation chromosome u s i n g e i t h e r T C - 6 5 o r 517, a n d h y b r i d i z a t i o n to s e q u e n c e s b e t w e e n 2080 a n d t h e t r a n s l o c a t i o n b r e a k p o i n t f a i l e d to reveal faint amplification products. Thus this approach t o c r o s s i n g t h e t r a n s l o c a t i o n b r e a k p o i n t d i d n o t succeed. N o t e w o r t h y , h o w e v e r , is t h e o b s e r v a t i o n o f specific a m p l i f i c a t i o n p r o d u c t s in t h e e t h i d i u m b r o m i d e - s t a i n e d m a t e r i a l f r o m t o t a l h u m a n D N A a t all t h r e e A l u p r i m e r c o n centrations. This demonstrates the feasibility of the approach to isolation of unknown regions.

73

gions. Coincidence cloning may allow very specific areas of the genome to be targeted for cloning without the requirement of a hybrid cell line retaining the region. Finally, IRS PCR can be extended to species other than the human. The repetitive sequences present in the mouse genome have been utilized to generate IRS PCR products from somatic cell hybrids in primate and even hamster backgrounds (49), and these can also generate amplification products from sequences cloned into E. coli and yeast vectors. Although the average distance between repeats in the mouse genome is greater, limiting the number of products from a region, it is still useful for mouse genome analysis. Any species with repetitive sequences will likely be amenable to IRS PCR.

ACKNOWLEDGMENTS I thank my colleagues at Baylor College of Medicine for their interest and support in the full development of IRS PCR in its many forms. In particular, Susan and David Ledbetter, Pragna Patel and her group, Huda Zoghbi, Andrea Ballabio, and Gall Herman have contributed substantially to the technique. I also acknowledge the advice and support of C. Thomas Caskey, and the superb technical assistance of Maureen F. Victoria. This work was supported in part by a grant from the US Department of Energy (DE-FG05-88ER60692).

CONCLUDING REMARKS IRS PCR can best be described as a very "useful" technique. It provides a faster and in many cases easier approach to the isolation of sequences from specific human genomic regions from somatic cell hybrids or cloned fragments. It can also provide some qualitative information about regions by generation of a fingerprint. However, its major contribution is the ease of generating fragments for further analysis (hybridization, sequencing, etc.). The ability to bypass creation of recombinant libraries from hybrid cell lines or DNA isolation from cloned fragments allows rapid access to the human regions present, thus accelerating the characterization of the region. Also, the reduced complexity of probe and target sequences when IRS PCR products are used allows for rapid mapping approaches such as the dot blots for chromosomal assignments (31). Some extensions of this technology that have not been addressed here include the generation of recombinant libraries of IRS PCR products, whether by standard or more exotic cloning methods (36, 45), and the use of "coincidence cloning" to select IRS PCR products from specific genomic regions in common between two DNA sources (47). Libraries of IRS PCR products can allow individual products to be analyzed. One example would be sequence analysis of several regionally localized A l u PCR products to generate polymorphic sequence tagged sites (STSs) (48) based on the 3' poly(A) tails present for further genetic and physical mapping of chromosomal re-

REFERENCES 1. Mullis, K. B., and Faloona, F. A. (1987) in Methods in Enzymology (Wu, R., Ed.), Vol. 155, pp. 335-350, Academic Press, San Diego. 2. Gibbs, R. A., Nguyen, P-N., McBride, L. J., Koepf, S. M., and Caskey, C. T. (1989) Proc. Natl. Acad. Sci. USA 86, 1919-1923. 3. Nelson, D. L., Ledbetter, S. A., Corbo, L., Victoria, M. F., RamirezSolis, R., Webster, T. D., Ledbetter, D. H., and Caskey, C. T. (1989) Proc. Natl. Acad. Sci. USA 86, 6686-6690. 4. Ledbetter, S. A., Nelson, D. L., Warren, S. T., and Ledbetter, D. H. (1990) Genomics 6, 475-481. 5. Lichter, P., Ledbetter, S. A., Ledbetter, D. H., and Ward, D. C. (1990) Proc. Natl. Acad. Sci. USA 87, 6634-6638. 6. Britten, R. J., and Kohne, D. E. (1968) Science 161,529-540. 7. Deninger, P. L., Jolly, D. J., Rubin, C. M., Friedmann, T., and Schmid, C. W. (1981) J. Mol. Biol. 151, 17-33. 8. Kariya, Y., Kato, K., Hayashizaki, Y., Himeno, S., Tarui, S., and Matsubara, K. (1987) Gene 53, 1-10. 9. Ullu, E., and Tschudi, C. (1984) Nature 312, 171-172. 10. Jelinek, W. R., and Schmid, C. W. (1982)Annu. Rev. Biochem. 51, 813-844. 11. Krayev, A. S., Markusheva, T. V., Kramerov, D. A., Ryskov, A. P., Skryabin, K. G., Bayev, A. A., and Georgiev, G. P. (1982) Nucleic Acids Res. 10, 7461-7475. 12. Singer, M. F., and Skowronski, J. (1985) Trends Biol. Sci. 10, 119122. 13. Kole, L. B., Haynes, S. R., and Jelinek, W. R. (1983) J. Mol. Biol. 165, 257-286. 14. Skowronski, J., and Singer, M. F. (1986) Cold Spring Harbor Symp. Quant. Biol. 51,457-466.

74

D A V I D L. N E L S O N

15. Scott, A. F., Schmeckpeper, B. J., Abdelrazik, M., Comey, C. T., O'Hara, B., Rossiter, J. P., Cooley, T., Heath, P., Smith, K. D., and Margolet, L. (1987) Genomics 1,113-125. 16. Moyzis, R. K., Albright, K. L., Bartholdi, M. F., Cram, L. S., Deaven, L. L., Hildebrand, C. E., Joste, N. E., Longmire, J. L., Meyne, J., and Schwarzacher,Robinson, T. (1987) Chromosoma 95, 375-386. 17. Moyzis, R. K., Buckingham, J. M., Cram, L. S., Dani, M., Deaven, L. L., Jones, M. D., Meyne, J,, Ratliff, R. L., and Wu, J.-R. (1988) Proc. Natl. Acad. Sci. U S A 85, 6622-6626. 18. Weber, J. L., and May, P. E. (1989) A m . J. H u m . Genet. 44, 388396. 19. Litt, M., and Luty, J. A. (1989) A m . J. H u m . Genet. 44, 397-401. 20. Edwards, A., Civitello; A., Hammond, H. A., and Caskey, C. T. (1991) Submitted for publication. 21. Gusella, J. F., Keys, C., Varsanyi-Breiner, A., Kao, F.-T., Jones, C., Puck, T. T., and Housman, D. E. (1980) Proc. Natl. Acad. Sci. U S A 77, 2829-2833. 22. Davies, K. E., Young, B. D., Elles, R. G., Hill, M. E., and Williamson, R. (1981) N a t u r e 293,374-376. 23. Burke, D. T., Carle, G. F., and Olson, M. V. {1987) Science 236, 806-812. 24. Nelson, D. L., Ballabio, A., Victoria, M. F., Pieretti, M., Bies, R. D., Gibbs, R. A., Maley, J. A., Chinault, A. C., Webster, T. D., and Caskey, C. T. (1991) Proc. Natl. Acad. Sci. USA, in press. 25. Moyzis, R. K., Torney, D. C., Meyne, J., Buckingham, J. M., Wu, J.-R., Burks, C., Sirotkin, K. M., and Goad, W. B. (1989) Genomics 4,273-289. 26. Sealey, P. G., Whittaker, P. A., and Southern, E. M. (1985) Nucleic Acids Res. 13, 1905-1922. 27. Litt, M., and White, R. L. (1985) Proc. Natl. Acad. Sci. U S A 82, 6206-6210. 28. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988) Science 239, 487-491. 29. Kogan, S. C., Doherty, M., and Gitschier, J. (1987) N. Engl. J. Med. 817,985-990. 30. Nussbaum, R. L., Airhart, S. D., and Ledbetter, D. H. (1986) A m . J. Med. Genet. 23,457-466. 31. Ledbetter, S. A., Garcia-Heras, J., and Ledbetter, D. H. (1990) Genomics 8, 614-622. 32. Brooks-Wilson, A. R., Goodfellow, P. N., Povey, S., Nevanlinna, H. A., de Jong, P. J., and Goodfellow, P. J. (1990) Genomics 7,614620.

33. Patel, P. I., Garcia, C., de Oca-Luna, R. M., Malamut, R. I., Franco, B., Slaugenhaupt, S., Chakravarti, A., and Lupski, J. R. (1990) A m . J. H u m . Genet. 47, 926-934. 34. Guzzetta, V., de Oca-Luna, R. M., Lupski, J. R., and Patel, P. I. (1991) Genomics 9, 31-36. 35. Zoghbi, H. Y., McCall, A. E., and LeBorgne-Demarquoy, F. (1991) Genomics 9, 713-720. 36. Cotter, F. E., Hampton, G. M., Nasipuri, S., Bodmer, W. F., and Young, B. D. (1990) Genomics 7, 257-263. 37. Reilly, D. S., Lewis, R. A., Ledbetter, D. H., and Nussbaum, R. L. (1988) A m . J. H u m . Genet. 42, 748-755. 38. Little, R. D., Porta, G., Carle, G. F., Schlessinger, D., and D'Urso, M. (1989) Proc. Natl. Acad. Sci. U S A 86, 1598-1602. 39. Green, E. D., and Olson, M. V. (1990) Proc. Natl. Acad. Sci. U S A 87, 1213-1217. 40. Sinnett, D., Deragon, J-M., Simard, L. R., and Labuda, D. (1990) Genomics 7, 331-334. 41. Zuliani, G., and Hobbs, H. H. {1990) A m . J. H u m . Genet. 46, 963969. 42. Epstein, N., Nahor, O., and Silver, J. (1990) Nucleic Acids Res. 18, 4634. 43. Economou, E. P., Bergen, A. W., Warren, A. C., and Antonarakis, S. E. (1990) Proc. Natl. Acad. Sci. U S A 87, 2951-2954. 44. Breukel, C., Wijnen, J., Tops, C., v/d Klift, H., Dauwerse, H., and Meera Khan, P. {1990) Nucleic Acids Res. 18, 3097. 45. Aslanidis, C., and de Jong, P. J. (1990) Nucleic Acids Res. 18, 60696074. 46. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990) Nucleic Acids Res. 18, 2887-2890. 47. de Jong, P. J., Aslanidis, C., Amemiya, C. T., Chen, C., and Carrano, A. V. (1990) Am. J. Hum. Genet. 47, A248. 48. Olson, M., Hood, L., Cantor, C., and Botstein, D. (1989) Science 245, 1434-1435. 49. Simmler, M-C., Cox, R. D., and Avner, P. (1991) Genomics, in press. 50. MacDonald, M. E., Anderson, M. A., Gilliam, T. C., Tranebjaerg, L., Carpenter, N. J., Magenis, E., Hayden, M. R., Healey, S. T., Bonnet, T. I., and Gusella, J. F. (1987) Genomics 1, 29-34. 51. Doucette-Stamm, L. A., Riba, L., Handelin, B., and Housman, D. E. (1991) Submitted for publication.