- Email: [email protected]
Intertypic recombination of human parechovirus 4 isolated from infants with sepsis-like disease
Journal of Clinical Virology 88 (2017) 1–7
Contents lists available at ScienceDirect
Journal of Clinical Virology journal homepage: www.elsevier.com/locate/jcv
Intertypic recombination of human parechovirus 4 isolated from infants with sepsis-like disease Pekka Kolehmainen a,b , Anu Siponen a , Teemu Smura b , Hannimari Kallio-Kokko b,c , Olli Vapalahti b,c,d , Anne Jääskeläinen b,c,1 , Sisko Tauriainen a,∗,1 a
Department of Virology, University of Turku, Kiinamyllynkatu 13, 20520, Turku, Finland Department of Virology, University of Helsinki and Helsinki University Hospital, Haartmaninkatu 3, 00290, Helsinki, Finland c Department of Virology and Immunology, University of Helsinki and Helsinki University Hospital, HUSLAB, Topeliuksenkatu 32, 00290, Helsinki, Finland d Department of Veterinary Biosciences, Faculty of Veterinary Medicine, University of Helsinki, Agnes Sjöbergin katu 2, 00790, Helsinki, Finland b
a r t i c l e
i n f o
Article history: Received 13 October 2016 Received in revised form 30 December 2016 Accepted 2 January 2017 Keywords: Human parechovirus HPeV-4 Complete coding sequence Sepsis-like disease Recombination Phylogenetic analysis
a b s t r a c t Background: Human parechoviruses (HPeVs) (family Picornaviridae), are common pathogens in young children. Despite their high prevalence, research on their genetic identity, diversity and evolution have remained scarce. Objectives: Complete coding regions of three previously reported HPeV-4 isolates from Finnish children with sepsis-like disease were sequenced in order to elucidate the phylogenetic relationships and potential recombination events during the evolution of these isolates. Study design: The isolated viruses were sequenced and aligned with all HPeV complete genome sequences available in GenBank. Phylogenetic trees were constructed and similarity plot and bootscanning methods were used for recombination analysis. Results: The three HPeV-4 isolates had 99.8% nucleotide sequence similarity. The phylogenetic analysis indicated that capsid-encoding sequences of these HPeV-4 isolates were closely related to other HPeV-4 strains (80.7-94.7% nucleotide similarity), whereas their non-structural region genes 2A to 3C clustered together with several HPeV-1 and HPeV-3 strains, in addition to the HPeV-4 strain K251176-02 (isolated 2002 in the Netherlands), but not with other HPeV-4 strains. However, in 3D-encoding sequence the Finnish HPeV-4 isolates did not cluster with the strain HPeV-4/K251176-02, but instead, formed a distinct group together with several HPeV-1 and HPeV-3 strains. Similarity plot and Bootscan analyses further confirmed intertypic recombination events in the evolution of the Finnish HPeV-4 isolates. Conclusion: Intertypic recombination event(s) have occurred during the evolution of HPeV-4 isolates from children with sepsis-like disease. However, due to the low number of parechovirus complete genomes available, the precise recombination partners could not be detected. The results suggest frequent intratypic recombination among parechoviruses. © 2017 Elsevier B.V. All rights reserved.
1. Background
Abbreviations: CDS, coding sequences; HPeV, human parechovirus; NGS, next generation sequencing; nt, nucleotide(s); UTR, untranslated region. ∗ Corresponding author at. University of Turku, Department of Virology, Kiinamyllynkatu 13, FIN-20520, Turku, Finland. E-mail addresses: [email protected] (P. Kolehmainen), aesipo@utu.fi (A. Siponen), teemu.smura@helsinki.fi (T. Smura), hannimari.kallio-kokko@helsinki.fi (H. Kallio-Kokko), olli.vapalahti@helsinki.fi (O. Vapalahti), anne.jaaskelainen@helsinki.fi (A. Jääskeläinen), sisko.tauriainen@utu.fi (S. Tauriainen). 1 These authors contributed equally. http://dx.doi.org/10.1016/j.jcv.2017.01.001 1386-6532/© 2017 Elsevier B.V. All rights reserved.
Human parechoviruses (HPeVs) are non-enveloped, singlestranded, positive-sense RNA-viruses and members of the family Picornaviridae. The HPeV genome, approximately 7350 nucleotides (nt) in size, encodes for a single polyprotein, which consists of three regions: P1, P2 and P3. The polyprotein is cleaved posttranslationally into three structural (VP0, VP3 and VP1 from P1) and seven non-structural proteins (2A, 2B, 2C from P2 and 3A-3D from P3) [1]. Both ends of the coding sequence (CDS) are flanked by untranslated regions; 5 UTR and 3 UTR. High seroprevalence and frequent detection of HPeV in fecal samples from healthy children [2–5] indicate that these are glob-
2
P. Kolehmainen et al. / Journal of Clinical Virology 88 (2017) 1–7
ally common viruses. HPeV infections are often asymptomatic or presented with mild gastrointestinal or respiratory symptoms and fever [3,6–8]. However, more severe infections such as viral encephalitis, meningitis or sepsis-like disease caused by HPeVs have been reported, especially in young infants [9–12]. The severity of infection seems to depend, at least partly, on the HPeV genotype. At the moment, HPeV types 1, 3 and 4 have been linked to more severe infections [12–16]; HPeV-3 most often. The HPeV genome is highly variable due to a high mutation rate [17] and frequent recombination events [18–20]. Especially in the P1 region, the nucleotide diversity of parechoviruses is greater than in the other regions of the genome [21]. High intertypic recombination frequency has been detected in the P2 and P3 regions, whereas in the P1 region only intratypic recombination has been found [18–20]. Knowledge of the genetic variation and evolution among any virus genus is important for understanding their virulence characteristics and epidemiology. The present number of complete HPeV sequences of different genotypes and from different geographical areas is limited and therefore studies on the recombination patterns, breakpoints and frequencies are of great importance. 2. Objectives Three HPeV-4 isolates from different infants were isolated during autumn 2012, sequenced and their complete coding sequences were analyzed for sequence similarity and recombination events. These HPeV–4 s were the first type 4 HPeVs found in Finland, and caused a small outbreak of sepsis-like disease in infants. Sepsis-like disease is a more common clinical outcome for HPeV-3, so these viruses caused more severe symptoms than previously reported for HPeV-4 [13,14]. Prior to this study, there were only four complete HPeV-4 genomes available in the GeneBank. Therefore, these three new isolates are valuable additions for future studies on parechovirus molecular epidemiology and evolution. 3. Study design 3.1. Samples Three HPeV-4 viruses FI121236, FI121290 and FI121301 were isolated from stool and serum samples of three patients (described earlier [13,14]). All patients were hospitalized with suspected sepsis in Helsinki, October 2012. Children were aged 1–2 months, two were boys and one girl. The viruses were isolated and passaged 1–2 times in human colon adenocarcinoma cells (HT-29, ATCC) prior to viral RNA extraction with QIAamp Viral RNA kit (Qiagen) according to the manufacturer’s instructions. Virus isolation and passaging was done at separate times to avoid cross contamination of samples.
untranslated genome regions using commercial kits, 5 RACE and 3 RACE System for Rapid Amplification of cDNA Ends (Invitrogen, Life technologies). The PCR fragments obtained from RACE amplifica® tion were cloned into pGEM -T Easy Vector (Promega) and purified with QIAprep Spin Miniprep Kit (Qiagen) before sequencing. Random hexamers were used in the cDNA synthesis with Maxima first strand cDNA synthesis kit (Invitrogen) prior to the PCR with each primer pair using DreamTaq DNA polymerase (Thermo Scientific). PCR fragments were purified with exonuclease I and FastAP thermosensitive alkaline phosphatase (Life technologies). Sanger sequencing was conducted at GATC Biotech (Konstanz, Germany). The sequence chromatograms were analyzed and manually edited in Bioedit v7.2.5 [22] and the assembly of the complete genome from the fragments was conducted with the CAP3 program [23] in Unipro UGENE 1.15 software [24]. 3.3. Nucleotide sequence alignment Sequence alignment was conducted using Clustal W algorithm [25] implemented in MEGA 6.0 software [26]. In addition to HPeV4 genomes sequenced in this study, all complete HPeV genomes or complete CDS sequences available in the GenBank on 26.6.2016 with search words “human parechovirus” and “complete” (Supplement 1) were added into the alignment. Only one representative sequence from two or more highly similar sequences (>99% similarity) was included into the final analysis of the distance between sequences by MEGA 6.0. Additional 62 sequences were used for the analysis of the 3D region. 3.4. Phylogenetic and recombination analysis Phylogenetic trees were constructed by the neighbor-joining method in MEGA 6.0 using Tamura-Nei substitution model [27] and 1000 bootstrap replicates. Recombination events were identified with similarity plot analysis, using a 200 nt window and 20 nt steps, and bootscanning analysis [28], using a 500 nt window and 20 nt steps, with SimPlot 3.5.1 software [29]. For the 3D gene region, the phylogenetic tree was constructed using the Bayesian Monte Carlo Markov Chain (MCMC) method implemented in BEAST version 1.8.0 [30] using Tamura-Nei substitution model, log normal relaxed molecular clock and constant population size. The Bayesian analysis was run for 50 million states and sampled every 1000 states. Posterior probabilities were calculated with a burn-in of 5 million states and checked for convergence using Tracer version 1.6 [31] 3.5. GenBank accession numbers The full length HPeV-4 sequences are accessible in GenBank with accession numbers: KY404169-KY404171 4. Results
3.2. Complete genome sequencing DNAse I (Thermo Scientific) treated RNA samples of isolates FI121236 and FI121290 were subjected to next generation sequencing (NGS) on the MiSeq sequencer platform (Illumina) at the Finnish institute of Molecular Medicine (FIMM, Helsinki, Finland). The data generated with the NGS was of low quality and therefore sequencing of all three isolates was later conducted with Sanger method. However, NGS data was used as a template together with complete HPeV-4 sequences from the GenBank for designing primers for amplification of the complete genome. Nine partially overlapping primer pairs targeting fragments of 700–900 nucleotides in size were designed to cover the CDS (Table 1). Two pairs of primers were designed for the sequencing of the two
4.1. Complete coding region sequences of the Finnish HPeV-4 isolates An almost complete genome sequence, approximately 7200 nucleotides long (excluding only about 70 nucleotides from the 5 end) was determined for HPeV-4 isolates FI121236, FI121290 and FI121301. The nucleotide sequences of these isolates were 99.8% similar to each other and therefore clustered closely together in the sequence analysis independent of the region under observation. These isolates can be considered to be of one strain, which circulated in the Helsinki region in fall 2012 causing sepsis-like symptoms in new-born babies. Laboratory contamination was excluded by separate cultivation of samples.
P. Kolehmainen et al. / Journal of Clinical Virology 88 (2017) 1–7
3
Table 1 Primers designed for amplification and sequencing. Primer name(s)
Fragment position
Forward primer
Reverse primer
HP4 5RACE1 HP4 5RACE2 HP4 9f HP4 17r HP4 14Nf HP4 24Nr HPeV VP1fa HPeV VP1reva HP4 32Nf HP4 40Nr HP4 39Nf HP4 47r HP4 45f HP4 53r HP4 52f HP4 60r HP4 59Nf HP4 66Nr HP4 65f HP4 72r HP3 3RACE1 HP3 3RACE2
0−1035 0−977 909–1740
– TGTGGTCCAAGCAACAACTA
GGTGACGTCATAAGCC GGCATAGTTGGGGCAGAAGG TCCAACTAGGGCTACTGACT
1492–2484
GATGTGACTGTGTTAGGAAGC
TGGCTTTTCACCTCCCAGAG
2374–3325
ATTCRTGGGGYTCMCARATGG
AATATCCTTAGCAATDGTYTCACARTT
3204–4015
ATTGACTCCAGACTGGGTCG
GAGGCATAGTCCAGGATAGC
3937–4719
ATGGTCCTGAGTGTATTCAAACC
CACTTCCCAACACTCACCAG
4582–5355
TTGCAAGATTCTGGTGCATT
CACAGTGAGTAAGGTGTCC
5242–6005
GTGACCCAAAGGGAGTTCAA
AAGCACTCGACTGGTTCCTC
5922–6621
CAGTCTATGGTGCTGTAGAAG
ATGGCAATAAGCCAACACTTCC
6531–7290
CATGATCAATGCCCTGAATG
CCATAACAAAGAAAAACCAAAACA
7023-polyA 7105-polyA
GGTTATTTCCCAGAGTCCACAT AAGCAGCAACTTCAATCCTAC
–
Genome position according to HPeV-4/K251176-02. a From Kolehmainen et al., 2012 [2].
Previously, only four full-length HPeV-4 sequences from samples collected in USA in 1979, the Netherlands in 2002, Japan in 2005 and Taiwan in 2011, have been available [32–35]. Therefore, the dataset in our analysis consisted of seven complete HPeV-4 coding sequences, in addition to the 57 complete coding sequences of other genotypes (Supplement 1). Compared to other type 4 HPeVs, 3 nucleotides (1 amino acid) were missing in all of the 3 Finnish isolates at positions 1585–1587 (position according to reference HPeV-4/K251176-02) in the 1C region, encoding for the VP3 protein (Fig. 1). At this site, there is variation between types: HPeV-1, HPeV-2, HPeV-6 and HPeV-8 have also a deletion at this position, compared to HPeV-3, HPeV-5 and HPeV-7 (data not shown). 4.2. Phylogenetic relationships of distinct genes Frequent variation in the clustering pattern was observed between the phylogenetic trees generated from different HPeV genes (Fig. 2; VP1, 2C, 3D, Supplement 2–11). The P1 sequence of Finnish HPeV-4 isolates presented highest similarity to HPeV4/K251176-02 (94.7%), isolated from a 6-day-old infant with high fever in the Netherlands 2002 [33], followed by the other HPeV-4 strains (80.7-82.4%) (Supplement 2 and 12). The phylogenetic clustering pattern of non-structural P2 and P3 regions was incongruent compared to that of the P1 region, and did not follow type specific clustering (Supplement 2–4). In the P2 region, the Finnish HPeV-4 and HPeV-4/K25117602 grouped together with more recent HPeV-3 isolates that caused sepsis-like disease, CNS infection and myalgia: VGHKS-2007 (Taiwan 2007), VGHKS 08217-2013 (Taiwan 2013), TW-030672011 (Taiwan 2011), 1361K-162589-Yamagata-2008 (Japan 2008), BJ-C3174 (China 2012) and BONN-2 (Germany, 2010). These HPeV-3 isolates, except the TW-03067-2011, formed a distinct subcluster within HPeV-3 type also in the P1 region. The phylogenetic trees constructed on the basis of distinct genes (2A-2C) in the P2 region suggested that the Finnish HPeV-4 strain formed a separate cluster with these six HPeV-3 strains in the 2B and 2C genes (Supplement 8, Fig. 2) but not in the 2A gene (Supplement 7). In the 2C gene, the HPeV-1 strain CAU10-NN isolated from a healthy child formed an out-group for this cluster.
Similar to the P2 region, the Finnish HPeV-4 isolates clustered together with HPeV-4/K251176-02 and the above-mentioned HPeV-3 and HPeV-1 strains also in the 3A gene (Supplement 9). However, in the 3C gene HPeV-4/K251176-02 and the Finnish HPeV-4 strain formed a separate highly supported cluster, whereas the above-mentioned HPeV-3 strains clustered together with strain HPeV-3/651689 (the Netherlands 2006) (Supplement 10). In the 3D gene the Finnish isolates were not similar to HPeV4/K251176-02 and instead were more closely related to a group consisting of several HPeV-1 and HPeV-3 isolates from: the Netherlands between years 1994–2004 (HPeV-1/252581, HPeV3s: 152037, 450936, K8-94, K11-94, K12-94, K20-94), Japan in the year 1999 (HPeV-3/A308/99; causing transient paralysis), Canada in the year 2001 (HPeV-3/Can82853-1; causing fever, rash and otitis media), Germany in the year 2003 (HPeV-1/BNI-788st; causing enteritis) and Taiwan in the year 2010 (HPeV-1/TW-71594-2010) (Fig. 2). Notably, the HPeV-3 isolates were not the same that clustered with the Finnish isolates in the 2B, 2C and 3A regions. Since the long branch lengths of this cluster suggested that the recombination partner of the Finnish HPeV-4 strain is not presented in the dataset, 62 additional partial 3D region sequences were included in the dataset. On the basis of this partial 3D dataset, the Finnish HPeV-4 isolates clustered together with six HPeV-1 sequences from Thailand (2006–2009) (Supplement 11) [35]. However, these strains had 5.0-6.6% nucleotide differences and the molecular clock analysis suggested tMRCA of 8.2 years (95%HPD 6.0 − 15.6) for the Finnish and Thai sequences, suggesting that either the recombination event has occurred years ago, or the actual recombination partner of the Finnish HPeV-4 isolates is not represented in the dataset. 4.3. Recombination analysis Simplot analysis of complete genomes (Fig. 3a) revealed a clear recombination event during the evolution of the HPeV-4 lineage that consisted of the Finnish isolates and the strain K251176-02 from the Netherlands. Similar to the data presented in gene-based phylogenetic trees the high, 95% similarity of HPeV-4/K251176-02 to Finnish HPeV-4 isolates was apparent for the first 6000 nt from the 5 end of the genome. In the 3D region the similarity between
4
P. Kolehmainen et al. / Journal of Clinical Virology 88 (2017) 1–7
Fig. 1. Amino acid sequence of the VP3 protein from position 286 to position 307 (position of HPeV-4/K251176-02). Sequences of 7 HPeV-4 isolates are shown.
Fig. 2. Phylogenetic trees of regions VP1 (702 nt), 2C (987 nt) and 3D (1407 nt) and the HPeV genome organization. Different HPeV types are defined by symbols: 䊏 HPeV1, 䊐 HPeV2, HPeV3, HPeV4 (Finnish isolates grey filled), HPeV5, HPeV6, HPeV7 and 䊉 HPeV8. Bars indicate nucleotide divergence.
the strain K251176-02 and Finnish HPeV-4 isolates dropped significantly and the Finnish HPeV-4 isolates were more similar (89–92% nt identity) to several HPeV-1 and HPeV-3 isolates. Notably, also two HPeV-3 strains (TW-7159-2010 and VGHKS-2007) isolated in Taiwan 2007 and 2010, had high similarities with the HPeV-4 strain K251176-02 and the Finnish HPeV4 isolates in the P2 coding region. These results suggest one or more recombination events during the evolutionary history of Finnish HPeV-4 isolates and HPeV4/K251176-02. However, the exact recombination partners cannot
be concluded from the data available. Similar observations were made in the bootscanning analysis (Fig. 3b), which showed grouping of Finnish HPeV-4 and HPeV-4/K251176-02 together for the first 6000 nt of the genomes and the slightly lower similarity of the Finnish HPeV-4 strain to HPeV-1 and HPeV-3 strains after the recombination breakpoint.
P. Kolehmainen et al. / Journal of Clinical Virology 88 (2017) 1–7
5
Fig. 3. Simplot (a) and bootscan (b) analysis of Finnish HPeV-4/FI121290 compared to selected HPeV-1, HPeV-3 and HPeV-4 strains.
5. Discussion This study presents complete coding sequences for three HPeV4 isolates, that caused sepsis-like disease in Finnish infants in autumn 2012 [13,14]. The sequencing of complete coding regions allowed analysis for their phylogenetic relations and recombination. Four main observations were made: 1) In the P1 and P2 regions, the Finnish HPeV-4 isolates were highly similar to the HPeV-4 strain isolated in the Netherlands in 2002; 2) the Finnish isolates had a 3 nucleotide deletion compared with other HPeV–4s in the 1C region; 3) in the region spanning from genes 2B to 3A, several HPeV-1 and HPeV-3 strains clustered together with HPeV4 strain from Finland; 4) this sequence similarity was lost in the 3D region, where the Finnish HPeV-4 isolates clustered together with a different set of HPeV-1 and HPeV-3 strains. As there were only 61 complete HPeV genomes in GenBank, a larger partial 3D sequence dataset was analyzed. On the basis of this larger set
the Finnish HPeV–4s clustered together with HPeV-1 strains isolated in Thailand between years 2006 and 2009. Together, these results indicate recombination during the evolution of these HPeV4 isolates. However, the exact recombination partners cannot be concluded unambiguously from the dataset. Simplot analysis of complete sequences clearly showed two recombination events in the evolution of the Finnish HPeV-4 strain. In the 2B-C sequence region the HPeV-4 strain K251176-02 and the Finnish isolates shared high sequence similarity to several HPeV-3 strains, suggesting intertypic recombination. In another recombination event the Finnish isolates lost their similarity to the HPeV-4/K251176-02 in the 3D region and, instead, were more similar to HPeV-1 strains from Thailand. Notably, the first (2B-C) recombination event has occurred between HPeV-4 and possibly HPeV-3, which have been reported to recombine seldom with other genotypes [18,19]. However, the phylogenetic analysis proposed relatively large evolutionary distances between the members of
6
P. Kolehmainen et al. / Journal of Clinical Virology 88 (2017) 1–7
both 2A/3A and 3D clusters. Therefore it is likely that the direct recombination parents are not included in the dataset (i.e. have not been isolated and sequenced so far). In addition to high mutation rate, homologous recombination has been shown to play a significant role in the evolution of almost all genera of picornaviruses [17,36,37]. In this respect, HPeVs resemble other picornaviruses [20]. These mechanisms produce divergence in the virus populations and, most likely, contribute significantly to their spreading and virulence. The recombination of HPeV-4 has been reported before in several studies, mainly based on observations on the difference in phylogenetic clustering between the capsid region (VP0/VP3) and the RNA polymerase region (3D)[18,19,38]. The analysis of two short fragments from distinct regions allows the detection of recombination but lacks insight into the number and positions of recombination breakpoints. Determining recombination history and the breakpoints require data from potential partners participating in a recombination event. However, in the case of HPeVs, the major limitation in recombination studies is the small number of complete genomes that are currently available. The previously described recombination breakpoints for HPeVs include areas all around the coding sequence; however, the intertypic breakpoints concentrate primarily on the non-structural regions in P2 and P3, whereas P1 facilitates mostly intratypic recombination breakpoints [18–21,39,40]. Recombination has been suggested to affect the infection properties and virulence of viruses. With enteroviruses, recombination events have often been shown to precede the emergence of novel circulating lineages [41–45]. However, it has proven difficult to link recombination events to higher virulence [46–48]. The symptoms of the children with the Finnish HPeV-4 isolates were more severe in comparison to those observed previously in HPeV-4 cases [7,13,14,33]. Further studies are required to evaluate the roles of point mutations and the potential effect of the recombination events observed in this study with respect to the level of virulence of the Finnish HPeV4 isolates. Funding This work was financially supported by the Jane and Aatos Erkko Foundation, and HUSLAB (grant no. TYH2011305; Helsinki University Hospital, Finland). Competing interests None declared Ethical approval Not required, all clinical samples were analyzed anonymously encoded. Acknowledgments Anni Kauppinen is thanked for technical assistance. CSC − IT Center for Science Ltd. (Espoo, Finland) is acknowledged for the allocation of computational resources. The Finnish institute of Molecular Medicine (FIMM, Helsinki, Finland) is thanked for technical assistance. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jcv.2017.01.001.
References [1] G. Stanway, P. Joki-Korpela, T. Hyypia, Human parechoviruses–biology and clinical significance, Rev. Med. Virol. 10 (2000) 57–69. [2] P. Kolehmainen, S. Oikarinen, M. Koskiniemi, O. Simell, J. Ilonen, M. Knip, et al., Human parechoviruses are frequently detected in stool of healthy Finnish children, J. Clin. Virol. 54 (2012) 156–161. [3] G. Tapia, O. Cinek, E. Witso, M. Kulich, T. Rasmussen, B. Grinde, et al., Longitudinal observation of parechovirus in stool samples from Norwegian infants, J. Med. Virol. 80 (2008) 1835–1842. [4] S. Tauriainen, M. Martiskainen, S. Oikarinen, M. Lonnrot, H. Viskari, J. Ilonen, et al., Human parechovirus 1 infections in young children-no association with type 1 diabetes, J. Med. Virol. 79 (2007) 457–462. [5] B. Westerhuis, P. Kolehmainen, K. Benschop, N. Nurminen, G. Koen, M. Koskiniemi, et al., Human parechovirus seroprevalence in Finland and the Netherlands, J. Clin. Virol. 58 (2013) 211–215. [6] H. Harvala, P. Simmonds, Human parechoviruses: biology, epidemiology and clinical significance, J. Clin. Virol. 45 (2009) 1–9. [7] D. Pajkrt, K.S. Benschop, B. Westerhuis, R. Molenkamp, L. Spanjerberg, K.C. Wolthers, Clinical characteristics of human parechoviruses 4–6 infections in young children, Pediatr. Infect. Dis. J. 28 (2009) 1008–1010. [8] S. Tauriainen, S. Oikarinen, K. Taimen, J. Laranne, M. Sipila, M. Lonnrot, et al., Temporal relationship between human parechovirus 1 infection and otitis media in young children, J. Infect. Dis. 198 (2008) 35–40. [9] K.S. Benschop, J. Schinkel, R.P. Minnaar, D. Pajkrt, L. Spanjerberg, H.C. Kraakman, et al., Human parechovirus infections in Dutch children and the association between serotype and disease severity, Clin. Infect. Dis. 42 (2006) 204–210. [10] H. Harvala, I. Robertson, T. Chieochansin, E.C. McWilliam Leitch, K. Templeton, P. Simmonds, Specific association of human parechovirus type 3 with sepsis and fever in young infants, as identified by direct typing of cerebrospinal fluid samples, J. Infect. Dis. 199 (2009) 1753–1760. [11] R. Selvarangan, M. Nzabi, S.B. Selvaraju, P. Ketter, C. Carpenter, C.J. Harrison, Human parechovirus 3 causing sepsis-like illness in children from midwestern United States, Pediatr. Infect. Dis. J. 30 (2011) 238–242. [12] M.A. Verboon-Maciolek, F. Groenendaal, C.D. Hahn, J. Hellmann, A.M. van Loon, G. Boivin, et al., Human parechovirus causes encephalitis with white matter injury in neonates, Ann. Neurol. 64 (2008) 266–273. [13] A.J. Jaaskelainen, P. Kolehmainen, H. Kallio-Kokko, T. Nieminen, M. Koskiniemi, S. Tauriainen, et al., First two cases of neonatal human parechovirus 4 infection with manifestation of suspected sepsis Finland, J. Clin. Virol. 58 (2013) 328–330. [14] P. Kolehmainen, A. Jääskeläinen, S. Blomqvist, H. Kallio-Kokko, K. Nuolivirta, M. Helminen, et al., Human parechovirus types 3 and 4 associate with severe infections in young children, Pediatr. Infect. Dis. J. 33 (2014) 1109–1113. [15] M. Koskiniemi, R. Paetau, K. Linnavuori, Severe encephalitis associated with disseminated echovirus 22 infection, Scand. J. Infect. Dis. 21 (1989) 463–466. [16] A.L. van Zwol, M. Lequin, C. Aarts-Tesselaar, A.A. van der Eijk, G.A. Driessen, M. de Hoog, et al., Fatal neonatal parechovirus encephalitis, BMJ Case Rep. 2009 (2009). [17] N.R. Faria, M. de Vries, F.J. van Hemert, K. Benschop, L. van der Hoek, Rooting human parechovirus evolution in time, BMC Evol. Biol. 9 (2009) 164. [18] K.S. Benschop, M. de Vries, R.P. Minnaar, G. Stanway, L. van der Hoek, K.C. Wolthers, et al., Comprehensive full-length sequence analyses of human parechoviruses: diversity and recombination, J. Gen. Virol. 91 (2010) 145–154. [19] K.S. Benschop, C.H. Williams, K.C. Wolthers, G. Stanway, P. Simmonds, Widespread recombination within human parechoviruses: analysis of temporal dynamics and constraints, J. Gen. Virol. 89 (2008) 1030–1035. [20] J.F. Drexler, K. Grywna, A. Lukashev, A. Stocker, P.S. Almeida, J. Wieseler, et al., Full genome sequence analysis of parechoviruses from Brazil reveals geographical patterns in the evolution of non-structural genes and intratypic recombination in the capsid region, J. Gen. Virol. 92 (2011) 564–571. [21] J. Calvert, T. Chieochansin, K.S. Benschop, E.C. McWilliam Leitch, J.F. Drexler, K. Grywna, et al., Recombination dynamics of human parechoviruses: investigation of type-specific differences in frequency and epidemiological correlates, J. Gen. Virol. 91 (2010) 1229–1238. [22] T.A. Hall, Bioedit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT, Nucleic Acids Symp. Ser. 41 (1999) 95–98. [23] X. Huang, A. Madan, CAP3: a DNA sequence assembly program, Genome Res. 9 (1999) 868–877. [24] K. Okonechnikov, O. Golosova, M. Fursov, Unipro UGENE: a unified bioinformatics toolkit, Bioinformatics 28 (2012) 1166–1167. [25] J.D. Thompson, D.G. Higgins, T.J. Gibson, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice, Nucleic Acids Res. 22 (1994) 4673–4680. [26] K. Tamura, G. Stecher, D. Peterson, A. Filipski, S. Kumar, MEGA6: molecular evolutionary genetics analysis version 6.0, Mol. Biol. Evol. 30 (2013) 2725–2729. [27] K. Tamura, M. Nei, Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees, Mol. Biol. Evol. 10 (1993) 512–526.
P. Kolehmainen et al. / Journal of Clinical Virology 88 (2017) 1–7 [28] M.O. Salminen, J.K. Carr, D.S. Burke, F.E. McCutchan, Identification of breakpoints in intergenotypic recombinants of HIV type 1 by bootscanning, AIDS Res. Hum. Retroviruses 11 (1995) 1423–1425. [29] K.S. Lole, R.C. Bollinger, R.S. Paranjape, D. Gadkari, S.S. Kulkarni, N.G. Novak, et al., Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination, J. Virol. 73 (1999) 152–160. [30] A.J. Drummond, M.A. Suchard, D. Xie, A. Rambaut, Bayesian phylogenetics with BEAUti and the BEAST 1.7, Mol. Biol. Evol. 29 (2012) 1969–1973. [31] A. Rambaut, M.A. Suchard, D. Xie, A.J. Drummond, Tracer. 1.6. Available from http://beast.bio.ed.ac.uk/Tracer (2013). [32] M. Al-Sunaidi, C.H. Williams, P.J. Hughes, D.P. Schnurr, G. Stanway, Analysis of a new human parechovirus allows the definition of parechovirus types and the identification of RNA structural domains, J. Virol. 81 (2007) 1013–1021. [33] K.S. Benschop, J. Schinkel, M.E. Luken, P.J. van den Broek, M.F. Beersma, N. Menelik, et al., Fourth human parechovirus serotype, Emerg. Infect. Dis. 12 (2006) 1572–1575. [34] K. Wakatsuki, D. Kawamoto, H. Hiwaki, K. Watanabe, H. Yoshida, Identification and characterization of two strains of human parechovirus 4 isolated from two clinical cases in Fukuoka City, Japan, J. Clin. Microbiol. 46 (2008) 3144–3146. [35] Y.N. Gong, G.W. Chen, S.L. Yang, C.J. Lee, S.R. Shih, K.C. Tsao, A next-generation sequencing data analysis pipeline for detecting unknown pathogens from mixed clinical samples and revealing their genetic diversity, PLoS One 11 (2016) e0151495. [36] P. Simmonds, Recombination and selection in the evolution of picornaviruses and other Mammalian positive-stranded RNA viruses, J. Virol. 80 (2006) 11124–11140. [37] P. Simmonds, J. Welch, Frequency and dynamics of recombination within different species of human enteroviruses, J. Virol. 80 (2006) 483–493. [38] T. Chieochansin, P. Vichiwattana, S. Korkong, A. Theamboonlers, Y. Poovorawan, Molecular epidemiology, genome characterization, and recombination event of human parechovirus, Virology 421 (2011) 159–166. [39] C.H. Williams, M. Panayiotou, G.D. Girling, C.I. Peard, S. Oikarinen, H. Hyoty, et al., Evolution and conservation in human parechovirus genomes, J. Gen. Virol. 90 (2009) 1702–1712.
7
[40] J. Zoll, J.M. Galama, F.J. van Kuppeveld, Identification of potential recombination breakpoints in human parechoviruses, J. Virol. 83 (2009) 3379–3383. [41] A. Mirand, C. Henquell, C. Archimbaud, H. Peigue-Lafeuille, J.L. Bailly, Emergence of recent echovirus 30 lineages is marked by serial genetic recombination events, J. Gen. Virol. 88 (2007) 166–176. [42] S. van der Sanden, J. van Eek, D.P. Martin, H. van der Avoort, H. Vennema, M. Koopmans, Detection of recombination breakpoints in the genomes of human enterovirus 71 strains isolated in the Netherlands in epidemic and non-epidemic years, 1963–2010, Infect. Genet. Evol. 11 (2011) 886–894. [43] E.C. McWilliam Leitch, J. Bendig, M. Cabrerizo, J. Cardosa, T. Hyypia, O.E. Ivanova, et al., Transmission networks and population turnover of echovirus 30, J. Virol. 83 (2009) 2109–2118. [44] E.C. McWilliam Leitch, M. Cabrerizo, J. Cardosa, H. Harvala, O.E. Ivanova, A.C. Kroes, et al., Evolutionary dynamics and temporal/geographical correlates of recombination in the human enterovirus echovirus types 9, 11, and 30, J. Virol 84 (2010) 9292–9300. [45] E.C. McWilliam Leitch, M. Cabrerizo, J. Cardosa, H. Harvala, O.E. Ivanova, S. Koike, et al., The association of recombination events in the founding and emergence of subgenogroup evolutionary lineages of human enterovirus 71, J. Virol. 86 (2012) 2676–2685. [46] C. Savolainen-Kopra, E. Samoilovich, H. Kahelin, A.K. Hiekka, T. Hovi, M. Roivainen, Comparison of poliovirus recombinants: accumulation of point mutations provides further advantages, J. Gen. Virol. 90 (2009) 1859–1868. [47] V. Pliaka, E. Dedepsidis, Z. Kyriakopoulou, G. Papadi, D. Tsakogiannis, A. Pratti, et al., Growth kinetic analysis of bi-recombinant poliovirus vaccine strains, Virus Genes 40 (2010) 200–211. [48] M. Schibler, D. Gerlach, Y. Martinez, S.V. Belle, L. Turin, L. Kaiser, et al., Experimental human rhinovirus and enterovirus interspecies recombination, J. Gen. Virol. 93 (2012) 93–101.
Contents lists available at ScienceDirect
Journal of Clinical Virology journal homepage: www.elsevier.com/locate/jcv
Intertypic recombination of human parechovirus 4 isolated from infants with sepsis-like disease Pekka Kolehmainen a,b , Anu Siponen a , Teemu Smura b , Hannimari Kallio-Kokko b,c , Olli Vapalahti b,c,d , Anne Jääskeläinen b,c,1 , Sisko Tauriainen a,∗,1 a
Department of Virology, University of Turku, Kiinamyllynkatu 13, 20520, Turku, Finland Department of Virology, University of Helsinki and Helsinki University Hospital, Haartmaninkatu 3, 00290, Helsinki, Finland c Department of Virology and Immunology, University of Helsinki and Helsinki University Hospital, HUSLAB, Topeliuksenkatu 32, 00290, Helsinki, Finland d Department of Veterinary Biosciences, Faculty of Veterinary Medicine, University of Helsinki, Agnes Sjöbergin katu 2, 00790, Helsinki, Finland b
a r t i c l e
i n f o
Article history: Received 13 October 2016 Received in revised form 30 December 2016 Accepted 2 January 2017 Keywords: Human parechovirus HPeV-4 Complete coding sequence Sepsis-like disease Recombination Phylogenetic analysis
a b s t r a c t Background: Human parechoviruses (HPeVs) (family Picornaviridae), are common pathogens in young children. Despite their high prevalence, research on their genetic identity, diversity and evolution have remained scarce. Objectives: Complete coding regions of three previously reported HPeV-4 isolates from Finnish children with sepsis-like disease were sequenced in order to elucidate the phylogenetic relationships and potential recombination events during the evolution of these isolates. Study design: The isolated viruses were sequenced and aligned with all HPeV complete genome sequences available in GenBank. Phylogenetic trees were constructed and similarity plot and bootscanning methods were used for recombination analysis. Results: The three HPeV-4 isolates had 99.8% nucleotide sequence similarity. The phylogenetic analysis indicated that capsid-encoding sequences of these HPeV-4 isolates were closely related to other HPeV-4 strains (80.7-94.7% nucleotide similarity), whereas their non-structural region genes 2A to 3C clustered together with several HPeV-1 and HPeV-3 strains, in addition to the HPeV-4 strain K251176-02 (isolated 2002 in the Netherlands), but not with other HPeV-4 strains. However, in 3D-encoding sequence the Finnish HPeV-4 isolates did not cluster with the strain HPeV-4/K251176-02, but instead, formed a distinct group together with several HPeV-1 and HPeV-3 strains. Similarity plot and Bootscan analyses further confirmed intertypic recombination events in the evolution of the Finnish HPeV-4 isolates. Conclusion: Intertypic recombination event(s) have occurred during the evolution of HPeV-4 isolates from children with sepsis-like disease. However, due to the low number of parechovirus complete genomes available, the precise recombination partners could not be detected. The results suggest frequent intratypic recombination among parechoviruses. © 2017 Elsevier B.V. All rights reserved.
1. Background
Abbreviations: CDS, coding sequences; HPeV, human parechovirus; NGS, next generation sequencing; nt, nucleotide(s); UTR, untranslated region. ∗ Corresponding author at. University of Turku, Department of Virology, Kiinamyllynkatu 13, FIN-20520, Turku, Finland. E-mail addresses: [email protected] (P. Kolehmainen), aesipo@utu.fi (A. Siponen), teemu.smura@helsinki.fi (T. Smura), hannimari.kallio-kokko@helsinki.fi (H. Kallio-Kokko), olli.vapalahti@helsinki.fi (O. Vapalahti), anne.jaaskelainen@helsinki.fi (A. Jääskeläinen), sisko.tauriainen@utu.fi (S. Tauriainen). 1 These authors contributed equally. http://dx.doi.org/10.1016/j.jcv.2017.01.001 1386-6532/© 2017 Elsevier B.V. All rights reserved.
Human parechoviruses (HPeVs) are non-enveloped, singlestranded, positive-sense RNA-viruses and members of the family Picornaviridae. The HPeV genome, approximately 7350 nucleotides (nt) in size, encodes for a single polyprotein, which consists of three regions: P1, P2 and P3. The polyprotein is cleaved posttranslationally into three structural (VP0, VP3 and VP1 from P1) and seven non-structural proteins (2A, 2B, 2C from P2 and 3A-3D from P3) [1]. Both ends of the coding sequence (CDS) are flanked by untranslated regions; 5 UTR and 3 UTR. High seroprevalence and frequent detection of HPeV in fecal samples from healthy children [2–5] indicate that these are glob-
2
P. Kolehmainen et al. / Journal of Clinical Virology 88 (2017) 1–7
ally common viruses. HPeV infections are often asymptomatic or presented with mild gastrointestinal or respiratory symptoms and fever [3,6–8]. However, more severe infections such as viral encephalitis, meningitis or sepsis-like disease caused by HPeVs have been reported, especially in young infants [9–12]. The severity of infection seems to depend, at least partly, on the HPeV genotype. At the moment, HPeV types 1, 3 and 4 have been linked to more severe infections [12–16]; HPeV-3 most often. The HPeV genome is highly variable due to a high mutation rate [17] and frequent recombination events [18–20]. Especially in the P1 region, the nucleotide diversity of parechoviruses is greater than in the other regions of the genome [21]. High intertypic recombination frequency has been detected in the P2 and P3 regions, whereas in the P1 region only intratypic recombination has been found [18–20]. Knowledge of the genetic variation and evolution among any virus genus is important for understanding their virulence characteristics and epidemiology. The present number of complete HPeV sequences of different genotypes and from different geographical areas is limited and therefore studies on the recombination patterns, breakpoints and frequencies are of great importance. 2. Objectives Three HPeV-4 isolates from different infants were isolated during autumn 2012, sequenced and their complete coding sequences were analyzed for sequence similarity and recombination events. These HPeV–4 s were the first type 4 HPeVs found in Finland, and caused a small outbreak of sepsis-like disease in infants. Sepsis-like disease is a more common clinical outcome for HPeV-3, so these viruses caused more severe symptoms than previously reported for HPeV-4 [13,14]. Prior to this study, there were only four complete HPeV-4 genomes available in the GeneBank. Therefore, these three new isolates are valuable additions for future studies on parechovirus molecular epidemiology and evolution. 3. Study design 3.1. Samples Three HPeV-4 viruses FI121236, FI121290 and FI121301 were isolated from stool and serum samples of three patients (described earlier [13,14]). All patients were hospitalized with suspected sepsis in Helsinki, October 2012. Children were aged 1–2 months, two were boys and one girl. The viruses were isolated and passaged 1–2 times in human colon adenocarcinoma cells (HT-29, ATCC) prior to viral RNA extraction with QIAamp Viral RNA kit (Qiagen) according to the manufacturer’s instructions. Virus isolation and passaging was done at separate times to avoid cross contamination of samples.
untranslated genome regions using commercial kits, 5 RACE and 3 RACE System for Rapid Amplification of cDNA Ends (Invitrogen, Life technologies). The PCR fragments obtained from RACE amplifica® tion were cloned into pGEM -T Easy Vector (Promega) and purified with QIAprep Spin Miniprep Kit (Qiagen) before sequencing. Random hexamers were used in the cDNA synthesis with Maxima first strand cDNA synthesis kit (Invitrogen) prior to the PCR with each primer pair using DreamTaq DNA polymerase (Thermo Scientific). PCR fragments were purified with exonuclease I and FastAP thermosensitive alkaline phosphatase (Life technologies). Sanger sequencing was conducted at GATC Biotech (Konstanz, Germany). The sequence chromatograms were analyzed and manually edited in Bioedit v7.2.5 [22] and the assembly of the complete genome from the fragments was conducted with the CAP3 program [23] in Unipro UGENE 1.15 software [24]. 3.3. Nucleotide sequence alignment Sequence alignment was conducted using Clustal W algorithm [25] implemented in MEGA 6.0 software [26]. In addition to HPeV4 genomes sequenced in this study, all complete HPeV genomes or complete CDS sequences available in the GenBank on 26.6.2016 with search words “human parechovirus” and “complete” (Supplement 1) were added into the alignment. Only one representative sequence from two or more highly similar sequences (>99% similarity) was included into the final analysis of the distance between sequences by MEGA 6.0. Additional 62 sequences were used for the analysis of the 3D region. 3.4. Phylogenetic and recombination analysis Phylogenetic trees were constructed by the neighbor-joining method in MEGA 6.0 using Tamura-Nei substitution model [27] and 1000 bootstrap replicates. Recombination events were identified with similarity plot analysis, using a 200 nt window and 20 nt steps, and bootscanning analysis [28], using a 500 nt window and 20 nt steps, with SimPlot 3.5.1 software [29]. For the 3D gene region, the phylogenetic tree was constructed using the Bayesian Monte Carlo Markov Chain (MCMC) method implemented in BEAST version 1.8.0 [30] using Tamura-Nei substitution model, log normal relaxed molecular clock and constant population size. The Bayesian analysis was run for 50 million states and sampled every 1000 states. Posterior probabilities were calculated with a burn-in of 5 million states and checked for convergence using Tracer version 1.6 [31] 3.5. GenBank accession numbers The full length HPeV-4 sequences are accessible in GenBank with accession numbers: KY404169-KY404171 4. Results
3.2. Complete genome sequencing DNAse I (Thermo Scientific) treated RNA samples of isolates FI121236 and FI121290 were subjected to next generation sequencing (NGS) on the MiSeq sequencer platform (Illumina) at the Finnish institute of Molecular Medicine (FIMM, Helsinki, Finland). The data generated with the NGS was of low quality and therefore sequencing of all three isolates was later conducted with Sanger method. However, NGS data was used as a template together with complete HPeV-4 sequences from the GenBank for designing primers for amplification of the complete genome. Nine partially overlapping primer pairs targeting fragments of 700–900 nucleotides in size were designed to cover the CDS (Table 1). Two pairs of primers were designed for the sequencing of the two
4.1. Complete coding region sequences of the Finnish HPeV-4 isolates An almost complete genome sequence, approximately 7200 nucleotides long (excluding only about 70 nucleotides from the 5 end) was determined for HPeV-4 isolates FI121236, FI121290 and FI121301. The nucleotide sequences of these isolates were 99.8% similar to each other and therefore clustered closely together in the sequence analysis independent of the region under observation. These isolates can be considered to be of one strain, which circulated in the Helsinki region in fall 2012 causing sepsis-like symptoms in new-born babies. Laboratory contamination was excluded by separate cultivation of samples.
P. Kolehmainen et al. / Journal of Clinical Virology 88 (2017) 1–7
3
Table 1 Primers designed for amplification and sequencing. Primer name(s)
Fragment position
Forward primer
Reverse primer
HP4 5RACE1 HP4 5RACE2 HP4 9f HP4 17r HP4 14Nf HP4 24Nr HPeV VP1fa HPeV VP1reva HP4 32Nf HP4 40Nr HP4 39Nf HP4 47r HP4 45f HP4 53r HP4 52f HP4 60r HP4 59Nf HP4 66Nr HP4 65f HP4 72r HP3 3RACE1 HP3 3RACE2
0−1035 0−977 909–1740
– TGTGGTCCAAGCAACAACTA
GGTGACGTCATAAGCC GGCATAGTTGGGGCAGAAGG TCCAACTAGGGCTACTGACT
1492–2484
GATGTGACTGTGTTAGGAAGC
TGGCTTTTCACCTCCCAGAG
2374–3325
ATTCRTGGGGYTCMCARATGG
AATATCCTTAGCAATDGTYTCACARTT
3204–4015
ATTGACTCCAGACTGGGTCG
GAGGCATAGTCCAGGATAGC
3937–4719
ATGGTCCTGAGTGTATTCAAACC
CACTTCCCAACACTCACCAG
4582–5355
TTGCAAGATTCTGGTGCATT
CACAGTGAGTAAGGTGTCC
5242–6005
GTGACCCAAAGGGAGTTCAA
AAGCACTCGACTGGTTCCTC
5922–6621
CAGTCTATGGTGCTGTAGAAG
ATGGCAATAAGCCAACACTTCC
6531–7290
CATGATCAATGCCCTGAATG
CCATAACAAAGAAAAACCAAAACA
7023-polyA 7105-polyA
GGTTATTTCCCAGAGTCCACAT AAGCAGCAACTTCAATCCTAC
–
Genome position according to HPeV-4/K251176-02. a From Kolehmainen et al., 2012 [2].
Previously, only four full-length HPeV-4 sequences from samples collected in USA in 1979, the Netherlands in 2002, Japan in 2005 and Taiwan in 2011, have been available [32–35]. Therefore, the dataset in our analysis consisted of seven complete HPeV-4 coding sequences, in addition to the 57 complete coding sequences of other genotypes (Supplement 1). Compared to other type 4 HPeVs, 3 nucleotides (1 amino acid) were missing in all of the 3 Finnish isolates at positions 1585–1587 (position according to reference HPeV-4/K251176-02) in the 1C region, encoding for the VP3 protein (Fig. 1). At this site, there is variation between types: HPeV-1, HPeV-2, HPeV-6 and HPeV-8 have also a deletion at this position, compared to HPeV-3, HPeV-5 and HPeV-7 (data not shown). 4.2. Phylogenetic relationships of distinct genes Frequent variation in the clustering pattern was observed between the phylogenetic trees generated from different HPeV genes (Fig. 2; VP1, 2C, 3D, Supplement 2–11). The P1 sequence of Finnish HPeV-4 isolates presented highest similarity to HPeV4/K251176-02 (94.7%), isolated from a 6-day-old infant with high fever in the Netherlands 2002 [33], followed by the other HPeV-4 strains (80.7-82.4%) (Supplement 2 and 12). The phylogenetic clustering pattern of non-structural P2 and P3 regions was incongruent compared to that of the P1 region, and did not follow type specific clustering (Supplement 2–4). In the P2 region, the Finnish HPeV-4 and HPeV-4/K25117602 grouped together with more recent HPeV-3 isolates that caused sepsis-like disease, CNS infection and myalgia: VGHKS-2007 (Taiwan 2007), VGHKS 08217-2013 (Taiwan 2013), TW-030672011 (Taiwan 2011), 1361K-162589-Yamagata-2008 (Japan 2008), BJ-C3174 (China 2012) and BONN-2 (Germany, 2010). These HPeV-3 isolates, except the TW-03067-2011, formed a distinct subcluster within HPeV-3 type also in the P1 region. The phylogenetic trees constructed on the basis of distinct genes (2A-2C) in the P2 region suggested that the Finnish HPeV-4 strain formed a separate cluster with these six HPeV-3 strains in the 2B and 2C genes (Supplement 8, Fig. 2) but not in the 2A gene (Supplement 7). In the 2C gene, the HPeV-1 strain CAU10-NN isolated from a healthy child formed an out-group for this cluster.
Similar to the P2 region, the Finnish HPeV-4 isolates clustered together with HPeV-4/K251176-02 and the above-mentioned HPeV-3 and HPeV-1 strains also in the 3A gene (Supplement 9). However, in the 3C gene HPeV-4/K251176-02 and the Finnish HPeV-4 strain formed a separate highly supported cluster, whereas the above-mentioned HPeV-3 strains clustered together with strain HPeV-3/651689 (the Netherlands 2006) (Supplement 10). In the 3D gene the Finnish isolates were not similar to HPeV4/K251176-02 and instead were more closely related to a group consisting of several HPeV-1 and HPeV-3 isolates from: the Netherlands between years 1994–2004 (HPeV-1/252581, HPeV3s: 152037, 450936, K8-94, K11-94, K12-94, K20-94), Japan in the year 1999 (HPeV-3/A308/99; causing transient paralysis), Canada in the year 2001 (HPeV-3/Can82853-1; causing fever, rash and otitis media), Germany in the year 2003 (HPeV-1/BNI-788st; causing enteritis) and Taiwan in the year 2010 (HPeV-1/TW-71594-2010) (Fig. 2). Notably, the HPeV-3 isolates were not the same that clustered with the Finnish isolates in the 2B, 2C and 3A regions. Since the long branch lengths of this cluster suggested that the recombination partner of the Finnish HPeV-4 strain is not presented in the dataset, 62 additional partial 3D region sequences were included in the dataset. On the basis of this partial 3D dataset, the Finnish HPeV-4 isolates clustered together with six HPeV-1 sequences from Thailand (2006–2009) (Supplement 11) [35]. However, these strains had 5.0-6.6% nucleotide differences and the molecular clock analysis suggested tMRCA of 8.2 years (95%HPD 6.0 − 15.6) for the Finnish and Thai sequences, suggesting that either the recombination event has occurred years ago, or the actual recombination partner of the Finnish HPeV-4 isolates is not represented in the dataset. 4.3. Recombination analysis Simplot analysis of complete genomes (Fig. 3a) revealed a clear recombination event during the evolution of the HPeV-4 lineage that consisted of the Finnish isolates and the strain K251176-02 from the Netherlands. Similar to the data presented in gene-based phylogenetic trees the high, 95% similarity of HPeV-4/K251176-02 to Finnish HPeV-4 isolates was apparent for the first 6000 nt from the 5 end of the genome. In the 3D region the similarity between
4
P. Kolehmainen et al. / Journal of Clinical Virology 88 (2017) 1–7
Fig. 1. Amino acid sequence of the VP3 protein from position 286 to position 307 (position of HPeV-4/K251176-02). Sequences of 7 HPeV-4 isolates are shown.
Fig. 2. Phylogenetic trees of regions VP1 (702 nt), 2C (987 nt) and 3D (1407 nt) and the HPeV genome organization. Different HPeV types are defined by symbols: 䊏 HPeV1, 䊐 HPeV2, HPeV3, HPeV4 (Finnish isolates grey filled), HPeV5, HPeV6, HPeV7 and 䊉 HPeV8. Bars indicate nucleotide divergence.
the strain K251176-02 and Finnish HPeV-4 isolates dropped significantly and the Finnish HPeV-4 isolates were more similar (89–92% nt identity) to several HPeV-1 and HPeV-3 isolates. Notably, also two HPeV-3 strains (TW-7159-2010 and VGHKS-2007) isolated in Taiwan 2007 and 2010, had high similarities with the HPeV-4 strain K251176-02 and the Finnish HPeV4 isolates in the P2 coding region. These results suggest one or more recombination events during the evolutionary history of Finnish HPeV-4 isolates and HPeV4/K251176-02. However, the exact recombination partners cannot
be concluded from the data available. Similar observations were made in the bootscanning analysis (Fig. 3b), which showed grouping of Finnish HPeV-4 and HPeV-4/K251176-02 together for the first 6000 nt of the genomes and the slightly lower similarity of the Finnish HPeV-4 strain to HPeV-1 and HPeV-3 strains after the recombination breakpoint.
P. Kolehmainen et al. / Journal of Clinical Virology 88 (2017) 1–7
5
Fig. 3. Simplot (a) and bootscan (b) analysis of Finnish HPeV-4/FI121290 compared to selected HPeV-1, HPeV-3 and HPeV-4 strains.
5. Discussion This study presents complete coding sequences for three HPeV4 isolates, that caused sepsis-like disease in Finnish infants in autumn 2012 [13,14]. The sequencing of complete coding regions allowed analysis for their phylogenetic relations and recombination. Four main observations were made: 1) In the P1 and P2 regions, the Finnish HPeV-4 isolates were highly similar to the HPeV-4 strain isolated in the Netherlands in 2002; 2) the Finnish isolates had a 3 nucleotide deletion compared with other HPeV–4s in the 1C region; 3) in the region spanning from genes 2B to 3A, several HPeV-1 and HPeV-3 strains clustered together with HPeV4 strain from Finland; 4) this sequence similarity was lost in the 3D region, where the Finnish HPeV-4 isolates clustered together with a different set of HPeV-1 and HPeV-3 strains. As there were only 61 complete HPeV genomes in GenBank, a larger partial 3D sequence dataset was analyzed. On the basis of this larger set
the Finnish HPeV–4s clustered together with HPeV-1 strains isolated in Thailand between years 2006 and 2009. Together, these results indicate recombination during the evolution of these HPeV4 isolates. However, the exact recombination partners cannot be concluded unambiguously from the dataset. Simplot analysis of complete sequences clearly showed two recombination events in the evolution of the Finnish HPeV-4 strain. In the 2B-C sequence region the HPeV-4 strain K251176-02 and the Finnish isolates shared high sequence similarity to several HPeV-3 strains, suggesting intertypic recombination. In another recombination event the Finnish isolates lost their similarity to the HPeV-4/K251176-02 in the 3D region and, instead, were more similar to HPeV-1 strains from Thailand. Notably, the first (2B-C) recombination event has occurred between HPeV-4 and possibly HPeV-3, which have been reported to recombine seldom with other genotypes [18,19]. However, the phylogenetic analysis proposed relatively large evolutionary distances between the members of
6
P. Kolehmainen et al. / Journal of Clinical Virology 88 (2017) 1–7
both 2A/3A and 3D clusters. Therefore it is likely that the direct recombination parents are not included in the dataset (i.e. have not been isolated and sequenced so far). In addition to high mutation rate, homologous recombination has been shown to play a significant role in the evolution of almost all genera of picornaviruses [17,36,37]. In this respect, HPeVs resemble other picornaviruses [20]. These mechanisms produce divergence in the virus populations and, most likely, contribute significantly to their spreading and virulence. The recombination of HPeV-4 has been reported before in several studies, mainly based on observations on the difference in phylogenetic clustering between the capsid region (VP0/VP3) and the RNA polymerase region (3D)[18,19,38]. The analysis of two short fragments from distinct regions allows the detection of recombination but lacks insight into the number and positions of recombination breakpoints. Determining recombination history and the breakpoints require data from potential partners participating in a recombination event. However, in the case of HPeVs, the major limitation in recombination studies is the small number of complete genomes that are currently available. The previously described recombination breakpoints for HPeVs include areas all around the coding sequence; however, the intertypic breakpoints concentrate primarily on the non-structural regions in P2 and P3, whereas P1 facilitates mostly intratypic recombination breakpoints [18–21,39,40]. Recombination has been suggested to affect the infection properties and virulence of viruses. With enteroviruses, recombination events have often been shown to precede the emergence of novel circulating lineages [41–45]. However, it has proven difficult to link recombination events to higher virulence [46–48]. The symptoms of the children with the Finnish HPeV-4 isolates were more severe in comparison to those observed previously in HPeV-4 cases [7,13,14,33]. Further studies are required to evaluate the roles of point mutations and the potential effect of the recombination events observed in this study with respect to the level of virulence of the Finnish HPeV4 isolates. Funding This work was financially supported by the Jane and Aatos Erkko Foundation, and HUSLAB (grant no. TYH2011305; Helsinki University Hospital, Finland). Competing interests None declared Ethical approval Not required, all clinical samples were analyzed anonymously encoded. Acknowledgments Anni Kauppinen is thanked for technical assistance. CSC − IT Center for Science Ltd. (Espoo, Finland) is acknowledged for the allocation of computational resources. The Finnish institute of Molecular Medicine (FIMM, Helsinki, Finland) is thanked for technical assistance. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jcv.2017.01.001.
References [1] G. Stanway, P. Joki-Korpela, T. Hyypia, Human parechoviruses–biology and clinical significance, Rev. Med. Virol. 10 (2000) 57–69. [2] P. Kolehmainen, S. Oikarinen, M. Koskiniemi, O. Simell, J. Ilonen, M. Knip, et al., Human parechoviruses are frequently detected in stool of healthy Finnish children, J. Clin. Virol. 54 (2012) 156–161. [3] G. Tapia, O. Cinek, E. Witso, M. Kulich, T. Rasmussen, B. Grinde, et al., Longitudinal observation of parechovirus in stool samples from Norwegian infants, J. Med. Virol. 80 (2008) 1835–1842. [4] S. Tauriainen, M. Martiskainen, S. Oikarinen, M. Lonnrot, H. Viskari, J. Ilonen, et al., Human parechovirus 1 infections in young children-no association with type 1 diabetes, J. Med. Virol. 79 (2007) 457–462. [5] B. Westerhuis, P. Kolehmainen, K. Benschop, N. Nurminen, G. Koen, M. Koskiniemi, et al., Human parechovirus seroprevalence in Finland and the Netherlands, J. Clin. Virol. 58 (2013) 211–215. [6] H. Harvala, P. Simmonds, Human parechoviruses: biology, epidemiology and clinical significance, J. Clin. Virol. 45 (2009) 1–9. [7] D. Pajkrt, K.S. Benschop, B. Westerhuis, R. Molenkamp, L. Spanjerberg, K.C. Wolthers, Clinical characteristics of human parechoviruses 4–6 infections in young children, Pediatr. Infect. Dis. J. 28 (2009) 1008–1010. [8] S. Tauriainen, S. Oikarinen, K. Taimen, J. Laranne, M. Sipila, M. Lonnrot, et al., Temporal relationship between human parechovirus 1 infection and otitis media in young children, J. Infect. Dis. 198 (2008) 35–40. [9] K.S. Benschop, J. Schinkel, R.P. Minnaar, D. Pajkrt, L. Spanjerberg, H.C. Kraakman, et al., Human parechovirus infections in Dutch children and the association between serotype and disease severity, Clin. Infect. Dis. 42 (2006) 204–210. [10] H. Harvala, I. Robertson, T. Chieochansin, E.C. McWilliam Leitch, K. Templeton, P. Simmonds, Specific association of human parechovirus type 3 with sepsis and fever in young infants, as identified by direct typing of cerebrospinal fluid samples, J. Infect. Dis. 199 (2009) 1753–1760. [11] R. Selvarangan, M. Nzabi, S.B. Selvaraju, P. Ketter, C. Carpenter, C.J. Harrison, Human parechovirus 3 causing sepsis-like illness in children from midwestern United States, Pediatr. Infect. Dis. J. 30 (2011) 238–242. [12] M.A. Verboon-Maciolek, F. Groenendaal, C.D. Hahn, J. Hellmann, A.M. van Loon, G. Boivin, et al., Human parechovirus causes encephalitis with white matter injury in neonates, Ann. Neurol. 64 (2008) 266–273. [13] A.J. Jaaskelainen, P. Kolehmainen, H. Kallio-Kokko, T. Nieminen, M. Koskiniemi, S. Tauriainen, et al., First two cases of neonatal human parechovirus 4 infection with manifestation of suspected sepsis Finland, J. Clin. Virol. 58 (2013) 328–330. [14] P. Kolehmainen, A. Jääskeläinen, S. Blomqvist, H. Kallio-Kokko, K. Nuolivirta, M. Helminen, et al., Human parechovirus types 3 and 4 associate with severe infections in young children, Pediatr. Infect. Dis. J. 33 (2014) 1109–1113. [15] M. Koskiniemi, R. Paetau, K. Linnavuori, Severe encephalitis associated with disseminated echovirus 22 infection, Scand. J. Infect. Dis. 21 (1989) 463–466. [16] A.L. van Zwol, M. Lequin, C. Aarts-Tesselaar, A.A. van der Eijk, G.A. Driessen, M. de Hoog, et al., Fatal neonatal parechovirus encephalitis, BMJ Case Rep. 2009 (2009). [17] N.R. Faria, M. de Vries, F.J. van Hemert, K. Benschop, L. van der Hoek, Rooting human parechovirus evolution in time, BMC Evol. Biol. 9 (2009) 164. [18] K.S. Benschop, M. de Vries, R.P. Minnaar, G. Stanway, L. van der Hoek, K.C. Wolthers, et al., Comprehensive full-length sequence analyses of human parechoviruses: diversity and recombination, J. Gen. Virol. 91 (2010) 145–154. [19] K.S. Benschop, C.H. Williams, K.C. Wolthers, G. Stanway, P. Simmonds, Widespread recombination within human parechoviruses: analysis of temporal dynamics and constraints, J. Gen. Virol. 89 (2008) 1030–1035. [20] J.F. Drexler, K. Grywna, A. Lukashev, A. Stocker, P.S. Almeida, J. Wieseler, et al., Full genome sequence analysis of parechoviruses from Brazil reveals geographical patterns in the evolution of non-structural genes and intratypic recombination in the capsid region, J. Gen. Virol. 92 (2011) 564–571. [21] J. Calvert, T. Chieochansin, K.S. Benschop, E.C. McWilliam Leitch, J.F. Drexler, K. Grywna, et al., Recombination dynamics of human parechoviruses: investigation of type-specific differences in frequency and epidemiological correlates, J. Gen. Virol. 91 (2010) 1229–1238. [22] T.A. Hall, Bioedit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT, Nucleic Acids Symp. Ser. 41 (1999) 95–98. [23] X. Huang, A. Madan, CAP3: a DNA sequence assembly program, Genome Res. 9 (1999) 868–877. [24] K. Okonechnikov, O. Golosova, M. Fursov, Unipro UGENE: a unified bioinformatics toolkit, Bioinformatics 28 (2012) 1166–1167. [25] J.D. Thompson, D.G. Higgins, T.J. Gibson, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice, Nucleic Acids Res. 22 (1994) 4673–4680. [26] K. Tamura, G. Stecher, D. Peterson, A. Filipski, S. Kumar, MEGA6: molecular evolutionary genetics analysis version 6.0, Mol. Biol. Evol. 30 (2013) 2725–2729. [27] K. Tamura, M. Nei, Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees, Mol. Biol. Evol. 10 (1993) 512–526.
P. Kolehmainen et al. / Journal of Clinical Virology 88 (2017) 1–7 [28] M.O. Salminen, J.K. Carr, D.S. Burke, F.E. McCutchan, Identification of breakpoints in intergenotypic recombinants of HIV type 1 by bootscanning, AIDS Res. Hum. Retroviruses 11 (1995) 1423–1425. [29] K.S. Lole, R.C. Bollinger, R.S. Paranjape, D. Gadkari, S.S. Kulkarni, N.G. Novak, et al., Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination, J. Virol. 73 (1999) 152–160. [30] A.J. Drummond, M.A. Suchard, D. Xie, A. Rambaut, Bayesian phylogenetics with BEAUti and the BEAST 1.7, Mol. Biol. Evol. 29 (2012) 1969–1973. [31] A. Rambaut, M.A. Suchard, D. Xie, A.J. Drummond, Tracer. 1.6. Available from http://beast.bio.ed.ac.uk/Tracer (2013). [32] M. Al-Sunaidi, C.H. Williams, P.J. Hughes, D.P. Schnurr, G. Stanway, Analysis of a new human parechovirus allows the definition of parechovirus types and the identification of RNA structural domains, J. Virol. 81 (2007) 1013–1021. [33] K.S. Benschop, J. Schinkel, M.E. Luken, P.J. van den Broek, M.F. Beersma, N. Menelik, et al., Fourth human parechovirus serotype, Emerg. Infect. Dis. 12 (2006) 1572–1575. [34] K. Wakatsuki, D. Kawamoto, H. Hiwaki, K. Watanabe, H. Yoshida, Identification and characterization of two strains of human parechovirus 4 isolated from two clinical cases in Fukuoka City, Japan, J. Clin. Microbiol. 46 (2008) 3144–3146. [35] Y.N. Gong, G.W. Chen, S.L. Yang, C.J. Lee, S.R. Shih, K.C. Tsao, A next-generation sequencing data analysis pipeline for detecting unknown pathogens from mixed clinical samples and revealing their genetic diversity, PLoS One 11 (2016) e0151495. [36] P. Simmonds, Recombination and selection in the evolution of picornaviruses and other Mammalian positive-stranded RNA viruses, J. Virol. 80 (2006) 11124–11140. [37] P. Simmonds, J. Welch, Frequency and dynamics of recombination within different species of human enteroviruses, J. Virol. 80 (2006) 483–493. [38] T. Chieochansin, P. Vichiwattana, S. Korkong, A. Theamboonlers, Y. Poovorawan, Molecular epidemiology, genome characterization, and recombination event of human parechovirus, Virology 421 (2011) 159–166. [39] C.H. Williams, M. Panayiotou, G.D. Girling, C.I. Peard, S. Oikarinen, H. Hyoty, et al., Evolution and conservation in human parechovirus genomes, J. Gen. Virol. 90 (2009) 1702–1712.
7
[40] J. Zoll, J.M. Galama, F.J. van Kuppeveld, Identification of potential recombination breakpoints in human parechoviruses, J. Virol. 83 (2009) 3379–3383. [41] A. Mirand, C. Henquell, C. Archimbaud, H. Peigue-Lafeuille, J.L. Bailly, Emergence of recent echovirus 30 lineages is marked by serial genetic recombination events, J. Gen. Virol. 88 (2007) 166–176. [42] S. van der Sanden, J. van Eek, D.P. Martin, H. van der Avoort, H. Vennema, M. Koopmans, Detection of recombination breakpoints in the genomes of human enterovirus 71 strains isolated in the Netherlands in epidemic and non-epidemic years, 1963–2010, Infect. Genet. Evol. 11 (2011) 886–894. [43] E.C. McWilliam Leitch, J. Bendig, M. Cabrerizo, J. Cardosa, T. Hyypia, O.E. Ivanova, et al., Transmission networks and population turnover of echovirus 30, J. Virol. 83 (2009) 2109–2118. [44] E.C. McWilliam Leitch, M. Cabrerizo, J. Cardosa, H. Harvala, O.E. Ivanova, A.C. Kroes, et al., Evolutionary dynamics and temporal/geographical correlates of recombination in the human enterovirus echovirus types 9, 11, and 30, J. Virol 84 (2010) 9292–9300. [45] E.C. McWilliam Leitch, M. Cabrerizo, J. Cardosa, H. Harvala, O.E. Ivanova, S. Koike, et al., The association of recombination events in the founding and emergence of subgenogroup evolutionary lineages of human enterovirus 71, J. Virol. 86 (2012) 2676–2685. [46] C. Savolainen-Kopra, E. Samoilovich, H. Kahelin, A.K. Hiekka, T. Hovi, M. Roivainen, Comparison of poliovirus recombinants: accumulation of point mutations provides further advantages, J. Gen. Virol. 90 (2009) 1859–1868. [47] V. Pliaka, E. Dedepsidis, Z. Kyriakopoulou, G. Papadi, D. Tsakogiannis, A. Pratti, et al., Growth kinetic analysis of bi-recombinant poliovirus vaccine strains, Virus Genes 40 (2010) 200–211. [48] M. Schibler, D. Gerlach, Y. Martinez, S.V. Belle, L. Turin, L. Kaiser, et al., Experimental human rhinovirus and enterovirus interspecies recombination, J. Gen. Virol. 93 (2012) 93–101.