Intra-pituitary relationship of follicle stimulating hormone and luteinizing hormone during pubertal development in Atlantic bluefin tuna (Thunnus thynnus)

General and Comparative Endocrinology 194 (2013) 10–23

Contents lists available at ScienceDirect

General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen

Intra-pituitary relationship of follicle stimulating hormone and luteinizing hormone during pubertal development in Atlantic bluefin tuna (Thunnus thynnus) Nadia Berkovich a,b, Aldo Corriero c, Nicoletta Santamaria c, Constantinos C. Mylonas d, Robert Vassallo-Aguis e, Fernando de la Gándara f, Iris Meiri-Ashkenazi a, Vered Zlatnikov a, Hillel Gordin a, Christopher R. Bridges g, Hanna Rosenfeld a,⇑ a

Israel Oceanographic and Limnological Research, National Center for Mariculture, Eilat, Israel Department of Life Sciences, Ben-Gurion University, Eilat Campus, Eilat, Israel c Department of Animal Health and Welfare, University of Bari, Bari, Italy d Institute of Aquaculture, Hellenic Center for Marine Research, Crete, Greece e Malta Center for Fisheries Sciences, Marsaxlokk, Malta f Instituto Español de Oceanografía, Centro Oceanográfico de Murcia, Puerto de Mazarrón (Murcia), Spain g Heinrich-Heine Universität, Institut für Stoffwechelphysiologie, Düsseldorf, Germany b

a r t i c l e

i n f o

Article history: Received 18 June 2012 Revised 7 August 2013 Accepted 8 August 2013 Available online 20 August 2013 Keywords: Atlantic bluefin tuna Dot-blot-immunoassay Gonadotropins Puberty Sexual dimorphism Fish reproduction

a b s t r a c t As part of the endeavor aiming at the domestication of Atlantic bluefin tuna (BFT; Thunnus thynnus), first sexual maturity in captivity was studied by documenting its occurrence and by characterizing the key hormones of the reproductive axis: follicle stimulating hormone (FSH) and luteinizing hormone (LH). The full length sequence encoding for the related hormone b-subunits, bftFSHb and bftLHb, were determined, revealing two bftFSHb mRNA variants, differing in their 50 untranslated region. A quantitative immuno-dot-blot assay to measure pituitary FSH content in BFT was developed and validated enabling, for the first time in this species, data sets for both LH and FSH to be compared. The expression and accumulation patterns of LH in the pituitary showed a steady increase of this hormone, concomitant with fish age, reaching higher levels in adult females compared to males of the same age class. Conversely, the pituitary FSH levels were elevated only in 2Y and adult fish. The pituitary FSH to LH ratio was consistently higher (>1) in immature than in maturing or pubertal fish, resembling the situation in mammals. Nevertheless, the results suggest that a rise in the LH storage level above a minimum threshold may be an indicator of the onset of puberty in BFT females. The higher pituitary LH levels in adult females over males may further support this notion. In contrast three year-old (3Y) males were pubertal while cognate females were still immature. However, it is not yet clear whether the advanced puberty in the 3Y males was a general feature typifying wild BFT populations or was induced by the culture conditions. Future studies testing the effects of captivity and hormonal treatments on precocious maturity may allow for improved handling of this species in a controlled environment which would lead to more cost-efficient farming. Ó 2013 Elsevier Inc. All rights reserved.

1. Introduction The Atlantic bluefin tuna (BFT; Thunnus thynnus) is one of the largest fish species, displaying migration over long distances across the North Atlantic Ocean and the Mediterranean Sea. Despite the uncertainty as to the actual structure and size of BFT populations (Riccioni et al., 2010; Rooker et al., 2008), the fishery management ⇑ Corresponding author. Address: Israel Oceanographic and Limnological Research, National Center for Mariculture, P.O. Box 1212, Eilat 8112, Israel. Fax: +972 8 6375761. E-mail address: [email protected] (H. Rosenfeld). 0016-6480/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ygcen.2013.08.005

of this species is based on the two stock hypothesis, which proposes the existence of a Western Atlantic stock, spawning in the Gulf of Mexico during April–July (Baglin, 1982; Richards, 1976), and an Eastern Atlantic stock, spawning in the Mediterranean Sea during May–July (Corriero et al., 2003; Heinisch et al., 2008; Karakulak et al., 2004; Medina et al., 2002; Susca et al., 2001). In nature, the Eastern stock attains first sexual maturity (i.e., puberty) at 4– 5 years of age (Corriero et al., 2005), while the Western Atlantic stock matures only at 8 years of age (Baglin, 1982; Mather et al., 1995). Due to its high market value, the BFT is the object of the most intense fishery worldwide, and as such both of its stocks are under

N. Berkovich et al. / General and Comparative Endocrinology 194 (2013) 10–23

constant overfishing pressure (Fromentin and Powers, 2005; Fromentin, 2008; MacKenzie et al., 2009; Mather et al., 1995). Recently, significant progress in the controlled breeding of captive BFT broodstocks has been achieved (De Metrio et al., 2010; Mylonas et al., 2007, 2010; Rosenfeld et al., 2012), paving the way towards a self-sustained industry of this species. Nevertheless, despite the progress made, the effects of confinement on pubertal development of fish reared exclusively or from an immature stage in captivity remain unpredictable. As in other vertebrates, puberty in fish is affected by the interaction between environmental and genetic factors, and necessitates the full activation of the brain–pituitary–gonadal (BPG) axis, which depends largely on the coordinated functions of the two pituitary gonadotropins, luteinizing hormone (LH) and follicle-stimulating hormone (FSH) (Carrillo et al., 2009; Taranger et al., 2010). Both are heterodimeric, non-covalently bound glycoproteins composed of a common a-subunit and a hormone-specific b-subunit (Pierce and Parsons, 1981). The physiological functions of the gonadotropins in teleosts are not entirely clear; however, several lines of evidence suggest that FSH has a dominant role during early phases of gametogenesis, while LH is considered to be responsible for the final maturational processes, including oocyte maturation and ovulation in females and spermiation in males (Rosenfeld et al., 2007; Swanson et al., 2003; Yaron and Sivan, 2006). In the present study we investigated first sexual maturity occurring in cage-reared BFT juveniles by characterizing the key players of the BPG axis, LH and FSH, at both the protein and the hormone-subunit mRNA levels.

2. Materials and methods

11

ments. One cm thick gonad slices were fixed in Bouin’s fixative and used for histological analysis. 2.3. Gonadal histology and reproductive status assessment For histological evaluations of maturational stage, fixed gonad samples were dehydrated in increasing ethanol concentrations, clarified in xylene and embedded in paraffin wax. Five micrometer thick sections were cut and stained with hematoxylin-eosin. For the classification of the reproductive status of females, the most advanced oocyte stage was recorded for each specimen, according to the scheme used by Corriero et al. (2007). Atretic vitellogenic follicles were identified on the basis of the description of Hunter and Macewicz (1985). For the classification of the reproductive status of males, the type of spermatogenic cysts was recorded, and the quantity of spermatozoa in the lumen of seminiferous lobules was evaluated subjectively, as in Corriero et al. (2007). 2.4. Age determination The age of juvenile BFT was determined using the technique described by Santamaria et al. (2009). Briefly, about 0.7 mm thick cross-sections were obtained from each spine at the point near the base of the condyle using a low speed electric saw. Spine sections were observed with a binocular lens microscope under transmitted light connected to an image analyzer Quantimet 500 W (Leica, Wetzlar, Germany). Interpretation of growth bands was based on the recognition of the narrow translucent and wider opaque zones that are assumed to represent slow and fast growth, respectively. The age of the fish was estimated on the basis of translucent zones or rings, interpreted as annual events.

2.1. Experimental animals

2.5. RNA isolation, cDNA synthesis, and PCR amplification

For the study of puberty, Atlantic bluefin tuna (BFT) juveniles (n = 20; weight range 8–23 kg) were sampled on 7 July 2009 (sea water temperature 24 °C), coinciding with the species’ natural spawning season in the Mediterranean Sea (Corriero et al., 2003; Heinisch et al., 2008; Medina et al., 2002; Susca et al., 2001). The fish were caught during 2008 in the Adriatic Sea, between Italy and Croatia, and reared in sea cages (20-m diameter) at the Drvenik Tuna ranch (Islands of Drvenik and Kluda, Croatia). Two weeks earlier (24 June 2009; sea water temperature 24.5 °C) adult BFT (n = 19; weight range 50–100 kg) were sampled, and used as a reference for sexually mature fish. These fish were caught by a purse seine (30 to 70 miles to the southwest of Malta) during July 2008, and kept in sea cages (50-m diameter) at the Malta Fish Farming site (approximately 2 km off Marsaxlokk, Malta).

Total RNA from pituitary tissue was isolated by the guanidiniumthiocyanate–phenol–chloroform extraction method (Chomczynski and Sacchi, 1987) using the Bio-Tri reagent (Bio Lab Ltd., Jerusalem, Israel). The extracted RNA (5 lg) was treated with 6 units of DNAse-RNAse free (Promega, Madison, WI), and following DNAse inactivation (15 min at 65 °C) the RNA was used to prepare the 50 -and 30 -RACE-ready cDNAs by the SMART™-RACE PCR (Clontech, Palo Alto, CA) according to the manufacturer’s instructions. The cDNAs obtained were subjected to RACE-PCR amplifications using primer sets consisting of the apposite anchor primer and gene specific primer (GSP; Table 1). For initial cloning degenerate GSP were designed according to amino acid sequences displaying high conservation among Perciformes. The PCRs were carried out in a final volume of 50 ll using the GoTaqÒ Green Master Mix (Promega) and 25 pmol of each GSP. Cycling parameters were: initial denaturation at 94 °C for 3 min, followed by annealing at 50 °C for 1 min, and extension at 72 °C for 2 min, then 30 cycles consisting of denaturation at 94 °C for 1 min, annealing at 50 °C for 1 min, and extension at 72 °C for 1 min.

2.2. Sampling procedures Sampling was done by sacrificing one fish at a time using either a spear gun (Croatia) or a power-head (Malta). Each fish was lifted onto the deck of a service boat using a hydraulic crane. In the case of adult BFT, the heads and gonads were immediately removed, placed on ice and transported to the laboratory onshore within 1 h. In the case of juveniles the whole fish was brought on ice to the laboratory. Fork length, wet body mass (MB), and gonad mass (MG) were recorded on board ship or in the laboratory, and the relative gonadosomatic index (GSI) was calculated as GSI = 100⁄MG⁄MB1. The first spiniform ray of the first dorsal fin was removed to determine the age of the fish (as described below), while the pituitary was removed, quickly frozen in liquid nitrogen and stored at 80 °C until use for gene expression and hormone measure-

2.6. Cloning and sequence analyses PCR products were purified with QIAquick PCR Purification Kit (QIAGENE, Hilden, Germany) cloned into pGEMÒ-T easy vector (Promega), and sequenced with ABI PRISMÒ 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) at the DNA Biological Services, Tel Aviv University, Israel. Gene identity was confirmed by comparing the obtained sequences with those available at the GenBank (http://www.ncbi.nlm.nih.gov/Genbank/). The nucleotide sequences were translated using the JustBio translator program (www.justbio.com) and their identities confirmed using the BLAST

12

N. Berkovich et al. / General and Comparative Endocrinology 194 (2013) 10–23

Table 1 Gene specific primers used to clone the BFT gonadotropin b-subunits cDNA sequences and to quantify the respective gene expression levels by real-time PCR. Gene

Primer identification

Primer sequence (50 ? 30 )

Primers concentration for reactions (nM)

Amplicon size (bp)

FSHb

bftFSH F1 bftFSH F2 bftFSH R1 RTbftFSH F RTbftFSH R

CAYGAYGARCARAARAT TGYAAYGGNGAYTGG GGACGGACAGCTGGGTACG GGCATCACCGAGTTCATCCT AGGACCAGTCGCCATTACAGAT

400 400 400 150 150

150–168

bftLH F1 bftLH R1 RTbftLH F RTbftLH R

TTYCARTTRCCNCCN YARTARTARAANGG GCCACTGCATCACCAAGGA CGGGAGGACAGTCAGGAAGTT

400 400 150 150

348

RT bftrRNA F RT bftrRNA R

CTTTCGCTTTCGTCCGTCTT CCTGAATACCGCAGCTAGGAA

150 150

160

LHb

rRNA

109

117

The identifications F and R denote primer direction: Forward (50 ? 30 ) and reverse (30 ? 50 ), respectively. Bold letters within primer sequences represent the following degeneracy: N- any of the four nucleotides (A/T/C/G); R- A or G; Y- C or T; S- G or C; H- A or C or T. RT signs primers for real time PCR quantification.

algorithm (Blastp) of the National Center for Biotechnology Information (Bethesda, MD). 2.7. Quantitative real-time polymerase chain reaction Two lg of DNAse treated total RNA (as above) were reverse transcribed with random primers using the High Capacity cDNA Reverse Transcriptase kit (Applied Biosystems, Branchburg, NJ) according to manufacturer’s protocol. Quantitative real-time polymerase chain reaction (qPCR) was performed in duplicate in 10 ll reaction volumes consisting of Fast SYBRÒ Green Master Mix (Applied Biosystems). Amplification was carried out in a Fast RealTime PCR System (Applied Biosystems). Cycling parameters were as follows: 3 s at 95 °C, and 40 cycles of 3 s at 95 °C and 30 s at 60 °C. The presence of a single amplicon was verified using a melting curve run following the PCR. To normalize the levels of target genes, qPCR for rRNA 18S was also performed with the sample cDNAs. A negative control with sterile water as template was included in order to check for possible reagent contamination. In addition, in order to rule out the presence of contaminating genomic DNA, our qPCR experiments included minus-reverse transcriptase controls (i.e., PCR amplification using DNAse-treated total RNA samples without reverse transcription as a template). The results were analyzed by 7500 Fast Real-Time PCR System software (Applied Biosystems). Gene expression levels were calculated by: relative expression = 2DCt, Ct – threshold cycle (Livak and Schmittgen, 2001). The GSPs designed using the Primer Express 3.0 software (Applied Biosystems) are listed in Table 1.

2.9. Protein gel electrophoresis and Western blotting BFT pituitary protein extracts were prepared as in Rosenfeld et al. (2012) and 10–50 lg of sample protein was subjected to two dimensional (2D) or 1D gel electrophoresis. The first dimension in the 2D gel electrophoresis involved protein separation according to their isoelectric point by applying an electric field (66,431 V h in total) within a 3–10 pH gradient, using the 11 cm ReadyStrip IPG strips and PROTEAN IEF systems (Bio-Rad Laboratories, Rishon Le Zion, Israel). The second protein separation was based on their size, using a precast 4–20% linear gradient polyacrylamide gel (Bio-Rad Laboratories). In addition, yeast (Pichia pastoris) produced recombinant proteins (see below) and/ or proteins extracted from BFT pituitaries were subjected to 1D sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE) using the miniVE vertical electrophoresis system (Amersham Biosciences, Piscataway, NJ). Denaturated protein samples were separated by 15% SDS–PAGE in parallel to commercial size markers (Bio-Rad). Following separation the proteins were either visualized by a Coomassie staining or electrotransferred from the polyacrylamide gel to a nitrocellulose membrane (0.2 lm Protran Nitrocellulose membrane; Thermo Fisher Scientific, Victoria, Australia) using the Semi-Dry electro-blotting system (Thermo Fisher Scientific). After blocking with 5% skim milk blots were incubated with diluted anti-FSHpep (1:5000; see above) or anti-sbLH (1:10,000; Mañanós et al., 1997; Rosenfeld et al., 2003). A horseradish peroxidase conjugated to goat-anti-rabbit-IgG (Bio-Rad Laboratories) was used as secondary antibody. Signals were visualized by an ECL detection system (Amersham Biosciences).

2.8. Atlantic bluefin tuna FSHb peptide antigens and their antibodies A peptide corresponding to codons 66–80 (CNGDWSYEVKHIEGC; Fig. S1A) of the deduced bftFSHb amino acid sequence (GenBank Accession: ABP04057.1) was synthetically manufactured (BioSight Ltd. Karmiel, Israel) as a branched octamer peptide according to the Multiple Antigen Peptide method (Tam and Spetzler, 1997). The synthetic FSH peptide (FSHpep) was dissolved in 0.9% saline to a final concentration of 1 mg/ml. Then the peptide solution (0.5 ml) was mixed with equal volume of Freund’s complete adjuvant and injected (4 times at 3-week intervals) into two rabbits for raising polyclonal hyper-immune serum. The procedure was carried out by a commercial company (Harlan Biotech Israel Ltd., Rehovot, Israel). Four weeks after the final injection, 50 ml of blood was drawn from each rabbit, and serum was obtained. The IgG fraction of the FSHpep antisera (anti-FSHpep) was further purified by the POROSÒ Protein A affinity chromatography (Applied Biosystems Inc.), aliquoted and lyophilized.

2.10. Mass spectrometry For protein identification and confirmation of anti-FSHpep specificity the immuno-detected protein spots on the Coomassie-stained 2D gel were excised and trypsinized in-gel (37 °C, overnight) using 30 ll of Trypsin solution (15 lg/ml in 25 mM NH4CO3, pH 8.0; Promega). The resulting peptides were extracted, resolved by reversed phase capillary chromatography, and analyzed on-line by electrospray tandem mass spectrometry (MS/MS) at the Smoler Proteomics Center (Technion – Israel Institute of Technology, Haifa, Israel). The identities of the peptides were confirmed by searching amino acid sequence databases (SwissProt) with tandem mass spectra using the SEQUEST algorithm (ThermoFinnigan, San Jose, CA) or MS/MS search program from Matrix science (Mascot, http://www.matrixscience. com) using the NCBInr database.

N. Berkovich et al. / General and Comparative Endocrinology 194 (2013) 10–23

2.11. Production and purification of recombinant Atlantic bluefin tuna FSHb The bftFSHb standard antigen was produced using the P. pastoris yeast recombinant DNA expression system (Invitrogen, Carlsbad, CA). For that purpose, the cDNA encoding for bftFSHb mature peptide, 30 tagged with a chain of 6 histidine residues (6xHis), was introduced into the P. pastoris expression vector, pPIC9K (Invitrogen). Following linearization with SalI, the constructed plasmid was used to transform the host strain GS115 his4 (auxotropihic for histidine) using the Micro-Pulser-Electroporator (Bio-Rad Laboratories) adjusted to yeast cells (Voltage2 kV; Time constant- 3.7 ms). Transformant colonies were selected on histidine-deficient agar. Each selected colony was grown on buffered BMGY medium (1% yeast extract; 2% peptone; 100 mM potassium phosphate, pH 6.0; 1.34% yeast nitrogen base; 4  105% biotin; 1% glycerol) for 2 days in a shaking incubator (250 rpm; 28 °C). The cells were harvested, re-suspended in buffered BMMY medium (BMGY containing 1% methanol instead of 1% glycerol) to induce the AOX1 promoter, and grown for 3 additional days. The His-tagged bftFSHb proteins were purified by HiTrap chelating HP column (Amersham Biosciences), quantified by the Bradford method, divided into aliquots, and kept frozen at 20 °C until used to standardize the immunodot-blot assay (see below).

2.12. Immuno-dot-blot assay to measure Atlantic bluefin tuna pituitary FSH An immuno-dot-blot assay employing polyclonal anti-FSHpep and purified recombinant bftFSHb standards (see above) was developed and validated to measure BFT pituitary FSH. Accordingly, 2–4 dilutions of pituitary extracts were spotted in duplicate on a nitrocellulose membrane. Once air-dried the membrane was subjected to Western blotting procedures as specified above. The ECL detected signals were imaged using the G-Box CHEMI HR (SynGene, Frederick, MD). Signal intensities (for each dot) were quantified by the Gene Tools 4.00 software (SynGene), and compared to those obtained from serial dilutions of the recombinant bftFSHb standard. A standard curve was generated by linear regression analysis from which the concentration of individual samples could be determined.

2.13. Quantification of Atlantic bluefin tuna pituitary LH The pituitary BFT LH content was measured using an ELISA developed for striped bass LH (Mañanós et al., 1997) and modified for tuna species (Rosenfeld et al., 2003). The sensitivity of the assay was 0.65 ng/ml and the respective inter- and intra- assay coefficients of variation were 8% and 15%.

2.14. Statistical analysis Data were analyzed using the JMP INÒ 8 statistical software (SAS Institute Inc., Cary, NC) and the SPSS for Windows 7.0 statistical package. One-Way ANOVA was employed to compare mean values (Tukey–Kramer HDS, a = 0.05). The non-parametric (distribution-free) test, Spearman rank correlation, was used to measure the degree of association between two variable data sets. In all analyses, significance was considered at a value of P 6 0.05. Unless otherwise indicated, all bar graphs present mean values ± SEM.

13

3. Results 3.1. Isolation and characterization of the Atlantic bluefin tuna gonadotropin b-subunit cDNAs The isolated full-length bftFSHb cDNA (GenBank ID: EF208026.1) is 562 bp in length spanning: 50 untranslated region (UTR; 139 bp), putative signal peptide (45 bp; 15 amino acids), mature peptide (309 bp; 103 amino acids) and 30 UTR (69 bp). An additional cDNA clone with a shorter 50 UTR (108 bp) was identified as well. The deduced amino acid sequence of bftFSHb bears 12 cysteine residues and a single asparagine putative glycosylation site (Supplementary data, Fig. S1A). The isolated full-length bftLHb cDNA (GenBank ID: EF205591.1) includes 50 UTR (48 bp), putative signal peptide (96 bp; 32 amino acids), mature peptide (348 bp; 116 amino acids) and 30 UTR (111 bp). The deduced amino acid sequence of bftLHb contains 12 cysteine residues and a single asparagine putative glycosylation site (Fig. S1B). Comparison of the bftFSHb and bftLHb amino acid sequences with homologous subunits from other Perciformes (Fig. 1) indicated that within the genus Thunnus, both gonadotropin b-subunits possess a high degree of similarity (e.g., 99% with the respective subunits of the bigeye tuna, T. obesus). Nevertheless, a wider comparison with other Perciformes indicated conservation (P87% identities) of the bftLHb and diversification (e.g., only 58% identity with the cichlid tilapia) of the bftFSHb.

3.2. Generation of polyclonal antibodies and validation of an immunodot-blot assay to measure Atlantic bluefin tuna pituitary FSH Polyclonal antibodies against bftFSH (anti-FSHpep) were generated in rabbits following immunization with synthetic peptide antigens. Direct validation of the anti-FSHpep specificity was carried out by means of 2D gel Western blotting and Mass spectrometry (MS/MS). A total protein extract from BFT pituitary was screened and immunoreactive proteins were identified predominantly at 15 kDa and to a lesser extent at 32 kDa (Fig. 2A and B). The MS/MS analysis of the corresponding excised spots identified bftFSHb as the sole protein immunodetected by the antiFSHpep (Fig. 2C). To further rule out cross reactivity with bftLHb, Western blotting on BFT pituitary total protein extract, separated by the 1D SDS–PAGE, was performed using anti-FSHpep vs. antisbLH (Fig. 2D). Both antibodies yielded specific signals, and positively identified proteins at 17 and 20 kDa, the relevant molecular weights for BFT FSHb and LHb, respectively. Of note, the estimated bftFSHb molecular mass slightly differed in the 2D and 1D gel Western blotting (15 and 17 kDa, respectively), probably due to differences in gel composition and/or electrophoretic conditions. To standardize the immunoassay, recombinant bftFSHb was produced using the yeast P. pastoris expression system. Following SDS–PAGE separation of the purified protein, both the Coomassie blue stain (Fig. 3A) and Western blotting with anti-FSHpep (Fig. 3B) showed a single protein band of the expected size (17 kDa; see Fig. 2D) confirming the purity and identity of the produced recombinant protein. The accuracy of the immuno-dot-blot assay was established by demonstrating parallelism of serial dilutions of BFT pituitary extract and the recombinant bftFSHb standard curve (Fig. 4). Plasma FSH concentrations were found to be beyond detection limits of the assay, restricting its applicability to pituitary samples only. The lowest concentration of FSH that could be distinguished from a zero sample was 125 ng/ml, as deduced by replicated determination (n = 10) of a zero blank (mean value +2 SDs) vs. the lowest

14

N. Berkovich et al. / General and Comparative Endocrinology 194 (2013) 10–23

Fig. 1. Multiple sequence alignment and conserved structural motifs of Perciformes FSHb (A) and LHb (B). Sequences are aligned from the first deduced amino acid of the signal peptide. FSHb GenBank accession numbers: Atlantic bluefin tuna (tuFSHb, GenBank ID: ABP04057.1), bigeye tuna (beFSHb, GenBank ID: P37205.1), bonito (bFSHb, GenBank ID: AAB25412.1), striped bass (stbFSHb, GenBank ID: AAC38035.1), tilapia (tFSHb, GenBank ID: AAP49575.1), red seabream (rsbFSHb, GenBank ID: BAB18563.1). LHb GenBank accession numbers: Atlantic bluefin tuna (tuLHb, GenBank ID: ABP04050.1), bigeye tuna (beLHb, GenBank ID: P37206.1), bonito (bLHb, GenBank ID: AAB25413.1), striped bass (stbLHb, GenBank ID: AAC38019.1), tilapia (tLHb, GenBank ID: AAP49576.1), red seabream (rsbLHb, GenBank ID: BAB18564.1). Gaps (marked by asterisks) were introduced to maximize alignment. The conserved 12 half cysteines are highlighted with gray background. Amino acids that were found to be identical to the related Atlantic bluefin tuna sequence (in bold) are marked with dash, and the respective homology percentages are indicated on the left panel.

Fig. 2. Establishment of anti-FSH antibody specificity by means of Western blotting and Mass spectrometry (MS/MS). (A) A proteome pattern of Atlantic bluefin tuna (BFT) pituitary extract was visualized by Coomassie brilliant blue stain following 2D gel electrophoresis. (B) Western blot analysis with polyclonal antibodies rose in rabbits against synthetic FSHb peptide (anti-FSHpep; dilution 1:5000), showing a predominant (15 kDa) and a minor (32 kDa) immuno-reactive bands. Spots of interest (circled and marked as A and B) were excised, submitted to tryptic digestion and analyzed by MS/MS. (C) Both excised spots yielded peptides corresponding to tuna FSHb by a database search. The matched triptic peptides (shown in red) constitute 55% sequence coverage. (D) Comparative immunoblotting of BFT pituitary extract with anti-FSHpep (1:5000; Lane1) and anti-sbLH (1:10,000; Lane 2). Lane M: standard pre-stained molecular weight markers. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

standard concentration. The intra-assay and inter-assay variation were determined by repeated measurement (n = 7) of 2 different samples at 2 different dilutions within one assay, and across different assays (n = 7). The mean intra-assay CV was 9.7%, the inter-assay CV was 10.8%.

3.3. Age and body size Based on the counts of the translucent zones in the first ray sections of the first dorsal fin (Fig. 5), the BFT juveniles were categorized into two age classes: 2 year-old (2Y; n = 10; weight range 8–11 kg) and 3Y fish (n = 10; weight range 16–23 kg). The esti-

mated age of the adult BFT (n = 19; weight range 50–100 kg) ranged from 5 to 8 years (P5Y). The three groups varied significantly (P < 0.001) in their fork length (FL) and body mass (MB) (Table 2). Yet, within each group (i.e., 2Y, 3Y and P5Y), the MB and FL variables did not vary significantly (P > 0.05) between the two sexes (Table 2). The Spearman’s rank correlation coefficient (q = 0.9524; P = 0.000) showed a strong positive correlation between the MB and the age of the fish (Table 3). 3.4. Ovarian and testicular development The GSI values of sexually mature BFT (P5Y) were significantly higher (ANOVA, P < 0.0001) compared to those of 2Y and 3Y juve-

N. Berkovich et al. / General and Comparative Endocrinology 194 (2013) 10–23

15

3.5. Pituitary gonadotropin patterns in relation to body mass, age and sex In both sexes the pituitary LH and FSH levels show strong positive correlations with the respective age and MB data sets in turn highly correlated with each other (Table 3). Hence, to remove the effect of MB and allow comparisons in fish with wide-ranging body sizes (from 8 to 100 kg; Table 2), the total pituitary LH and FSH levels (lg hormone per pituitary gland) were corrected per kg MB. The normalized pituitary LH levels increased correlatively with the age in females (q = 0.803, P = 0.003) and males (q = 0.7828, P = 0.000) (Table 3; Fig. 8A). Significantly (P < 0.0001) higher LH levels were detected in the P5Y females (259.34 ± 34.09 lg per pituitary per kg MB) compared to those measured in cognate males (94.32 ± 12.39 lg per pituitary per kg MB) or in 3Y (54.59 ± 6.82 lg per pituitary per kg MB) and 2Y (30.69 ± 5.87 lg per pituitary per kg MB) juveniles. Unlike in adult BFT, the pituitary LH levels did not vary significantly (P > 0.05) between females and males among the 2Yand 3Y groups. The normalized pituitary FSH levels did not vary significantly (P > 0.05) between females and males of the same age group (Fig. 8B). In both sexes the levels were significantly (P < 0.01) lower in the 3Y (11.49 ± 1.10 lg per pituitary per kg MB) compared to 2Y (60.89 ± 8.03 lg per pituitary per kg MB) and adult (80.65 ± 13.17 lg per pituitary per kg MB) fish, which did not vary significantly (P > 0.05) from each other (Fig. 8B). The ratios of pituitary FSH to LH were significantly (P < 0.01) higher in 2Y (3.28 ± 0.87) compared to 3Y (0.25 ± 0.05) and P5Y (0.72 ± 0.32) fish (Fig. 8C). 3.6. Profiles of pituitary FSHb and LHb gene expression Fig. 3. SDS–PAGE and Western blot analyses of purified recombinant bftFSHb. (A) Proteins stained with Coomassie blue. (B) Western blotting with anti-FSHpep (dilution 1:5000). The protein molecular weight marker provides a ladder (in kDa) of convenience.

niles, which did not vary significantly (ANOVA, P = 0.83) from each other (Table 2). Significant differences between sexes with mean GSI of females larger than that of males were detected in the 3Y (ANOVA, P < 0.05) and P5Y (ANOVA, P < 0.0001) groups, but not in the 2Y juveniles (ANOVA, P = 0.86). The perinucleolar stage was the most advanced oocyte stage in all the ovaries analyzed in both 2Y and 3Y groups (Fig. 6A and B). No histological signs of previous reproductive activity, like atretic vitellogenic follicles or post-ovulatory follicles, were observed in any samples. The testes of all 2Y males showed a germinal epithelium constituted only by spermatogonia (Fig. 6C). In contrast, testes of all 3Y males exhibited seminiferous lobules with a germinal epithelium containing all stages of spermatogenesis and spermatozoa in the lumina (Fig. 6D). Adult (P5Y) BFT were reproductively active or had signs of recent reproductive activity in their gonads. Among adult females, two individuals had cortical alveoli stage oocytes and five individuals showed late vitellogenic oocytes as the most advanced oocyte population (Fig. 7A). Atretic vitellogenic follicles were observed in all the ovaries analyzed. Most males (n = 11) were spent as their germinal epithelium consisted mainly of spermatogonia and residual spermatozoa were present in the lumen of seminiferous lobules (Fig. 7B). One additional male was found to be in late spermatogenesis stage since its germinal epithelium contained mainly cysts with spermatids and spermatozoa, and the lumen of the seminiferous lobules was partially filled with spermatozoa (Fig. 7C).

The pituitary LHb and FSHb transcript levels increased with the age of the fish, reaching their maximum in the sexually mature P5Y BFT (Fig. 9). The LHb mRNA levels demonstrated opposing sex-dependent patterns in the 3Y as compared with the P5Y fish (Fig. 9A). Accordingly, the LHb mRNA levels in the 3Y group were significantly (P < 0.05) higher in males than in females, while in the P5Y group were significantly (P < 0.01) higher in females than in males. Conversely, the LHb mRNA levels in the 2Y fish (Fig. 9A), as well as the FSHb mRNA levels in fish at all age categories (Fig. 9B), did not differ significantly (P > 0.05) between the genders. With the exception of the 2Y females, the pituitary FSHb mRNA levels were constantly higher than those of LHb (Fig. 9C). Remarkably higher FSHb to LHb mRNA ratios were detected in the 3Y females (8.14 ± 2.98) and males (5.69 ± 1.33). 4. Discussion In the present work the intra-pituitary relationship of the gonadotropins, follicle-stimulating hormone (FSH) and luteinizing hormone (LH) was investigated in captive Atlantic bluefin tuna (BFT; T. thynnus) undergoing pubertal development. Our findings are in line with the classic roles of FSH and LH in the respective stages of early gonadal development and maturation, and emphasize the importance of the FSH to LH ratio as a potential marker distinguishing between immature and pubertal fish. Full length cDNA sequences encoding for BFT gonadotropin subunits (i.e., bftFSHb and bftLHb) were cloned and characterized. Alignment of the deduced amino acid sequences demonstrated high conservation of the bftLHb (85–99%) and relative diversification of the bftFSHb among Perciformes. The latter subunit shared high homology (99–94%) only within the family Scombridae. Both, bftFSHb, and bftLHb deduced amino acid sequences, revealed the presence of typifying structural characteristics, including: (i) high

16

N. Berkovich et al. / General and Comparative Endocrinology 194 (2013) 10–23

Fig. 4. A quantitative dot-blot immunoassay for Atlantic bluefin tuna FSH. Serial dilutions of pituitary extract (PE) and recombinant BFT FSHb produced in yeast cells (Pichia pastoris) were blotted onto a nitrocellulose membrane and incubated with anti-FSHpep antisera. Data points represent the mean of two independent determinations.

content of cysteine residues (12 in each b subunit) having a role in determining the tertiary structure of the molecule (Fox, 2001; Lapthorn et al., 1994; Wu et al., 1994), and (ii) one asparagine (N)linked glycosylation sequon. As it was found in salmonids and modern teleosts, Perciformes and Pleuronectiformes, bftFSHb shows two major changes compared to those of tetrapods and ancient piscine orders, such as dogfish, sturgeon and eel (reviewed by Levavi-Sivan et al., 2010; Quérat et al., 2000, 2001; Rosenfeld et al., 2007; Yaron et al., 2003). These include: a reduced number of Nlinked putative glycosylation sites (one or none rather than two), and a noticeable rearrangement in the cysteine scaffold, i.e., replacement of the conserved 3rd cysteine (counting from the Nterminal) by a new cysteine residue that was integrated to the mature protein N-terminal, probably due to relocation of the signalpeptide cleavage site (Rosenfeld et al., 2007). The physiological roles of the observed structural changes are not yet clear. Biochemical studies with FSH purified from the pituitaries of coho salmon (Oncorhynchus kisutch; Kawauchi et al., 1989; Suzuki et al., 1988b; Swanson et al., 1991), common carp (Cyprinus carpio; Van der Kraak et al., 1992), bonito (Katsuwonus pelamis; Koide et al., 1993), bigeye tuna (Thunnus obesus; Okada et al., 1994), Mediterranean yellowtail (Seriola dumerili; García-Hernández et al., 1997), and Atlantic halibut (Hippoglossus hippoglossus; Weltzien et al., 2003) indicated that the heterodimer is remarkably stable, as compared to LH, even under moderate acidic treatment. It was suggested that the relocation of the cysteine residues affects the formation of the ‘‘seat-belt’’ by narrowing the gap in the b-subunit through which the a-subunit is connected. This change is known to increase heterodimer stability (Swanson et al., 2003; Xing et al., 2004). On the other hand, a less stable native FSH format was recently purified from European seabass (Dicentrarchus labrax) pituitaries (Molés et al., 2008). The second trait typifying modern teleost FSHb sequences is a tendency to reduce putative glycosylation sites. This tendency is further exemplified in the FSHb derived from Atlantic halibut (Weltzien et al., 2003) and greasy grouper (Epinephelus coioides; Li et al., 2005) exhibiting no N-linked glyco-

sylation sequon. It was postulated that partial or total elimination of FSHb carbohydrates contributes to a more efficient delivery of the follicular granulose cells to the avascular tissue, and as a side effect increases its metabolic clearance rate (Walton et al., 2001). In this study, two bftFSHb transcript variants differing in their 50 untranslated region (50 UTR) were identified by RT-PCR amplifications on total pituitary RNA. Multiple FSHb transcripts encompassing 50 UTR variations were identified also in tilapia (Oreochromis mossambicus; Rosenfeld et al., 2001) and humans (Jameson et al., 1988). Both cited studies demonstrated that: (i) an alternate acceptor/donor site in the first exon of the respective tilapia and human FSHb genes cause transcripts to have different length of 50 UTR, and (ii) the most abundant (60–65%) transcripts contain the longer 50 UTR forms. The fact that the alternative splicing sites in the FSHb 50 UTR are well conserved between human and fish, species that separated over 400 million years ago, points to strong selection constraints probably coupled with functional implications. In this regard, the vast majority of mRNAs containing 50 UTR variants encode protooncogenes or protein products that are implicated in cell growth or cell proliferation (Pickering and Willis, 2005). In the latter, the transforming growth factor (TGF-b) 50 UTR splice variants markedly differ in their translational efficiencies, resulting with the longest and most abundant isoforms being poorly translated compared to the shorter 50 UTR versions (Kim et al., 1992; Romeo et al., 1993). It was found that inhibitory interactions of transacting factors with cis-elements within the longer 50 UTR variants impede the progression of the ribosome towards the initiation codons (Allison et al., 1998). Interestingly, FSH, like the TGF-b, belongs to the cystine-knot growth factor super-family (Vitt et al., 2001), and is known to stimulate gonadal germ/somatic cell proliferation in mammals (Hillier, 2001; Simoni et al., 1999) and fish (Schulz et al., 2010) including BFT (Rosenfeld et al., 2011). These characteristics highlight the need to further elucidate the post-transcriptional regulation of the FSHb gene expression, particularly in lower vertebrates such as fish.

17

N. Berkovich et al. / General and Comparative Endocrinology 194 (2013) 10–23

Table 3 Spearman rank correlation coefficients (q) for comparison of biometric parameters (i.e., MB and age) and pituitary LH and FSH levels from female and male data sources. Variable

MB

Females and Males MB

(n = 30)

Age

Females Pituitary FSH (lg/pit) Normalized pituitary FSH (lg/pit/kg) Pituitary LH (lg/pit) Normalized pituitary LH (lg/pit/kg)

(n = 12) 0.7063 (P = 0.010) NS 0.8741 (P = 0.000) 0.7063 (P = 0.010)

(n = 11) 0.6730 (P = 0.023) NS 0.9329 (P = 0.023) 0.8030 (P = 0.003)

Males Pituitary FSH (lg/pit) Normalized pituitary FSH (lg/pit/kg) Pituitary LH (lg/pit) Normalized pituitary LH (lg/pit/kg)

(n = 22) 0.6676 (P = 0 .001) NS 0.8687 (P = 0 .000) 0.7467 (P = 0.000)

(n = 19) 0.5261 (P = 0.021) NS 0.8928 (P = 0.000) 0.7828 (P = 0.000)

0.9524 (P = 0.000)

Note: NS = comparison which did not yield a significant correlation (P > 0.05).

Fig. 5. Age determination: images of Atlantic bluefin tuna spine sections. (A) Age 2 specimen with 82 cm fork length (FL) and 8.1 kg body mass (Mb). Two translucent zones (rings) are visible. (B) Age 3 specimens with 107 cm FL and 21.3 kg Mb. Three rings are visible. (C) Age 6 specimens with 156 cm FL and 70.0 Mb. Three rings are visible and three rings were reabsorbed. Arrows indicate visible rings. Magnification bar = 3 mm.

In this study, a dot-blot immunoassay was developed and validated to measure BFT pituitary FSH, allowing, for the first time in this species, data sets for the two gonadotropins to be compared. A synthetic peptide antigen corresponding to bftFSHb 66–80 codons (supplementary data, Fig. S1A) aided in generating highly

specific primary antisera (anti-FSHpep), which reacted exclusively with the FSH, in either its monomeric (=b-subunit) or hetrodimeric forms, showing no cross-reactivity with LH or any other pituitary proteins (Fig. 3). The results of a database search that followed a mass spectrometry analysis, further confirmed this notion. Despite the low conservation of the FSHb sequences across Perciformes, the synthetic FSHpep spanned a relatively conservative domain (Fig. 1). Indeed, a similar synthetic peptide antigen (based on 11 amino acids of the mummichog, Fundulus heteroclitus FSHb) sharing 91% homology with the BFT FSHpep, was found to generate universal FSH antisera applicable for immunocytochemical studies in large variety of acanthopterygian fishes (Shimizu et al., 2003, 2005). It is likely that our polyclonal anti-FSHpep have similar generic capabilities, however, further testing is necessary to confirm this assumption. In parallel, by employing the yeast P. pastoris expression system, a recombinant bftFSHb was produced, purified and used to standardize the aforementioned immunoassay. The sensitivity of the BFT FSH dot-blot immunoassay (125 ng/ml) is comparable to the one, recently developed for measuring FSH in the European seabass (162.8 ng/ml; Molés et al., 2011). Both the BFT and European seabass FSH immuno-dot-blot assays exhibited 3-fold less sensitivity in comparison with ELISAs validated to measure the equivalent hormone in other fishes, including: salmon (<2 ng/ml; Suzuki et al., 1988a), trout (0.1–0.15 ng /ml; Govoroun et al., 1998; Santos et al., 2001), tilapia (0.24 pg/ml; Aizen et al., 2007), European seabass (0.5 ng/ml; (Molés et al., 2012) and mummichog (0.125 ng/ml; Shimizu et al., 2012). Undoubtedly, the next important step would be to develop a sensitive ELISA for BFT FSH facilitating measurements of this important hormone also at the plasma level. Our results show expression and accumulation of LH and FSH in the pituitaries of both immature and mature captive BFT. The absolute pituitary levels of the two gonadotropins in adult fish were up to 30-fold higher compared to those measured in the two year-old (2Y) juveniles, and up to 2 orders of magnitude higher compared to

Table 2 Mean ± SEM body mass, fork length and GSI values of juvenile (2Y and 3Y, respectively) and adult (P5Y) captive Atlantic bluefin tuna during the reproductive season in the Mediterranean Sea. 2Y

Body mass (kg)* Fork length (cm)* GSI (%)* *

3Y

P5Y

Males

Females

Males

Females

Males

Females

8.5 ± 0.5b 83.4 ± 1.4c 0.06 ± 0.01c

8.4 ± 0.7b 81.3 ± 1.2c 0.06 ± 0.02c

20.4 ± 1.1b 104 ± 1.5b 0.05 ± 0.01c

18.7 ± 1b 102 ± 1.3b 0.15 ± 0.04d

65.3 ± 2.2a 157.8 ± 2.2a 0.96 ± 0.18b

64.5 ± 9.6a 153.8 ± 5.8a 1.54 ± 0.27a

Means designated by different letters were significantly different (P < 0.05).

18

N. Berkovich et al. / General and Comparative Endocrinology 194 (2013) 10–23

Fig. 6. Micrographs of gonad sections from captive Atlantic bluefin tuna specimens reared in sea cages at the Drvenik Tuna ranch (Islands of Drvenik and Kluda, Croatia) and sampled on 7 of July 2009. (A) Ovary from an age 2 individual showing perinucleolar stage oocytes interspersed in abundant somatic tissue. (B) Ovary from an age 3 individual showing perinucleolar stage oocytes and unyolkedatretic follicles. (C) Testis from an age 2 specimen showing germinal epithelium constituted only by spermatogonia. No spermatozoa are visible in the lumen of seminiferous tubules. (D) Testis from an age 3 specimen showing germinal epithelium containing all stages of spermatogenesis. Luminal spermatozoa can also be observed. Haematoxylin-eosin staining. Bars in (A) and (B) = 500 lm; in (C) = 50 lm; in (D) = 100 lm. Arrows, perinucleolar stage oocytes; arrowheads, unyolked atretic follicles; sp; luminal spermatozoa.

those measured in the pituitaries of sexually mature fish with smaller body size such as the rainbow trout (Gomez et al., 1999). BFT is an outstandingly fast growing fish gaining tens of kilograms within few years (Santamaria et al., 2009). Thus, the remarkably high pituitary hormonal content found in adult specimens seems to be vital to compensate for high dilution rates when released into the blood circulation (Rosenfeld et al., 2012). To avoid any distortion due to the vast size variation (from 8 to 100 kg) among the different age classes, we corrected the pituitary gonadotropin levels per kg body mass. The normalized values proved to better reflect the reproductive state of the fish allowing comparison with other fish species regardless of their body size. For example, the normalized pituitary LH content in sexually mature BFT (MB = 100 kg; absolute LH levels = 17,000 lg/pit; normalized LH levels = 170 lg/ pit/kg) and in sexually mature rainbow trout (MB = 2 kg; absolute LH levels = 250 lg/pit; normalized LH levels = 125 lg/pit/kg; Gomez et al., 1999) were found to be on the same scale. In our analyses, the pituitary LH content gradually increased concomitantly with the age of the fish, reaching its maximal levels in fully mature (P5Y) females and males. Similar LH levels, that were detectable in juveniles, steadily increased together with gonadal growth until reaching a maximum at maturation, were noticed in fish species like the African catfish (Clarias gariepinus; Schulz et al., 1995, 1997), black carp (Mylopharyngodon piceus; Gur et al., 2000), and European seabass (Mateos et al., 2003). In contrast, the pituitary LH was undetectable in most salmonid juveniles studied (Nozaki et al., 1990; Weil et al., 1995). At the protein level, notable sex-dependent LH patterns were recognized in adult BFT but not in the 2Y and 3Y juveniles. Consistent with our previous findings (Rosenfeld et al., 2012), the levels detected in the pituitaries of sexually mature females were approximately 3-fold higher compared to those of males in the same age-class. In the gilthead sea bream (Sparus aurata), a nonsynchronous spawner (Zohar et al., 1995) like the BFT, the pituitary

LH content (Zohar, University of Maryland Baltimore, USA; personal communication) and the expression levels of the gene encoding the LH b-subunit (Elizur et al., 1995; Meiri et al., 2004) demonstrated sexual dimorphic patterns resembling that found in the current study. The pituitary FSH levels, unlike the LH ones, did not show parallelism with the age of the fish. A significant (P < 0.01) drop was apparent in 3Y fish that reached approximately 6-fold lower concentrations compared to the 2Y fish. This drop was followed with a dramatic increase (approximately 8-fold higher) in the sexually mature adults. The latter pattern was more pronounced in males than in females. It is difficult to interpret the dramatic drop in the pituitary FSH levels seen in the 3Y juveniles. On the other hand, it could reflect a rapid secretion of the hormone into the circulation. The 1.5–4-fold higher FSHb/LHb mRNA ratios observed in 3Y fish as compared to those of 2Y juveniles and older than 5Y adults (Fig. 9C) may further signify an increased synthesis to replenish the hormone storage within the pituitary. Nonetheless, this intriguing observation will probably be explained by the actual determination of the circulating FSH levels. Thus far, the only comparable information regarding pituitary and circulating FSH levels are available for the rainbow trout (Gomez et al., 1999; Santos et al., 2001) and European seabass (Molés et al., 2011, 2012). These fish are unlike the BFT, in that they represent group-synchronous ovarian development. In these model species the pituitary FSH levels rise gradually during the initial phases of vitellogenesis and spermatogenesis and then more rapidly in the final stages of gonadal maturation. The fact that cognate plasma FSH levels demonstrated a similar peak during vitellogenesis and postvitellogenesis, argue that FSH plays a role in mediating recruitment of primary oocytes into vitellogenic growth and/or stimulating uptake of vitellogenin into oocytes (Tyler et al., 1991, 1997). However, towards maturation–ovulation the circulating FSH patterns highlight variations between the salmonid and non-salmonid

N. Berkovich et al. / General and Comparative Endocrinology 194 (2013) 10–23

19

Fig. 8. The pituitary LH (A), FSH (B) and the FSH/LH ratio (C) in juveniles and sexually mature captive Atlantic bluefin tuna males and females. Abbreviations: 2Y, 3Y, and P5Y respectively represent 2, 3, and 5 (and older) year old fish. Levels (mean ± SEM) are expressed as total amount (lg) per pituitary per kg body mass. Different letters above bars indicate significant (P < 0.05) difference between means.

Fig. 7. Micrographs of gonad sections from adult captive Atlantic bluefin tuna specimens reared in sea cages at the Malta Fish Farming site (Marsaxlokk, Malta) and sacrificed on 24 of June 2009. (A) Ovary showing late vitellogenic oocytes as the most advanced oocyte population. (B) Testis from a spent individual showing residual spermatozoa in the lumen of seminiferous tubules. (C) Testis from an individual in late spermatogenesis showing germinal epithelium constituted mainly by spermatocysts containing spermatids and spermatozoa. Abundant luminal spermatozoa can also be observed. Haematoxylin-eosin staining. Bars in (A) = 400 lm; in (B) and (C) = 250 lm. Arrows, late vitellogenic oocytes; dashed arrows, atretic vitellogenic follicles; sp; luminal spermatozoa.

group synchronous spawners: a climax in the rainbow trout (Breton et al., 1998; Gomez et al., 1999; Prat et al., 1996; Santos et al., 2001) vs. significant decline in the European seabass (Molés et al., 2011). Despite these apparent species specific FSH patterns, the analogous patterns of plasma and pituitary FSH in the immature rainbow trout (Prat et al., 1996) and BFT, should be noted. Prat

and collaborators (1996) have found elevated plasma FSH levels in immature male trout a year before spermiation and again during the final stage of testicular growth, whereas in the current study we measured elevated FSH levels in the pituitaries of 2Y immature males and later on in those of fully mature BFT adults. Considering that the 3Y males were already pubertal, it would appear that FSH has an important function in gonadal growth a year before the first reproductive cycle. Nevertheless, in the 3Y females, which were still immature, the onset of puberty appears to necessitate some other prerequisites, such as a rise in the LH storage above a minimum threshold. The observed sexual dimorphic pattern, demonstrating approximately 3-fold higher LH levels in the pituitaries of sexually mature BFT females compared to males of the same age class, further supports this hypothesis. One of the striking findings from the current study reveals a clear discrepancy in the pituitary FSH to LH ratios in immature

20

N. Berkovich et al. / General and Comparative Endocrinology 194 (2013) 10–23

Fig. 9. Relative transcript levels of pituitary LH and FSH b-subunits in juveniles and sexually mature captive Atlantic bluefin tuna males and females. Abbreviations: 2Y, 3Y, and P5Y, respectively represent 2, 3, and 5 (and older), year old fish. Levels (mean ± SEM) are expressed as relative units, normalized to the amount of 18S rRNA. Different letters above bars indicate significant (P < 0.05) difference between means.

vs. mature BFT. A relative higher FSH to LH ratio (>3) distinguished the 2Y fish, which were all sexually immature, from the other two groups consisting of (i) 3Y pubertal males and immature females, and (ii) fully mature adults, both exhibiting ratios smaller than 1 (0.2 and 0.7, respectively). Interestingly, in several mammalian models (reviewed by Wan´kowska and Polkowska, 2010) including human (Rifkind et al., 1967) the intra-pituitary mechanism that prepares the gonadotrope cell population for puberty is represented by an increase in the storage of LH accompanied by a comparable decrease in the storage of FSH and a subsequent decrease in the FSH to LH ratio. Clinical studies that monitored circulating

gonadotropin levels in children undergoing pubertal development revealed that the FSH to LH ratios reliably discriminate between pre-pubertal and early pubertal groups (Ito et al., 1993). Similarly to our findings, Ito and collaborators (1993) reported that the FSH to LH ratios typifying pre-pubertal and pubertal children is higher (1.8–3.6) or lower (0.29–0.7) than 1, respectively. Establishing a similar standard clinical marker in fish would be of great importance to better understand the mechanisms regulating their puberty. In BFT, as in other multiple spawners (Elizur et al., 1996; Jackson et al., 1999; Kajimura et al., 2001; Mateos et al., 2003; Meiri et al., 2004; Mittelholzer et al., 2009; Sohn et al., 1999; Weltzien et al., 2003; Yoshiura et al., 1997), transcripts of the two gonadotropin b-subunits were detectable in all sampled fish, regardless of their age, sex or reproductive status. Both bftLHb and bftFSHb mRNAs showed age-dependent profiles with maximum levels in the sexually mature adults. Yet, unlike bftFSHb, the bftLHb gene expression profiles showed distinct sexual dimorphism in juveniles (3Y) and adults (P5Y), which largely reflected the storage pattern of LH in the pituitary. Accordingly, higher bftLHb mRNA levels were found in the P5Y females compared to males of the same age class, and vice versa in the 3Y fish. It is important to note that in the latter group the higher bftLHb mRNA levels were associated with sexual maturation (i.e., pubertal males vs. sexually immature females). Our results also show a consistent predominance of bftFSHb mRNA levels over bftLHb, with up to 10-fold higher expression levels in the 3Y juveniles. Similar results were obtained by other investigators with Atlantic cod (Gadus morhua; Mittelholzer et al., 2009) and rainbow trout (Gomez et al., 1999), representing multiand synchronous spawners, respectively. The high transcript abundance in respect to the hormone’s storage patterns may point to a poor translation rate of the bftFSHb, as was suggested previously when referring to the 50 UTR splice variants of this gene. The disproportionate transcript over hormone levels may also suggest that FSH is secreted by the constitutive pathway. In mammals, FSH was mobilized to the site of exocytosis and released shortly after synthesis (Crawford, 2002; Farnworth, 1995; Farnworth et al., 1988), while in salmonids, a strong relationship between the level of pituitary FSHb mRNA and plasma FSH was demonstrated (Gomez et al., 1999). In contrast, the relatively low bftFSHb mRNA levels as compared to the high protein content in the 2Y fish suggest hormone secretion by the regulated pathway as it was demonstrated in sheep (Brooks et al., 1992) and more recently in the European seabass (Molés et al., 2012). The recorded biometric parameters for the cage reared 2Y and 3Y BFT sampled in this study fit well the length-weight relationship established for cognate wild specimens captured over an 8year period in the central Mediterranean Sea (Santamaria et al., 2009). Based on histological sections of the gonads, the 3Y males were already sexually mature with testes containing all the spermatogenetic stages including spermatozoa in the lumen of seminiferous lobules. In contrast, all the 3Y females were still previtellogenic. A previous study carried out with wild BFT population indicated that in females at 4 to 5 years of age 100% maturity is reached (Corriero et al., 2005). In this regard, an earlier puberty in males as compared to females is a common feature of many fish species including Atlantic halibut (Jákupsstovu and Haug, 1988), sturgeons (Acipenser gueldenstaedtii: Hurvitz et al., 2005; Acipenser sinensis: Cao et al., 2009), European seabass (Carrillo et al., 1995; Saillant et al., 2003), and Pacific bluefin tuna (Thunnus orientalis: Sawada et al., 2007). This phenomenon becomes even more pronounced under intensive culture conditions where ample food availability gives rise to faster growth rates compared to those in wild populations (reviewed by Carrillo et al., 2009; Taranger et al., 2010). Thus, it is not yet clear whether the observed puberty

N. Berkovich et al. / General and Comparative Endocrinology 194 (2013) 10–23

in 3Y BFT males is a general feature typifying wild populations or is induced due to the culture conditions. In summary, our results, for the first time in non-salmonid fish, clearly show that the intra-pituitary mechanism responsible for divergent LH and FSH regulation during maturational transition to puberty is the result of different influences at the level of both synthesis and storage. Future studies testing the effects of captivity and hormone-based treatments on precocious maturity at relatively small body size may allow for a better handling in environmentally controlled land-based facilities, and greatly improve the cost-efficiency of BFT farming. Acknowledgments We would like to express our gratitude to the personnel of Tuna Graso, S.A., and Malta Fish Farming Ltd., for their assistance during the sampling operations. In particular, we would like to acknowledge the assistance of Goran Brstilo and the divers from DRVENIK TUNA D.O.O., whose expertise and dedication were instrumental for the success of this project. Thanks are also due to Ivana Jovanovic´ and the staff of the DRVENIK-TUNA in Croatia for their hospitality and assistance during the field experiments. We would like to express our gratitude to Dr. A. Colorni (IOLR-NCM, Israel) for careful reading and helpful comments that improve the quality of our manuscript. This work was undertaken as part of the research program ‘‘From capture based to SELF-sustained aquaculture and Domestication Of bluefin tuna, Thunnus Thynnus’’ (SELFDOTT) and was supported by a research grant from the European Community under the collaborative projects FP7-KBBE-2007-1 program (Grant Agreement number: 212797). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ygcen.2013.08. 005. References Aizen, J., Kasuto, H., Levavi-Sivan, B., 2007. Development of specific enzyme-linked immunosorbent assay for determining LH and FSH levels in tilapia, using recombinant gonadotropins. Gen. Comp. Endocrinol. 153, 323–332. Allison, R.S., Mumy, M.L., Wakefield, L.M., 1998. Translational control elements in the major human transforming growth factor-b 1 mRNA. Growth Factors 16, 89–100. Baglin, R.E.J., 1982. Reproductive biology of western Atlantic bluefin tuna. Fish. Bull. 80, 121–134. Breton, B., Govoroun, M., Mikolajczyk, T., 1998. GTH I and GTH II secretion profiles during the reproductive cycle in female rainbow trout: relationship with pituitary responsiveness to GnRH-A stimulation. Gen. Comp. Endocrinol. 111, 38–50. Brooks, J., Crow, W.J., McNeilly, J.R., McNeilly, A.S., 1992. Relationship between gonadotrophin subunit gene expression, gonadotrophin-releasing hormone receptor content and pituitary and plasma gonadotrophin concentrations during the rebound release of FSH after treatment of ewes with bovine follicular fluid during the luteal phase of the cycle. J. Mol. Endocrinol. 8, 109– 118. Cao, H., Zhou, L., Zhang, Y.-Z., Wei, Q.-W., Chen, X.-H., Gui, J.-F., 2009. Molecular characterization of Chinese sturgeon gonadotropins and cellular distribution in pituitaries of mature and immature individuals. Mol. Cell. Endocrinol. 303, 34– 42. Carrillo, M., Zanuy, S., Prat, F., Cerda, J., Ramos, J., Mañanós, L., Bromage, N.R., 1995. Sea bass (Dicentrarchus labrax). In: Bromage, N.R., Roberts, R.J. (Eds.), Broodstock Management and Egg and Larval Quality. Blackwell Science Publishers, Oxford, pp. 138–168. Carrillo, M., Zanuy, S., Felip, A., Bayarri, M.J., Molés, G., Gómez, A., 2009. Hormonal and environmental control of puberty in perciform fish: the case of sea bass. Ann. NY Acad. Sci. 1163, 49–59. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. Corriero, A., Desantis, S., Deflorio, M., Acone, F., Bridges, C.R., De la Serna, J.M., Megalofonou, P., De Metrio, G., 2003. Histological investigation on the ovarian

21

cycle of the bluefin tuna in the western and central Mediterranean. J. Fish Biol. 63, 108–119. Corriero, A., Karakulak, S., Santamaria, N., Deflorio, M., Spedicato, D., Addis, P., Desantis, S., Cirillo, F., Fenech-Farrugia, A., Vassallo-Agius, R., Serna, J.M., Oray, Y., Cau, A., Megalofonou, P., Metrio, G., 2005. Size and age at sexual maturity of female bluefin tuna (Thunnus thynnus L. 1758) from the Mediterranean Sea. J. Appl. Ichtyol. 21, 483–486. Corriero, A., Medina, A., Mylonas, C.C., Abascal, F.J., Deflorio, M., Aragón, L., Bridges, C.R., Santamaria, N., Heinisch, G., Vassallo-Agius, R., Belmonte, A., Fauvel, C., Garcia, A., Gordin, H., De Metrio, G., 2007. Histological study of the effects of treatment with gonadotropin-releasing hormone agonist (GnRHa) on the reproductive maturation of captive-reared Atlantic bluefin tuna (Thunnus thynnus L.). Aquaculture 272, 675–686. Crawford, J., 2002. Co-localisation of gonadotrophins and granins in gonadotrophs at different stages of the oestrous cycle in sheep. J. Endocrinol. 174, 179–194. De Metrio, G., Bridges, C.R., Mylonas, C.C., Caggiano, M., Deflorio, M., Santamaria, N., Zupa, R., Pousis, C., Vassallo-Agius, R., Gordin, H., Corriero, A., 2010. Spawning induction and large-scale collection of fertilized eggs in captive Atlantic bluefin tuna (Thunnus thynnus L.) and the first larval rearing efforts. J. Appl. Ichtyol. 26, 596–599. Elizur, A., Meiri, I., Rosenfeld, H., Zmora, N., Knibb, W.R., Zohar, Y., 1995. Seabream gonadotropins: Sexual dimorphism in gene expression. In: Goetz, F.W., Thomas, P. (Eds.), Fifth International Symposium. Presented at the International Symposium on Reproductive Physiology of Fish. University of Texas, Austin, pp. 13–15. Elizur, A., Zmora, N., Rosenfeld, H., Meiri, I., Hassin, S., Gordin, H., Zohar, Y., 1996. Gonadotropins b-GtHI and b-GtHII from the Gilthead Seabream, Sparus aurata. Gen. Comp. Endocrinol. 102, 39–46. Farnworth, P.G., 1995. Gonadotrophin secretion revisited. How many ways can FSH leave a gonadotroph? J. Endocrinol. 145, 387–395. Farnworth, P.G., Robertson, D.M., De Kretser, D.M., Burger, H.G., 1988. Effects of 31 kilodalton bovine inhibin on follicle-stimulating hormone and luteinizing hormone in rat pituitary cells in vitro: actions under basal conditions. Endocrinology 122, 207–213. Fox, K.M., 2001. Three-dimensional structure of human follicle-stimulating hormone. J. Mol. Endocrinol. 15, 378–389. Fromentin, J.M., 2008. An attempt to evaluate the recent management regulations of the Atlantic and Mediterranean bluefin tuna stock through a simple simulation model. Collect. Vol. Sci. Pap. ICCAT 62, 1271–1279. Fromentin, J.-M., Powers, J.E., 2005. Atlantic bluefin tuna: population dynamics, ecology, fisheries and management. Fish Fish. 6, 281–306. García-Hernández, M.P., Koide, Y., Díaz, M.V., Kawauchi, H., 1997. Isolation and characterization of two distinct gonadotropins from the pituitary gland of Mediterranean yellowtail, Seriola dumerilii (Risso, 1810). Gen. Comp. Endocrinol. 106, 389–399. Gomez, J.M., Weil, C., Ollitrault, M., Le Bail, P.Y., Breton, B., Le Gac, F., 1999. Growth hormone (GH) and gonadotropin subunit gene expression and pituitary and plasma changes during spermatogenesis and oogenesis in rainbow trout (Oncorhynchus mykiss). Gen. Comp. Endocrinol. 113, 413–428. Govoroun, M., Chyb, J., Breton, B., 1998. Immunological cross-reactivity between rainbow trout GTH I and GTH II and their alpha and beta subunits: application to the development of specific radioimmunoassays. Gen. Comp. Endocrinol. 111, 28–37. Gur, G., Melamed, P., Gissis, A., Yaron, Z., 2000. Changes along the pituitary-gonadal axis during maturation of the black carp, Mylopharyngodon piceus. J. Exp. Zool. 286, 405–413. Heinisch, G., Corriero, A., Medina, A., Abascal, F.J., Serna, J.-M., Vassallo-Agius, R., Ríos, A.B., García, A., Gándara, F., Fauvel, C., Bridges, C.R., Mylonas, C.C., Karakulak, S.F., Oray, I., Metrio, G., Rosenfeld, H., Gordin, H., 2008. Spatial– temporal pattern of bluefin tuna (Thunnus thynnus L. 1758) gonad maturation across the Mediterranean Sea. Mar. Biol. 154, 623–630. Hillier, S.G., 2001. Gonadotropic control of ovarian follicular growth and development. Mol. Cell. Endocrinol. 179, 39–46. Hunter, J.R., Macewicz, B.J., 1985. Rates of atresia in the ovary of captive and wild northern anchovy, Engraulis mordax. Fish. Bull. 83, 119–136. Hurvitz, A., Degani, G., Goldberg, D., Din, S.Y., Jackson, K., Levavi-Sivan, B., 2005. Cloning of FSHb, LHb, and glycoprotein a subunits from the Russian Sturgeon (Acipenser gueldenstaedtii), b-subunit mRNA expression, gonad development, and steroid levels in immature fish. Gen. Comp. Endocrinol. 140, 61–73. Ito, J., Tanaka, T., Horikawa, R., Morita, S., Kokaji, M., Satoh, M., Tanae, A., Hibi, I., 1993. Changes in serum and urinary LH/FSH ratio during puberty. Pediatric Res. 33, S86. Jackson, K., Goldberg, D., Ofir, M., Abraham, M., Degani, G., 1999. Blue gourami (Trichogaster trichopterus) gonadotropic b subunits (I and II) cDNA sequences and expression during oogenesis. J. Mol. Endocrinol. 23, 177–187. Jákupsstovu, S.H., Haug, T., 1988. Growth, sexual maturation, and spawning season of Atlantic halibut, Hippoglossus hippoglossus, in Faroese waters. Fish. Res. 6, 201–215. Jameson, J.L., Becker, C.B., Lindell, C.M., Habener, J.F., 1988. Human folliclestimulating hormone b-subunit gene encodes multiple messenger ribonucleic acids. J. Mol. Endocrinol. 2, 806–815. Kajimura, S., Yoshiura, Y., Suzuki, M., Aida, K., 2001. CDNA cloning of two gonadotropin b subunits (GTH-Ib and -IIb) and their expression profiles during gametogenesis in the Japanese flounder (Paralichthys olivaceus). Gen. Comp. Endocrinol. 122, 117–129.

22

N. Berkovich et al. / General and Comparative Endocrinology 194 (2013) 10–23

Karakulak, S., Oray, I., Corriero, A., Deflorio, M., Santamaria, N., Desantis, S., De Metrio, G., 2004. Evidence of a spawning area for the bluefin tuna (Thunnus thynnus L.) in the eastern Mediterranean. J. Appl. Ichtyol. 20, 318–320. Kawauchi, H., Suzuki, K., Itoh, H., Swanson, P., Naito, N., Nagahama, Y., Nozaki, M., Nakai, Y., Itoh, S., 1989. The duality of teleost gonadotropins. Fish Physiol. Biochem. 7, 29–38. Kim, S.J., Park, K., Koeller, D., Kim, K.Y., Wakefield, L.M., Sporn, M.B., Roberts, A.B., 1992. Post-transcriptional regulation of the human transforming growth factorb 1 gene. J. Biol. Chem. 267, 13702–13707. Koide, Y., Itoh, H., Kawauchi, H., 1993. Isolation and characterization of two distinct gonadotropins, GTHI and GTHII, from bonito (Katsuwonus plelamis) pituitary glands. Int. J. Pept. Protein Res. 41, 52–65. Lapthorn, A.J., Harris, D.C., Littlejohn, A., Lustbader, J.W., Canfield, R.E., Machin, K.J., Morgan, F.J., Isaacs, N.W., 1994. Crystal structure of human chorionic gonadotropin. Nature 369, 455–461. Levavi-Sivan, B., Bogerd, J., Mañanós, E.L., Gómez, A., Lareyre, J.J., 2010. Perspectives on fish gonadotropins and their receptors. Gen. Comp. Endocrinol. 165, 412– 437. Li, C., Zhou, L., Wang, Y., Hong, Y., Gui, J., 2005. Molecular and expression characterization of three gonadotropin subunits common a, FSHb and LHb in groupers. Mol. Cell. Endocrinol. 233, 33–46. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2DDCt method. Methods 25, 402–408. MacKenzie, B.R., Mosegaard, H., Rosenberg, A.A., 2009. Impending collapse of bluefin tuna in the northeast Atlantic and Mediterranean. Conserv. Lett. 2, 26– 35. Mañanós, E.L., Swanson, P., Stubblefield, J., Zohar, Y., 1997. Purification of gonadotropin II from a teleost fish, the hybrid striped bass, and development of a specific enzyme-linked immunosorbent assay. Gen. Comp. Endocrinol. 108, 209–222. Mateos, J., Mañanós, E., Martı´nez-Rodrı´guez, E., Carrillo, M., Querat, B., Zanuy, B., 2003. Molecular characterization of sea bass gonadotropin subunits (a, FSHb, and LHb) and their expression during the reproductive cycle. Gen. Comp. Endocrinol. 133, 216–232. Mather, F.J.I., Mason, J.M., Jones, A.C., 1995. Historical document: Life history and fisheries of Atlantic bluefin tuna NOAA, Technical, Memorandum, Vol. NMFSSEFSC-370, pp. 165. Medina, A., Abascal, F.J., Megina, C., Garcia, A., 2002. Stereological assessment of the reproductive status of female Atlantic northern bluefin tuna during migration to Mediterranean spawning grounds through the Strait of Gibraltar. J. Fish Biol. 60, 203–217. Meiri, I., Knibb, W.R., Zohar, Y., Elizur, A., 2004. Temporal profile of b folliclestimulating hormone, b luteinizing hormone, and growth hormone gene expression in the protandrous hermaphrodite, gilthead seabream, Sparus aurata. Gen. Comp. Endocrinol. 137, 288–299. Mittelholzer, C., Andersson, E., Taranger, G.L., Consten, D., Hirai, T., Senthilkumaran, B., Nagahama, Y., Norberg, B., 2009. Molecular characterization and quantification of the gonadotropin receptors FSH-R and LH-R from Atlantic cod (Gadus morhua). Gen. Comp. Endocrinol. 160, 47–58. Molés, G., Gómez, A., Rocha, A., Carrillo, M., Zanuy, S., 2008. Purification and characterization of follicle-stimulating hormone from pituitary glands of sea bass (Dicentrarchus labrax). Gen. Comp. Endocrinol. 158, 68–76. Molés, G., Gómez, A., Carrillo, M., Rocha, A., Mylonas, C.C., Zanuy, S., 2011. Determination of FSH quantity and bioactivity during sex differentiation and oogenesis in European sea bass. Biol. Reprod. 85, 848–857. Molés, G., Gómez, A., Carrillo, M., Zanuy, S., 2012. Development of a homologous enzyme-linked immunosorbent assay for European sea bass FSH. Reproductive cycle plasma levels in both sexes and in yearling precocious and non-precocious males. Gen. Comp. Endocrinol. 176, 70–78. Mylonas, C.C., Bridges, C., Gordin, H., Ríos, A.B., García, A., De La Gándara, F., Fauvel, C., Suquet, M., Medina, A., Papadaki, M., Heinisch, G., De Metrio, G., Corriero, A., Vassallo-Agius, R., Guzmán, J.-M., Mañanos, E., Zohar, Y., 2007. Preparation and administration of gonadotropin-releasing hormone agonist (GnRHa) implants for the artificial control of reproductive maturation in captive-reared Atlantic bluefin tuna (Thunnus thynnus thynnus). Rev. Fish. Sci. 15, 183–210. Mylonas, C.C., De La Gándara, F., Corriero, A., Ríos, A.B., 2010. Atlantic bluefin tuna (Thunnus Thynnus) farming and fattening in the Mediterranean Sea. Rev. Fish. Sci. 18, 266–280. Nozaki, M., Naito, N., Swanson, P., Dickhoff, W.W., Nakai, Y., Suzuki, K., Kawauchi, H., 1990. Salmonid pituitary gonadotrophs II. Ontogeny of GTH I and GTH II cells in the rainbow trout (Salmo gairdneri irideus). Gen. Comp. Endocrinol. 77, 358–367. Okada, T., Kawazoe, I., Kimura, S., Sasamoto, Y., Aida, K., Kawauchi, H., 1994. Purification and characterization of gonadotropin I and II from pituitary glands of tuna (Thunnus obesus). Int. J. Pept. Protein Res. 43, 69–80. Pickering, B.M., Willis, A.E., 2005. The implications of structured 50 untranslated regions on translation and disease. Semin. Cell Dev. Biol. 16, 39–47. Pierce, J.G., Parsons, T.F., 1981. Glycoprotein hormones: structure and function. Annu. Rev. Biochem. 50, 465–495. Prat, F., Sumpter, J.P., Tyler, C.R., 1996. Validation of radioimmunoassays for two salmon gonadotropins (GTH I and GTH II) and their plasma concentrations throughout the reproductivecycle in male and female rainbow trout (Oncorhynchus mykiss). Biol. Reprod. 54, 1375–1382. Quérat, B., Sellouk, A., Salmon, C., 2000. Phylogenetic analysis of the vertebrate glycoprotein hormone family including new sequences of sturgeon (Acipenser baeri) b subunits of the two gonadotropins and the thyroid-stimulating hormone. Biol. Reprod. 63, 222–228.

Quérat, B., Tonnerre-Doncarli, C., Géniès, F., Salmon, C., 2001. Duality of gonadotropins in gnathostomes. Gen. Comp. Endocrinol. 124, 308–314. Riccioni, G., Landi, M., Ferrara, G., Milano, I., Cariani, A., Zane, L., Sella, M., Barbujani, G., Tinti, F., 2010. Spatio-temporal population structuring and genetic diversity retention in depleted Atlantic bluefin tuna of the Mediterranean Sea. Proc. Natl. Acad. Sci. 107, 2102–2107. Richards, W.J., 1976. Spawning of bluefin tuna (Thunnus thynnus) in the Atlantic Ocean and adjacent seas. ICCAT Coll. Vol. Sci. Pap. 5, 267–278. Rifkind, A.B., Kulin, H.E., Ross, G.T., 1967. Follicle-stimulating hormone (FSH) and luteinizing hormone (LH) in the urine of prepubertal children. J. Clin. Invest. 46, 1925–1931. Romeo, D.S., Park, K., Roberts, A.B., Sporn, M.B., Kim, S.J., 1993. An element of the transforming growth factor-b 1 50 -untranslated region represses translation and specifically binds a cytosolic factor. J. Mol. Endocrinol. 7, 759–766. Rooker, J.R., Secor, D.H., De Metrio, G., Schloesser, R., Block, B.A., Neilson, J.D., 2008. Natal homing and connectivity in Atlantic bluefin tuna populations. Science 322, 742–744. Rosenfeld, H., Levavi-Sivan, B., Gur, G., Melamed, P., Meiri, I., Yaron, Z., Elizur, A., 2001. Characterization of tilapia FSHb gene and analysis of its 50 flanking region. Comp. Biochem. Phys. B 129, 389–398. Rosenfeld, H., Gordin, H., Zohar, Y., 2003. Preliminary study of the key hormones regulating reproduction in the bluefin tuna (BFT): the brain gonadotropinreleasing hormones (GnRHs) and the pituitary gonadotropins, FSH and LH. Cah. Options Medit. 60, 177–181. Rosenfeld, H., Meiri, I., Elizur, A., 2007. Gonadotropic regulation of oocyte development: from basic studies to biotechnological applications. In: Babin, P.J., Cerda, J., Lubzens, E. (Eds.), The Fish Oocyte: From Basic Studies to Biotechnological Applications. Springer, Dordrecht, pp. 175–202. Rosenfeld, H., Zlatnikov, V., Meiri-Ashkenazi, I., 2011. Fish gonadotropin agonists: applications in assisted reproductive technologies. In: Joy, K.P., Inbaraj, R.M., Kirubagaran, R., Chaube, R. (Eds.), Presented at the 9th International Symposium on Reproductive Physiology of Fish. Indian Society for Education and Environment, Cochin, India. Rosenfeld, H., Mylonas, C.C., Bridges, C.R., Heinisch, G., Corriero, A., Vassallo-Aguis, R., Medina, A., Belmonte, A., Garcia, A., De la Gándara, F., Fauvel, C., De Metrio, G., Meiri-Ashkenazi, I., Gordin, H., Zohar, Y., 2012. GnRHa-mediated stimulation of the reproductive endocrine axis in captive Atlantic bluefin tuna, Thunnus thynnus. Gen. Comp. Endocrinol. 175, 55–64. Saillant, E., Chatain, B., Menu, B., Fauvel, C., Vidal, M.O., Fostier, A., 2003. Sexual differentiation and juvenile intersexuality in the European sea bass (Dicentrarchus labrax). J. Zool. 260, 53–63. Santamaria, N., Bello, G., Corriero, A., Deflorio, M., Vassallo-Agius, R., Bök, T., De Metrio, G., 2009. Age and growth of Atlantic bluefin tuna, Thunnus thynnus (Osteichthyes: Thunnidae), in the Mediterranean Sea. J. Appl. Ichtyol. 25, 38–45. Santos, E.M., Rand-Weaver, M., Tyler, C.R., 2001. Follicle-stimulating hormone and its a and b subunits in rainbow trout (Oncorhynchus mykiss): purification, characterization, development of specific radioimmunoassays, and their seasonal plasma and pituitary concentrations in females. Biol. Reprod. 65, 288–294. Sawada, Y., Seoka, M., Kato, K., Tamura, T., Nakatani, M., Hayashi, S., Okada, T., Tose, K., Miyashita, S., Murata, O., Kumai, H., 2007. Testes maturation of reared Pacific bluefin tuna Thunnus orientalis at two-plus years old. Fish. Sci. 73, 1070–1077. Schulz, R.W., Renes, I.B., Zandbergen, M.A., van Dijk, W., Peute, J., Goos, H.J., 1995. Pubertal development of male African catfish (Clarias gariepinus). Pituitary ultrastructure and responsiveness to gonadotropin-releasing hormone. Biol. Reprod. 53, 940–950. Schulz, R.W., Zandbergen, M.A., Peute, J., Bogerd, J., van Dijk, W., Goos, H.J., 1997. Pituitary gonadotrophs are strongly activated at the beginning of spermatogenesis in African catfish, Clarias gariepinus. Biol. Reprod. 57, 139–147. Schulz, R.W., de França, L.R., Lareyre, J.-J., Le Gac, F., LeGac, F., Chiarini-Garcia, H., Nobrega, R.H., Miura, T., 2010. Spermatogenesis in fish. Gen. Comp. Endocrinol. 165, 390–411. Shimizu, A., Tanaka, H., Kagawa, H., 2003. Immunocytochemical applications of specific antisera raised against synthetic fragment peptides of mummichog GtH subunits: examining seasonal variations of gonadotrophs (FSH cells and LH cells) in the mummichog and applications to other acanthopterygian fishes. Gen. Comp. Endocrinol. 132, 35–45. Shimizu, A., Sakai, T., Nashida, K., Honda, H., 2005. Universal antisera for immunocytochemical identification of two different gonadotrophs in acanthopterygian fishes. Fish Physiol. Biochem. 29, 275–287. Shimizu, A., Ohkubo, M., Hamaguchi, M., 2012. Development of non-competitive enzyme-linked immunosorbent assays for mummichog Fundulus heteroclitus gonadotropins – examining seasonal variations in plasma FSH and LH levels in both sexes. Gen. Comp. Endocrinol. 178, 463–469. Simoni, M., Weinbauer, G.F., Gromoll, J., Nieschlag, E., 1999. Role of FSH in male gonadal function. Ann. Endocrinol. (Paris) 60, 102–106. Sohn, Y.C., Yoshiura, Y., Kobayashi, M., Aida, K., 1999. Seasonal changes in mRNA levels of gonadotropin and thyrotropin subunits in the goldfish, Carassius auratus. Gen. Comp. Endocrinol. 113, 436–444. Susca, V., Corriero, A., Bridges, C.R., Metrio, G., 2001. Study of the sexual maturity of female bluefin tuna: purification and partial characterization of vitellogenin and its use in an enzyme-linked immunosorbent assay. J. Fish Biol. 58, 815–831. Suzuki, K., Kanamori, A., Nagahama, Y., Kawauchi, H., 1988a. Development of salmon GTH I and GTH II radioimmunoassays. Gen. Comp. Endocrinol. 71, 459– 467.

N. Berkovich et al. / General and Comparative Endocrinology 194 (2013) 10–23 Suzuki, K., Nagahama, Y., Kawauchi, H., 1988b. Steroidogenic activities of two distinct salmon gonadotropins. Gen. Comp. Endocrinol. 71, 452–458. Swanson, P., Suzuki, K., Kawauchi, H., Dickhoff, W.W., 1991. Isolation and characterization of two coho salmon gonadotropins, GTH I and GTH II. Biol. Reprod. 44, 29–38. Swanson, P., Dickey, J.T., Campbell, B., 2003. Biochemistry and physiology of fish gonadotropins. Fish Physiol. Biochem. 28, 53–59. Tam, J.P., Spetzler, J.C., 1997. Multiple antigen peptide system, in: Gregg B. Fields (Ed.), Methods in Enzymology, Academic Press, pp. 612–637. Taranger, G.L., Carrillo, M., Schulz, R.W., Fontaine, P., Zanuy, S., Felip, A., Weltzien, F.A., Dufour, S., Karlsen, O., Norberg, B., Andersson, E., Hansen, T., 2010. Control of puberty in farmed fish. Gen. Comp. Endocrinol. 165, 483–515. Tyler, C.R., Sumpter, J.P., Kawauchi, H., Swanson, P., 1991. Involvement of gonadotropin in the uptake of vitellogenin into vitellogenic oocytes of the rainbow trout, Oncorhynchus mykiss. Gen. Comp. Endocrinol. 84, 291–299. Tyler, C.R., Pottinger, T.G., Coward, K., Prat, F., Beresford, N., Maddix, S., 1997. Salmonid follicle-stimulating hormone (GtH I) mediates vitellogenic development of oocytes in the rainbow trout, Oncorhynchus mykiss. Biol. Reprod. 57, 1238–1244. Van der Kraak, G., Suzuki, K., Peter, R.E., Itoh, H., Kawauchi, H., 1992. Properties of common carp gonadotropin I and gonadotropin II. Gen. Comp. Endocrinol. 85, 217–229. Vitt, U.A., Hsu, S.Y., Hsueh, A.J., 2001. Evolution and classification of cystine knotcontaining hormones and related extracellular signaling molecules. J. Mol. Endocrinol. 15, 681–694. Walton, W.J., Nguyen, V.T., Butnev, V.Y., Singh, V., Moore, W.T., Bousfield, G.R., 2001. Characterization of human FSH isoforms reveals a nonglycosylated b-subunit in addition to the conventional glycosylated b-subunit. J. Clin. Endocrinol. Metab. 86, 3675–3685. Wan´kowska, M., Polkowska, J., 2010. The pituitary endocrine mechanisms involved in mammalian maturation: maternal and photoperiodic influences. Reprod. Biol. 10, 3–18.

23

Weil, C., Bougoussa-Houadec, M., Gallais, C., Itoh, S., Sekine, S., Valotaire, Y., 1995. Preliminary evidence suggesting variations of GtH 1 and GtH 2 mRNA levels at different stages of gonadal development in rainbow trout, Oncorhynchus mykiss. Gen. Comp. Endocrinol. 100, 327–333. Weltzien, F.-A., Kobayashi, T., Andersson, E., Norberg, B., Andersen, Ø., 2003. Molecular characterization and expression of FSHb, LHb, and common asubunit in male Atlantic halibut (Hippoglossus hippoglossus). Gen. Comp. Endocrinol. 131, 87–96. Wu, H., Lustbader, J.W., Liu, Y., Canfield, R.E., Hendrickson, W.A., 1994. Structure of human chorionic gonadotropin at 2.6 A resolution from MAD analysis of the selenomethionyl protein. Structure 2, 545–558. Xing, Y., Myers, R.V., Cao, D., Lin, W., Jiang, M., Bernard, M.P., Moyle, W.R., 2004. Glycoprotein hormone assembly in the endoplasmic reticulum: III. The seatbelt and its latch site determine the assembly pathway. J. Biol. Chem. 279, 35449– 35457. Yaron, Z., Sivan, B., 2006. Reproduction. In: Evans, D.H., Clairbourne, J.B. (Eds.), The Physiology of Fishes. CRC Press, Taylor and Francis, Boca Raton, pp. 343–386. Yaron, Z., Gur, G., Melamed, P., Rosenfeld, H., Elizur, A., Levavi-Sivan, B., 2003. Regulation of fish gonadotropins, in: International Review of Cytology. Elsevier, pp. 131–185. Yoshiura, Y., Kobayashi, M., Kato, Y., Aida, K., 1997. Molecular cloning of the cDNAs encoding two gonadotropin b subunits (GTH-Ib and -IIb) from the goldfish, Carassius auratus. Gen. Comp. Endocrinol. 105, 379–389. Zohar, Y., Elizur, A., Sherwood, N.M., Powell, J.F., Rivier, J.E., Zmora, N., 1995. Gonadotropin-releasing activities of the three native forms of gonadotropinreleasing hormone present in the brain of gilthead seabream, Sparus aurata. Gen. Comp. Endocrinol. 97, 289–299.