Intracellular-activated Notch1 can reactivate Kaposi's sarcoma-associated herpesvirus from latency

Virology 351 (2006) 393 – 403 www.elsevier.com/locate/yviro

Intracellular-activated Notch1 can reactivate Kaposi's sarcoma-associated herpesvirus from latency Ke Lan, Masanao Murakami, Tathagata Choudhuri, Daniel A. Kuppers, Erle S. Robertson ⁎ Department of Microbiology and the Tumor Virology Program, Abramson Comprehensive Cancer Center, University of Pennsylvania Medical School, 201E Johnson Pavilion, 3610 Hamilton Walk, Philadelphia, PA 19104, USA Received 20 January 2006; returned to author for revision 8 March 2006; accepted 24 March 2006 Available online 15 May 2006

Abstract Kaposi's sarcoma-associated herpesvirus (KSHV) establishes a predominantly latent infection in the infected host. Importantly, during latency, only a small number of viral encoded genes are expressed. This viral gene expression pattern contributes to the establishment of longterm infection as well as the ability of the virus to evade the immune system. Previous studies have been shown that the replication and transcription activator (RTA) encoded by ORF50 activates it downstream genes and initiates viral lytic reactivation through functional interaction with RBP–Jκ, the major downstream effector of the Notch signaling pathway. This indicates that RTA can usurp the conserved Notch signaling pathway and mimic the activities of intracellular Notch1 to modulate gene expression. In this report, we show that the activated intracellular domain of Notch1 (ICN) is aberrantly accumulated in KSHV latently infected pleural effusion lymphoma (PEL) cells. ICN activated the RTA promoter in a dose-dependent manner, and forced expression of ICN in latently infected KSHV-positive cells initiated full blown lytic replication with the production of infectious viral progeny. However, latency-associated nuclear antigen (LANA) which is predominantly expressed during latency can specifically down-modulate ICN-mediated transactivation of RTA and so control KSHV for lytic reactivation. These results demonstrate that LANA can inhibit viral lytic replication by antagonizing ICN function and suggest that LANA is a critical component of the regulatory control mechanism for switching between viral latent and lytic replication by directly interacting with effectors of the conserved cellular Notch1 pathway. © 2006 Elsevier Inc. All rights reserved. Keywords: KSHV; Notch1; LANA

Introduction Kaposi's sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus 8 (HHV-8), is a γ2 herpesvirus and the infectious agent important for development of Kaposi's sarcoma (KS) as well as specific lymphoproliferative disorders in humans (Boshoff and Weiss, 2001; Cesarman et al., 1995; Cesarman et al., 1996a, 1996b; Chang et al., 1994; Russo et al., 1996; Sarid et al., 1999, 2002). KSHV is a large DNA virus, and there are ninety genes encoded by the KSHV genome (Taylor et al., 2005), however, less than 10% of these genes are expressed during latency which is quickly established after primary infection (Russo et al., 1996). KSHV-associated KS ⁎ Corresponding author. Fax: +1 215 898 9557. E-mail address: [email protected] (E.S. Robertson). 0042-6822/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2006.03.047

and pleural effusion lymphomas (PELs) express these latent genes shown to be capable of dysregulating cell cycle and apoptotic pathways as well as providing evasion strategies from host immune responses (Friborg et al., 1999; Guasparri et al., 2004). KSHV infection displays two distinct modes during its life cycle, latent and lytic replication (Miller et al., 1997). KSHV can maintain a tightly latent infection in infected cells but is also able to undergo lytic infection in a small percentage of cells in the population. In KS for example, KSHV can latently persist in greater than 90% of tumor cells, with a small number of tumor cells also capable of undergoing spontaneous lytic viral replication. This is thought to be essential for sustaining Kaposi's sarcoma lesions through a paracrine mechanism (Neipel and Fleckenstein, 1999; Schulz and Moore, 1999; Sun et al., 1999). Although over 90 genes or open reading

394

K. Lan et al. / Virology 351 (2006) 393–403

frames have been identified in KSHV genome, only a small subset of these viral genes are typically expressed during latency (Russo et al., 1996). This pattern of viral gene expression allows the virus to escape host immune surveillance and to establish persistent latent infection (Renne et al., 1996; Russo et al., 1996; Sarid et al., 1998). Maintenance of latency is critical for KSHV long-term infection and KSHV-mediated pathogenesis. Under physiological conditions, stress such as hypoxia is sufficient to reactivate KSHV through activation of RTA encoded by ORF50 (Haque et al., 2003). Additionally, ectopic expression of KSHV RTA is sufficient to disrupt viral latency and drive full lytic replication (Lukac et al., 1998, 1999). RTA activates a number of viral genes in the KSHV lytic reactivation, including its own promoter, polyadenylated nuclear RNA, K12, ORF57, vOX-2, K14/vGPCR (viral G-protein-coupled receptor), and vIRF1. RTA modulates its downstream genes either through directly binding to cis-acting element which is known as the RTA-responsive element (RRE) or through interaction with the transcription factors such as RBP–Jκ (Liang et al., 2002; West and Wood, 2003). Interestingly, EBNA2 of Epstein–Barr virus (EBV) has been shown to be

recruited to DNA through interaction with the RBP–Jκ bound to its cis-acting DNA-responsive element (Hsieh and Hayward, 1995). RBP–Jκ is the major downstream target of the highly conserved Notch signaling pathway (Radtke et al., 2004). This suggests that viral proteins like KSHV-encoded RTA and the EBV transactivator EBNA2 can usurp and mimic Notch function to modulate transcription. Most recently, it has been shown that intracellular Notch (ICN, also referred to the activated form of Notch1) (Fig. 1A) is accumulated in KS cells (Curry et al., 2005; Ellisen et al., 1991). This prompted us to explore the potential role of Notch in viral lytic reactivation as there are a number of RBP–Jκ binding sites within RTA promoter along with the promoters of a number of early genes (Lan et al., 2004; Liang et al., 2002). In this report, we show that ICN is aberrantly accumulated in KSHV latently infected PEL cell lines including BCBL1, BC3, and JSC1 (Cannon et al., 2000; Renne et al., 1998). We also tested the potential ability of ICN to disrupt KSHV latency when expressed from a heterologous system. Our results demonstrate that ICN can activate the RTA promoter in a dose-dependent manner and forced expression ICN in KSHV latently infected cells can initiate full blown lytic

Fig. 1. Notch ICN is accumulated in KSHV-infected cells. (A) Scheme showing the Notch1 protein. Notch receptor is heterodimeric transmembrane proteins consisting of an extracellular ligand-binding domain, transmembrane domain, and intracellular domain. The intracellular domain contains a RAM domain, ankyrin repeats, nuclear localization signal, transcriptional activation domain (TAD), and a PEST sequence. The extracellular domain contains multiple EGF-like repeats and LIN12/ Notch repeats (LNR). (B) Western blot showing ICN levels in different cells. Cell lysate of BJAB, BCBL1, BC3, and JSC1 was separated on 8% SDS-PAGE gel, transferred to NC membrane, and then blotted with anti-Notch rabbit serum. This anti-serum recognizes the uncleaved transmembrane subunit NTM (upper band) and its intracellular cleavage product ICN (bottom band), respectively. Same samples were also detected with Val1744 antibody which specifically recognizes ICN. The loading amount of lysates was normalized by Bradford assay. Quantification of relative density for ICN from each cell is also shown. (C) Notch1 ICN up-regulation in Kaposi's sarcoma. Kaposi's sarcoma tissue specimens from 3 patients were analyzed for LANA and Notch1 ICN expression by immunohistochemistry. A representative sample shows a strong correlation between LANA expression and ICN expression. Tumor cell staining is presented in the left panel, and the right panel is the adjacent normal tissue staining. The images on the top are HE staining. Magnification, ×40.

K. Lan et al. / Virology 351 (2006) 393–403

replication and produce viral progeny. However, latencyassociated nuclear antigen (LANA) which is predominantly expressed during latency can repress ICN-mediated transactivation of RTA. Results Expression levels of Notch ICN are elevated in KSHV-positive B cells Recent studies have shown that the levels of activated Notch-1 are elevated in KS tumor cells (Curry et al., 2005). Since KSHV infection is also closely associated with PEL and Multi-centric Castleman Disease (MCD), two B lymphocyte proliferative disorders (Cesarman, 2002; Soulier et al., 1995), it would be interesting to explore the expression levels of ICN in KSHV-positive B cells. To determine if ICN is up-regulated in KSHV-infected PEL cell lines, Western blot analysis of three cell lines, BCBL1, BC3, and JSC1, which are all latently infected with KSHV was performed. The results showed dramatically elevated levels of ICN in KSHV-positive PEL cells when compared to the KSHV-negative B lymphoma cell line BJAB based on signals from either the ICN polyclonal anti-serum against intracellular Notch or the ICN-specific antibody Val1744 which detects the approximately 110 kDa Notch1 cleaved at V1744 by gamma-secretases (Schroeter et al., 1998) (Fig. 1B). As expected, Notch-1 ICN up-regulation was also seen in paraffin-embedded tissue section stained from KS lesion in a Kaposi's sarcoma patient by immunohistochemistry (Fig. 1C, left panel). In this immunostaining, ICN expression correlated with KSHV infection as determined by the corresponding signals for LANA when compared with the reduced ICN signals in the adjacent normal tissue not infected with KSHV (Fig. 1C, compare left and right panels). From HE staining, characteristic cells with spindle shape are visualized in the tumor (Fig. 1C, top panels). ICN activates RTA promoter in a dose-dependent manner and ectopic expression of ICN reactivates KSHV from latency Previous studies have shown that RTA, the immediate early transactivator and master switch of viral reactivation, can initiate lytic replication through functional interaction with RBP–Jκ, the major downstream effector of the Notch signaling pathway (Liang et al., 2002; Liang and Ganem, 2003), indicating that RTA can mimic cellular Notch signal transduction to activate viral lytic gene expression. As previously shown, there are multiple RBP–Jκ binding sites within the RTA promoter (Lan et al., 2005a; Liang et al., 2002). Data above indicate that there is a consistent high level of ICN in KSHV latently infected PEL cells. This led us to hypothesize that ICN may activate RTA promoter through functional interaction with RBP–Jκ complex with its cognate sequence. Thus, we want to determine if Notch1 and specific truncations of Notch1 which includes ICN can reactivate KSHV (Fig. 2A). Interestingly, results from the reporter assays showed that ICN specifically up-regulated the RTA

395

promoter in a dose-dependent manner (Fig. 2B). This suggested that increased ICN may potentially activate RTA expression in KSHV-infected cells leading to viral reactivation. However, full-length Notch as well as a truncated transmembrane form of Notch1 with ankyrin repeats deleted had little or no effect on the RTA promoter (Fig. 2B). Additionally, truncated Notch1 delta E construct can activate RTA promoter when delivered at high doses, but the activation is much less efficient when compared to the activation seen with ICN (Fig. 2B). To test if ICN could drive lytic replication, BCBL1 cells were transfected with an ICN expression vector or induced with TPA as a positive control. TPA is a chemical inducer which is capable of inducing RTA expression and complete viral lytic replication cycle. Twelve hours post-transfection and induction, cells were harvested for analysis. Western blot analysis showed that RTA was strongly expressed in TPA-induced cells as expected (Fig. 3A, lane 4). RTA was also detected in ICN-transfected cells (Fig. 3A, lane 3), however the level of RTA induction by ICN was lower than that seen for TPA-induced cells, likely as a result of the transfection efficiency of the BCBL1 cell line using the ICN expression construct. These results were further corroborated by FACS and immunostaining analyses. RTA signal was clearly detected in ICN-transfected BCBL1 cells. However, the number of cells expressing RTA was less than those found positive in TPA-induced BCBL1 cells (Figs. 3B, C). As expected, there are no detectable levels of RTA found in mock or empty vector-transfected BCBL1 cells (Figs. 3B, C). To determine if RTA induction resulted in production of viral particles, the supernatants of the transfected or induced cells were collected and concentrated and used to infect fresh 293 cells. Immunostaining analysis demonstrated that RTA and LANA were detected in infected cells incubated with supernatant from TPA-induced BCBL1 (Fig. 3D, upper panel) or with supernatant obtained from ICN-transfected BCBL1 (Fig. 3D, bottom panel) 12-h post-infection. This indicated that KSHV infectious virions were produced and secreted in both supernatants and that increased expression of ICN can drive the full cycle of viral lytic replication. In addition, viral DNA was also detected in both supernatants (Fig. 3E, lanes 3 and 4, respectively), however, viral DNA was not detected in the supernatants from mock and empty vector-transfected BCBL1 cells (Fig. 3E, lanes 1 and 2). To further support these studies, we employed Vero cells stably infected with the KSHV-GFP Bac36 recombinant virus to test the ability of ICN to regulate viral life cycle since there is a much higher transfection efficiency for Vero cells (Zhou et al., 2002). Vero/Bac36 cells were transfected with ICN or empty vector, and TPA-induced Vero/Bac36 cells were also used as a positive control. Four days post-transfection or induction, the supernatants were collected and concentrated for infection of 293 cells. GFP can be directly observed as a marker for viral infection. Clearly, GFP signals were detected by FACS analysis in the infected cells with supernatants from ICN-transfected Vero/Bac36 or TPA-induced Vero/ Bac36 (Fig. 4A). However, no detectable levels of GFP signals were found in cells infected with supernatants from

396

K. Lan et al. / Virology 351 (2006) 393–403

Fig. 2. ICN activates RTA promoter in a dose-dependent manner. (A) Scheme to show the Notch expression constructs used for luciferase assay. Delta E is encoded by a cDNA consisting of codons 1–22 fused to codons 1673–2555 and is predicted to result in the synthesis of a mature polypeptide with an amino terminus lying 61 amino acids external to the transmembrane domain. Delta EA has an additional deletion of ankyrin repeats. ICN is encoded by a cDNA consisting of the first two codons of NOTCH1 fused to codon 1770, which lies 24 amino acids internal to the transmembrane domain (Aster et al., 1997). In the diagram, proteolytic cleavage by furin at site S1 produces two subunits, ECN and NTM, which remain non-covalently associated at the cell surface. Sites S2 and S3 identify the sites of proteolytic cleavage mediated by metalloproteases and presenilins induced upon activation by ligand. Cleavage at S3 yields activated form of Notch ICN (Schroeter et al., 1998). (B) Luciferase assay: 1 million of U2OS cells were transfected with 0.5-μg RTA promoter reporter plasmid along with increasing amount of full-length Notch, Delta E, Delta EA or ICN expression vector (0 ng, 10 ng, 20 ng, 50 ng, 100 ng, 200 ng) by lipofectamine 2000. Twenty four hours post-transfection, cells were harvested and lysed for reporter assay.

mock or empty vector-transfected Vero/Bac36 (Fig. 4A). In addition, 293 cells infected with Bac36 were also directly observed by GFP signals suggesting successful infection (Fig. 4B). RBP–Jκ binding sites within ORF50 promoter are critical for ICN-mediated regulation of RTA expression As previously shown, RBP–Jκ is the downstream target of ICN (Furukawa et al., 1992; Lu and Lux, 1996; Schweisguth and Posakony, 1992). To test if RBP–Jκ binding sites within RTA promoter are functional for ICN regulation, we employed a series of truncated versions of the RTA promoter (Fig. 5) which were described before (Lan et al., 2005a). In these truncated promoters, RBP–Jκ binding sites were removed sequentially

until all RBP–Jκ binding sites were deleted to determine the contribution of each site to the regulation of RTA expression (Fig. 5). These reporter constructs were transfected into U2OS cells along with the expression vector pflu-ICN, an HA-tagged ICN expression vector (Aster et al., 1997). As expected, activation of the promoter activity of more than 30-fold was observed when reporter constructs containing the full length (FL) RTA promoter with all the RBP–Jκ binding sites were cotransfected with the ICN expression vector (Fig. 5). However, this activation was not observed when co-transfections were performed with reporter construct pRplucΔ1327 deleted for most of the RBP–Jκ binding sites (Fig. 5). Interestingly, activation by ICN was gradually decreased when pRplucΔ2570 as well as pRplucΔ1490 sequentially deleted for RBP–Jκ binding sites were co-transfected with the ICN expression

K. Lan et al. / Virology 351 (2006) 393–403

397

Fig. 3. Ectopic expression of ICN can activate KSHV. Fifteen million BCBL1 cells were transfected with mock, empty vector pA3M, and ICN, respectively or induced with TPA. Twenty four hours post-transfection and induction, cells were harvested and used for making lysates for Western blot analysis (A) and stained with rabbit anti-RTA serum and goat anti-rabbit FITC for FACS analysis (B) as well as immunofluorescence assay to detect RTA expression (C). (D) Supernatants from ICNtransfected BCBL1 or TPA-induced BCBL1 cells were harvested and concentrated for infection of 293 cells. Twelve hours post-infection, cells were collected and fixed for immunofluorescence assay to detect LANA and RTA expression. (E) PCR showing the presence of KSHV viral DNA in the supernatants from ICNtransfected (lane 3) and TPA-induced (lane 4) BCBL1 cells instead of mock (lane 1) and empty vector pA3M (lane 2)-transfected BCBL1 cells. The primers were 5′ CCTTGGTGCGTTTAACAACA 3′ and 5′ TTATGTAACGCGGAACTCCA 3′.

construct (Fig. 5). This indicated that each of the RBP–Jκ binding sites can contribute to the activation of the RTA promoter by ICN. RBP–Jκ interaction with ICN can form complexes bound to its cognate sequence on the RTA promoter in vitro The results of the luciferase reporter assays above showed that the presence of potential RBP–Jκ binding sites within the RTA promoter is important for ICN's ability to activate the promoter. Therefore, to address whether ICN activates the RTA promoter through formation of an RBP–Jκ/ICN complex bound to the cis-acting DNA element within the RTA promoter, an electrophoretic mobility shift assay (EMSA) was performed. A probe was designed that contained the furthest downstream RBP–Jκ consensus binding sequence within the RTA promoter, as well as the 6 adjacent bases both 5′ and 3′ to the cognate

sequence (Russo et al., 1996). The results of the EMSA assay show that a specific RBP–Jκ shift was observed with the probe in the presence of in vitro translated RBP–Jκ (Fig. 6, lane 2). The specificity of this band was demonstrated by its disappearance in the presence of specific competitor probe (Fig. 6, lane 3) and was further verified by its supershifting in the presence of specific antibody (Fig. 6, lane 4). In the presence of in vitro translated HA-tagged ICN, an additional shift was observed (asterisk, Fig. 6, lanes 7). This shift is likely to be formed by ICN/RBP–Jκ complex. The specificity of this band was further verified by its supershifting in the presence of specific antibodies (Fig. 6, lanes 8, 9), while no effect was observed in the presence of nonspecific antibody (Fig. 6, lane 10). Data therefore suggest that RBP–Jκ can form a complex with its consensus binding site within the RTA promoter and that ICN is able to associate with the complex of RBP–Jκ bound to its specific sequence.

398

K. Lan et al. / Virology 351 (2006) 393–403

Fig. 4. (A) FACS analysis showing the GFP expression in infected 293 cells with the supernatants from mock, pA3M, and ICN-transfected or TPA-induced Vero cells which were stably infected with Bac36. (B) Direct microscope to check GFP expression in the above infected cells.

LANA regulates Notch ICN transactivation and viral reactivation Although our transfection experiments showed that ICN can drive lytic replication of KSHV, it is understandable that KSHV predominantly stays latent under physiological conditions in vivo and in vitro. This suggests that the accumulation of ICN in the majority of KSHV-positive cells has not crossed a threshold level which can overcome the latent state or there are built-in control mechanisms used by KSHV to antagonize the ability of ICN to reactivate the virus from latency. Additionally, LANA is predominantly expressed in all KSHV latently infected cells, and we have previously shown that LANA can maintain latency by down-regulating RTA expression (Lan et al., 2004). Here, we show that LANA can also repress the ability of ICN to transactivate RTA expression and so maintain latency. Indeed, reporter assays showed that LANA can repress ICN transactivation of RTA in a dose-dependent manner (Fig. 7A). To determine if up-regulation of RTA by ICN can be shut down by LANA at the transcriptional level, real-time qPCR was performed to examine the effect on RTA expression in different transient transfection. BCBL1 cells were transfected with mock, empty vector, and ICN with or without LANA. BCBL1 cell line is latently infected with KSHV in which LANA expression level remains high to keep the virus in latent state. Total RNA was collected 24-h post-transfection for real-time PCR analysis. The results indicated that there was a higher Ct value in mock and vector-transfected BCBL1 cells which represents less copy number of RTA transcripts in these cells (Fig. 7B). However, Ct value for ICN-transfected BCBL1 was much lower, indicating accumulation of RTA transcripts in this sample (Fig. 7B). Expectedly, Ct value for ICN and LANA co-transfected BCBL1 was similar to mock and vector control. This shows that LANA is capable of shutting down RTA transcription by antagonizing ICN (Fig. 7B). Additionally, ICN expression levels were similar in both ICN-transfected and ICN/LANA co-transfected cells which indicated down-regulation of RTA is due to the presence of LANA but not due to the reduction of ICN (Fig. 7B). We also

took advantage of the Bac36 system to determine if exogenous expression of LANA could antagonize ICN by directly blocking the production of viral particles. Vero/Bac36 cells were transfected with ICN with or without LANA, similarly 4 days post-transfection, the supernatants of each transfection were collected and concentrated for infection of 293 cells. Twenty four hours post-infection, the cells were collected for FACS analysis. GFP signals were clearly detected in cells infected with supernatant from Vero/Bac36/ICN cells (Fig. 7C). However, there is little or no detectable levels of GFP found

Fig. 5. Transcriptional activity of ICN on RTA promoters. The reporter plasmid pRpluc contains a 3-kb sequence upstream of the translational initiation site of the RTA gene that drives the expression of firefly luciferase. A series of truncation promoters named as pRplucΔ2570, pRplucΔ1490 and pRplucΔ1327 were made for deletion of RBP–Jκ binding sites (bottom panel). A fixed amount (0.5 μg) of the reporter plasmids was transfected or co-transfected into U2OS cell with 50 ng of pflu-ICN. The promoter activity was expressed as the fold activation relative to the reporters alone control. The means and standard deviations from three independent transfections are shown.

K. Lan et al. / Virology 351 (2006) 393–403

399

Discussion Similar to other herpesviruses, KSHV is also characterized by its ability to establish two distinct modes of infection: latent and lytic replication. Latency is established soon after primary lytic infection and is characterized by the persistence of the viral genome in the cell nucleus and expression of a small subset of viral genes. Lytic reactivation of latent virus involves the sequential activation of immediate-early, early, and late viral genes. In KSHV, this gene expression cascade is initiated by immediate-early viral transactivator RTA (Sun et

Fig. 6. ICN/RBP–Jκ DNA binding complex. The probe for the EMSA consists of an RBP–Jκ consensus binding sequence and the flanking bases from RTA promoter, the sequence of the probe is as follows: 5′-GATCATTTCCGTGGGAAGACGAT-3′. RBP–Jκ/DNA complex is indicated. The asterisk indicates the position of the supershifted complex in the presence of ICN-HA and RBP– Jκ-myc in vitro translated mixture with specific antibodies. Non, nonspecific; IVT, in vitro translated; SCC, specific cold competitor.

in cells infected with supernatant from Vero/Bac36 cells cotransfected with ICN and LANA similar to that seen for mock or vector (Fig. 7C). This indicates that LANA is capable of downmodulating the ability of ICN to reactivate KSHV and so ensures maintenance of latency. Fig. 7. (A) LANA represses ICN transactivation on RTA promoter. 1 million of U2OS cells were transfected with 0.5 μg RTA promoter reporter plasmid and 50 ng ICN expression vector along with increasing amount of LANA expression vector (0 ng, 10 ng, 20 ng, 50 ng, 100 ng, 200 ng) by lipofectamine 2000. Twenty four hours post-transfection, cells were harvested and lysed for reporter assay. (B) For each transfection, 15 million BCBL1 cells were transfected with mock, pA3M empty vector, and ICN with or without LANA. Twenty four hours post-transfection, total RNA was collected from the cells. A total of 5 μg of RNA was used with the Superscript First Strand Synthesis system to construct cDNA. Real-time PCR was performed using the DyNAmo SYBR Green qPCR kit with β-actin as the standard. The PCR data are expressed as the Ct values for RTA transcription. Each sample was tested in triplicate for the calculation of the mean and standard deviation. The relative transcript abundance (Log molecules) based on the Ct values for RTA. (C) Twenty million of Vero cells stably infected with Bac36 were mock-transfected or transfected with empty vector pA3M, ICN, or ICN plus LANA. Four days post-transfection, supernatant from each transfection was harvested and concentrated for infection of 293 cells. Twenty four hours post-infection, cells were harvested for FACS analysis to detect GFP expression marking the virus existence.

400

K. Lan et al. / Virology 351 (2006) 393–403

al., 1998, 1999). The ectopic expression of RTA in latently infected B cells is sufficient to reactivate the latent virus and initiate replication (Lukac et al., 1998, 1999; Nakamura et al., 2003). Since long-term infection in the host is one of the most important features of KSHV and contributes to viral pathogenesis, maintenance of latent state becomes a critical component of the virus life cycle. It is therefore important to understand the mechanisms by which expression of RTA is regulated. RTA can be activated by chemical inducers such as TPA and sodium butyrate (Sun et al., 1999). It has also been shown that hypoxia can induce lytic replication through upregulating RTA (Haque et al., 2003). During lytic reactivation, RTA auto-activates its own promoter, and by using this positive feed back loop, RTA is able to successfully drive lytic replication to completion (Deng et al., 2000). Additionally, RTA is down-regulated by NF-κB and KSHV LANA which is critical for latency control (Brown et al., 2003). To fully understand the regulation of RTA, it would be interesting to explore the potential regulatory mechanisms controlling RTA expression by host factors in the context of the viral–host environment. Previously, it has been shown that RTA activates lytic reactivation through functional interaction with RBP–Jκ (Liang et al., 2002). In another gamma-herpesvirus EBV, EBNAs modulate gene expression by targeting RBP–Jκ (Hsieh and Hayward, 1995). Additionally, we showed that LANA can down-regulate RTA transcription by binding to RBP–Jκ (Lan et al., 2005a). Thus, RBP–Jκ is likely serving as a signal transducer which transmits a series of finely tuned negative or positive regulatory signals to the virus to stringently regulate the viral life cycle. Since RBP–Jκ is the major downstream effector of Notch signaling pathway, this indicates viral proteins can to some extent replace the function of Notch ICN to modulate specific viral and cellular gene transcription. The Notch signaling pathway plays a critical role in the development of different tissues and cell types, through diverse effects on differentiation, survival, and/or proliferation that are highly dependent on signal strength and the cellular context (Radtke et al., 2004). Ligand binding triggers a series of protease-based cleavage events which lead to ICN production from the full-length Notch receptor (Wu and Griffin, 2004). ICN can then be translocated into nucleus and binds to its major downstream target RBP–Jκ to regulate gene transcription (Wu and Griffin, 2004). This is the classic RBP–Jκdependent pathway for Notch signaling. However, increasing evidence indicates that there is also a RBP–Jκ-independent pathway (Brennan and Gardner, 2002). This provides for some flexibility for Notch ICN to modulate gene expression in the context of varying cellular physiological conditions. In this study, we first demonstrated that the expression level of ICN in KSHV latently infected B lymphocytes is aberrantly high compared to that in KSHV-negative B lymphocytes. This finding is corroborated with a most recent discovery which showed that ICN level is greatly elevated in KS tissue (Curry et al., 2005). We next addressed the potential functional consequences of increased ICN for the viral life cycle. We

found that ICN can up-regulate the RTA promoter in a dosedependent manner. This is not very surprising since there are four identical RBP–Jκ binding sites within the RTA promoter (Lan et al., 2005a; Liang et al., 2002). As expected, truncated RTA promoter constructs lacking of RBP–Jκ-binding site are not responsive to ICN. Overexpression of ICN in KSHV latently infected PEL cells can interrupt the viral latency and drive lytic replication to completion. Recently, another report showed that induced expression of a truncated form of Notch1 failed to trigger full lytic reactivation of KSHV (Chang et al., 2005). The different result between this report and our study is most likely due to the difference of expression constructs of Notch1. The truncated Notch1 expression vector may contain the transmembrane domain (Chang et al., 2005). Similarly, our data evaluating a number of truncated Notch1 constructs which include one that contains the transmembrane domain showed minimal activation of the RTA promoter compared to that seen with ICN which does not have a transmembrane domain and clearly activates RTA. Additionally, the promoter of ICN expression vector in our report is the strong CMV promoter and transient transfection can result in induction of high levels of intracellular-activated Notch1 (ICN levels). Thus, the latent state of the virus can be overcome in these transfected cells. Interestingly, induction of the truncated Notch1 does upregulate a number of lytic genes (Chang et al., 2005). Taken together, these data demonstrate aberrant elevated levels of ICN in KSHV-positive B cells, where ICN is likely to have an impact on either viral or cellular host factors. We also demonstrated that LANA can down-regulate ICN-mediated transactivation of the RTA promoter and that LANA can shut down ICN-mediated lytic replication. Previously, it was shown that LANA down-regulates RTA promoter through interaction with RBP–Jκ (Lan et al., 2005a). Thus, repression of ICN transactivation by LANA is not necessarily a surprising phenomenon. Additionally, we showed that ectopic expression of ICN can trigger lytic replication and viral progeny production can also provide a possible explanation for the fact that there are always a small percentage of KSHV-infected cells which automatically undergo viral lytic replication leading to production of progeny viruses. In the context of specific cellular environments, ICN may be able to overcome the tightly latent state controlled by LANA. There are a number of questions to be answered in the future. Although we and others have observed that ICN is accumulated in KSHV-infected cells, what would be the potential mechanism for ICN accumulation in these cells? Does KSHV regulate ICN expression through transcription or post-translational activities? Pathophysiologic Notch1 signals can potentially contribute to cancer development in a number of different mechanisms. A well-known example is that abnormal Notch1 signaling was linked to tumorigenesis through identification of a recurrent t(7;9)(q34;q34.3) chromosomal translocation involving the human Notch1 gene that is found in a small subset of human pre-T-cell acute lymphoblastic leukemias (T-ALL) (Aster et al., 2000; Ellisen et al., 1991). Since this discovery, aberrant Notch signaling has been suggested to be involved in a wide variety of human

K. Lan et al. / Virology 351 (2006) 393–403

neoplasms (Nam et al., 2002). We showed that ICN is highly expressed in KSHV-infected B cell. Thus, a future goal of this laboratory would be to address the role of ICN in KSHVmediated lymphomagenesis. Materials and methods Antibodies, cell lines, plasmids and tissue KSHV Rta rabbit polyclonal antibody was provided by Gary S. Hayward (Johns Hopkins University School of Medicine). KSHV Rta mouse monoclonal antibody was a kind gift from Koichi Yamanishi (Osaka University, Osaka, Japan). Human polyclonal serum which recognizes LANA is designated as HS and was provided by Gary Nabel (Vaccine Institute, NIH, Bethesda, MD). Notch rabbit anti-serum was provided by Jon C. Aster and Elliot Kieff (Brigham and Women's Hospital, Boston, MA). Val1744 antibody was purchased from Cell Signaling Technology Inc, Beverly, MA. Human embryonic kidney fibroblast 293 cell was obtained from Jon Aster (Brigham and Women's Hospital, Boston, MA). BJAB is KSHV-negative B cell lines isolated from Burkitt's lymphoma and was provided by Elliott Kieff (Harvard Medical School, Boston, MA). BCBL1 and BC3 are KSHV-positive body cavity-based lymphoma-derived cell lines obtained from Dr. Don Ganem and the American Type Culture Collection, respectively. JSC1 is a kind gift from Richard F. Ambinder (Johns Hopkins University School of Medicine, Baltimore, MD). Vero cells stably infected with Bac36 (Vero/Bac36) were provided by Shou-jiang Gao (The University of Texas Health Science Center, San Antonio, TX). A human osteosarcoma cell line U2OS was obtained from the American Type Culture Collection. Human embryonic kidney fibroblast 293 and 293T cells were grown in high-glucose DMEM supplemented with 5% bovine growth serum (BGS, Hyclone Inc. Logan, UT), 2 mM L-glutamine, 25 U/ml penicillin, and 25 μg/ml streptomycin. Ramos, Loukes, DG75, BCBL1, BC3, and JSC1 were grown in RPMI 1640 medium supplemented with 10% BGS, 2 mM L-glutamine, 25 U/ml penicillin, and 25 μg/ml streptomycin. HA-tagged Notch ICN pflu-ICN and untagged pCDNA3.1ICN expression vector, full-length Notch1, Delta E, and Delta EA constructs were described previously (Aster et al., 1997). Specifically, ICN is encoded by a cDNA consisting of the first two codons of NOTCH1 fused to codon 1770, which lies 24 amino acids internal to the transmembrane domain (Aster et al., 1997). Reporter plasmid of RTA promoter was provided by Ren Sun (University of California at Los Angeles) (Deng et al., 2000). Myc-tagged LANA pA3M-LANA and truncation versions of RTA promoters were described previously (Lan et al., 2005a, 2005b; Lan et al., 2004). Kaposi's sarcoma tissues were obtained from archived samples at the Hospital of University of Pennsylvania Department of Pathology and Laboratory Medicine and with diagnosis of KS by the resident pathologist. All tissue samples are AIDS-associated Kaposi's sarcoma.

401

Transfection BCBL1 or Vero/Bac36 cells were transfected by electroporation using a Bio-Rad Gene Pulser II electroporator. Ten million cells harvested in exponential phase were collected and washed in phosphate-buffered saline and then resuspended in 400 μl of RPMI or DMEM with DNA for transfection. Resuspended cells were transferred to a 0.4-cm cuvette and electroporated at 975 μF and 220 V. The electroporated cells were then transferred to 10 ml of complete medium followed by incubation at 37 °C and 5% CO2. Transfections were harvested after 24 h and assayed for activity. Luciferase assay U2OS cells were collected at 70% confluency. One million cells were collected for transfection by using lipofectamine 2000. The cells were subsequently lysed with 200-μl Reporter Lysis Buffer (Promega, Inc. Madison, WI). Forty microliters of the lysate was mixed with 100 μl of luciferase assay reagent. Luminescence was measured for 10 s by the Opticomp I luminometer (MGM Instruments, Inc. Hamden, CT). The lysates were also tested at varying dilutions to ensure that luciferase activity was within the linear range of the assay. The results shown represent experiments performed in triplicate. Induction of KSHV lytic replication and infection To prepare KSHV virus particles, we collected approximately 500 million exponentially growing BCBL1 cells for induction. The procedure for preparation of infectious virions and for infection of cells was described previously (Lan et al., 2005b). Real-time RT-PCR Real-time qPCR was used to make a relative quantitative comparison of Notch levels in different cell lines or RTA levels in different transfected or TPA-induced BCBL1 cells. The procedure and method for calculation were described previous-ly (Lan et al., 2005b). The primers in this experiment were for Notch (5′ GGGCTTCAAAGTGTCTGAGG 3′, 5′ CGGAACTTCTTGGTCTCCAG 3′), Rta (5′ TATCCAGGAAGCGGTCTCAT 3′, 5′ GGGTTAAAGGGGATGATGCT 3′), and β-actin (5′GCTCGTCGTCGACAACGGCT C3′, 5′CAAACATGATCTGGGTCATCTTCTC 3′). Immunofluorescence Immunofluorescent assays were performed essentially as described previously (Lan et al., 2005a, 2005b; Lan et al., 2004). Slides were visualized with an Olympus XI70 inverted fluorescence microscope (Olympus Inc. Melville, NY) and photographed using a digital PixelFly camera and software (Cooke Inc. Warren, MI).

402

K. Lan et al. / Virology 351 (2006) 393–403

Flow cytometry All flow cytometric analysis was conducted on FACSCalibur cytometer (Becton Dickinson, San Jose, CA) and analysis with FlowJo software (Tree Star, Ashland, OR). For GFP quantification, cells were fixed with 3% paraformaldehyde. Rehyrdrade in PBS containing 1% BSA. Cells were washed thoroughly and analyzed on a flow cytometer equipped with 488-nm Argon laser light source and a 515-nm band pass filter for GFP fluorescence. Total 10,000 events were acquired for analysis using CellQuest software. Cells were properly gated as described earlier, and histogram plot of GFP fluorescence (x axis) versus counts (y axis) has been shown in logarithmic fluorescence intensity. For the determination of the expression of RTA protein, 5 million cells were fixed in methanol and then permeabilized. Cells were incubated with polyclonal anti-RTA for 2 h at room temperature and then with FITC-conjugated isotypespecific secondary antibody for detecting the respective protein levels for 1 h. Cells were washed thoroughly and analyzed on a flow cytometer equipped with 488-nm Argon laser light source and a 515-nm band pass filter for FITC fluorescence. Total 10,000 events were acquired for analysis using CellQuest software. Cells were properly gated as described earlier, and histogram plot of FITC fluorescence (x axis) versus counts (y axis) has been shown in logarithmic fluorescence intensity. Acknowledgments We thank Gary S. Hayward (Johns Hopkins University School of Medicine) for KSHV Rta rabbit polyclonal antibody, Kaiji Ueda and Koichi Yamanishi (Osaka University, Osaka, Japan) for KSHV Rta mouse monoclonal antibody, Shoujiang Gao (University of Texas) for Bac36 KSHV-GFP recombinant virus, we also thank Michael Feldman (University of Pennsylvania) for KS tissue slides. We are grateful to Jie Sun (Veterinary School of University of Pennsylvania) for technical assistance. This work was supported by public health service awards from the NCI CA072510 and CA091792 and from NIDCR DE01436. ESR is a scholar of the Leukemia and Lymphoma Society of America. References Aster, J.C., Robertson, E.S., Hasserjian, R.P., Turner, J.R., Kieff, E., Sklar, J., 1997. Oncogenic forms of NOTCH1 lacking either the primary binding site for RBP–Jkappa or nuclear localization sequences retain the ability to associate with RBP–Jkappa and activate transcription. J. Biol. Chem. 272 (17), 11336–11343. Aster, J.C., Xu, L., Karnell, F.G., Patriub, V., Pui, J.C., Pear, W.S., 2000. Essential roles for ankyrin repeat and transactivation domains in induction of T-cell leukemia by notch1. Mol. Cell. Biol. 20 (20), 7505–7515. Boshoff, C., Weiss, R.A., 2001. Epidemiology and pathogenesis of Kaposi's sarcoma-associated herpesvirus. Philos. Trans. R. Soc. London, Ser. B Biol. Sci. 356 (1408), 517–534. Brennan, K., Gardner, P., 2002. Notching up another pathway. Bioessays 24 (5), 405–410.

Brown, H.J., Song, M.J., Deng, H., Wu, T.T., Cheng, G., Sun, R., 2003. NFkappaB inhibits gammaherpesvirus lytic replication. J. Virol. 77 (15), 8532–8540. Cannon, J.S., Ciufo, D., Hawkins, A.L., Griffin, C.A., Borowitz, M.J., Hayward, G.S., Ambinder, R.F., 2000. A new primary effusion lymphoma-derived cell line yields a highly infectious Kaposi's sarcoma herpesvirus-containing supernatant. J. Virol. 74 (21), 10187–10193. Cesarman, E., 2002. The role of Kaposi's sarcoma-associated herpesvirus (KSHV/HHV-8) in lymphoproliferative diseases. Recent Results Cancer Res. 159, 27–37. Cesarman, E., Chang, Y., Moore, P.S., Said, J.W., Knowles, D.M., 1995. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDSrelated body-cavity-based lymphomas. N. Engl. J. Med. 332 (18), 1186–1191. Cesarman, E., Nador, R.G., Aozasa, K., Delsol, G., Said, J.W., Knowles, D.M., 1996a. Kaposi's sarcoma-associated herpesvirus in non-AIDS related lymphomas occurring in body cavities. Am. J. Pathol. 149 (1), 53–57. Cesarman, E., Nador, R.G., Bai, F., Bohenzky, R.A., Russo, J.J., Moore, P.S., Chang, Y., Knowles, D.M., 1996b. Kaposi's sarcoma-associated herpesvirus contains G protein-coupled receptor and cyclin D homologs which are expressed in Kaposi's sarcoma and malignant lymphoma. J. Virol. 70 (11), 8218–8223. Chang, Y., Cesarman, E., Pessin, M.S., Lee, F., Culpepper, J., Knowles, D.M., Moore, P.S., 1994. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266 (5192), 1865–1869. Chang, H., Dittmer, D.P., Chul, S.Y., Hong, Y., Jung, J.U., 2005. Role of Notch signal transduction in Kaposi's sarcoma-associated herpesvirus gene expression. J. Virol. 79 (22), 14371–14382. Curry, C.L., Reed, L.L., Golde, T.E., Miele, L., Nickoloff, B.J., Foreman, K.E., 2005. Gamma secretase inhibitor blocks Notch activation and induces apoptosis in Kaposi's sarcoma tumor cells. Oncogene 24 (42), 6333–6344. Deng, H., Young, A., Sun, R., 2000. Auto-activation of the rta gene of human herpesvirus-8/Kaposi's sarcoma-associated herpesvirus. J. Gen. Virol. 81 (Pt. 12), 3043–3048. Ellisen, L.W., Bird, J., West, D.C., Soreng, A.L., Reynolds, T.C., Smith, S.D., Sklar, J., 1991. TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 66 (4), 649–661. Friborg Jr., J., Kong, W., Hottiger, M.O., Nabel, G.J., 1999. p53 inhibition by the LANA protein of KSHV protects against cell death. Nature 402 (6764), 889–894. Furukawa, T., Maruyama, S., Kawaichi, M., Honjo, T., 1992. The Drosophila homolog of the immunoglobulin recombination signal-binding protein regulates peripheral nervous system development. Cell 69 (7), 1191–1197. Guasparri, I., Keller, S.A., Cesarman, E., 2004. KSHV vFLIP is essential for the survival of infected lymphoma cells. J. Exp. Med. 199 (7), 993–1003. Haque, M., Davis, D.A., Wang, V., Widmer, I., Yarchoan, R., 2003. Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) contains hypoxia response elements: relevance to lytic induction by hypoxia. J. Virol. 77 (12), 6761–6768. Hsieh, J.J., Hayward, S.D., 1995. Masking of the CBF1/RBPJ kappa transcriptional repression domain by Epstein–Barr virus EBNA2. Science 268 (5210), 560–563. Lan, K., Kuppers, D.A., Verma, S.C., Robertson, E.S., 2004. Kaposi's sarcomaassociated herpesvirus-encoded latency-associated nuclear antigen inhibits lytic replication by targeting Rta: a potential mechanism for virus-mediated control of latency. J. Virol. 78 (12), 6585–6594. Lan, K., Kuppers, D.A., Robertson, E.S., 2005a. Kaposi's sarcoma-associated herpesvirus reactivation is regulated by interaction of latency-associated nuclear antigen with recombination signal sequence-binding protein Jkappa, the major downstream effector of the Notch signaling pathway. J. Virol. 79 (6), 3468–3478. Lan, K., Kuppers, D.A., Verma, S.C., Sharma, N., Murakami, M., Robertson, E.S., 2005b. Induction of Kaposi's sarcoma-associated herpesvirus latencyassociated nuclear antigen by the lytic transactivator RTA: a novel mechanism for establishment of latency. J. Virol. 79 (12), 7453–7465.

K. Lan et al. / Virology 351 (2006) 393–403 Liang, Y., Ganem, D., 2003. Lytic but not latent infection by Kaposi's sarcoma-associated herpesvirus requires host CSL protein, the mediator of Notch signaling. Proc. Natl. Acad. Sci. U.S.A. 100 (14), 8490–8495. Liang, Y., Chang, J., Lynch, S.J., Lukac, D.M., Ganem, D., 2002. The lytic switch protein of KSHV activates gene expression via functional interaction with RBP–Jkappa (CSL), the target of the Notch signaling pathway. Genes Dev. 16 (15), 1977–1989. Lu, F.M., Lux, S.E., 1996. Constitutively active human Notch1 binds to the transcription factor CBF1 and stimulates transcription through a promoter containing a CBF1-responsive element. Proc. Natl. Acad. Sci. U.S.A. 93 (11), 5663–5667. Lukac, D.M., Renne, R., Kirshner, J.R., Ganem, D., 1998. Reactivation of Kaposi's sarcoma-associated herpesvirus infection from latency by expression of the ORF 50 transactivator, a homolog of the EBV R protein. Virology 252 (2), 304–312. Lukac, D.M., Kirshner, J.R., Ganem, D., 1999. Transcriptional activation by the product of open reading frame 50 of Kaposi's sarcoma-associated herpesvirus is required for lytic viral reactivation in B cells. J. Virol. 73 (11), 9348–9361. Miller, G., Heston, L., Grogan, E., Gradoville, L., Rigsby, M., Sun, R., Shedd, D., Kushnaryov, V.M., Grossberg, S., Chang, Y., 1997. Selective switch between latency and lytic replication of Kaposi's sarcoma herpesvirus and Epstein–Barr virus in dually infected body cavity lymphoma cells. J. Virol. 71 (1), 314–324. Nakamura, H., Lu, M., Gwack, Y., Souvlis, J., Zeichner, S.L., Jung, J.U., 2003. Global changes in Kaposi's sarcoma-associated virus gene expression patterns following expression of a tetracycline-inducible Rta transactivator. J. Virol. 77 (7), 4205–4220. Nam, Y., Aster, J.C., Blacklow, S.C., 2002. Notch signaling as a therapeutic target. Curr. Opin. Chem. Biol. 6 (4), 501–509. Neipel, F., Fleckenstein, B., 1999. The role of HHV-8 in Kaposi's sarcoma. Semin. Cancer Biol. 9 (3), 151–164. Radtke, F., Wilson, A., Mancini, S.J., MacDonald, H.R., 2004. Notch regulation of lymphocyte development and function. Nat. Immunol. 5 (3), 247–253. Renne, R., Zhong, W., Herndier, B., McGrath, M., Abbey, N., Kedes, D., Ganem, D., 1996. Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat. Med. 2 (3), 342–346. Renne, R., Blackbourn, D., Whitby, D., Levy, J., Ganem, D., 1998. Limited transmission of Kaposi's sarcoma-associated herpesvirus in cultured cells. J. Virol. 72 (6), 5182–5188. Russo, J.J., Bohenzky, R.A., Chien, M.C., Chen, J., Yan, M., Maddalena, D., Parry, J.P., Peruzzi, D., Edelman, I.S., Chang, Y., Moore, P.S., 1996.

403

Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8). Proc. Natl. Acad. Sci. U.S.A. 93 (25), 14862–14867. Sarid, R., Flore, O., Bohenzky, R.A., Chang, Y., Moore, P.S., 1998. Transcription mapping of the Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based lymphoma cell line (BC-1). J. Virol. 72 (2), 1005–1012. Sarid, R., Olsen, S.J., Moore, P.S., 1999. Kaposi's sarcoma-associated herpesvirus: epidemiology, virology, and molecular biology. Adv. Virus Res. 52, 139–232. Sarid, R., Klepfish, A., Schattner, A., 2002. Virology, pathogenetic mechanisms, and associated diseases of Kaposi sarcoma-associated herpesvirus (human herpesvirus 8). Mayo Clin. Proc. 77 (9), 941–949. Schroeter, E.H., Kisslinger, J.A., Kopan, R., 1998. Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain. Nature 393 (6683), 382–386. Schulz, T.F., Moore, P.S., 1999. Kaposi's sarcoma-associated herpesvirus: a new human tumor virus, but how? Trends Microbiol. 7 (5), 196–200. Schweisguth, F., Posakony, J.W., 1992. Suppressor of Hairless, the Drosophila homolog of the mouse recombination signal-binding protein gene, controls sensory organ cell fates. Cell 69 (7), 1199–1212. Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazals-Hatem, D., Babinet, P., d'Agay, M.F., Clauvel, J.P., Raphael, M., Degos, L., et al., 1995. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease. Blood 86 (4), 1276–1280. Sun, R., Lin, S.F., Gradoville, L., Yuan, Y., Zhu, F., Miller, G., 1998. A viral gene that activates lytic cycle expression of Kaposi's sarcoma-associated herpesvirus. Proc. Natl. Acad. Sci. U.S.A. 95 (18), 10866–10871. Sun, R., Lin, S.F., Staskus, K., Gradoville, L., Grogan, E., Haase, A., Miller, G., 1999. Kinetics of Kaposi's sarcoma-associated herpesvirus gene expression. J. Virol. 73 (3), 2232–2242. Taylor, J.L., Bennett, H.N., Snyder, B.A., Moore, P.S., Chang, Y., 2005. Transcriptional analysis of latent and inducible Kaposi's sarcoma-associated herpesvirus transcripts in the K4 to K7 region. J. Virol. 79 (24), 15099–15106. West, J.T., Wood, C., 2003. The role of Kaposi's sarcoma-associated herpesvirus/human herpesvirus-8 regulator of transcription activation (RTA) in control of gene expression. Oncogene 22 (33), 5150–5163. Wu, L., Griffin, J.D., 2004. Modulation of Notch signaling by mastermind-like (MAML) transcriptional co-activators and their involvement in tumorigenesis. Semin. Cancer Biol. 14 (5), 348–356. Zhou, F.C., Zhang, Y.J., Deng, J.H., Wang, X.P., Pan, H.Y., Hettler, E., Gao, S.J., 2002. Efficient infection by a recombinant Kaposi's sarcoma-associated herpesvirus cloned in a bacterial artificial chromosome: application for genetic analysis. J. Virol. 76 (12), 6185–6196.