- Email: [email protected]
Intracellular expression and purification of the Canstatin-N protein in Pichia pastoris
Gene 504 (2012) 122–126
Contents lists available at SciVerse ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Short Communication
Intracellular expression and purification of the Canstatin-N protein in Pichia pastoris☆ Huixiang Yin a, Zhenwang Liu a, Ailian Zhang a,⁎, Tianyuan Zhang d, Jinxian Luo d, Jincheng Shen a, Liping Chen a, Bing Zhou b, Xian Fu a, Ceyi Fu c, Zehua Zhang a a Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences/Key Laboratory of Biology and Genetic Resources of Tropical Crops, Ministry of Agriculture, Haikou Hainan 571101, China b Hainan Jinbao Mining Industry Limited Company, Haikou Hainan 570125, China c Hainan Provincial Institute for Drug Control, Haikou Hainan 570216, China d The Key Laboratory of Gene Engineering of Ministry of Education and Department of Biochemistry, Sun Yat-Sen University, Guangzhou Guangdong 510275, China
a r t i c l e
i n f o
Article history: Accepted 22 April 2012 Available online 2 May 2012 Keywords: Canstatin-N gene Pichia pastoris Intracellular expression Purification Bioactivity
a b s t r a c t Canstatin-N DNA fragment amplified from human genome was inserted into the MCS of pGAP9K*, an intracellular expression vector of Pichia pastoris, to generate pGAP9K*-can-N which was then transformed into P. pastoris GS115 by electroporation. A transformant was chosen as an engineering strain from the plate containing G418 (700 μg/ml). D-sorbitol was selected as the only carbon source. The fermentation was carried out in a 50 L bioreactor at a 20 L working volume. After 48 h fermentation with continuous feeding of 25% (w/v) D-sorbitol and 0.8% PTM4, the cell grew to A600 = 178 and intracellularly expressed Canstatin-N reached 780 mg/L. Snail enzyme was combined with water to crack P. pastoris and to release intracellular proteins. The purified recombinant Canstatin-N inhibited CAM angiogenesis and induced significant apoptosis of the human umbilical vein endothelial cell (EVC340). © 2012 Elsevier B.V. All rights reserved.
1. Introduction Tumor growth and metastasis are associated with angiogenesis, which is essential for solid tumors to grow beyond a few cubic millimeters in size. Inhibition of angiogenesis can block the supply of nutrients and can suppress tumor growth (Folkman, 1972). Canstatin, a non-collagenuous 1 (NC1) domain of the α2 chain in type IV collagen, was identified by Kamphaus et al. (2000) as an inhibitor of angiogenesis and tumor growth. Our previous study demonstrated that Canstatin-N (N-terminal 1–89 amino acid sequences of Canstatin), a protein with small molecular weight, is highly active in suppressing blood vessels and tumor growth (He et al., 2003). A research on
Abbreviations: SDS-PAGE, dodecyl sulfate, sodium salt-Polyacrylamide gel electrophoresis; DEME, Dulbecco's Modified Eagle Media; bFGF, basic fibroblast growth factor. ☆ Supported by the Emphases Science and Technology Program of Hainan Province (No. 05204). ⁎ Corresponding author at: Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences/Key Laboratory of Biology and Genetic Resources of Tropical Crops, Ministry of Agriculture, Haikou Hainan 571101, China. Tel.: + 86 898 66984197. E-mail addresses: [email protected] (H. Yin), [email protected] (Z. Liu), [email protected] (A. Zhang), [email protected] (T. Zhang), [email protected] (J. Luo), [email protected] (J. Shen), [email protected] (L. Chen), [email protected] (B. Zhou), [email protected] (X. Fu), [email protected] (C. Fu), [email protected] (Z. Zhang). 0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2012.04.073
large-scale production of recombinant Canstatin-N is necessary to acquire a more in-depth understanding of this finding (He et al., 2003). The methylotrophic yeast Pichia pastoris has been widely reported as an excellent source for the expression of heterologous genes. The cells of P. pastoris can grow to very high cell densities (40–50% v/v) on an inexpensive, non-complex, and chemically defined medium (Cai et al., 2010). Traditionally, foreign protein expression by P. pastoris involves the use of an alcohol oxidase promoter (pAOX1). Recently, a constitutive promoter (GAP) has been developed as an alternative expression system for P. pastoris (Cos et al., 2006; Zhang et al., 2009a). This promoter allows the production of the desired recombinant protein without methanol induction and with ease of operation (Zhang et al., 2009a). In this research, we studied the use of pGAP to express Canstatin-N in P. pastoris to enhance the foreign protein expression level and to purify the intracellularly expressed protein. 2. Materials and methods 2.1. Preparation of recombinant P. pastoris strain Two primers, namely, 5′ CGCAGGATCCATGGTCAGCATCGGCTACCTCCTGGTGA3′ and 5′ CAAGCGGCCGCCTAATGATGATGATGATGATGATGATGGGGCAGCGGCGCAGTGGTAGAGAGCCA 3′, were synthesized according to the published human Canstatin gene sequence. With the human umbilical genome RNA as the template, the Canstatin-N DNA fragment (after encoding the 1–98 amino acid of Canstatin) was amplified by
H. Yin et al. / Gene 504 (2012) 122–126
123
setting 20% to 30% dissolved oxygen and by binding the parameters of the dissolved oxygen through agitation and feeding together. After 12 h of fermentation, 25% (w/v) D-sorbitol-PTM4 trace salts [1 L 25% (w/v) D-sorbitol +12 ml PTM4] were added at a rate of 80 ml/h. The smallest dose of the snail enzyme, which effectively dissolved the cell wall of P. pastoris, was 3 mg/ml, as proven by the orthogonal test. After infusing 3 mg/ml snail enzyme, the fermentation broth was shaken with 180 rpm at 30 °C for 1 h to remove the cell wall. The protoplast was harvested via centrifugation (3000 rpm for 6 min), and water of the same volume was poured into the protoplast. According to the result of the SDS-PAGE, the Canstatin-N solution was loaded on a SP-Sepharose Fast Flow column (Pharmacia Biotech, NJ, USA). The column was then washed with equilibrium buffer (50 mM Na2HPO4 and 24 mM C6H8O7). The bound protein was successively eluted with 0.3, 0.6, and 1 M NaCl. Canstatin-N-containing fractions were collected, concentrated, and desalted using the ultrafiltration device (Millipore, Bedford, MA, USA). Fig. 1. Physical map of pGAP9K*-can-N.
2.4. Chicken chorioallantoic membrane angiogenesis assay RT-PCR and inserted into the MCS of pGAP9K*, the reconstructed pGAP9K (Zhang et al., 2009a). The reconstruction of pGAP9K was achieved by cutting off MF 5α secretion signal to generate the expression vector pGAP9K*-can-N (Fig. 1), which was then transformed into P. pastoris GS115 by electroporation. A transformant was chosen as an engineering strain from the plate containing G418 (700 μg/ml). 2.2. Fermentation in the shaking flask and carbon source analysis The fermentation of GS115 (pGAP9k*-can-N) in the shaking flask for constitutive expression of Canstatin-N was adopted from Waterham et al., (1997). The strain of GS115 (pGAP9k*-can-N) was grown in the YPD medium at 30 °C. The culture grew to A600 = 1.5 and then was transferred to the YP (2% peptone and 1% yeast extract) media, each containing one carbon source (trehalose, oleic acid, L-αalanine, glycerol, lactic acid, D-sorbitol, L-glycin, methanol, or glucose). Each media was tested in three concentrations: 1%, 2%, and 3%. After 24 h of fermentation at 30 °C and with 250 rpm, the biomass was measured with A600 on UV–VIS Spectrophotometer (SHIMAD2U), and the expressed aim protein was analyzed by SDS-PAGE stained by Coomassie Brilliant Blue. Protein markers (TaKaLa) with lysozyme were run on each SDS-PAGE gel. The background of the SDS-PAGE gels could not be the same, so the marker for the molecular weight of 14.3 kD (lysozyme) in each marker lane was used as the control for the calculation of the aimed protein content. The Pix values (optical density of protein) of the zones of the lysozyme and the aimed protein content on the SDS-PAGE were obtained by optical density scanning using Gel-Pro® Analyzer Version 6.0 VDS software (Media Cybemetics). The formula X = B × 4.5 ÷ A was used to eliminate the difference among the different plates of the SDS-PAGE, where X is the protein content of the aimed protein band in the gel, B is the Pix value of the aimed protein band, 4.5 is the known content of the lysozyme (μg), and A is the Pix value of the 4.5 μg lysozyme.
The anti-angiogenic activity of the expressed product was determined using a seven-day-old chicken embryo chorioallantoic membrane (CAM), where a filter paper disk (0.8 × 0.5 cm) was placed as described previously (Zhang et al., 2009b). Approximately 30 ng basic fibroblast growth factor (bFGF, Invitrogen, San Diego, CA, USA) and 10 μg Canstatin-N were added on the sterilized filter paper. For the control, Canstatin-N was replaced by PBS. The embryos were incubated at 37 °C for 48 h, after which the filter disk was removed. The surrounding CAM tissues were then fixed, excised, and photographed. These experiments were performed three times with four embryos in each group per condition.
2.5. Endothelial cell apoptosis assay Endothelial cell apoptosis assay was adopted from Zarubin (Nicoletti et al., 1991). ECV304 cells were grown in 250 μl DEME with 10% FCS in eight wells. The wells were separated into two groups: four wells for the test group and the other four wells for the control group at 5 × 105/mL cell density. In the test group, 25 μl (5 μg/ml) Canstatin-N was dropped in each well, whereas in the control group, Canstatin-N was replaced by PBS. After 24 h incubation, the cells were trypsinized, washed gently with PBS, fixed in ice-cold 70% ethanol for 30 min, collected by centrifugation, and then stained with 5 μg/ml propidium iodide. The cells were assessed using the DeadEndTM Fluorometric TUNEL System (Promega) and by fluorescence microscopy. The specific operation and result analysis were in accordance with the kit's instructions. The experiment principle was that cell apoptosis on the DNA crack showed fluorescence as a reaction to the DeadEndTM Fluorometric TUNEL System and as detected by fluorescence microscopy. The tested cell morphologies were also observed under a microscope.
2.6. Treatment of B16 melanoma in BALB/c mice 2.3. Fermentation condition and purification Five 1000 ml flasks with 200 ml YPD medium each were inoculated with 2 ml P. pastoris GS115 (pGAP9K*-can-N) (A600 =1.5) and incubated under 30 °C at 250 rpm for 20 h. The cultures were transferred to a 50 L fermentor with 20 L modified growth medium recommended by Invitrogen Corp. (1998). The medium consisted of (liter) 26.7 ml of 85% H3PO4, 0.9.3 g CaSO4.2H2O, 18.2 g K2SO4, 14.9 g MgSO4.7H2O, 4.13 g KOH, 40 g D-sorbitol, 40 ml PTM4 trace salts (each liter containing 2.0 g CuSO4, 0.08 g NaI, 3.0 g MnSO4.H2O, 0.2 g Na2MoO4.H2O, 0.02 g H3BO3, 0.5 g CoCl2, 7.0 g ZnCl2, 22 g Fe2(SO4)3 .7 H2O, 0.2 g biotin, and 1 ml H2SO4), 2% peptone, and 1% yeast extract. Fermentation was done by
The procedure was performed as described in a previous study (Zhang et al., 2009b). Melanoma cells at 1.5 × 10 5 B16 were subcutaneously injected into seven-week-old male BALB/c mice. The cell line and the mice were provided by the Experimental Animal Center of Sun Yat-sen University. The mice were randomly divided into two groups (n = 5). On the second day, the experimental groups were intraperitoneally injected with 10 mg/kg Canstatin-N in sterile PBS daily for 15 days, achieving a total volume of 0.2 ml for each mouse. Meanwhile, the control group was treated with PBS. Tumor length and width were measured every 3 days. A statistical method was used to evaluate the difference of the treatment effect.
124
H. Yin et al. / Gene 504 (2012) 122–126
Fig. 4. Comparing the Pix of the expressed Canstatin-N for the well growing cell's carbon sources. Fig. 2. Effect of carbon sources on P. pastoris growth.
3. Result 3.1. Effect of carbon sources on P. pastoris growth and Canstatin-N gene expression The result linking biomass, carbon sources, and their concentrations is shown in Fig. 2. The A600 values of the sole use of oleic acid, glycerol, D-sorbitol, or glucose as carbon source are significantly higher than the others. Fig. 3 illustrates that although the amount for each sample is the same, the intensity of the aim zones varies. D-sorbitol was selected as the carbon source to express Canstatin-N in P. pastoris based on the result of the comparison on Canstatin-N expression levels (Fig. 4) between the four carbon sources with well-grown cells.
3.3. Purification of the intracellularly expressed product We first applied the method of beading to the crack of P. pastoris (Invitrogen Corp., 1998). However, the efficiency was not ideal. We then found that combining the snail enzyme with water to treat P. pastoris does not only fully hydrolyze P. pastoris, but also causes the easy purification of the intracellularly expressed foreign protein. In Fig. 6, a new zone conforming to the theoretical molecular weight of Canstatin-N is displayed on the SDS-PAGE on the lane of the dissolved protoplast. The inhibition results of the CAM angiogenesis experiment showed 84 blood vessels under the filter paper loaded with the fermentation supernatant GS115 (pGAP9K*), 65 blood vessels of the snail enzyme-treated GS115 (pGAP9K*-can-N), and 18 blood vessels of the water-dissolved protoplast (p b 0.01). The results analyzed by SDS-PAGE and inhibition CAM angiogenesis (Fig. 6) indicated that the mass of miscellaneous proteins was present in the snail enzymecontaining solution and the aimed protein was in the solution of the cracked protoplast.
3.2. Canstatin-N production
3.4. Canstatin-N induced endothelial cell apoptosis
The fermentation was a fed-batch process. GS115 (pGAP9K*-canN) was initially grown on D-sorbitol and then fed-batched with 25% (w/v) D-sorbitol-0.8% PTM4 for 48 h. During the fermentation process, the volume of the culture increased from 21 L to 25.3 L. Pichia cell concentration (A600), Canstatin-N concentration (mg/l), and feeding D-sorbitol (ml/h) are presented in Fig. 5. As shown in the figure, the biomass accumulated was 178 A600, whereas intracellularly expressed Canstatin-N reached 780 mg/l.
As shown in Fig. 7A, Canstatin-N induced an average of 81% ECV304 cell apoptosis that reacted with DeadEndTM Fluorometric TUNEL System (Promega) for fluorescence. On the other hand, the apoptosis in the PBS-treated control group exhibited only an average of 1.4% (p b 0.01). The morphology of the tested cells is exhibited in Fig. 7B, where the cell configuration is clear in the control group, whereas the test group displayed tumefaction or illegibility. These results suggested that P. pastoris intracellularly expressed Canstatin-N possesses the function of inducing endothelial cell apoptosis. 3.5. Effect of Canstatin-N on the growth of B16 melanoma in BALB/c mice The effect of Canstatin-N on the growth of B16 melanoma in BALB/ c mice is illustrated in Fig. 8. Tumors in the control group grew rapidly and reached an average size of 1687 mm 3 at the end of 15 days, whereas the tumor size in the experimental mice injected with the recombinant Canstatin-N was only 1.02 mm 3 (P b 0.01).
Fig. 3. SDS-PAGE analyzing the expressed product of different carbon sources. M. marker, 0. Without carbon source, 1. Trehalose, 2. Oleic acid, 3. L-α-alanine, 4. Glycerol, 5. Lactic acid, 6. D‐sorbital, 7. L-glycin, 8. Methanol, 9. Glucose, a.1%, b. 2%, c.3%.
Fig. 5. Accumulation of biomass and Canstatin-N expression and feeding D-sorbitol during the high-density cell culture of GS115 (pGAP9K*-can‐N).
H. Yin et al. / Gene 504 (2012) 122–126
125
Fig. 8. Effect of Canstatin-N on the growth of mouse B16 melanoma.
Fig. 6. Analyzing the cell cracking product by SDS-PAGE and CAM angiogenesis. A. SDSPAGE; B. CAM angiogenesis.M. marker, 0. GS115 (pGAP9K*), 1. The snail enzyme treated GS115 (pGAP9K*-can-N), 2. The water dissolved protoplast.
4. Discussion The development of a replaceable expression system for pAOX1 is significant because the only carbon source for this expression system is methanol (Zarubin et al., 2009). Methanol is toxic and volatile and can easily pollute the environment during the production. Thus, the use of pGAP (Qiao et al., 2010; Zhang et al., 2009a), a
safe expression system of P. pastoris, has been increasingly reported in the field of foreign protein expression. However, as a new expression system, the fermentation condition of pGAP still has to be satisfied. pGAP is strongly controlled by carbon sources which may be nontoxic substances (Zhang et al., 2009a). However, this finding does not mean that every carbon substance is suited for such expression system. The results of the carbon sources analyzed in this study indicated that among the nine tested carbon sources, D-sorbitol, glycerol, glucose, and oleic acid excellently promoted P. pastoris growth and highly regulated foreign gene expression compared with others. With sorbitol as the carbon source for the fermentation in the bioreactor, high-yielding and active recombinant Canstatin-N protein was obtained, which demonstrated that the pGAP expression system can be a potential alternative to the AOX1 promoter in the large-scale production of Canstatin-N and other heterologous recombinant proteins. The foreign protein in P. pastoris can be expressed in two ways: secretory and intracellular (Invitrogen Corp., 1998). Although the aimed product of the secretory expression is easy to purify, the yield is usually lower (Cos et al., 2006). Generally, intracellular expression can increase the yield (Cos et al., 2006) because the foreign proteins within the cell can avoid the hydrolysis of the cell's metabolic product, such as the protein enzymes, in the fermentation broth. Maresová reported the intracellular expression of the leader-less pga gene with the pAOX1 expression system of P. pastoris (Maresová et al., 2010).
Fig. 7. Canstatin-N induces endothelial cell apoptosis. A. By DeadEndTM Fluorometric TUNEL System; B. By Endoscopic observation. a. GS115 (pGAP9K*), b. GS115 (pGAP9K*-can-N).
126
H. Yin et al. / Gene 504 (2012) 122–126
In the present study, 780 mg/L Canstatin-N was intracellularly expressed by the pGAP expression system, which was obviously higher than the secretory-expressed foreign protein (Zhang et al., 2007). Unlike the foreign protein after secretory expression, the intracellularly expressed aimed product can only be purified after releasing it from the host. The cell wall of P. pastoris was so firm that it could not be easily cracked. The method of combining the application of snail enzyme to hydrolyze the cell wall and water to burst the protoplast exhibited a better effect. The advantage of this method includes high efficiency on cracking P. pastoris and easy purification of the recombinant protein from the host proteins containing protoplast and water solution. The disadvantage of this method is that the snail enzyme is costly and is currently limited for laboratory purposes. If a less expensive reagent can be found to replace the snail enzyme, the use of P. pastoris for largescale foreign protein intracellular expression can be popularized in the future.
References Cai, X., et al., 2010. Expression, purification and characterization of recombinant human interleukin-22 in Pichia pastoris. Mol. Biol. Rep. 37 (6), 2609–2613. Cos, O., Ramon, R., Montesinos, J.L., Valero, F., 2006. Operational strategies, monitoring and control of heterologous protein production in the methylotrophic yeast Pichia pastoris: A review. Microb. Cell Fact. 5, 17.
Folkman, J., 1972. Anti-angiogenesis: new concept for therapy of solid tumors. Ann. Surg. 175, 409–4162. He, G.A., Luo, J.X., Zhang, T.Y., Wang, F.Y., Li, R.F., 2003. Canstatin-N fragment inhibits in vitro endothelial cell proliferation and suppresses in vivo tumor growth. Biochem. Biophys. Res. Commun. 312, 801–805. Invitrogen Corp., San Diego, CA, 1998. A Manual of Methods of Expression of Recombinant Proteins in Pichia pastoris. Kamphaus, G.D., et al., 2000. Canstatin, a novel matrix-derived inhibitor of angiogenesis and tumor growth. J. Biol. Chem. 275, 1209–12152. Maresová, H., Marková, Z., Valesová, R., Sklenár, J., Kyslík, P., 2010. Heterologous expression of leader-less pga gene in Pichia pastoris: intracellular production of prokaryotic enzyme. BMC Biotechnol. 10, 7. Nicoletti, I., Migliorati, G., Pagliacci, M.C., Grignani, F., Riccardi, C., 1991. A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J. Immunol. Methods 139, 271–279. Qiao, J., Rao, Z., Dong, B., Cao, Y., 2010. Expression of Bacillus subtilis MA139 betamannanase in Pichia pastoris and the enzyme characterization. Appl. Biochem. Biotechnol. 160 (5), 1362–1370. Waterham, H.R., Digan, M.E., Koutz, P.J., Lair, S.V., Cregg, J.M., 1997. Isolation of the Pichia pastoris glyceraldehydes-3-phosphate dehydrogenase gene and regulation and use of its promoter. Gene 186, 37–44. Zarubin, T.P., Chang, E.S., Mykles, D.L., 2009. Expression of recombinant eyestalk crustacean hyperglycemic hormone from the tropical land crab, Gecarcinus lateralis, that inhibits Y-organ ecdysteroidogenesis in vitro. Mol. Biol. Rep. 36 (6), 1231–1237. Zhang, A.L., et al., 2007. Constitutive expression of human angiostatin in Pichia pastoris by high-density cell culture. J. Ind. Microbiol. Biotechnol. 34, 117–122. Zhang, A.L., et al., 2009a. Recent advances on the GAP promoter derived expression system of Pichia pastoris. Mol. Biol. Rep. 36 (6), 1611–1619. Zhang, A.L., Tu, F.Z., Pan, Y.W., 2009b. Inducible expression of human angiostatin by AOXI promoter in P. pastoris using high-density cell culture. Mol. Biol. Rep. 36 (8), 2265–2270.
Contents lists available at SciVerse ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Short Communication
Intracellular expression and purification of the Canstatin-N protein in Pichia pastoris☆ Huixiang Yin a, Zhenwang Liu a, Ailian Zhang a,⁎, Tianyuan Zhang d, Jinxian Luo d, Jincheng Shen a, Liping Chen a, Bing Zhou b, Xian Fu a, Ceyi Fu c, Zehua Zhang a a Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences/Key Laboratory of Biology and Genetic Resources of Tropical Crops, Ministry of Agriculture, Haikou Hainan 571101, China b Hainan Jinbao Mining Industry Limited Company, Haikou Hainan 570125, China c Hainan Provincial Institute for Drug Control, Haikou Hainan 570216, China d The Key Laboratory of Gene Engineering of Ministry of Education and Department of Biochemistry, Sun Yat-Sen University, Guangzhou Guangdong 510275, China
a r t i c l e
i n f o
Article history: Accepted 22 April 2012 Available online 2 May 2012 Keywords: Canstatin-N gene Pichia pastoris Intracellular expression Purification Bioactivity
a b s t r a c t Canstatin-N DNA fragment amplified from human genome was inserted into the MCS of pGAP9K*, an intracellular expression vector of Pichia pastoris, to generate pGAP9K*-can-N which was then transformed into P. pastoris GS115 by electroporation. A transformant was chosen as an engineering strain from the plate containing G418 (700 μg/ml). D-sorbitol was selected as the only carbon source. The fermentation was carried out in a 50 L bioreactor at a 20 L working volume. After 48 h fermentation with continuous feeding of 25% (w/v) D-sorbitol and 0.8% PTM4, the cell grew to A600 = 178 and intracellularly expressed Canstatin-N reached 780 mg/L. Snail enzyme was combined with water to crack P. pastoris and to release intracellular proteins. The purified recombinant Canstatin-N inhibited CAM angiogenesis and induced significant apoptosis of the human umbilical vein endothelial cell (EVC340). © 2012 Elsevier B.V. All rights reserved.
1. Introduction Tumor growth and metastasis are associated with angiogenesis, which is essential for solid tumors to grow beyond a few cubic millimeters in size. Inhibition of angiogenesis can block the supply of nutrients and can suppress tumor growth (Folkman, 1972). Canstatin, a non-collagenuous 1 (NC1) domain of the α2 chain in type IV collagen, was identified by Kamphaus et al. (2000) as an inhibitor of angiogenesis and tumor growth. Our previous study demonstrated that Canstatin-N (N-terminal 1–89 amino acid sequences of Canstatin), a protein with small molecular weight, is highly active in suppressing blood vessels and tumor growth (He et al., 2003). A research on
Abbreviations: SDS-PAGE, dodecyl sulfate, sodium salt-Polyacrylamide gel electrophoresis; DEME, Dulbecco's Modified Eagle Media; bFGF, basic fibroblast growth factor. ☆ Supported by the Emphases Science and Technology Program of Hainan Province (No. 05204). ⁎ Corresponding author at: Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences/Key Laboratory of Biology and Genetic Resources of Tropical Crops, Ministry of Agriculture, Haikou Hainan 571101, China. Tel.: + 86 898 66984197. E-mail addresses: [email protected] (H. Yin), [email protected] (Z. Liu), [email protected] (A. Zhang), [email protected] (T. Zhang), [email protected] (J. Luo), [email protected] (J. Shen), [email protected] (L. Chen), [email protected] (B. Zhou), [email protected] (X. Fu), [email protected] (C. Fu), [email protected] (Z. Zhang). 0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2012.04.073
large-scale production of recombinant Canstatin-N is necessary to acquire a more in-depth understanding of this finding (He et al., 2003). The methylotrophic yeast Pichia pastoris has been widely reported as an excellent source for the expression of heterologous genes. The cells of P. pastoris can grow to very high cell densities (40–50% v/v) on an inexpensive, non-complex, and chemically defined medium (Cai et al., 2010). Traditionally, foreign protein expression by P. pastoris involves the use of an alcohol oxidase promoter (pAOX1). Recently, a constitutive promoter (GAP) has been developed as an alternative expression system for P. pastoris (Cos et al., 2006; Zhang et al., 2009a). This promoter allows the production of the desired recombinant protein without methanol induction and with ease of operation (Zhang et al., 2009a). In this research, we studied the use of pGAP to express Canstatin-N in P. pastoris to enhance the foreign protein expression level and to purify the intracellularly expressed protein. 2. Materials and methods 2.1. Preparation of recombinant P. pastoris strain Two primers, namely, 5′ CGCAGGATCCATGGTCAGCATCGGCTACCTCCTGGTGA3′ and 5′ CAAGCGGCCGCCTAATGATGATGATGATGATGATGATGGGGCAGCGGCGCAGTGGTAGAGAGCCA 3′, were synthesized according to the published human Canstatin gene sequence. With the human umbilical genome RNA as the template, the Canstatin-N DNA fragment (after encoding the 1–98 amino acid of Canstatin) was amplified by
H. Yin et al. / Gene 504 (2012) 122–126
123
setting 20% to 30% dissolved oxygen and by binding the parameters of the dissolved oxygen through agitation and feeding together. After 12 h of fermentation, 25% (w/v) D-sorbitol-PTM4 trace salts [1 L 25% (w/v) D-sorbitol +12 ml PTM4] were added at a rate of 80 ml/h. The smallest dose of the snail enzyme, which effectively dissolved the cell wall of P. pastoris, was 3 mg/ml, as proven by the orthogonal test. After infusing 3 mg/ml snail enzyme, the fermentation broth was shaken with 180 rpm at 30 °C for 1 h to remove the cell wall. The protoplast was harvested via centrifugation (3000 rpm for 6 min), and water of the same volume was poured into the protoplast. According to the result of the SDS-PAGE, the Canstatin-N solution was loaded on a SP-Sepharose Fast Flow column (Pharmacia Biotech, NJ, USA). The column was then washed with equilibrium buffer (50 mM Na2HPO4 and 24 mM C6H8O7). The bound protein was successively eluted with 0.3, 0.6, and 1 M NaCl. Canstatin-N-containing fractions were collected, concentrated, and desalted using the ultrafiltration device (Millipore, Bedford, MA, USA). Fig. 1. Physical map of pGAP9K*-can-N.
2.4. Chicken chorioallantoic membrane angiogenesis assay RT-PCR and inserted into the MCS of pGAP9K*, the reconstructed pGAP9K (Zhang et al., 2009a). The reconstruction of pGAP9K was achieved by cutting off MF 5α secretion signal to generate the expression vector pGAP9K*-can-N (Fig. 1), which was then transformed into P. pastoris GS115 by electroporation. A transformant was chosen as an engineering strain from the plate containing G418 (700 μg/ml). 2.2. Fermentation in the shaking flask and carbon source analysis The fermentation of GS115 (pGAP9k*-can-N) in the shaking flask for constitutive expression of Canstatin-N was adopted from Waterham et al., (1997). The strain of GS115 (pGAP9k*-can-N) was grown in the YPD medium at 30 °C. The culture grew to A600 = 1.5 and then was transferred to the YP (2% peptone and 1% yeast extract) media, each containing one carbon source (trehalose, oleic acid, L-αalanine, glycerol, lactic acid, D-sorbitol, L-glycin, methanol, or glucose). Each media was tested in three concentrations: 1%, 2%, and 3%. After 24 h of fermentation at 30 °C and with 250 rpm, the biomass was measured with A600 on UV–VIS Spectrophotometer (SHIMAD2U), and the expressed aim protein was analyzed by SDS-PAGE stained by Coomassie Brilliant Blue. Protein markers (TaKaLa) with lysozyme were run on each SDS-PAGE gel. The background of the SDS-PAGE gels could not be the same, so the marker for the molecular weight of 14.3 kD (lysozyme) in each marker lane was used as the control for the calculation of the aimed protein content. The Pix values (optical density of protein) of the zones of the lysozyme and the aimed protein content on the SDS-PAGE were obtained by optical density scanning using Gel-Pro® Analyzer Version 6.0 VDS software (Media Cybemetics). The formula X = B × 4.5 ÷ A was used to eliminate the difference among the different plates of the SDS-PAGE, where X is the protein content of the aimed protein band in the gel, B is the Pix value of the aimed protein band, 4.5 is the known content of the lysozyme (μg), and A is the Pix value of the 4.5 μg lysozyme.
The anti-angiogenic activity of the expressed product was determined using a seven-day-old chicken embryo chorioallantoic membrane (CAM), where a filter paper disk (0.8 × 0.5 cm) was placed as described previously (Zhang et al., 2009b). Approximately 30 ng basic fibroblast growth factor (bFGF, Invitrogen, San Diego, CA, USA) and 10 μg Canstatin-N were added on the sterilized filter paper. For the control, Canstatin-N was replaced by PBS. The embryos were incubated at 37 °C for 48 h, after which the filter disk was removed. The surrounding CAM tissues were then fixed, excised, and photographed. These experiments were performed three times with four embryos in each group per condition.
2.5. Endothelial cell apoptosis assay Endothelial cell apoptosis assay was adopted from Zarubin (Nicoletti et al., 1991). ECV304 cells were grown in 250 μl DEME with 10% FCS in eight wells. The wells were separated into two groups: four wells for the test group and the other four wells for the control group at 5 × 105/mL cell density. In the test group, 25 μl (5 μg/ml) Canstatin-N was dropped in each well, whereas in the control group, Canstatin-N was replaced by PBS. After 24 h incubation, the cells were trypsinized, washed gently with PBS, fixed in ice-cold 70% ethanol for 30 min, collected by centrifugation, and then stained with 5 μg/ml propidium iodide. The cells were assessed using the DeadEndTM Fluorometric TUNEL System (Promega) and by fluorescence microscopy. The specific operation and result analysis were in accordance with the kit's instructions. The experiment principle was that cell apoptosis on the DNA crack showed fluorescence as a reaction to the DeadEndTM Fluorometric TUNEL System and as detected by fluorescence microscopy. The tested cell morphologies were also observed under a microscope.
2.6. Treatment of B16 melanoma in BALB/c mice 2.3. Fermentation condition and purification Five 1000 ml flasks with 200 ml YPD medium each were inoculated with 2 ml P. pastoris GS115 (pGAP9K*-can-N) (A600 =1.5) and incubated under 30 °C at 250 rpm for 20 h. The cultures were transferred to a 50 L fermentor with 20 L modified growth medium recommended by Invitrogen Corp. (1998). The medium consisted of (liter) 26.7 ml of 85% H3PO4, 0.9.3 g CaSO4.2H2O, 18.2 g K2SO4, 14.9 g MgSO4.7H2O, 4.13 g KOH, 40 g D-sorbitol, 40 ml PTM4 trace salts (each liter containing 2.0 g CuSO4, 0.08 g NaI, 3.0 g MnSO4.H2O, 0.2 g Na2MoO4.H2O, 0.02 g H3BO3, 0.5 g CoCl2, 7.0 g ZnCl2, 22 g Fe2(SO4)3 .7 H2O, 0.2 g biotin, and 1 ml H2SO4), 2% peptone, and 1% yeast extract. Fermentation was done by
The procedure was performed as described in a previous study (Zhang et al., 2009b). Melanoma cells at 1.5 × 10 5 B16 were subcutaneously injected into seven-week-old male BALB/c mice. The cell line and the mice were provided by the Experimental Animal Center of Sun Yat-sen University. The mice were randomly divided into two groups (n = 5). On the second day, the experimental groups were intraperitoneally injected with 10 mg/kg Canstatin-N in sterile PBS daily for 15 days, achieving a total volume of 0.2 ml for each mouse. Meanwhile, the control group was treated with PBS. Tumor length and width were measured every 3 days. A statistical method was used to evaluate the difference of the treatment effect.
124
H. Yin et al. / Gene 504 (2012) 122–126
Fig. 4. Comparing the Pix of the expressed Canstatin-N for the well growing cell's carbon sources. Fig. 2. Effect of carbon sources on P. pastoris growth.
3. Result 3.1. Effect of carbon sources on P. pastoris growth and Canstatin-N gene expression The result linking biomass, carbon sources, and their concentrations is shown in Fig. 2. The A600 values of the sole use of oleic acid, glycerol, D-sorbitol, or glucose as carbon source are significantly higher than the others. Fig. 3 illustrates that although the amount for each sample is the same, the intensity of the aim zones varies. D-sorbitol was selected as the carbon source to express Canstatin-N in P. pastoris based on the result of the comparison on Canstatin-N expression levels (Fig. 4) between the four carbon sources with well-grown cells.
3.3. Purification of the intracellularly expressed product We first applied the method of beading to the crack of P. pastoris (Invitrogen Corp., 1998). However, the efficiency was not ideal. We then found that combining the snail enzyme with water to treat P. pastoris does not only fully hydrolyze P. pastoris, but also causes the easy purification of the intracellularly expressed foreign protein. In Fig. 6, a new zone conforming to the theoretical molecular weight of Canstatin-N is displayed on the SDS-PAGE on the lane of the dissolved protoplast. The inhibition results of the CAM angiogenesis experiment showed 84 blood vessels under the filter paper loaded with the fermentation supernatant GS115 (pGAP9K*), 65 blood vessels of the snail enzyme-treated GS115 (pGAP9K*-can-N), and 18 blood vessels of the water-dissolved protoplast (p b 0.01). The results analyzed by SDS-PAGE and inhibition CAM angiogenesis (Fig. 6) indicated that the mass of miscellaneous proteins was present in the snail enzymecontaining solution and the aimed protein was in the solution of the cracked protoplast.
3.2. Canstatin-N production
3.4. Canstatin-N induced endothelial cell apoptosis
The fermentation was a fed-batch process. GS115 (pGAP9K*-canN) was initially grown on D-sorbitol and then fed-batched with 25% (w/v) D-sorbitol-0.8% PTM4 for 48 h. During the fermentation process, the volume of the culture increased from 21 L to 25.3 L. Pichia cell concentration (A600), Canstatin-N concentration (mg/l), and feeding D-sorbitol (ml/h) are presented in Fig. 5. As shown in the figure, the biomass accumulated was 178 A600, whereas intracellularly expressed Canstatin-N reached 780 mg/l.
As shown in Fig. 7A, Canstatin-N induced an average of 81% ECV304 cell apoptosis that reacted with DeadEndTM Fluorometric TUNEL System (Promega) for fluorescence. On the other hand, the apoptosis in the PBS-treated control group exhibited only an average of 1.4% (p b 0.01). The morphology of the tested cells is exhibited in Fig. 7B, where the cell configuration is clear in the control group, whereas the test group displayed tumefaction or illegibility. These results suggested that P. pastoris intracellularly expressed Canstatin-N possesses the function of inducing endothelial cell apoptosis. 3.5. Effect of Canstatin-N on the growth of B16 melanoma in BALB/c mice The effect of Canstatin-N on the growth of B16 melanoma in BALB/ c mice is illustrated in Fig. 8. Tumors in the control group grew rapidly and reached an average size of 1687 mm 3 at the end of 15 days, whereas the tumor size in the experimental mice injected with the recombinant Canstatin-N was only 1.02 mm 3 (P b 0.01).
Fig. 3. SDS-PAGE analyzing the expressed product of different carbon sources. M. marker, 0. Without carbon source, 1. Trehalose, 2. Oleic acid, 3. L-α-alanine, 4. Glycerol, 5. Lactic acid, 6. D‐sorbital, 7. L-glycin, 8. Methanol, 9. Glucose, a.1%, b. 2%, c.3%.
Fig. 5. Accumulation of biomass and Canstatin-N expression and feeding D-sorbitol during the high-density cell culture of GS115 (pGAP9K*-can‐N).
H. Yin et al. / Gene 504 (2012) 122–126
125
Fig. 8. Effect of Canstatin-N on the growth of mouse B16 melanoma.
Fig. 6. Analyzing the cell cracking product by SDS-PAGE and CAM angiogenesis. A. SDSPAGE; B. CAM angiogenesis.M. marker, 0. GS115 (pGAP9K*), 1. The snail enzyme treated GS115 (pGAP9K*-can-N), 2. The water dissolved protoplast.
4. Discussion The development of a replaceable expression system for pAOX1 is significant because the only carbon source for this expression system is methanol (Zarubin et al., 2009). Methanol is toxic and volatile and can easily pollute the environment during the production. Thus, the use of pGAP (Qiao et al., 2010; Zhang et al., 2009a), a
safe expression system of P. pastoris, has been increasingly reported in the field of foreign protein expression. However, as a new expression system, the fermentation condition of pGAP still has to be satisfied. pGAP is strongly controlled by carbon sources which may be nontoxic substances (Zhang et al., 2009a). However, this finding does not mean that every carbon substance is suited for such expression system. The results of the carbon sources analyzed in this study indicated that among the nine tested carbon sources, D-sorbitol, glycerol, glucose, and oleic acid excellently promoted P. pastoris growth and highly regulated foreign gene expression compared with others. With sorbitol as the carbon source for the fermentation in the bioreactor, high-yielding and active recombinant Canstatin-N protein was obtained, which demonstrated that the pGAP expression system can be a potential alternative to the AOX1 promoter in the large-scale production of Canstatin-N and other heterologous recombinant proteins. The foreign protein in P. pastoris can be expressed in two ways: secretory and intracellular (Invitrogen Corp., 1998). Although the aimed product of the secretory expression is easy to purify, the yield is usually lower (Cos et al., 2006). Generally, intracellular expression can increase the yield (Cos et al., 2006) because the foreign proteins within the cell can avoid the hydrolysis of the cell's metabolic product, such as the protein enzymes, in the fermentation broth. Maresová reported the intracellular expression of the leader-less pga gene with the pAOX1 expression system of P. pastoris (Maresová et al., 2010).
Fig. 7. Canstatin-N induces endothelial cell apoptosis. A. By DeadEndTM Fluorometric TUNEL System; B. By Endoscopic observation. a. GS115 (pGAP9K*), b. GS115 (pGAP9K*-can-N).
126
H. Yin et al. / Gene 504 (2012) 122–126
In the present study, 780 mg/L Canstatin-N was intracellularly expressed by the pGAP expression system, which was obviously higher than the secretory-expressed foreign protein (Zhang et al., 2007). Unlike the foreign protein after secretory expression, the intracellularly expressed aimed product can only be purified after releasing it from the host. The cell wall of P. pastoris was so firm that it could not be easily cracked. The method of combining the application of snail enzyme to hydrolyze the cell wall and water to burst the protoplast exhibited a better effect. The advantage of this method includes high efficiency on cracking P. pastoris and easy purification of the recombinant protein from the host proteins containing protoplast and water solution. The disadvantage of this method is that the snail enzyme is costly and is currently limited for laboratory purposes. If a less expensive reagent can be found to replace the snail enzyme, the use of P. pastoris for largescale foreign protein intracellular expression can be popularized in the future.
References Cai, X., et al., 2010. Expression, purification and characterization of recombinant human interleukin-22 in Pichia pastoris. Mol. Biol. Rep. 37 (6), 2609–2613. Cos, O., Ramon, R., Montesinos, J.L., Valero, F., 2006. Operational strategies, monitoring and control of heterologous protein production in the methylotrophic yeast Pichia pastoris: A review. Microb. Cell Fact. 5, 17.
Folkman, J., 1972. Anti-angiogenesis: new concept for therapy of solid tumors. Ann. Surg. 175, 409–4162. He, G.A., Luo, J.X., Zhang, T.Y., Wang, F.Y., Li, R.F., 2003. Canstatin-N fragment inhibits in vitro endothelial cell proliferation and suppresses in vivo tumor growth. Biochem. Biophys. Res. Commun. 312, 801–805. Invitrogen Corp., San Diego, CA, 1998. A Manual of Methods of Expression of Recombinant Proteins in Pichia pastoris. Kamphaus, G.D., et al., 2000. Canstatin, a novel matrix-derived inhibitor of angiogenesis and tumor growth. J. Biol. Chem. 275, 1209–12152. Maresová, H., Marková, Z., Valesová, R., Sklenár, J., Kyslík, P., 2010. Heterologous expression of leader-less pga gene in Pichia pastoris: intracellular production of prokaryotic enzyme. BMC Biotechnol. 10, 7. Nicoletti, I., Migliorati, G., Pagliacci, M.C., Grignani, F., Riccardi, C., 1991. A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J. Immunol. Methods 139, 271–279. Qiao, J., Rao, Z., Dong, B., Cao, Y., 2010. Expression of Bacillus subtilis MA139 betamannanase in Pichia pastoris and the enzyme characterization. Appl. Biochem. Biotechnol. 160 (5), 1362–1370. Waterham, H.R., Digan, M.E., Koutz, P.J., Lair, S.V., Cregg, J.M., 1997. Isolation of the Pichia pastoris glyceraldehydes-3-phosphate dehydrogenase gene and regulation and use of its promoter. Gene 186, 37–44. Zarubin, T.P., Chang, E.S., Mykles, D.L., 2009. Expression of recombinant eyestalk crustacean hyperglycemic hormone from the tropical land crab, Gecarcinus lateralis, that inhibits Y-organ ecdysteroidogenesis in vitro. Mol. Biol. Rep. 36 (6), 1231–1237. Zhang, A.L., et al., 2007. Constitutive expression of human angiostatin in Pichia pastoris by high-density cell culture. J. Ind. Microbiol. Biotechnol. 34, 117–122. Zhang, A.L., et al., 2009a. Recent advances on the GAP promoter derived expression system of Pichia pastoris. Mol. Biol. Rep. 36 (6), 1611–1619. Zhang, A.L., Tu, F.Z., Pan, Y.W., 2009b. Inducible expression of human angiostatin by AOXI promoter in P. pastoris using high-density cell culture. Mol. Biol. Rep. 36 (8), 2265–2270.