- Email: [email protected]
Intracellular Immunization against SIVmacUtilizing a Hairpin Ribozyme
VIROLOGY
216, 241–244 (1996) 0055
ARTICLE NO.
SHORT COMMUNICATION Intracellular Immunization against SIVmac Utilizing a Hairpin Ribozyme ¨ NTER KRAUS,* PAUL JOHNSON,† and FLOSSIE WONG-STAAL*,1 MARINA HEUSCH,* GU *Departments of Biology and Medicine, University of California at San Diego, La Jolla, California 92093-0665; and †New England Regional Primate Center, Harvard Medical School, Southborough, Massachusetts 01772 Received August 28, 1995; accepted November 21, 1995 A hairpin ribozyme targeting the 3* LTR region (9456) of SIVmac239 was cloned into a murine retroviral vector. This target sequence is conserved among various SIV, as well as most HIV-2, strains. The ribozyme cassette is driven from a polymerase III promoter, that of the human tRNAval gene. Hybrid human B-/T-cell lines (CEM/174) were transduced with the retroviral constructs and selected for G418 resistance. Cells stably expressing the 9456 ribozyme exhibited long-term resistance to infection by a pathogenic molecular clone of SIV and two strains of HIV-2. The ribozyme was also able to effectively reduce the proviral DNA burden. Its efficient protection against SIV/HIV-2 infection constitutes an important step toward evaluating ribozyme gene therapy in a primate model. q 1996 Academic Press, Inc.
In addition to HIV-1, which has been clearly demonstrated to be the etiological agent of AIDS (1), a second type of human immunodeficiency virus, HIV-2, was isolated from West African patients afflicted with the disease (2). Although genetic analysis showed 40% nucleotide homology between the virus types, HIV-2 isolates exhibit lower rates of transmission and a significantly longer period of clinical latency in infected individuals in comparison to HIV-1 (3). HIV-2 is more closely related to simian immunodeficiency virus (SIV) in terms of antigenicity, cell tropism, and genomic organization (4). Furthermore, both SIV and HIV-2 are able to infect, and in some cases produce AIDS-like symptoms, in macaque monkeys (5–7). The desperate need for an experimental animal model of AIDS makes studies of HIV-2/SIV infection in monkeys an obvious candidate (8). Gene therapy is a new addition to the armamentarium for AIDS intervention. Our group has focused on the use of ribozymes, RNA molecules that contain both antisense sequences and RNA-cleaving enzymatic activity. Ribozymes are able to target the HIV replication cycle during its early and late phases by cleaving incoming virion RNA and transcribed genomic/subgenomic mRNA (9). This study focuses on the protection against viral infection afforded by the use of a hairpin ribozyme targeting a genome sequence in SIV/HIV-2. This sequence (ATTCAGTCGCTCTGCG) at the 3* end of the viral mRNA is highly conserved among known SIVmac and HIV-2 iso-
lates. A rare exception is HIV-2 ROD, which reads ACTTCG at the 5* end of the selected region. However, even this virus RNA should be cleaved, because the nucleotide in question is not involved in base-pairing with the enzyme strand and can be flexible (10). The retroviral vector pMJT expressing an anti-HIV-1 ribozyme was constructed as described previously (11). Single-stranded oligonucleotides containing the specifically targeting ribozyme sequence (5* GGGGATCCCGCAGAGCAGAAGAATACCAGAGAAACACAC 3*) and one upstream of the promoter/ribozyme cassette, in the LNL-6 parent vector backbone (5* CTGCTCCAAAGGGACCTCAAG 3*), were employed to amplify a 170-bp fragment via polymerase chain reaction (947 30 sec, 597 30 sec, 727 30 sec; 30 cycles) from pMJT. The PCR product was subsequently digested with BamHI and MluI. pMJT was digested with the same enzymes and treated with alkaline phosphatase. The two fragments were then ligated to generate the retroviral vector p9456t. The amphotropic packaging cell line PA317 was transfected with 20 mg p9456t DNA via the calcium phosphate method (12). The culture supernatant was harvested for virus 48 to 56 hr later and filtered (0.45 mm). CEM/174 cells (1 1 106) were resuspended in 5–10 ml of the supernatant supplemented with 10–20 ml 4 mg/ ml polybrene and incubated 2–4 hr at 377. Selection for G418 resistance (at a concentration of 400–600 mg/ml) was begun 3–4 days later and continued over a period of approximately 4 weeks. Expression of the ribozyme in these cells was verified via a two-step process combining RT–PCR with Southern blotting (12) (data not shown).
1 To whom correspondence and reprint requests should be addressed.
0042-6822/96 $12.00
241
/ m4950f7690
01-04-96 19:27:35
viras
Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AP-Virology
242
SHORT COMMUNICATION
FIG. 1. (A) Inhibition of HIV-2 p26 production. Untransduced CEM/174 cells (h), cells stably expressing pMJT (s), and cells stably expressing p9456t were infected with HIV-2 KR (j) and HIV-2NIHZ (m) stocks at an input m.o.i. of 0.02. Viral infectivity was monitored for 37 days, the duration of the experiment, via regular sampling of the culture supernatant for subsequent HIV-2 antigen capture test (Coulter). (B) Inhibition of SIV p26 production. Untransduced CEM/174 cells (s), cells stably expressing pMJT (L), and cells stably expressing p9456t (j) were infected with an SIVmac239 stock at an input m.o.i. of 0.02. Viral infectivity was monitored as in (A) for 43 days.
Stable expression of the ribozyme in the transduced CEM/174 cells did not induce any cellular toxicity, since comparable growth rates were observed among untransduced, 9456 vector-transduced, and MJT vector-transduced cell lines (data not shown). The stably transduced cells also remained morphologically indistinguishable from the untransduced cells. CEM/174 cells (3–5 1 105) stably expressing p9456t were challenged with two HIV-2 strains, NIHZ and ISY (Fig. 1A), or the pathogenic, molecularly cloned virus, SIVmac239 (Fig. 1B). Virus supernatant was added at an input m.o.i. of 0.02. Untransduced CEM/174 cells and cells stably expressing pMJT were subjected to similar challenge conditions as controls. The culture supernatants were sampled every 2 to 3 days beginning 3 days postinfection for p26 antigen capture ELISA. The infected cells were maintained at a concentration of approxi-
/ m4950f7690
01-04-96 19:27:35
viras
mately 1 1 106 cells/ml via splitting upon regular intervals.The CEM/174 cells stably expressing the 9456 ribozyme showed 100% protection against infection with the pathogenic molecular clone of SIVmac239 for up to 43 days. Figure 1B shows that despite an input virus m.o.i. of 0.02, further SIV replication was effectively inhibited in p9456t, as measured in terms of the levels of p26 viral core antigen. In contrast, untransduced cells (data not shown) and cells stably expressing pMJT both reached a peak level of virus (80 ng/ml) by Day 15 and died off just 5 days later, as is depicted by the end of the curve. Figure 1A shows that the 9456 ribozyme also confers long-term resistance to HIV-2 NIHZ and ISY infection. The proviral DNA burden in ribozyme- and control vector-transduced cells was also examined. CEM/174 cells (1 1 105) stably expressing p9456t were infected with 1 ml DNase-treated infectious virus stock in triplicate and harvested (8 min centrifugation at 1500 rpm and transfer of pellet to 0807) at 48 hr postinfection. This pellet was thawed out and resuspended in 50 ml each lysis buffer for a 60-min incubation at 567 (13). The Proteinase K was inactivated via 10 min boiling, and the lysate was subsequently subjected to PCR (947 45 sec, 557 45 sec, 727 30 sec; 30 cycles) with the primer pair 5* EHO (AGTCTCATAGCCAACATTGA) and 3* EHO (CAAAGCCAATTGGTGTTATC). Two microliters of this PCR product was subjected to a new round of five cycles (same conditions) PCR and loaded onto a 3% agarose gel for detection. Figure 2A shows that at 48 hr postinfection, there is a marked difference in the intensity of the amplified 120bp band between the untransduced cells (lanes 1 and 4), those cells stably expressing the MJT ribozyme (lane 3), and those stably transduced with p9456t (lane 2). The presence of the 9456 ribozyme resulted in a significant decrease in proviral DNA (Fig. 2B). This dramatic reduction may in part be due to the ability of the 9456 ribozyme to cleave incoming viral RNA (12). We have previously demonstrated the efficacy of antiHIV ribozymes in protecting T-cell lines (12), as well as primary T cells (14) against diverse HIV-1 strains. Furthermore, CD34 cells transduced with the ribozyme vector differentiated into macrophages that were resistant to HIV-1 infection (15). Although a pilot clinical study to evaluate the safety and feasibility of this approach has been approved, initiation of such a study has been delayed due to the various regulatory processes required for human trials. In the meantime, the SIV/HIV-2 (macaque) model may serve as the most relevant animal model. In this study, a ribozyme containing a target sequence, 9456, conserved in almost all known HIV-2 (HIV-2 ROD is an exception), as well as numerous SIV, strains and chosen according to a previously determined algorithm was cloned into a retroviral vector for delivery into lymphocytes. This target sequence is present toward the 3*
AP-Virology
SHORT COMMUNICATION
FIG. 2. (A) Effect of the stable expression of the 9456 ribozyme on proviral synthesis. Lane M represents the marker dye, which allowed us to estimate the size of our specific band; lane 1, virus present in untransduced cells; lane 2, virus present in cells transduced with p9456t; lane 3, virus present in cells transduced with pMJT; lane 4, as in lane 1, virus present in untransduced cells. (B) Quantification of differences between band intensities via calculation of rato of densities of PCR products.
end of the viral mRNA, downstream of the nef gene, and therefore contained in spliced and unspliced mRNAs, including genomic RNA. Stable transduction of the hybrid B-/T-cell line, CEM/174, with the ribozyme construct resulted in G418-resistant cells that did not differ from untransduced cells in terms of growth or viability. Upon establishment of stable expression of the ribozyme gene, the selected cells were challenged with a pathogenic molecular clone of SIVmac239 as well as two different infectious molecular clones of HIV-2. Regular monitoring of viral core antigen production showed that p26 was virtually undetectable up to 43 days postchallenge (for SIV). This implies that the ribozyme conferred long-term resistance to SIV/HIV-2 infection. This protection was most likely provided via the ribozyme’s specific cleavage of viral RNA in both early and late phases of the viral replication cycle, as made evident by the dramatic reduction in proviral DNA burden measured in those cells stably expressing the ribozyme 48 hr after they were infected with an artificially high m.o.i. of input virus. Ideally, the viral burden should be quantified before the completion of one round of replication—less than 24 hr. Here, however, the 48-hr time point was chosen, because PCR amplification of a specific viral sequence was undetectable per agarose gel electrophoresis until then. The SIV model offers additional advantages to human trials. It presents the opportunity to challenge animals with a defined genotype (e.g., molecular clone), allowing
/ m4950f7690
01-04-96 19:27:35
viras
243
the ability to evaluate the in vivo development of mutations or the effect of specifically designed mutations. It also allows the standardization of infection conditions, including the level of input virus, thus minimizing the variability that is inevitable in human trials and access to lymphoid and/or autopsy tissues. Specific issues that can be addressed in the SIVmac model for the adoptive transfer of gene-altered T cells include information on the longevity and trafficking of these cells. The effect of different ex vivo culture and transduction conditions on in vivo properties and that of different vectors on selectable markers (such as CTL response to the neomycin resistance gene) can also be studied. The animal data gathered can then be directly applied to humans, as the same ribozyme construct can be utilized for HIV-2 infection. There remains a host of basic, unanswered questions regarding the potential efficacy of gene therapy that can be more readily addressed in an animal model. Such issues include the optimization of gene transfer into hematopoietic stem cells, the maintenance of long-term gene expression in vivo, and the evaluation of potential toxicity of genes expressed in multiple hematopoietic lineages. Autologous bone marrow transplants in nonhuman primates using genetically marked cells have been performed by several groups, and the availability of our SIV-specific ribozyme should pave the way for the undertaking of studies of stem cell therapy for AIDS in the SIVmac model. Recently, successful induction of rhesus monkey CD34/ cells to differentiate into mature T cells in vitro has been shown (P. Johnson, unpublished data). We have initiated experiments to transduce macaque CD34/ cells with retroviral vectors expressing the 9456 ribozyme, so that we can examine if the macrophage, as well as T-cell, progeny of the transduced cells would be protected against virus challenge. ACKNOWLEDGMENTS We thank Dr. Mark Leavitt for his support and advice. This work was supported by NIH Grant DK49618 to F. W.-S.
REFERENCES 1. Gallo, R. C., Sarin, P. S., Gelmann, E. P., Robert-Guroff, M., Richardson, E., Kalyanaraman, V. S., Mann, D., Sidhu, G. D., Stahl, R. E., Zolla-Pazner, S., Leibowitch, J., and Popovic, M., Science 220, 865–867 (1983). 2. Alizon, M., Wain-Hobson, S., Montagnier, L., and Sonigo, P., Cell 46, 63–74 (1986). 3. Travers, K., Mboup, S., Marlink, R., Gueye-Ndiaye, A., Siby, T., Thior, I., Traore, I., Dieng-Sarr, A., Sankale, J., Mullins, C., Ndoye, I., Hsieh, C., Essex, M., and Kanki, P., Science 268, 1612–1615 (1995). 4. Chalifoux, L. V., Ringler, D. J., King, N. W., Sehgal, P. K., Desrosiers, R. C., Daniel, M. D., and Letvin, N. L., Am. J. Pathol. 128, 104– 110 (1987). 5. Kestler, H. W. d., Li, Y., Naidu, Y. M., Butler, C. V., Ochs, M. F., Jaenel, G., King, N. W., Daniel, M. D., and Desrosiers, R. C., Nature 331, 619–622 (1988).
AP-Virology
244
SHORT COMMUNICATION
6. Kestler, H. W. d., Naidu, Y. N., Kodama, T., King, N. W., Daniel, M. D., Li, Y., and Desrosiers, R. C., J. Med. Primatol. 18, 305– 309 (1989). 7. Kindt, T. J., Hirsch, V. M., Johnson, P. R., and Sawasdikosol, S., Adv. Immunol. 52, 425–474 (1992). 8. Letvin, N. L., Immunol. Today 11, 322–326 (1990). 9. Yamada, O., Kraus, G., Leavitt, M. C., Yu, M., and Wong-Staal, F., Virology 205, 121–126 (1994). 10. Joseph, S., Berzal-Herranz, A., Chowrira, B. M., Butcher, S. E., and Burke, J. M., Genes Dev. 7, 130–138 (1993). 11. Yu, M., Ojwang, J., Yamada, O., Hampel, A., Rapapport, J., Looney,
/ m4950f7690
01-04-96 19:27:35
viras
12. 13. 14. 15.
D., and Wong-Staal, F., Proc. Natl. Acad. Sci. USA 90, 6340– 6344 (1993). Yamada, O., Yu, M., Yee, J. K., Kraus, G., Looney, D., and WongStaal, F., Gene Ther. 1, 38–45 (1994). Reddy, T. R., Kraus, G., Yamada, O., Looney, D. J., Suhasini, M., and Wong-Staal, F., J. Virol. 69, 3549–3553 (1995). Leavitt, M. C., Yu, M., Yamada, O., Kraus, G., Looney, D., Poeschla, E., and Wong-Staal, F., Hum. Gene Ther. 5, 1115–1120 (1994). Yu, M., Leavitt, M. C., Maruyama, M., Yamada, O., Young, D., Ho, A. D., and Wong-Staal, F., Proc. Natl. Acad. Sci. USA 92, 699– 703 (1995).
AP-Virology
216, 241–244 (1996) 0055
ARTICLE NO.
SHORT COMMUNICATION Intracellular Immunization against SIVmac Utilizing a Hairpin Ribozyme ¨ NTER KRAUS,* PAUL JOHNSON,† and FLOSSIE WONG-STAAL*,1 MARINA HEUSCH,* GU *Departments of Biology and Medicine, University of California at San Diego, La Jolla, California 92093-0665; and †New England Regional Primate Center, Harvard Medical School, Southborough, Massachusetts 01772 Received August 28, 1995; accepted November 21, 1995 A hairpin ribozyme targeting the 3* LTR region (9456) of SIVmac239 was cloned into a murine retroviral vector. This target sequence is conserved among various SIV, as well as most HIV-2, strains. The ribozyme cassette is driven from a polymerase III promoter, that of the human tRNAval gene. Hybrid human B-/T-cell lines (CEM/174) were transduced with the retroviral constructs and selected for G418 resistance. Cells stably expressing the 9456 ribozyme exhibited long-term resistance to infection by a pathogenic molecular clone of SIV and two strains of HIV-2. The ribozyme was also able to effectively reduce the proviral DNA burden. Its efficient protection against SIV/HIV-2 infection constitutes an important step toward evaluating ribozyme gene therapy in a primate model. q 1996 Academic Press, Inc.
In addition to HIV-1, which has been clearly demonstrated to be the etiological agent of AIDS (1), a second type of human immunodeficiency virus, HIV-2, was isolated from West African patients afflicted with the disease (2). Although genetic analysis showed 40% nucleotide homology between the virus types, HIV-2 isolates exhibit lower rates of transmission and a significantly longer period of clinical latency in infected individuals in comparison to HIV-1 (3). HIV-2 is more closely related to simian immunodeficiency virus (SIV) in terms of antigenicity, cell tropism, and genomic organization (4). Furthermore, both SIV and HIV-2 are able to infect, and in some cases produce AIDS-like symptoms, in macaque monkeys (5–7). The desperate need for an experimental animal model of AIDS makes studies of HIV-2/SIV infection in monkeys an obvious candidate (8). Gene therapy is a new addition to the armamentarium for AIDS intervention. Our group has focused on the use of ribozymes, RNA molecules that contain both antisense sequences and RNA-cleaving enzymatic activity. Ribozymes are able to target the HIV replication cycle during its early and late phases by cleaving incoming virion RNA and transcribed genomic/subgenomic mRNA (9). This study focuses on the protection against viral infection afforded by the use of a hairpin ribozyme targeting a genome sequence in SIV/HIV-2. This sequence (ATTCAGTCGCTCTGCG) at the 3* end of the viral mRNA is highly conserved among known SIVmac and HIV-2 iso-
lates. A rare exception is HIV-2 ROD, which reads ACTTCG at the 5* end of the selected region. However, even this virus RNA should be cleaved, because the nucleotide in question is not involved in base-pairing with the enzyme strand and can be flexible (10). The retroviral vector pMJT expressing an anti-HIV-1 ribozyme was constructed as described previously (11). Single-stranded oligonucleotides containing the specifically targeting ribozyme sequence (5* GGGGATCCCGCAGAGCAGAAGAATACCAGAGAAACACAC 3*) and one upstream of the promoter/ribozyme cassette, in the LNL-6 parent vector backbone (5* CTGCTCCAAAGGGACCTCAAG 3*), were employed to amplify a 170-bp fragment via polymerase chain reaction (947 30 sec, 597 30 sec, 727 30 sec; 30 cycles) from pMJT. The PCR product was subsequently digested with BamHI and MluI. pMJT was digested with the same enzymes and treated with alkaline phosphatase. The two fragments were then ligated to generate the retroviral vector p9456t. The amphotropic packaging cell line PA317 was transfected with 20 mg p9456t DNA via the calcium phosphate method (12). The culture supernatant was harvested for virus 48 to 56 hr later and filtered (0.45 mm). CEM/174 cells (1 1 106) were resuspended in 5–10 ml of the supernatant supplemented with 10–20 ml 4 mg/ ml polybrene and incubated 2–4 hr at 377. Selection for G418 resistance (at a concentration of 400–600 mg/ml) was begun 3–4 days later and continued over a period of approximately 4 weeks. Expression of the ribozyme in these cells was verified via a two-step process combining RT–PCR with Southern blotting (12) (data not shown).
1 To whom correspondence and reprint requests should be addressed.
0042-6822/96 $12.00
241
/ m4950f7690
01-04-96 19:27:35
viras
Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AP-Virology
242
SHORT COMMUNICATION
FIG. 1. (A) Inhibition of HIV-2 p26 production. Untransduced CEM/174 cells (h), cells stably expressing pMJT (s), and cells stably expressing p9456t were infected with HIV-2 KR (j) and HIV-2NIHZ (m) stocks at an input m.o.i. of 0.02. Viral infectivity was monitored for 37 days, the duration of the experiment, via regular sampling of the culture supernatant for subsequent HIV-2 antigen capture test (Coulter). (B) Inhibition of SIV p26 production. Untransduced CEM/174 cells (s), cells stably expressing pMJT (L), and cells stably expressing p9456t (j) were infected with an SIVmac239 stock at an input m.o.i. of 0.02. Viral infectivity was monitored as in (A) for 43 days.
Stable expression of the ribozyme in the transduced CEM/174 cells did not induce any cellular toxicity, since comparable growth rates were observed among untransduced, 9456 vector-transduced, and MJT vector-transduced cell lines (data not shown). The stably transduced cells also remained morphologically indistinguishable from the untransduced cells. CEM/174 cells (3–5 1 105) stably expressing p9456t were challenged with two HIV-2 strains, NIHZ and ISY (Fig. 1A), or the pathogenic, molecularly cloned virus, SIVmac239 (Fig. 1B). Virus supernatant was added at an input m.o.i. of 0.02. Untransduced CEM/174 cells and cells stably expressing pMJT were subjected to similar challenge conditions as controls. The culture supernatants were sampled every 2 to 3 days beginning 3 days postinfection for p26 antigen capture ELISA. The infected cells were maintained at a concentration of approxi-
/ m4950f7690
01-04-96 19:27:35
viras
mately 1 1 106 cells/ml via splitting upon regular intervals.The CEM/174 cells stably expressing the 9456 ribozyme showed 100% protection against infection with the pathogenic molecular clone of SIVmac239 for up to 43 days. Figure 1B shows that despite an input virus m.o.i. of 0.02, further SIV replication was effectively inhibited in p9456t, as measured in terms of the levels of p26 viral core antigen. In contrast, untransduced cells (data not shown) and cells stably expressing pMJT both reached a peak level of virus (80 ng/ml) by Day 15 and died off just 5 days later, as is depicted by the end of the curve. Figure 1A shows that the 9456 ribozyme also confers long-term resistance to HIV-2 NIHZ and ISY infection. The proviral DNA burden in ribozyme- and control vector-transduced cells was also examined. CEM/174 cells (1 1 105) stably expressing p9456t were infected with 1 ml DNase-treated infectious virus stock in triplicate and harvested (8 min centrifugation at 1500 rpm and transfer of pellet to 0807) at 48 hr postinfection. This pellet was thawed out and resuspended in 50 ml each lysis buffer for a 60-min incubation at 567 (13). The Proteinase K was inactivated via 10 min boiling, and the lysate was subsequently subjected to PCR (947 45 sec, 557 45 sec, 727 30 sec; 30 cycles) with the primer pair 5* EHO (AGTCTCATAGCCAACATTGA) and 3* EHO (CAAAGCCAATTGGTGTTATC). Two microliters of this PCR product was subjected to a new round of five cycles (same conditions) PCR and loaded onto a 3% agarose gel for detection. Figure 2A shows that at 48 hr postinfection, there is a marked difference in the intensity of the amplified 120bp band between the untransduced cells (lanes 1 and 4), those cells stably expressing the MJT ribozyme (lane 3), and those stably transduced with p9456t (lane 2). The presence of the 9456 ribozyme resulted in a significant decrease in proviral DNA (Fig. 2B). This dramatic reduction may in part be due to the ability of the 9456 ribozyme to cleave incoming viral RNA (12). We have previously demonstrated the efficacy of antiHIV ribozymes in protecting T-cell lines (12), as well as primary T cells (14) against diverse HIV-1 strains. Furthermore, CD34 cells transduced with the ribozyme vector differentiated into macrophages that were resistant to HIV-1 infection (15). Although a pilot clinical study to evaluate the safety and feasibility of this approach has been approved, initiation of such a study has been delayed due to the various regulatory processes required for human trials. In the meantime, the SIV/HIV-2 (macaque) model may serve as the most relevant animal model. In this study, a ribozyme containing a target sequence, 9456, conserved in almost all known HIV-2 (HIV-2 ROD is an exception), as well as numerous SIV, strains and chosen according to a previously determined algorithm was cloned into a retroviral vector for delivery into lymphocytes. This target sequence is present toward the 3*
AP-Virology
SHORT COMMUNICATION
FIG. 2. (A) Effect of the stable expression of the 9456 ribozyme on proviral synthesis. Lane M represents the marker dye, which allowed us to estimate the size of our specific band; lane 1, virus present in untransduced cells; lane 2, virus present in cells transduced with p9456t; lane 3, virus present in cells transduced with pMJT; lane 4, as in lane 1, virus present in untransduced cells. (B) Quantification of differences between band intensities via calculation of rato of densities of PCR products.
end of the viral mRNA, downstream of the nef gene, and therefore contained in spliced and unspliced mRNAs, including genomic RNA. Stable transduction of the hybrid B-/T-cell line, CEM/174, with the ribozyme construct resulted in G418-resistant cells that did not differ from untransduced cells in terms of growth or viability. Upon establishment of stable expression of the ribozyme gene, the selected cells were challenged with a pathogenic molecular clone of SIVmac239 as well as two different infectious molecular clones of HIV-2. Regular monitoring of viral core antigen production showed that p26 was virtually undetectable up to 43 days postchallenge (for SIV). This implies that the ribozyme conferred long-term resistance to SIV/HIV-2 infection. This protection was most likely provided via the ribozyme’s specific cleavage of viral RNA in both early and late phases of the viral replication cycle, as made evident by the dramatic reduction in proviral DNA burden measured in those cells stably expressing the ribozyme 48 hr after they were infected with an artificially high m.o.i. of input virus. Ideally, the viral burden should be quantified before the completion of one round of replication—less than 24 hr. Here, however, the 48-hr time point was chosen, because PCR amplification of a specific viral sequence was undetectable per agarose gel electrophoresis until then. The SIV model offers additional advantages to human trials. It presents the opportunity to challenge animals with a defined genotype (e.g., molecular clone), allowing
/ m4950f7690
01-04-96 19:27:35
viras
243
the ability to evaluate the in vivo development of mutations or the effect of specifically designed mutations. It also allows the standardization of infection conditions, including the level of input virus, thus minimizing the variability that is inevitable in human trials and access to lymphoid and/or autopsy tissues. Specific issues that can be addressed in the SIVmac model for the adoptive transfer of gene-altered T cells include information on the longevity and trafficking of these cells. The effect of different ex vivo culture and transduction conditions on in vivo properties and that of different vectors on selectable markers (such as CTL response to the neomycin resistance gene) can also be studied. The animal data gathered can then be directly applied to humans, as the same ribozyme construct can be utilized for HIV-2 infection. There remains a host of basic, unanswered questions regarding the potential efficacy of gene therapy that can be more readily addressed in an animal model. Such issues include the optimization of gene transfer into hematopoietic stem cells, the maintenance of long-term gene expression in vivo, and the evaluation of potential toxicity of genes expressed in multiple hematopoietic lineages. Autologous bone marrow transplants in nonhuman primates using genetically marked cells have been performed by several groups, and the availability of our SIV-specific ribozyme should pave the way for the undertaking of studies of stem cell therapy for AIDS in the SIVmac model. Recently, successful induction of rhesus monkey CD34/ cells to differentiate into mature T cells in vitro has been shown (P. Johnson, unpublished data). We have initiated experiments to transduce macaque CD34/ cells with retroviral vectors expressing the 9456 ribozyme, so that we can examine if the macrophage, as well as T-cell, progeny of the transduced cells would be protected against virus challenge. ACKNOWLEDGMENTS We thank Dr. Mark Leavitt for his support and advice. This work was supported by NIH Grant DK49618 to F. W.-S.
REFERENCES 1. Gallo, R. C., Sarin, P. S., Gelmann, E. P., Robert-Guroff, M., Richardson, E., Kalyanaraman, V. S., Mann, D., Sidhu, G. D., Stahl, R. E., Zolla-Pazner, S., Leibowitch, J., and Popovic, M., Science 220, 865–867 (1983). 2. Alizon, M., Wain-Hobson, S., Montagnier, L., and Sonigo, P., Cell 46, 63–74 (1986). 3. Travers, K., Mboup, S., Marlink, R., Gueye-Ndiaye, A., Siby, T., Thior, I., Traore, I., Dieng-Sarr, A., Sankale, J., Mullins, C., Ndoye, I., Hsieh, C., Essex, M., and Kanki, P., Science 268, 1612–1615 (1995). 4. Chalifoux, L. V., Ringler, D. J., King, N. W., Sehgal, P. K., Desrosiers, R. C., Daniel, M. D., and Letvin, N. L., Am. J. Pathol. 128, 104– 110 (1987). 5. Kestler, H. W. d., Li, Y., Naidu, Y. M., Butler, C. V., Ochs, M. F., Jaenel, G., King, N. W., Daniel, M. D., and Desrosiers, R. C., Nature 331, 619–622 (1988).
AP-Virology
244
SHORT COMMUNICATION
6. Kestler, H. W. d., Naidu, Y. N., Kodama, T., King, N. W., Daniel, M. D., Li, Y., and Desrosiers, R. C., J. Med. Primatol. 18, 305– 309 (1989). 7. Kindt, T. J., Hirsch, V. M., Johnson, P. R., and Sawasdikosol, S., Adv. Immunol. 52, 425–474 (1992). 8. Letvin, N. L., Immunol. Today 11, 322–326 (1990). 9. Yamada, O., Kraus, G., Leavitt, M. C., Yu, M., and Wong-Staal, F., Virology 205, 121–126 (1994). 10. Joseph, S., Berzal-Herranz, A., Chowrira, B. M., Butcher, S. E., and Burke, J. M., Genes Dev. 7, 130–138 (1993). 11. Yu, M., Ojwang, J., Yamada, O., Hampel, A., Rapapport, J., Looney,
/ m4950f7690
01-04-96 19:27:35
viras
12. 13. 14. 15.
D., and Wong-Staal, F., Proc. Natl. Acad. Sci. USA 90, 6340– 6344 (1993). Yamada, O., Yu, M., Yee, J. K., Kraus, G., Looney, D., and WongStaal, F., Gene Ther. 1, 38–45 (1994). Reddy, T. R., Kraus, G., Yamada, O., Looney, D. J., Suhasini, M., and Wong-Staal, F., J. Virol. 69, 3549–3553 (1995). Leavitt, M. C., Yu, M., Yamada, O., Kraus, G., Looney, D., Poeschla, E., and Wong-Staal, F., Hum. Gene Ther. 5, 1115–1120 (1994). Yu, M., Leavitt, M. C., Maruyama, M., Yamada, O., Young, D., Ho, A. D., and Wong-Staal, F., Proc. Natl. Acad. Sci. USA 92, 699– 703 (1995).
AP-Virology