Intracellular localization of Equine herpesvirus type 1 tegument protein VP22

Virus Research 192 (2014) 103–113

Contents lists available at ScienceDirect

Virus Research journal homepage: www.elsevier.com/locate/virusres

Intracellular localization of Equine herpesvirus type 1 tegument protein VP22 Ayaka Okada a , Akari Kodaira a , Sachiko Hanyu a , Satoko Izume a , Kenji Ohya a,b , Hideto Fukushi a,b,∗ a b

Department of Applied Veterinary Sciences, United Graduated School of Veterinary Sciences, Gifu University, 1-1 Yanagido, Gifu 501-1193, Japan Laboratory of Veterinary Microbiology, Faculty of Applied Biological Sciences, Gifu University, 1-1 Yanagido, Gifu 501-1193, Japan

a r t i c l e

i n f o

Article history: Received 18 March 2014 Received in revised form 14 August 2014 Accepted 14 August 2014 Available online 3 September 2014 Keywords: Equine herpesvirus 1 Tegument VP22 Localization

a b s t r a c t Intracellular localization of Equine herpesvirus type 1 (EHV-1) tegument protein VP22 was examined by using a plasmid that expressed VP22 fused with an enhanced green fluorescent protein (EGFP). Also a recombinant EHV-1 expressing VP22 fused with a red fluorescent protein (mCherry) was constructed to observe the localization of VP22 in infected cells. When EGFP-fused VP22 was overexpressed in the cells, VP22 localized in the cytoplasm and nucleus. Live cell imaging suggested that the fluorescently tagged VP22 also localized in the cytoplasm and nucleus. These results show that VP22 localizes in the cytoplasm and nucleus independently of other viral proteins. Experiments with truncation mutants of pEGFP-VP22 suggested that 154–188 aa might be the nuclear localization signal of EHV-1 VP22. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Equine herpesvirus type 1 (EHV-1; family Herpesviridae, subfamily Alphaherpesvirinae, genus Varicellovirus) is a major cause of abortion in pregnant mares, and a major cause of respiratory and neurological diseases in horses (Lunn et al., 2009). The herpesvirus virion is composed of four concentric compartments including a linear double-stranded DNA, the capsid, the tegument, and the envelope (Roizman, 1996). The tegument proteins of alphaherpesviruses are encoded by at least 15 genes (Mettenleiter, 2002). EHV-1 VP22 (EVP22) is a tegument protein composed of 304 amino acids (aa) encoded by ORF11 (Barnett et al., 1992). VP22 is conserved among alphaherpesvirinae but is not found in beta and gammaherpesvirinae (Kelly et al., 2009). HSV-1 VP22 (HVP22) and BHV-1 VP22 (BVP22) are encoded by UL49 (Elliott and Meredith, 1992; Liang et al., 1995). Each virion is thought to have about 2000 copies of HVP22 (Heine et al., 1974). However, there are no reports on EVP22. Three studies have fluorescently localized HVP22 in cells: (1) using a red fluorescent protein (mRFP) and live cell imaging, HVP22

∗ Corresponding author at: Laboratory of Veterinary Microbiology, Faculty of Applied Biological Sciences, Gifu University, 1-1 Yanagido, Gifu 501-1193, Japan. Tel.: +81 58 293 2946; fax: +81 58 293 2945. E-mail addresses: [email protected], [email protected] (H. Fukushi). http://dx.doi.org/10.1016/j.virusres.2014.08.006 0168-1702/© 2014 Elsevier B.V. All rights reserved.

was localized in the cytoplasm of Vero cells at 8 h postinfection and then translocated to the nucleus at 16 h (Sugimoto et al., 2008). (2) In fixed cells infected by wild-type HSV-1, HVP22 was localized in the cytoplasm and then in the nucleus (Pomeranz and Blaho, 1999). (3) In transfected cells, HVP22 was localized in the cytoplasm and then in the nucleus, which suggested that the localization of HVP22 does not require any other viral proteins (Blouin and Blaho, 2001). And also, BVP22 was localized in the nuclei of both infected cells and transfected cells (Ren et al., 2001). Thus, the localization of BVP22, like that of HVP22, is independent of other viral factors. The necessity of VP22 homologs for viral replication differs in alphaherpesviruses. For example, the VP22s of Marek’s disease virus serotype 1 and varicella-zoster virus are essential for viral replication in cell culture (Che et al., 2008; Dorange et al., 2002). On the other hand, BVP22 and HVP22 are not essential for viral replication in cell culture, but they were shown to affect the pathogenicity in a natural host (BVP22) (Liang et al., 1995, 1997) and in an animal model (HVP22) (Duffy et al., 2006; Pomeranz and Blaho, 2000). We focused on EHV-1 tegument protein EVP22, because tegument proteins are generally known to have many roles in viral replication. The importance of VP22s is reflected by their abundance and high degree of conservation among alphaherpesvirinae including HSV-1. However, the role of VP22 remains unclear, especially in the case of EHV-1. In this study we constructed a plasmid that expresses EVP22 fused with an enhanced green fluorescent protein (EGFP). The construct has made it possible to observe EVP22 localization in the cells.

104

A. Okada et al. / Virus Research 192 (2014) 103–113

IR

UL

US

TR

EHV-1 genome

ORF11

Cherry Fig. 1. Schematic diagram of the genome structure of Ab4p Cherry-VP22 and location of viral genes. The position of insertion of mCherry is indicated. UL, unique long; US, unique short; IR, internal repeat; TR, terminal repeat.

In addition, we examined the localizations of truncation mutants of EVP22 to determine the location of nuclear localization signal. On the other hand, we constructed a recombinant EHV-1 expressing EVP22 fused with a red fluorescent protein (mCherry) and the recombinant virus made it possible to reveal whether the EVP22 localization observed in the overexpression experiments occured in infected cells or not.

2. Materials and methods

2.3. Bacteria and plasmids Escherichia coli DH10␤ cells harboring the Ab4p bacterial artificial chromosome (pAb4pBAC) and Red/ET expression plasmid (pRed/ET) was used as described in the previous study (Kasem et al., 2010). Other plasmids were pEGFP-C1 (Clontech, Takara Bio Inc., Shiga, Japan), pmCherry-C1 (Clontech, Takara Bio Inc., Shiga, Japan), pRed/ET (Gene Bridges GmbH, Germany), and pGEX-6P-1 (GE Healthcare UK Ltd., England). E. coli BL21 was used for molecular cloning and protein expression. Three plasmids were constructed for this study:

2.1. Cells FHK Tcl3 cells, which were derived from a kidney of an equine fetus and kindly provided by Dr. K. Maeda, Yamaguchi University, Yamaguchi, Japan, were grown in Dulbecco’s Modified Eagle’s Medium (D-MEM) (Wako Pure Chemical Industries, Ltd., Tokyo, Japan) with 5% fetal bovine serum (FBS) (Invitrogen, Life Technologies, Tokyo, Japan) (Maeda et al., 2007). Madin-Darby bovine kidney (MDBK) and Rabbit kidney 13 (RK-13) cells were grown in minimum essential medium ␣ (MEM␣) (Wako Pure Chemical Industries, Ltd., Tokyo, Japan) supplemented with 3% FBS.

2.2. Viruses EHV-1 Ab4p, a neuropathogenic EHV-1 strain, was kindly provided by Dr. A.J. Davison, Glasgow University, Scotland, was used. Ab4p attB, which has an attB sequence between ORF2 and ORF3 of Ab4p was constructed from pAb4p BAC as previously described (Kasem et al., 2010).

(1) pEGFP-VP22 was used to observe the localization of overexpressing EVP22. The VP22 gene was PCR amplified from the EHV-1 Ab4p genome with a pair of primers pEGFP-VP22-F and pEGFP-VP22-R (Table 1). The amplicon was cloned into the multiple cloning site of the pEGFP-C1 vector for expression of an EGFP-VP22 fusion protein. (2) pEGFP-VP22 truncation mutants were used to determine the location of the nuclear localization signal. They were constructed by PCR using pEGFP-VP22 for a template. The forward and reverse primers were complementary to the adjacent sequence of the truncation region (Table 1). cNLS Mapper (http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS Mapper form.cgi) was used to predict the nuclear localization signal in EVP22 sequence. Seven plasmids encoding mutant genes were constructed: two kinds of pEGFP-VP22 N-terminal truncation mutants (pEGFP-VP22-102-305 and pEGFP-VP22-204-305), two kinds of C-terminal truncation mutants (pEGFP-VP22-1203 and pEGFP-VP22-1-101), one central region expressing mutant (pEGFP-VP22-102-203) and two kinds of predicted

Table 1 Primer sequences for constructing the plasmids. Sequence (5 –3 )

Construct

pEGFP-VP22-F pEGFP-VP22-R

GGATCCATGGCCAAACTCACTGGGAT GTCGACCTATGATTCTTCTTTGATGGC

pEGFP-VP22

1-203-F 1-203-R

TAACTGCAGTCGACGGTACCG GCAAAACACGTTTTTGTTGAACAGG

pEGFP-VP22-1-203

102-305-F 102-305-R

GAATATTCTCTGATTGGCGGTG GGATCTGAGTCCGGACTTGTAC

pEGFP-VP22-102-305

1-101-F 1-101-R

TAACTGCAGTCGACGGTACCG GCATGCATCGTAGAATTCATCACCC

pEGFP-VP22-1-101

204-305-F 204-305-R

GCGGCCGTGAGTCGCGTGGC GGATCTGAGTCCGGACTTGTAC

pEGFP-VP22-204-305

117-149-F 117-149-R

CCAATGGCACGCCCCGGCAACAGGACTG GGGGCGTGCCATTGGAGGTCGATAGTTTACC

pEGFP-VP22 NLS/117

154-188-F 154-188-R

CGACGCCCCAGTGGTACGGGGCCACTCAC GTACCACTGGGGCGTCGTGGAAGTAGCCGCC

pEGFP-VP22 NLS/154

pGST-VP22-F pGST-VP22-R

CGGGATCCATGTCCGATACGTGGCGTAG TTGCGGCCGCCGTCGTGGAAGTAGCCGC

pGST-VP22

A. Okada et al. / Virus Research 192 (2014) 103–113

105

Fig. 2. Bam HI RFLP pattern of Ab4p-Cherry VP22. Left panel shows predicted RFLP pattern generated by Snap gene and right panel figure shows RFLP pattern of Ab4p-Cherry VP22 genome sequence. Lane 1 indicates the ␭-Hind III digest molecular weight marker (Takara Bio Inc., Shiga, Japan) and lane 2 indicated RFLP pattern of Ab4p-Cherry-VP22.

NLS deletion mutants (pEGFP-VP22NLS/117 and pEGFPVP22NLS/154). (3) pGST-VP22 was used to express recombinant EVP22 for making the antibody. A VP22 N terminal fragment corresponding to 1–152 aa was used for making recombinant VP22 protein. To construct the vector encoding GST-VP22, PCR was performed with a pair of primers pGST-VP22-F and pGST-VP22-R (Table 1). Following amplification, the VP22-encoded DNA was ligated into pGEX-6P-1. The sequences of all cloned VP22 were confirmed by direct sequencing. 2.4. Overexpression experiments 2.4.1. Transfection and Western blotting RK-13 cells were plated in 6-well culture plates. Lipofectamine® 2000 Transfection Reagent (Invitrogen, Life Technologies, Tokyo, Japan) was used for transfecting pEGFP-C1, pEGFP-VP22 and pEGFP-VP22 truncation mutants as described in the manufacturer’s

manual. Approximately 24 h posttransfection, the cells were collected and lysed. The lysates were assayed by Western blotting using anti-GFP (Mouse IgG1-␬), monoclonal (GF200), AS (NAKALAI TESQUE, Kyoto, Japan). Bound antibody was detected with a goat anti-mouse antibody conjugated to peroxidase (MP Biomedicals, Santa Ana, CA, USA) by chemiluminescence with ECL reagents (GE Healthcare, England). 2.4.2. Fluorescence microscopy RK-13 cells were plated in 24-well culture plates and transfected as described above. 24 h posttransfection, cells were fixed with 4% paraformaldehyde in PBS and were observed by confocal microscopy. 2.5. Time-lapse imaging of Ab4p Cherry-VP22 2.5.1. Construction of Ab4p Cherry-VP22 We constructed a recombinant virus that expressed EVP22 fused with mCherry (Ab4p Cherry-VP22) (Fig. 1). We first constructed the

106

A. Okada et al. / Virus Research 192 (2014) 103–113

A

Predicted MW (kDa)

pEGFP-VP22

VP22

60.0 203

1

305

49.5

1-203 102

1

305

48.3

102-305 1

305

101

1-101

38.8 1

305

204

37.8

204-305 203

102

1

305

37.6

102-203

10

2-2

03

05 4-3 20

01 1-1

05 2-3 10

1-2

03

-VP EG FP

kDa

EG FP

22

B

75 50 37 25

Fig. 3. Schematic diagram of the construction of pEGFP-VP22 and truncation mutants (A). VP22 encoded sequence was inserted in the pEGFP-C1 multiple cloning site. Predicted molecular weights (MW) are indicated on the right. Western blotting with antibody to GFP (B). To confirm the expression of pEGFP-VP22 and truncation mutants, RK-13 cells were transfected with each plasmid, and 24 h posttransfection cells were collected with the sample buffer. The samples were separated by SDS-PAGE, transferred to PVDF membrane, and detected by anti-GFP monoclonal antibody and HRP tagged anti-mouse IgG antibody.

recombinant virus in which the rpsL-neo cassette sequence was inserted in front of the starting codon of ORF11 gene. We then constructed Ab4p Cherry-VP22 by replacing the rpsL-neo cassette sequence with the mCherry sequence. The EHV-1 BAC clone, pAb4pBAC, was used to insert a fluorescent protein mCherry coding sequence into pAb4p BAC as described below. Counter-selection BAC modification by Red/ET recombination system (Gene Bridges GmbH, Germany) was used as described in the manufacturer’s manual (Gene Bridges, version 3.0). The rpsL-neo cassette (rpsL-neo gene) was fused to the N terminus of EVP22 as follows: a pair of primers was designed to amplify the insertion fragment using rpsL-neo template DNA (Gene Bridges GmbH, Germany) as the template. A forward primer was 5 -AGC GCT AGT ATT AGA GTT TTG TAA GAG TTT ATT ATT AGC AAG TGA ATA TGG GCC TGG TGA TGA TGG CGG GAT CG-3 and a reverse primer was 5 -GTA GCG TTA GCA TCG TTA CAG CCA CTG CGA CGT CTA CGC CAC GTA TCG GAT CAG AAG AAC TCG TCA AGA AGG CG3 . Both primers consisted of 50-nucleotide homology arms and 24 nucleotides (underlined) for amplifying the rpsL-neo cassette sequences. To construct Ab4p Cherry-VP22, the rpsL-neo gene was replaced with the gene for red fluorescent protein mCherry. An mCherry gene fragment was amplified by PCR with a pair of primers 5 AGC GCT AGT ATT AGA GTT TTG TAA GAG TTT ATT ATT AGC AAG

TGA ATA TGG TGA GCA AGG GCG AGG AGG A-3 and 5 -GTA GCG TTA GCA TCG TTA CAG CCA CTG CGA CGT CTA CGC CAC GTA TCG GAC TTG TAC AGC TCG TCC ATG C-3 . The primers were designed to amplify the insertion fragment using pmCherry-C1 plasmid DNA as a template. Both primers consisted of 50-nucleotide homology arms and 24 nucleotides (underlined) for amplifying the mCherry sequences. Infectious Ab4p attB and Ab4p Cherry-VP22 viruses were generated as described previously (Kasem et al., 2010). The sequence of Cherry-VP22 was confirmed and there was no mutation in this region (data not shown). The RFLP pattern of Ab4p Cherry-VP22 was checked and confirmed to be the same as predicted (Fig. 2). 2.5.2. Viral growth kinetics and plaque size measurements The growth curve of Ab4p Cherry-VP22 was compared with that of both Ab4p and Ab4p attB. Monolayers of MDBK cells prepared in 24-well plates were inoculated with the Ab4p attB and Ab4p Cherry-VP22 at an m.o.i. of 0.01 plaque-forming unit (PFU)/cell. Supernatants and infected cells were separately collected at 0, 6, 12, 24, 36, 48, 60 and 72 hpi. The extracellular and intracellular virus titer was determined by plaque assay. Each experiment was conducted three times. Plaque areas were measured after plating of the viruses on MDBK cells and 3 days of incubation at 37 ◦ C under a 1.5%

A. Okada et al. / Virus Research 192 (2014) 103–113

107

Fig. 4. Intracellular localization of pEGFP-VP22. RK-13 cells were transfected with plasmids, incubated for 24 h, fixed and observed by confocal microscopy. Scale bars indicate 50 ␮m (A) and 10 ␮m (B).

methylcellulose overlay. For each virus, plaque areas of 23–50 plaques for each experiment were determined using the ImageJ 1.42q software (http://rsb.info.nih.gov/ij/index.html) that are freely available online.

Animal Care and Welfare, Faculty of Applied Biological Science, Gifu University.

2.7. Indirect immunofluorescence and microscopy 2.5.3. Live-cell imaging MDBK cells were cultured on 35-mm-diameter glass-bottomed dishes (MatTek, MA, USA). Ab4p Cherry-VP22 was inoculated onto MDBK cells at an m.o.i. of 1 PFU/cell. Then the dish was placed in a humidified chamber, mounted on an LSM700 inverted confocal microscope (Carl Zeiss, Germany), supplied with 5% CO2 , and heated to 37 ◦ C. The LSM700 microscope was used with a Plan-Apochromat 63 objective, an LED laser (555 nm) (Carl Zeiss, Germany). 2.6. Making EVP22 antibody To express the GST fusion protein, pGST-VP22 was transformed into BL21 competent cells made according to the protocol previously described (Inoue et al., 1990). To induce protein expression, 0.1 mM IPTG (isopropyl ␤-d-1-thiogalactopyranoside, GIBCO, Life Technologies, Tokyo, Japan) was used. The GST fusion protein in the collected bacterial pellet was purified using glutathione-Sepharose 4B beads (GE Healthcare UK Ltd., England) and used for immunization. A Japanese white male rabbit of 8 weeks age was immunized subcutaneously with 300 ␮g of recombinant GST-VP22 protein and boosted with 100 ␮g of GST-VP22 2 weeks and 5 weeks after first immunization. First and second immunization was performed with TiterMax® Gold (Funakoshi, Tokyo, Japan). Antiserum was collected 3 weeks after the final immunization. The animal experiments were certified (certification number 13036) and conducted under the guidelines of the Committee of

Monolayers of MDBK cells prepared in 24-well plates were inoculated with Ab4p attB at an m.o.i. of 1 PFU/cell. Cells were fixed with 4% paraformaldehyde in PBS at 0, 2, 4, 6 and 8 hpi. Fixed cells were permeabilized with 0.2% Triton X-100 and incubated for 30 min in 3% BSA at room temperature. Anti EVP22 antibody described in Section 2.6 was used as the primary antibody and added for 1 h. After washing the appropriate secondary antibody was added and incubated for 1 h. And cells were preserved with Slow Fade® Gold antifade reagents (Life Technologies, Tokyo, Japan) as an anti-bleaching agent and observed by confocal microscopy same as described in Section 2.4.2 using an LED laser (488 nm).

2.8. Western blot analysis Monolayers of MDBK cells prepared in 6-well plates were inoculated with the Ab4p attB and Ab4p Cherry-VP22. Cells were collected 24 hpi and cell lysates were assayed by Western blotting using Living Colors® DsRed Polyclonal Antibody (Clontech, Takara Bio Inc., Shiga, Japan) that reacted with mCherry and anti EVP22 antibody described in Section 2.6. Also monolayers of MDBK cells prepared in 9 cm2 plate were inoculated with the Ab4p attB described above. Cells were collected 24 hpi by cell lysis buffer (25 mM Tris–Hcl [pH 7.5], 100 mM NaCl, 2 mM EDTA [pH 8.0], 0.5% Triron X-100). Cell lysates were dephosphorylated by shrimp alkaline phosphatase (Takara Bio Inc., Shiga, Japan) and assayed by Western blotting using anti EVP22 antibody.

108

A. Okada et al. / Virus Research 192 (2014) 103–113

Fig. 5. Intracellular localization of pEGFP-VP22 truncation mutants. RK-13 cells were transfected with plasmids, incubated for 24 h, fixed and observed by confocal microscopy. Scale bars indicate 50 ␮m (left) and 10 ␮m (right).

A. Okada et al. / Virus Research 192 (2014) 103–113

109

Fig. 6. Intracellular localization of pEGFP-VP22NLS/117 and pEGFP-VP22NLS/154. RK-13 cells were transfected with plasmids, incubated for 24 h, fixed and observed by confocal microscopy. Scale bars indicate 50 ␮m (A) and 10 ␮m (B).

3. Results 3.1. Construction of pEGFP-VP22 and truncation mutants To confirm the localization of EVP22, a plasmid, pEGFP-VP22, was constructed that expressed EGFP fused to VP22. Also seven kinds of pEGFP-VP22 truncation mutants were constructed to determine the domain required for translocation to the nucleus (Fig. 3A). Expressions of EGFP-VP22 and truncation mutants in RK-13 cells were confirmed by Western blotting using anti-GFP antibody (Fig. 3B). The proteins were detected at the predicted molecular weights. Thus pEGFP-VP22 and the truncation mutants were correctly expressed in RK-13 cells. 3.2. Intracellular localization of EGFP-VP22 and truncation mutants in transfected cells EGFP-VP22 was localized in the cytoplasm and the nucleus (Fig. 4). The truncation mutants EGFP-VP22-1-203, EGFP-VP22102-305 and EGFP-VP22-102-203 were localized throughout the whole cell or the nucleus only (Fig. 5). On the other hand, EGFP-VP22-1-101 and EGFP-VP22-204-305 were localized only throughout the whole cell, i.e., their localizations, like the

localization of EGFP, were not confined to the nucleus (Fig. 5). These results show that the center region including amino acids 102–203 of EVP22 was required for the nuclear localization of EVP22. Although the EGFP-VP22-102-203 mutant was localized at the nucleus, its localization was diffuse while the nuclear localization of the full-length EVP22 was punctate. In agreement with the above results, cNLS Mapper predicted two regions that could be the nuclear localization signal in EVP22 sequence, 117–149 aa and 154–188 aa. Therefore we constructed pEGFP 117–149 aa deletion mutant and pEGFP 154–188 aa deletion mutant as NLS deletion mutant (pEGFP-VP22NLS/117 and pEGFP-VP22NLS/154) to confirm which amino acid residues were required for nuclear localization of VP22. The localization of pEGFP-VP22NLS/117 was localized in nucleus and pEGFPVP22NLS/154 was confined to the cytoplasm and not localized in nucleus (Fig. 6). Thus 154–188 aa might be the nuclear localization signal of EVP22. 3.3. Construction of Ab4p Cherry-VP22 Expression of Cherry-VP22 in infected MDBK cells was confirmed by Western blotting of a cell lysate using anti-mCherry and anti-VP22 antibodies. The anti-mCherry antibody gave a signal of about 60 kDa, which was the predicted size of the mCherry

110

A. Okada et al. / Virus Research 192 (2014) 103–113

A

MDBKcells

B α-mCherry

α-VP22

kDa

1.2

kDa

1.0 75

Ab

50

50

37

37

4p

C

he

rry

VP

22

Plaque area(mm2)

75

tB

4p

at

Ab

Ab

4p

C

he

rry

-V

P2

2

tB

4p

at

0.8 0.6

0.4

0.2

Ab

0 Ab4p

C

attB

Cherry-VP22

AP +

AP -

FHK Tcl3 cells

VP22

p<0.01 1.4

Fig. 7. Western blot to confirm the expression of EVP22 and Cherry-VP22 in infected cells. MDBK cells were infected with Ab4p attB and Ab4p Cherry-VP22 at an m.o.i. of 1 PFU/cell and analyzed by immunoblotting with antibody to mCherry (A) and VP22 (B). Molecular sizes are shown on the left. Alkaline phosphatase treated cell lysate of Ab4p attB infected cells was analyzed by immunoblotting with antibody to EVP22 (C).

p<0.01

Plaque area(mm2)

1.2

fused VP22 (Fig. 7A). The anti-VP22 antibody gave two signals, one of about 33 kDa, which is the predicted size of VP22, and 37 kDa (Fig. 7B). The larger band was disappeared by treating infected cell lysate with the alkaline phosphatase (Fig. 7C).

1.0 0.8 0.6 0.4 0.2

3.4. Biological characterization of Ab4p Cherry-VP22 0

Multi-step growth experiments were conducted to evaluate whether Cherry fusion to VP22 affected viral growth. The growth curves of Ab4p Cherry-VP22 Ab4p attB were similar to that of wild type (Fig. 8), suggesting that mCherry fusion to VP22 did not affect on viral growth. The average plaque size of Ab4p Cherry-VP22 was not significantly different from that of the parent virus Ab4p attB infection in MDBK cells, while the average plaque size of Ab4p Cherry-VP22 in

Ab4p

Cherry-VP22

Fig. 9. Plaque sizes of Ab4p, Ab4p attB and Ab4p Cherry-VP22 in MDBK cells (A) and FHK Tcl3 cells (B). Cells were seeded in 6-well plates and infected with each virus. At 3 days postinfection, cells were stained with crystal violet and the sizes of 23–50 (MDBK cells) or 26–30 (FHK Tcl3 cells) randomly selected plaques of each virus were determined. The bars indicate the 90th, 75th, 50th, 25th and 10th percentiles from the top to the bottom.

Intracellular

Extracellular

106

106

105

105

104

104 PFU/ml

PFU/ml

attB

103

103 102

102 Ab4p

101

Ab4p

101

attB

attB

Cherry-VP22

Cherry-VP22

100

100 0

12

24

36

48

60

Hours post infection

72

0

12

24

36

48

60

72

Hours post infection

Fig. 8. Growth curves of Ab4p, Ab4p attB and Ab4p Cherry-VP22. MDBK cells were infected at an m.o.i. of 0.01 PFU/cell with each viruses. And extracellular and intracellular viruses were collected at the indicated times. The titers of each sample were determined by plaque assay.

A. Okada et al. / Virus Research 192 (2014) 103–113

111

Fig. 10. Time-lapse microscopy of live MDBK cells infected with Ab4p Cherry-VP22. MDBK cells on a glass-bottomed dish were infected with Ab4p Cherry-VP22 at an m.o.i. of 1 PFU/cell and observed by confocal microscopy from 0 to 24 hpi.

FHK Tcl3 cells was smaller than that of both Ab4p and Ab4p attB (p < 0.05) (Fig. 9).

VP22 were the same as those in the live cell imaging using Ab4p Cherry-VP22.

3.5. Intracellular localization of VP22 by live cell imaging of Ab4p Cherry-VP22 infection in MDBK cells

4. Discussion

In MDBK cells infected with Ab4p Cherry-VP22, the virus started to express Cherry-VP22 in the cytoplasm at 3.5 hpi. Then, CherryVP22 was translocated to the nucleus (Fig. 10).

3.6. Intracellular localization of wild type VP22 In MDBK cells infected with Ab4p attB, the expression of EVP22 was first detected at 4 hpi throughout the cell or in the cytoplasm (Fig. 11). The nuclear localization of EVP22 was first detected in 6 hpi (Fig. 11 arrow head). The number of cells showing intranuclear EVP22 increased with time. The localization and translocation of

4.1. Localization of Ab4p VP22 is independent of other viral proteins EVP22 was localized in the cytoplasm and the nucleus. HVP22 and BVP22 are known to localize in the cytoplasm and the nucleus independently of other viral proteins (Blouin and Blaho, 2001; Harms et al., 2000). Thus the localization observed in EVP22transfected cells is common among alphaherpesvirinae. However, the efficiency of VP22 translocation to the nucleus differed between infected cells and transfected cells. Our time-lapse imaging using RK-13 cells (data not shown) indicated the fluorescent tagged VP22 translocation rate to the nucleus was larger in infected cells than in transfected cells. Thus, unrelated to the kinds of cells, the

112

A. Okada et al. / Virus Research 192 (2014) 103–113

Fig. 11. Intracellular localization of Ab4p attB. MDBK cells were infected by Ab4p attB. At 0, 2, 4, 6, 8 hpi cells were fixed and observed by confocal microscopy. The figure shows the localization at 4, 6, 8 hpi. Scale bars of upper figures and lower figures indicate 50 ␮m and 10 ␮m respectively.

nuclear transport of VP22 can occur independently of other viral proteins, but effective transport might require other viral proteins. 4.2. The 154–188 amino acid residue of EVP22 is important for nuclear localization An alignment of the predicted amino acid sequences of the VP22s of EHV-1, HSV-1 and BHV-1 reveals a conserved region at 160–257 aa (Fig. 12). Our data using truncated EVP22 molecules showed that EVP22 required the 154–188 aa for nuclear localization. HVP22 is reported to have at least two separate determinants for nuclear localization (regions of 81–121 aa and 267–301 aa) (Aints et al., 2001), corresponding to regions 84–119 aa and 268–304 aa of EVP22. However, the amino acid sequences of the corresponding regions are completely different. The nuclear targeting signal of BVP22 is less clear. One study suggested that it is at 130–232 aa (Zhu et al., 2005), whereas another study reported that the overexpression experiment of carboxyl terminus of BVP22 (118–258 aa) had a nuclear-localization pattern similar to that of full-length VP22 (Ren et al., 2001). Another study reported that BVP22 requires 121–139 aa for nuclear transport (Zheng et al., 2005) and PRPR (131–134 aa) is not required for nuclear transport (Lobanov et al., 2010), but this motif is essential for the targeting of dot-like nuclear domain (Lobanov et al., 2010). Although alphaherpesvirus VP22s generally localize in the cytoplasm and the nucleus, the above findings suggest that their nuclear localization signals are not necessarily the same or even located in the conserved regions of the protein. Therefore, in addition to its central nuclear localization signal, EVP22, like HVP22 and BVP22, might have another region that is required for punctate nuclear localization that is equivalent to its fulllength.

4.3. Protein fusion of VP22 with mCherry does not influence the propagation of Ab4p The plaque size of Ab4p Cherry-VP22 was smaller than that of Ab4p attB in FHK Tcl3 cells. Although mCherry fusion had no effect to EHV-1 growth, it affected the cell-to-cell spreading in FHK Tcl3 cells. Deletion of HVP22 was reported to result in the reduction of plaque size in HSV-1 (Duffy et al., 2006). Furthermore, HVP22 was recognized to bridge a complex between glycoprotein E (gE) and glycoprotein M (gM). Deletion of gE or gM resulted in small plaque size (Maringer et al., 2012). Thus mCherry fused to VP22 might inhibit cell-to-cell spreading because mCherry-VP22 might affect construction of the gE-VP22-gM complex. On the other hand, we could not detect small plaques in MDBK cells. EHV-1 might have another manner of cell-to-cell spreading in MDBK cells. 4.4. VP22 might be phosphorylated in MDBK cells The Western blotting data that showed that VP22 signal had two major bands suggested VP22 might be modified in MDBK cells. In HSV-1, VP22 was reported to be phosphorylated in infected cells (Elliott et al., 1996). Therefore we tried to dephosphorylate the infected cell lysate, and assayed it by WB analysis. Alkaline phosphatase treatment caused the larger band to disappear. Thus EVP22 might be a phosphorylated protein similar to HSV-1 VP22. Considering this data, two bands in each lane of pEGFP-VP22 and truncation mutants (Fig. 3B) might be the phosphorylated and dephosphorylated proteins of EVP22. 4.5. Intracellular localization of VP22 is a conserved property among alphaherpesvirinae We used MDBK cells because FHK Tcl3 cells showed CPE at the early infection stage, which made it difficult to observe the

A. Okada et al. / Virus Research 192 (2014) 103–113

113

Fig. 12. Alignment of the predicted amino acid sequences of EVP22, HVP22 and BVP22 by GENETYX-MAC.

intracellular localization of Cherry-VP22 in FHK Tcl3 cells. Our data is consistent with the data obtained with wild-type HSV-1 and a recombinant HSV-1 expressing VP22 fused to mRFP (mRFP-VP22) (Sugimoto et al., 2008). HVP22 and mRFP-HVP22 were shown to be localized in the cytoplasm and were then translocated from the cytoplasm to the nucleus in Vero cells (Pomeranz and Blaho, 1999; Sugimoto et al., 2008). Also BVP22 was localized in the cytoplasm during the early stage of infection and in the nucleus during the late stage of infection (Lobanov et al., 2010). Thus, the intracellular localization of VP22 (at least expressing in cytoplasm and translocate to the nucleus) is a conserved property in alphaherpesvirinae. Our results suggest that EVP22 might be phosphorylated in infected cells and localizes to cytoplasm and translocates to nucleus independently of other viral proteins. Also the region 154–188 aa is required for nuclear translocation. Acknowledgements We thank Dr. Ken Maeda for kindly providing FHK Tcl3 cells. We also thank Kiyotada Naitou for technical support for making antibody. This work was supported JSPS KAKENHI Grant Number 24380165. References Aints, A., Guven, H., Gahrton, G., Smith, C.I., Dilber, M.S., 2001. Mapping of herpes simplex virus-1 VP22 functional domains for inter- and subcellular protein targeting. Gene Ther. 8 (14), 1051–1056. Barnett, B.C., Dolan, A., Telford, E.A., Davison, A.J., McGeoch, D.J., 1992. A novel herpes simplex virus gene (UL49A) encodes a putative membrane protein with counterparts in other herpesviruses.J. Gen. Virol. 73 (Pt 8), 2167–2171. Blouin, A., Blaho, J.A., 2001. Assessment of the subcellular localization of the herpes simplex virus structural protein VP22 in the absence of other viral gene products. Virus Res. 81 (1–2), 57–68. Che, X., Reichelt, M., Sommer, M.H., Rajamani, J., Zerboni, L., Arvin, A.M., 2008. Functions of the ORF9-to-ORF12 gene cluster in varicella-zoster virus replication and in the pathogenesis of skin infection. J. Virol. 82 (12), 5825–5834. Dorange, F., Tischer, B.K., Vautherot, J.F., Osterrieder, N., 2002. Characterization of Marek’s disease virus serotype 1 (MDV-1) deletion mutants that lack UL46 to UL49 genes: MDV-1 UL49, encoding VP22, is indispensable for virus growth. J. Virol. 76 (4), 1959–1970. Duffy, C., Lavail, J.H., Tauscher, A.N., Wills, E.G., Blaho, J.A., Baines, J.D., 2006. Characterization of a UL49-null mutant: VP22 of herpes simplex virus type 1 facilitates viral spread in cultured cells and the mouse cornea. J. Virol. 80 (17), 8664–8675. Elliott, G., O’Reilly, D., O’Hare, P., 1996. Phosphorylation of the herpes simplex virus type 1 tegument protein VP22. Virology 226 (1), 140–145.

Elliott, G.D., Meredith, D.M., 1992. The herpes simplex virus type 1 tegument protein VP22 is encoded by gene UL49. J. Gen. Virol. 73 (Pt 3), 723–726. Harms, J.S., Ren, X., Oliveira, S.C., Splitter, G.A., 2000. Distinctions between bovine herpesvirus 1 and herpes simplex virus type 1 VP22 tegument protein subcellular associations. J. Virol. 74 (7), 3301–3312. Heine, J.W., Honess, R.W., Cassai, E., Roizman, B., 1974. Proteins specified by herpes simplex virus. XII. The virion polypeptides of type 1 strains. J. Virol. 14 (3), 640–651. Inoue, H., Nojima, H., Okayama, H., 1990. High efficiency transformation of Escherichia coli with plasmids. Gene 96 (1), 23–28. Kasem, S., Yu, M.H., Yamada, S., Kodaira, A., Matsumura, T., Tsujimura, K., Madbouly, H., Yamaguchi, T., Ohya, K., Fukushi, H., 2010. The ORF37 (UL24) is a neuropathogenicity determinant of equine herpesvirus 1 (EHV-1) in the mouse encephalitis model. Virology 400 (2), 259–270. Kelly, B.J., Fraefel, C., Cunningham, A.L., Diefenbach, R.J., 2009. Functional roles of the tegument proteins of herpes simplex virus type 1. Virus Res. 145 (2), 173–186. Liang, X., Chow, B., Babiuk, L.A., 1997. Study of immunogenicity and virulence of bovine herpesvirus 1 mutants deficient in the UL49 homolog, UL49.5 homolog and dUTPase genes in cattle. Vaccine 15 (10), 1057–1064. Liang, X., Chow, B., Li, Y., Raggo, C., Yoo, D., Attah-Poku, S., Babiuk, L.A., 1995. Characterization of bovine herpesvirus 1 UL49 homolog gene and product: bovine herpesvirus 1 UL49 homolog is dispensable for virus growth. J. Virol. 69 (6), 3863–3867. Lobanov, V.A., Zheng, C., Babiuk, L.A., van Drunen Littel-van den Hurk, S., 2010. Intracellular trafficking of VP22 in bovine herpesvirus-1 infected cells. Virology 396 (2), 189–202. Lunn, D.P., Davis-Poynter, N., Flaminio, M.J., Horohov, D.W., Osterrieder, K., Pusterla, N., Townsend, H.G., 2009. Equine herpesvirus-1 consensus statement. Vet. Intern. Med. 23 (3), 450–461. Maeda, K., Yasumoto, S., Tsuruda, A., Andoh, K., Kai, K., Otoi, T., Matsumura, T., 2007. Establishment of a novel equine cell line for isolation and propagation of equine herpesviruses. J. Vet. Med. Sci. 69 (9), 989–991. Maringer, K., Stylianou, J., Elliott, G., 2012. A network of protein interactions around the herpes simplex virus tegument protein VP22. J. Virol. 86 (23), 12971–12982. Mettenleiter, T.C., 2002. Herpesvirus assembly and egress. J. Virol. 76 (4), 1537–1547. Pomeranz, L.E., Blaho, J.A., 1999. Modified VP22 localizes to the cell nucleus during synchronized herpes simplex virus type 1 infection. J. Virol. 73 (8), 6769–6781. Pomeranz, L.E., Blaho, J.A., 2000. Assembly of infectious Herpes simplex virus type 1 virions in the absence of full-length VP22. J. Virol. 74 (21), 10041–10054. Ren, X., Harms, J.S., Splitter, G.A., 2001. Bovine herpesvirus 1 tegument protein VP22 interacts with histones, and the carboxyl terminus of VP22 is required for nuclear localization. J. Virol. 75 (17), 8251–8258. Roizman, B., 1996. The function of herpes simplex virus genes: a primer for genetic engineering of novel vectors. Proc. Natl. Acad. Sci. U. S. A. 93 (21), 11307–11312. Sugimoto, K., Uema, M., Sagara, H., Tanaka, M., Sata, T., Hashimoto, Y., Kawaguchi, Y., 2008. Simultaneous tracking of capsid, tegument, and envelope protein localization in living cells infected with triply fluorescent herpes simplex virus 1. J. Virol. 82 (11), 5198–5211. Zheng, C., Brownlie, R., Babiuk, L.A., van Drunen Littel-van den Hurk, S., 2005. Characterization of the nuclear localization and nuclear export signals of bovine herpesvirus 1 VP22. J. Virol. 79 (18), 11864–11872. Zhu, J., Qiu, Z., Wiese, C., Ishii, Y., Friedrichsen, J., Rajashekara, G., Splitter, G.A., 2005. Nuclear and mitochondrial localization signals overlap within bovine herpesvirus 1 tegument protein VP22. J. Biol. Chem. 280 (16), 16038–16044.