Intragenic Deletions at Atp7a in Mouse Models for Menkes Disease

Genomics 74, 155–162 (2001) doi:10.1006/geno.2001.6529, available online at http://www.idealibrary.com on

Intragenic Deletions at Atp7a in Mouse Models for Menkes Disease Pamela Cunliffe,* ,1 Vivienne Reed,† and Yvonne Boyd‡ *University Department of Medical Genetics, St. Mary’s Hospital, Hathersage Road, Manchester M13 OJH, United Kingdom; †Mammalian Genetics Unit, Medical Research Council, Harwell, Didcot, Oxon OX11 0RD, United Kingdom; and ‡Institute for Animal Health, Compton, Newbury, Berkshire RG20 7NN, United Kingdom Received October 17, 2000; accepted February 19, 2001; published online May 7, 2001

Mottled mice have mutations in the copper-transporting ATPase Atp7a. They are proven models for the human disorder Menkes disease (MD), which results from mutations in a homologous gene. Mottled mice can be divided into three classes: class 1, in which affected males die before birth; class 2, in which affected males die in the early postnatal period; and class 3, in which affected males survive to adulthood. In humans, it has been shown that mutations that lead to a complete absence of functional protein cause classical MD, which is characterized by death of boys in early childhood. We hypothesized that the most severely affected mottled alleles would be the most likely to carry mutations equivalent to those causing classical MD and therefore undertook mutational analysis of several class 1 mottled alleles to assess whether these were appropriate models for the disease at the molecular level. Two novel mutations, a deletion of exons 11–14 in mottled spot and an insertion in exon 10 leading to missplicing in mottled candy, were identified. However, these are both “inframe” mutations, as are the other eight Atp7a mutations reported to date, and therefore no frameshift or nonsense mutations have yet been associated with the mottled phenotype. This contrasts with the mutation spectrum associated with MD, emphasizing the need for caution when mottled mice are used as models for the clinical disorder. © 2001 Academic Press

INTRODUCTION

Copper is an essential cofactor for numerous enzymes. Disturbances in biological copper processing lead to pleiotropic and often severe pathological consequences. For example, the genetic disorder Menkes disease (MD) is caused by mutations in an X-linked gene, ATP7A, which encodes a copper transporting ATPase (Chelly et al., 1993; Mercer et al., 1993; Vulpe et al., 1993). The ATP7A protein has recently been shown to localize to the trans-Golgi network (TGN) compartment of cells and to traffic from this location to 1 To whom correspondence should be addressed. Telephone: ⫹44(0)161 2766608. Fax: ⫹44(0)161 2766606. E-mail: [email protected].

the plasma membrane via vesicles under conditions of elevated copper (Petris et al., 1996, 1998). Forms of the ATP7A protein derived from alternatively spliced transcripts and localizing to different subcellular compartments have also been described (Reddy and Harris, 1998; Qi and Byers, 1998; Francis et al., 1998). Patients with the classical form of MD appear normal at birth but after the age of 3 months fail to thrive and usually die before the age of 3 years. Symptoms include severe neurodegeneration, depigmentation of the skin and hair, hypothermia, lax skin and joints, a characteristic face, and unusual hair structure (Danks, 1986). Moderate and milder forms of MD have also been reported, with the mildest form also being known as an X-linked form of cutis laxa or occipital horn syndrome (OHS) (Kaler et al., 1994; Das et al., 1994). The mottled mouse, which has been shown to have mutations in the mouse homologue of ATP7A, provides an animal model for MD (Reed and Boyd, 1997; Cecchi et al., 1997; Grimes et al., 1997). The mouse and human versions of the gene are highly homologous, having 88% identity across the coding region (Levinson et al., 1994; Mercer et al., 1994). Many of the pathological features of the mottled mouse can be directly related to those seen in classical MD and, as in humans, there is substantial phenotypic variation among mottled mutants. The large allelic series at mottled can be divided into three classes according to the effect of the mutation on the survival of hemizygous males (Reed and Boyd, 1997). Males carrying class 1 alleles die before birth, those carrying class 2 alleles are most likely to die between birth and weaning, and class 3 hemizygotes typically survive to adulthood. It has been shown that the phenotype of hemizygous males carrying some class 2 mottled alleles can be rescued by the administration of copper. Affected animals treated in this way survive to become fertile adults (Hunt, 1976; Mann et al., 1979; Nishimura, 1984). It is also possible to treat MD by early injections of copper histidine, giving considerable therapeutic benefit with regard to the neurological phenotype of the patients (Christolodou et al., 1998). However, connective tissue problems associated

155

0888-7543/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.

156

CUNLIFFE, REED, AND BOYD

with the syndrome are refractory to this type of treatment. Whereas class 2 alleles are considered good phenotypic models for classical MD (Hunt, 1974) and class 3 alleles appear to be comparable to milder allelic forms of MD such as OHS, class 1 mottled alleles appear to have no direct phenotypic counterpart in humans. Classical MD patients survive for some time postnatally even when they carry mutations such as large deletions, nonsense mutations, or frameshift mutations, which would be expected to ablate ATP7A function (Tu¨mer, 1998). No mutations of this type have yet been described in the mouse despite the fact that the mutational basis for eight mottled alleles, including three class 1 alleles, has been reported (Levinson et al., 1994, 1997a, 1997b; Mercer et al., 1994; George et al., 1994; Das et al., 1995; Reed and Boyd, 1997; Mori and Nishimura, 1997; Murata et al., 1997; Ohta et al., 1997; Cecchi et al., 1997). Based on the hypothesis that the most severely affected mutants would carry null mutations as in humans, we undertook a search for Atp7a mutations in further class 1 mottled alleles in an attempt to find a good model for classical MD at the molecular level. We describe two novel mutations at Atp7a in mice carrying class 1 alleles and review the differences in the mutation spectra at ATP7A in humans and mice. MATERIALS AND METHODS Mouse stocks, crosses, and mutant nomenclature. All mouse stocks, including the inbred strains C3H/HeH, 101/H, C57BL/6, CBA, and PT (Lyon et al., 1996), were kept in the animal facility at the Mammalian Genetics Unit, Harwell, under standard conditions. All animal studies were carried out under the guidance issued by the Medical Research Council in “Responsibility in the Use of Animals for Medical Research” (July 1993). The alleles of mottled were routinely maintained by mating heterozygous mottled females to 3H1 males, where 3H1 is an F 1 hybrid produced by crossing C3H/HeH females to 101/H males. Mottled individuals were scored by the presence of curly whiskers at birth and/or coat color between birth and weaning. Throughout this article, mutants are referred to as mottled (allele name) for simplicity; however, it should be noted that the correct nomenclature would be Atp7a mo-allele name; e.g., the official name for mottled spot is Atp7a mo-spot. Two of the mottled alleles (dappled, 12H) used in this study have been described previously (Carter et al., 1958; Levinson et al., 1997a; Rasberry and Cattanach, 1993). Mottled spot, a gift from Dr. Dominic Norris, arose spontaneously at the Clinical Research Centre (Northwick Park) and has been maintained at Harwell since 1993. Mottled candy, a gift from Louise Anderson, arose spontaneously at the AFRC (Edinburgh) and has been maintained at Harwell since 1995. The remaining two alleles arose at Harwell: mottled 16H (a gift from Emma Shutt) arose spontaneously in the SWF stock, and mottled 17H (a gift from Dr. Bruce Cattanach) was recovered from a chemical mutagenesis experiment. All mutants exhibited the characteristic mottled coat phenotype in the heterozygous females, and this was shown to cosegregate with Atp7a (Cunliffe, 1999). Southern blots. DNA was prepared from tissues of adult mice (control samples) or hemizygous mottled embryos (10 –15 dpc) that were identified by genotyping for a PCR variant at Atp7a. Primers GTCAAGAAAGATCGATCAGC and ACAGGCTCACAAGGAAAGAC (5⬘ 3 3⬘) were used in polymerase chain reaction (PCR) to identify the amplification product variation between inbred strains of mice

found in intron 8 of Atp7a (Cecchi and Avner, 1996). For some alleles, it was necessary to backcross stock animals to C57BL/6J to permit identification of animals carrying the mutant locus. Southern blots were prepared by alkaline transfer of DNAs, which had been digested with TaqI or HindIII. Digests were performed in 100-␮l reactions containing 10 ␮g genomic DNA, 60 U of enzyme in the manufacturer’s buffer at 65 or 37°C, for TaqI and HindIII respectively, overnight. Samples were separated by electrophoresis on 0.8% agarose gels overnight at 25–35 V and blotted overnight onto Hybond-N⫹ membranes (Amersham International). Filters were prehybridized for 2– 4 h at 63– 65°C in prehybridization buffer (6⫻ SSC, 5⫻ Denhardt’s solution, 200 ␮g ml ⫺1 herring sperm DNA, and 1 mM EDTA). Overlapping probes covering the entire Atp7a coding region were labeled with [ 32P]dCTP by nick-translation or multipriming using commercial kits (Amersham International). Probes were denatured and added to the filter in hybridization buffer, followed by incubation at 63– 65°C overnight. Filters were washed with serial dilutions (2⫻, 1⫻, 0.5⫻, etc.) of SSC:0.1% SDS and exposed to autoradiographic film at ⫺70°C. PCR and RT(reverse-transcription)-PCR. Primers were designed using the published Atp7a cDNA sequence Accession No. U03434 or using sequence derived from Cecchi and Avner (1996). Primers were synthesized commercially or by the UK HGMP Resource Centre. Standard conditions for PCR were reaction volumes of 10 ␮l using approximately 50 ng of genomic DNA per reaction, in a reaction mix containing a 0.5 ␮M concentration of each forward and reverse primer, 50 mM KCl, 10 mM Tris HCl (pH 8.4), 1.5 mM MgCl 2, 200 ␮M each of dCTP, dATP, dGTP, and dTTP, and 0.5 units of AmpliTaq polymerase (Perkin–Elmer). Standard PCR conditions were as follows: Step 1: 94°C for 3 min, 55°C for 1 min 30 s, 72°C for 1 min 30 s, for 1 cycle; Step 2: 94°C for 1 min, 55°C for 1 min 30 s, 72°C for 1 min 30 s, for 30 cycles; Step 3: 94°C for 1 min, 55°C for 2 min, 72°C for 3 min, for 1 cycle. RNA was extracted from mouse tissues using RNAzol B (Biogenesis) according to the manufacturer’s instructions and treated with DNase I to remove any genomic DNA contamination. Approximately 5 ␮g of the DNase-treated RNA was then added to random hexamer primers at a concentration of approximately 40 ng ␮l ⫺1 in a volume of 12 ␮l and denatured at 70°C for 10 min before being placed on ice. To this was added 0.5 ␮M each of dGTP, dATP, dCTP, and dTTP, 10 mM DTT (Gibco BRL), 4 ␮l of 5⫻ First Strand Buffer (Gibco BRL), and 200 U of reverse transcriptase (Superscript II RT, Gibco BRL) in a final reaction volume of 20 ␮l. The reactions were incubated at 37°C for 1 h and then denatured for 5 min at 95°C before the PCR was set up as described above using 1 ␮l of the RT reaction as template and 1 ␮l of a 1:4 dilution of DNase-treated RNA in a parallel reaction as a control for genomic DNA contamination. Sequencing. Sequencing was either from cloned PCR products or directly from PCR products. For manual sequencing, plasmid DNA was sequenced in both directions using a sequencing kit (Pharmacia Biotech) and labeled with 35S-dCTP (Amersham). Sequenced plasmid was run on denaturing acrylamide gels (7 M urea; 1⫻ TBE; 9.5% acrylamide; 0.5% bis-acrylamide) at a constant 75 W. Gels were dried on 3MM paper (Whatman) using a Bio-Rad gel drier (Model 583) attached to a Genevac (CPV100) vacuum pump at 80°C for 45–120 min and exposed to X-ray film overnight. Automated sequencing was performed on an ABI 377 automated sequencer using the dRhodamine Terminator Cycle Sequencing kit (Applied Biosystems). The sequence of mutant DNA was compared to wildtype sequence (Accession No. U03434) using the GCG program “Bestfit” (HGMP Resource Centre) or by using the program “BLAST” at the National Center for Biotechnology Information Web site (http://www.ncbi.nlm.nih.gov/BLAST/).

RESULTS

Mutation Analysis of Class 1 Mottled Alleles A range of probes that detected all the exon-containing HindIII and TaqI restriction fragments of Atp7a

MUTATIONS AT Atp7a

157

FIG. 1. (A) Southern blot of TaqI digested control (C3H/HeH, 101/H, PT, and CBA/H) and mottled hemizygote DNA probed with exons 9 –12 of Atp7a (nt 2088 –2588 of u03434). Mottled candy arose on a C57BL/6 genetic background (Norris, London, pers. comm. 1993); the background strain of mottled spot is unknown but types the same as C3H/HeH at the Atp7a variant in intron 8 (see Materials and Methods); mottled 12H arose in PT mouse stocks (Rasberry and Cattanach, 1993); mottled 16H arose in the SWF (small with white feet) mutant mouse stocks that are maintained on a 3H1 (C3H/HeH ⫻ 101/H) genetic background (Shutt, Harwell, pers. comm. 1997). The 1.6/1.8-kb fragment is variant between inbred strains. The 4.0-kb fragment (**), which contains exons 11–14, is absent from mottled spot samples. The fragment containing exon 10, which is 0.9 kb in all other samples, is larger (*) in samples derived from mottled candy hemizygotes. (B) Sequence of cloned RT-PCR product derived from spot allele of Atp7a. The sequence skips from exon 10 to exon 15.

were hybridized to DNA derived from mutant male embryos (spot, candy, dappled, 12H, 16H) identified by genotyping (see Materials and Methods). The only differences found in the exon-containing restriction fragments were observed when probe 13H5.5 (exons 9 –12) was hybridized to TaqI or HindIII digested DNA prepared from the two alleles, mottled spot and mottled candy. Mottled Spot Has a Deletion of Exons 11–14 of Atp7a DNA prepared from male embryos carrying the mottled spot allele was shown to contain the 0.9- and 3.2-kb TaqI fragments containing exons 10 and 15 of Atp7a, respectively, but lacked the 4.0-kb TaqI fragment, known to contain exons 11–14 (Fig. 1A). To determine the exact extent of this deletion in the Atp7a coding region, exons 9 –15 were amplified by RT-PCR using a cDNA template derived from a heterozygous mottled spot female. A smaller product, of the size expected (320 bp) if exons 11–14 were missing, was amplified along with the 829-bp wildtype allele (data not shown). The mutant product was sequenced in both directions to confirm the absence of exons 11–14 (Fig. 1B). As the first 3 bp (GGC) of exon 11 are identical to the first 3 bp of exon 15, we designed a primer within intron 14 (GGGTTGACCAGTGTTGCTTT 5⬘ 3 3⬘) and used it in conjunction with a primer in exon 15 (ACAGGCACATGCGATACACA 5⬘ 3 3⬘) in a PCR on genomic DNA from mottled spot and controls. A product was amplified from the mottled spot samples, indicating that the 5⬘ boundary of exon 15 is present in mottled spot and that the deletion breakpoints are within introns 10 and 14. A deletion resulting in the removal of exons 11–14

would be expected to result in an in-frame transcript encoding a protein lacking the majority of the small cytoplasmic loop of Atp7a including the highly conserved phosphatase motif and also the entire fifth transmembrane domain. There are deletions causing classical Menkes disease that include some or all of these exons, but none which is exactly equivalent (Tu¨mer, 1998). An Insertion Event in Mottled Candy Results in Loss of the First 30 bp of Exon 10 Southern blotting showed that the 0.9-kb TaqI fragment containing exon 10 was replaced by a fragment of approximately 0.95 kb in DNA prepared from mottled candy hemizygotes (Fig. 1A). A larger amplification product (⬃1.5 kb) was observed in DNA prepared from mottled candy than in that from relevant controls (⬃1.4 kb) when PCR using a forward primer in exon 9 in conjunction with a reverse primer in exon 10 was carried out (data not shown). These data suggested that there was an insertion in intron 9 or in the flanking exonic DNA that formed part of the PCR product. However, a smaller product was observed in the mutant samples when the coding region covering exons 9 –13 was amplified from cDNA derived from hemizygous embryos and heterozygous females carrying mottled candy (data not shown). Exonic primers that flanked intron 9 and gave rise to an amplification product covering nucleotides 2088 –2426 also yielded a smaller product from mottled candy cDNA than the expected 347-bp product amplified from control cDNA (Fig. 2). These PCR products and also the products from genomic DNA that contained intron 9 were cloned

158

CUNLIFFE, REED, AND BOYD

FIG. 2. (A) RT-PCR products amplified from mottled candy and wildtype cDNAs. Primers used were nt 2088 –2108 and 2435–2426, which yield a 347-bp product from the 3H1 (wildtype) cDNA. A smaller 317-bp product is amplified from the mottled candy hemizygote sample. In the heterozygotes, a wildtype-sized band, a faint product from the mutant (317 bp) transcript, and a larger band, which is likely to be a heteroduplex, are observed. (B) Diagrammatic representation of the mutation of Atp7a in mottled candy (not to scale). There is an 81-bp insertion (outlined) in exon 10. There is a 14-bp duplication of the insertion site flanking the inserted sequence, which has a 45-bp poly(A) tail. The insertion is in an antisense direction in relation to the Atp7a transcript. The insertion causes missplicing by activating a cryptic splice site 27 bp downstream in exon 10 and creating an in-frame deletion (nt 2228 –2257) in the Atp7a transcript.

and sequenced to identify the nature of the mutational event. Sequence data from genomic DNA revealed that there was an insertion of 81 bp after the first 8 bp of exon 10. The 81 bp consists of a 45-bp poly(A) repeat, a 14-bp duplication of the insertion site, and a further 22 bp (Fig. 2). The sequence of the insertion, excluding the 14-bp duplication of the insertion site, showed 91% identity to the transposable element LINE L1Md (Accession No. L43538). However, owing to its small size, it was not possible to assign the inserted element to any particular transposon family. The insertion had the characteristic features of a retrotranspostion

event, i.e., a 14-bp duplication of the insertion site flanking the inserted sequence and a poly(A) tail, indicating that a transposable element had been inserted into the 5⬘ end of exon 10. Sequencing of the RT-PCR product revealed that the first 30 bp of exon 10 were spliced out of the mutant transcript, suggesting that the insertion causes the splicing machinery to skip the first part of the exon and activates a cryptic splice acceptor 27 bp further downstream. The transcript produced would result in production of a protein with an in-frame deletion of 10 amino acids (715–724) spanning the carboxy-terminal part of the second transmembrane motif (Fig. 2).

MUTATIONS AT Atp7a

This mutation in Atp7a adds another case to the growing list of mouse mutant phenotypes that have been caused by retrotransposition events (e.g., Kingsmore et al., 1994; Kohrman et al., 1996; Takahara et al., 1996; Perou et al., 1997). Mottled Dappled, 12H, 16H, and 17H The deletion of exon 1 of Atp7a in the allele mottled dappled identified by Levinson et al. (1997a) was also confirmed (data not shown). As no changes were observed on Southern analysis of mottled 12H and mottled 16H, material from heterozygotes carrying each of these two alleles and an additional allele, mottled 17H, was screened using RT-PCR. Although the entire coding region was covered, no differences in transcript size were detected in amplification products of Atp7a in material derived from any of these three mutants (data not shown). DISCUSSION

With the discovery of 2 additional Atp7a mutations described here, 10 molecular lesions have now been identified in a total of 24 mottled alleles subjected to mutational analyses (see references in Table 1 and George et al., 1994). There are now two deletions, an insertion mutation, a missense mutation, and a splice site mutation reported in alleles associated with prenatal death of males before birth. Although this frequency of mutations detectable by Southern analysis (3/14) appears to be similar to that reported for classical MD patients (⬃20%, Tu¨mer, 1998), there are important differences. All of the 35 mutations at ATP7A detected by Southern analysis in classical Menkes patients are partial gene deletions, many of which extend beyond the ATP7A gene (Tu¨mer, 1998). Cecchi et al. (1997) hypothesized that the absence of this type of gross deletion at the mouse locus may be due to the presence of a developmental gene closely linked to Atp7a. The absence of insertion mutations in human is not surprising, as mutations shown to be caused by transposition events are relatively rare in humans, being approximately 1 in 670 as compared to about 1 in 10 in the mouse (Kazazian, 1998). A more striking difference in the ATP7A mutation spectra is that all the mouse mutations described to date leave the majority of the coding region intact and there are no frameshift or nonsense mutations. In contrast, approximately 90% of classical Menkes patients have mutations that would lead to truncated proteins because they cause a shift in the translation reading frame or are nonsense mutations (Tu¨mer et al., 1997; Tu¨mer, 1998). The only mutation in a mottled mouse shown to result in an out-of-frame transcript is that in the class 3 allele mottled blotchy, which has a single basepair substitution in the splice donor site of intron 11 (Das et al., 1995). This results in occasional skipping of exon 11, giving rise to an out-of-frame transcript

159

along with other aberrant splice forms; however, a substantial amount of the normal Atp7a transcript is produced in this allele (Das et al., 1995). The absence of mutations that would unequivocally ablate all Atp7a function in the mouse is surprising as we would expect that, by chance, a proportion of the mutations at Atp7a would result in frameshift or nonsense mutations. The lack of frameshift/nonsense mutations in mottled mice may represent a difference in the mutation spectrum of the ATP7A gene between mice and humans. It is possible that the proteins produced by the mutations described for the class 1 alleles are nonfunctional; for example, the allele mottled spot has a deletion covering the region encoding the highly conserved phosphatase domain, which performs a critical role in the ATPase function (Solioz and Vulpe, 1996). However, there may be important functions associated with the deleted proteins, as alternatively spliced (AS) forms of human ATP7A, including a transcript lacking exons 3–15, have been described (Reddy and Harris, 1998). If similar AS forms exist in the mouse, three of the five class 1 mutants (spot, 1Pub, candy) with defined molecular lesions would retain some ATP7A function. In support of this argument, smaller proteins, of approximately 95 and 110 kDa as opposed to the normal sized ⬃170 kDa, can be identified using antibodies to mouse Atp7a in some tissues (Grimes et al., 1997; Cunliffe, unpublished observations) and have been postulated to represent possible posttranslationally modified forms of the protein. Low levels of functional protein may also be present in mottled dappled, which carries a deletion of the untranslated exon 1, as Atp7a transcripts can be detected by RT-PCR (Levinson et al., 1997a; Cunliffe, unpublished observations). In contrast, the frameshift and nonsense mutations associated with classical MD in humans, and also many of the gross deletions, would not be expected to result in production of a functional protein. Another feature of the mutation spectrum at ATP7A in MD patients not present in mottled mice is the occurrence of a mutation hotspot in exons 7–10 (Tu¨mer, 1998). Approximately 50% of small mutations in classical Menkes patients occur in the region spanning exons 7–10 of the gene, and in addition, 11 of 20 genomic deletions at ATP7A remove part, or all, of exons 7–10. These divergent features in the mutation spectra may represent a difference between human and mouse in addition to any effects caused by a possible difference in fetal copper requirements between the two species as suggested by Mercer et al. (1999). This may have a bearing on the usefulness of the mottled mouse as a model for Menkes disease. For example, Payne et al., (1998) discuss the possibility that up-regulation of ATP7B in Menkes patients could rescue at least some of the symptoms of the disease. This is based on their observations that expression of wildtype ATP7B in fibroblasts carrying the mottled brindled mutations res-

160

CUNLIFFE, REED, AND BOYD

TABLE 1 Summary of Mutations at Atp7a Described in Mottled Mice to Date Including This Study Mutation Allele

Class

Effect on gene

Effect on protein

11H

1

Missense, 4173 C 3 A; levels of Atp7a mutant transcript are reduced to ⬃22% of total in heterozygotes

1Pub

1

Splice site mutation resulting from G 3 A substitution at ⫹1 splice donor site of intron 14, leading to constitutive splicing out of exon 14 (nt 2837–2971)

Dappled

1

Spot

1

Genomic deletion of exon 1 (nt 1–66) and surrounding sequences, including putative promoter region; reduced levels of Atp7a transcript Genomic deletion including exons 11–14 (nt 2462–2971)

A1364D in seventh transmembrane motif; insertion of a positively charged amino acid into a hydrophobic motif is predicted to make insertion into the membrane difficult Protein lacking entire fifth transmembrane motif; predicted to cause rotation of the C-terminus of Atp7a, including the phosphatase and ATP-binding domains from one side of the membrane to the other Presumably reduced levels of protein

Candy

1

Brindled

2

Insertion of 81-bp sequence with homology to the transposable element LINE L1 in exon 10; results in activation of a cryptic splice acceptor in exon 10 and a transcript lacking the first 30 bp of this exon Deletion of 6 bp (nt 2473–2478)

Macular

2

Missense, 4233 T 3 C

Blotchy

3

Splice site mutation caused by A 3 C substitution at position ⫹3 of intron 11 splice donor, leading to occasional missplicing of exon 11 (nt 2462–2553)

Pewter

3

Missense, 3074 G 3 A

Viable brindled

3

Missense, 3189 A 3 C

Reference Cecchi et al. (1997)

Cecchi et al. (1997)

Levinson et al. (1997a); This study

In-frame deletion taking out majority of small cytoplasmic loop, the phosphatase domain, and the entire fifth transmembrane motif Deletion of the first 10 amino acids encoded by exon 10; the protein produced would lack the carboxyterminal portion of the second transmembrane motif

This study

In-frame deletion of 2 amino acids, A799 and L800 a S1382P in eighth transmembrane motif

Reed and Boyd (1997); Grimes et al. (1997) Mori and Nishimura (1997); Murata et al. (1997); Ohta et al. (1997) Das et al. (1995); La Fontaine et al. (1999)

Translation of misspliced product would give a protein lacking part of the small cytoplasmic loop; however, a truncated protein is not visible on Western blots, only greatly reduced levels of normal sized product; the protein fails to traffic to the plasma membrane in elevated copper A998T in transduction domain of sixth transmembrane motif K1036T in phosphorylation domain

This study

Levinson et al. (1997b) Reed and Boyd (1997); Cecchi et al. (1997)

a The deleted amino acids are highly evolutionarily conserved and situated in a region thought to be responsible for communication of conformational signals between the enzyme catalytic site and the cation-binding sites (Higgins, 1992). The deletion has been postulated to be analagous to the ⌬I507 and ⌬F508 mutations in the cystic fibrosis cation transporter CFTR (Reed and Boyd, 1997). CFTR with the ⌬F508 mutation is thought to adopt an abnormal conformation, leading to incorrect glycosylation and failure to localize to the plasma membrane (Welsh and Smith, 1993). It has been shown that Atp7a protein carrying the brindled mutation fails to traffic to the plasma membrane under conditions of elevated copper in cultured cells (La Fontaine et al., 1999).

cued the copper retention phenotype. It seems unlikely that the brindled mutation is equivalent to mutations causing classical Menkes disease; therefore, an evaluation of this type of approach in vivo using the mottled brindled allele would not be appropriate.

ACKNOWLEDGMENTS We thank Lynette Hobbs for animal care, Helen Blair and Emmanuelle Gormally for valuable discussions, and the MRC for support.

MUTATIONS AT Atp7a

REFERENCES Carter, T. C., Lyon, M. F., and Phillips, R. J. S. (1958). Genetic hazard of ionizing radiations. Nature 182: 409. Cecchi, C., and Avner, P. (1996). Genomic organization of the mottled gene, the mouse homologue of the human Menkes disease gene. Genomics 37: 96 –104. Cecchi, C., Biasotto, M., Tosi, M., and Avner, P. (1997). The mottled mouse as a model for human Menkes disease: Identification of mutations in the Atp7a gene. Hum. Mol. Genet. 6: 425– 433. Chelly, J., Tu¨mer, Z., Tonnesen, T., Petterson, A., Ishikawa-Brush, Y., Tommerup, N., Horn, N., and Monaco, A. P. (1993). Isolation of a candidate gene for Menkes disease that encodes a potential heavy metal binding protein. Nat. Genet. 3: 14 –19. Christodoulou, J., Danks, D. M., Sarkar, B., Baerlocher, K. E., Casey, R., Horn, N., Tu¨mer, Z., and Clarke, J. T. R. (1998). Early treatment of Menkes disease with parental copper-histidine: Long-term follow-up of four treated patients. Am. J. Med. Genet. 76: 154 –164. Cunliffe, P. (1999). “Molecular Analysis of Mottled Mice,” Ph.D. thesis, University of Oxford. Danks, D. M. (1986). Of mice and men, metals and mutations. J. Med. Genet. 23: 99 –106. Das, S., Levinson, B., Whitney, S., Vulpe, C., Packman, S., and Gitschier, J. (1994). Diverse mutations in patients with Menkes disease often lead to exon skipping. Am. J. Hum. Genet. 55: 883– 889. Das, S., Levinson, B., Vulpe, C., Whitney, S., Gitschier, J., and Packman, S. (1995). Similar splicing mutations of the Menkes/ mottled copper-transporting ATPase gene in occipital horn syndrome and the blotchy mouse. Am. J. Hum. Genet. 56: 570 –576. Francis, M. J., Jones, E. E., Levy, E. R., Ponnambalam, S., Chelly, J., and Monaco, A. P. (1998). A Golgi localization signal identified in the Menkes recombinant protein. Hum. Mol. Genet. 7: 1245–1252. George, A. M., Reed, V., Glenister, P., Chelly, J., Tu¨mer, Z., Horn, N., Monaco, A. P., and Boyd, Y. (1994). Analysis of Mnk, the murine homologue of the locus for Menke’s disease, in normal and mottled (Mo) mice. Genomics 22: 27–35. Grimes, A., Hearn, C. J., Lockhart, P., Newgreen D. F., and Mercer, J. F. B. (1997). Molecular basis of the brindled mouse mutant (Mobr): A murine model of Menkes disease. Hum. Mol. Genet. 6: 1037–1042. Higgins, C. F. (1992). ABC transporters: From microorganisms to man. Annu. Rev. Cell Biol. 8: 67–113. Hunt, D. M. (1974). Primary defect in copper transport underlies mottled mutants in the mouse. Nature 249: 852– 854. Hunt, D. M. (1976). A study of copper treatment and tissue copper levels in the murine congenital copper deficiency, mottled. Life Sci. 19: 1913–1920. Kaler, S. G., Gallo, L. K., Proud, V. K., Percy, A. K., Mark, Y., Segal, N. A., Goldstein, D. S., Holmes, C. S., and Gahl, W. A. (1994). Occipital horn syndrome and a mild Menkes phenotype associated with splice site mutations at the MNK locus. Nat. Genet. 8: 195. Kazazian, H. H., Jr. (1998). Mobile elements and disease. Curr. Opin. Genet. Dev. 8: 343–350. Kingsmore, S. F., Giros, B., Suh, D., Bieniarz, M., Caron, M. G., and Seldin, M. F. (1994). Glycine receptor ␤-subunit gene mutation in spastic mouse associated with LINE-1 element insertion. Nat. Genet. 7: 136 –141. Kohrman, D. C., Harris, J. B., and Meisler, M. H. (1996). Mutation detection in the med and medJ alleles of the sodium channel Scn8a. J. Biol. Chem. 271: 17576 –17581. La Fontaine, S., Firth, S. D., Lockhart, P. J., Brooks, H., Camakaris, J., and Mercer, J. F. B. (1999). Intracellular localization and loss of copper responsiveness of Mnk, the murine homologue of the Men-

161

kes protein, in cells from bloychy (Mo blo) and brindled (Mo br) mouse mutants. Hum. Mol. Genet. 8: 1069 –1075. Levinson, B., Vulpe, C., Elder, B., Martin, C., Verley, F., Packman, S., and Gitschier, J. (1994). The mottled gene is the mouse homologue of the Menkes disease gene. Nat. Genet. 6: 369 –373. Levinson, B., Packman, S., and Gitschier, J. (1997a). Deletion of the promoter region in the Atp7a gene of the mottled dappled mouse. Nat. Genet. 16: 224 –225. Levinson, B., Packman, S., and Gitschier, J. (1997b). Mutation analysis of mottled pewter. Mouse Genome 95: 163–165. Lyon, M. F., Rastan, S., and Brown, S. D. M. (Eds.) (1996). “Genetic Variants and Strains of the Laboratory Mouse,” Vol. 2, 3rd ed., Oxford Univ. Press, London. Mann, J. R.., Camarakis, J., and Danks, D. M. (1979). Copper metabolism in mottled mouse mutants, distribution of Cu in brindled (Mobr) mice. Biochem. J. 180: 613– 619. Mercer, J. F. B., Livingston, J., Hall, B., Paynter, J. A., Begy, C., Chandrasekharappa, S., Lockhart, P., Grimes, A., Bhave, M., Siemieniak, D., and Glover T. W. (1993). Isolation of a partial candidate gene for Menkes disease by positional cloning. Nat. Genet. 3: 20 –25. Mercer, J. F. B., Grimes, A., Ambrosini, L., Lockhart, P., Paynter, J. A., Dierick, H., and Glover, T. W. (1994). Mutations in the murine homologue of the Menkes gene in dappled and blotchy mice. Nat. Genet. 6: 374 –378. Mercer, J. F., Ambrosini, L., Horton, S., Gazeas, S., and Grimes, A. (1999). Animal models of Menkes disease. Adv. Exp. Med. Biol. 448: 97–108. Mori, M., and Nishimura, M. (1997). A serine-to-proline mutation in the copper-transporting P-type ATPase gene of the macular mouse. Mamm. Genome 8: 407– 410. Murata, Y., Kodama, H., Abe, T., Ishida, N., Nishimura, M., Levinson, B., Gitschier, J., and Packman, S. (1997). Mutation analysis and expression of the mottled gene in the macular mouse model of Menkes disease. Pediatr. Res. 42: 436 – 442. Nishimura, M. (1984). Menkes’ kinky hair syndrome mutant mouse (macular mouse). In “Experimental Animal Model of Intractable Disease” (M. Kyogoku, Ed.), pp. 158 –168, Soft Science, Tokyo. [In Japanese] Ohta, Y., Shiraishi, N., and Nishikimi, M. (1997). Occurrence of two missense mutations in Cu-ATPase of the macular mouse, a Menkes disease model. Biochem. Mol. Biol. Int. 43: 913–918. Payne, A. S., and Gitlin, J. D. (1998). Functional expression of the Menkes disease protein reveals common biochemical mechanisms among the copper-transporting P-type ATPase. J. Biol. Chem. 273: 3765–3770. Payne, A. S., Kelly, E. J., Gitlin, J. D. (1998). Functional expression of the Wilson disease protein reveals mislocalization and impaired copper-dependent trafficking of the common H1D69Q mutation. Proc. Natl. Acad. Sci. USA 95: 10854 –10859. Perou, C. M., Pryor, R. J., Naas, T. P., and Kaplan, J. (1997). The bg allele mutation is due to a LINE1 element retrotransposition. Genomics 42: 366 –368. Petris, M. J., Mercer, J. F. B., Culvenor, J. G., Lockhart, P., Gleeson, P. A., and Camakaris, J. (1996). Ligand-regulated transport of the Menkes copper P-type ATPase efflux pump from the golgi apparatus to the plasma membrane: A novel mechanism of regulated trafficking. EMBO J. 15: 6084 – 6095. Petris, M. J., Camakaris, J., Greenough, M., LaFontaine, S. and Mercer, J. F. B. (1998). A C-terminal di-leucine is required for localisation of the Menkes protein in the trans-Golgi network. Hum. Mol. Genet. 7: 2063–2071. Qi, M., and Byers, P. H. (1998). Constitutive skipping of alternatively spliced exon 10 in the ATP7A gene abolishes Golgi localization of the Menkes protein and produces the occipital horn syndrome. Hum. Molec. Genet. 7: 465– 469.

162

CUNLIFFE, REED, AND BOYD

Rasberry, C., and Cattanach, B. M. (1993). Three new mottled mutations. Mouse Genome 91: 851– 853. Reddy, M. C. M., and Harris, E. D. (1998). Multiple transcripts coding for the Menkes gene: Evidence for alternative splicing of Menkes mRNA. Biochem. J. 334: 71–77. Reed, V., and Boyd, Y. (1997). Mutation analysis provides additional proof that mottled is the mouse homologue of Menke’s disease. Hum. Mol. Genet. 6: 417– 423. Soloz, M., and Vulpe, C. (1996). CPx-type ATPases: A class of P-type ATPases that pump heavy metals. Trends Biochem. Sci. 21: 237– 241. Takahara, T., Ohsumi, T., Kuromitsu, J., Shibata, K., Sasaki, N., Okazaki, Y., Shibata, H., Sato, S., Yoshiki, A., Kusakabe, M., Muramatsu, M., Ueki, M., Okuda, K., and Hayashizaki, Y. (1996).

Dysfunction of the Orleans reeler gene arising from exon skipping due to transposition of a full-length copy of an active L1 sequence into the skipped exon. Hum. Mol. Genet. 5: 989 –993. Tu¨mer, Z. (1998). Genetics of Menkes disease. J. Trace Elem. Exp. Med. 11: 147–161. Tu¨mer, Z., Lund, C., Tolshave, J., Vural, B., Tonnesen, T., and Horn, N. (1997). Identification of point mutations in 41 unrelated patients affected with Menkes disease. Am. J. Hum. Genet. 60: 63–71. Vulpe, C., Levinson, B., Whitney, S., Packman, S., and Gitschier, J. (1993). Isolation of a candidate gene for Menkes disease and evidence that it encodes a copper-transporting ATPase. Nat. Genet. 3: 7–13. Welsh, M. J., and Smith, A. E. (1993). Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis. Cell 73: 1251–1254.