Intragenic DNA methylation status down-regulates bovine IGF2 gene expression in different developmental stages

Gene 534 (2014) 356–361

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Intragenic DNA methylation status down-regulates bovine IGF2 gene expression in different developmental stages Yong-Zhen Huang a, Zhao-Yang Zhan a, Yu-Jia Sun a, Xiu-Kai Cao a, Ming-Xun Li a, Jing Wang a, Xian-Yong Lan a, Chu-Zhao Lei a, Chun-Lei Zhang b, Hong Chen a,⁎ a b

College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Yangling Shaanxi, China Institute of Cellular and Molecular Biology, Jiangsu Normal University, Xuzhou Jiangsu, China

a r t i c l e

i n f o

Article history: Accepted 26 September 2013 Available online 16 October 2013 Keywords: Cattle IGF2 DMR DNA methylation qPCR

a b s t r a c t DNA methylation is a key epigenetic modification in mammals and has an essential and important role in muscle development. Insulin-like growth factor 2 (IGF2) is a fetal growth and differentiation factor that plays an important role in muscle growth and in myoblast proliferation and differentiation. The aim of this study was to evaluate the expression of IGF2 and the methylation pattern on the differentially methylated region (DMR) of the last exon of IGF2 in six tissues with two different developmental stages. The DNA methylation pattern was compared using bisulfite sequencing polymerase chain reaction (BSP) and combined bisulfite restriction analysis (COBRA). The quantitative real-time PCR (qPCR) analysis indicated that IGF2 has a broad tissue distribution and the adult bovine group showed significant lower mRNA expression levels than that in the fetal bovine group (P b 0.05 or P b 0.01). Moreover, the DNA methylation level analysis showed that the adult bovine group exhibited a significantly higher DNA methylation levels than that in the fetal bovine group (P b 0.05 or P b 0.01). These results indicate that IGF2 expression levels were negatively associated with the methylation status of the IGF2 DMR during the two developmental stages. Our results suggest that the methylation pattern in this DMR may be a useful parameter to investigate as a marker-assisted selection for muscle developmental in beef cattle breeding program and as a model for studies in other species. © 2013 Published by Elsevier B.V.

1. Introduction Epigenetics refers to the heritable changes that modify DNA or associated proteins without changing the DNA sequence itself (Egger et al., 2004). DNA methylation is a major epigenetic modification of the genome and is crucial for genomic stability. DNA methylation is a normal process used by mammalian cells in maintaining a development and has been implicated in diverse processes, including embryogenesis, genomic imprinting, X-inactivation and transposon silencing in mammals and plants (Lippman et al., 2004; Rhee et al., 2002). DNA methylation modification plays important roles in genome

Abbreviations: 3’-UTRs, regulation at the 3’ untranslated regions; AB, adult bovine; bp, base pair(s); ANOVA, analysis of variance; BSP, Bisulfite sequencing PCR; cDNA, Complementary DNA; COBRA, combined bisulfite restriction analysis; CpG, Cyt osineguan inedinucleotide; CTCF, CCCTC binding factor; DMR, differentially methylated region; FB, fetal bovine; H19, histocompatibility gene; IGF2, Insulin-like growth factor 2; LDM, longissimus dorsi muscle; miRNA, microRNA; qPCR, quantitative real-time PCR; QTLs, quantitative trait locus; QUMA, quantification tool for methylation analysis; SEM, standard error; SPSS, statistical product and service solutions; TSS, transcription start site; TTS, the transcription termination site. ⁎ Corresponding author at: No.22 Xinong Road, College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi 712100, China. Tel.: +86 29 87092012; fax: +86 29 87092164. E-mail address: [email protected] (H. Chen). 0378-1119/$ – see front matter © 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.gene.2013.09.111

reprogramming and expression of genes that control animal development. Generally, methylation of CpG islands represses the initiation of transcription in the somatic cells of mammals and other vertebrates (Bird, 2002; Plass and Soloway, 2002). CpG sites are roughly 80% depleted in the genome, and are asymmetrically distributed into CpG poor regions and dense regions called CpG “islands” (CGI), which are often located in the promoter regions of roughly half of all the protein-coding genes (Takai and Jones, 2002). CGIs normally remain unmethylated, whereas the sporadic CpG sites in the rest of the genome are normally methylated (Chuang and Jones, 2007). Methylation of CGIs in promoter regions is often associated with gene silencing, and aberrant DNA methylation occurs in most cancers, leading to the silencing of some tumor suppressor genes (Jones and Baylin, 2002). Promoter methylation is negatively correlated with the gene expression level, indicating its suppressive role in regulating gene transcription (Li et al., 2011). DNA methylation is enriched in the gene body regions and the repetitive sequences, and depleted in the transcription start site (TSS) and the transcription termination site (TTS) (Li et al., 2011). The differentially methylated regions (DMRs) in promoters are highly associated with obesity development via expression repression of both known obesityrelated genes and novel genes (Li et al., 2012). Insulin-like growth factor 2 (IGF2) is a fetal growth and differentiation factor that plays an important role in muscle growth and

Y.-Z. Huang et al. / Gene 534 (2014) 356–361

myoblast proliferation and differentiation (Giannoukakis et al., 1993). The IGF2 gene contains 10 exons in all species studied to date. The mature form of IGF2, however, contains only the last three exons (exons 8, 9, and 10), with part of the translated product of exon 10. The other exons, together with four promoters (P1–P4), are involved in tissue- and/or developmental stage-specific expression of IGF2 (Curchoe et al., 2005). In most bovine fetal tissues, only the paternal allele of this gene is expressed, while the maternal allele is transcriptionally silent (Dindot et al., 2004). Simultaneously, biallelic expression driven by promoters 3 and 4 has been observed in adult tissues (Curchoe et al., 2005). The IGF2 gene was the first imprinted genes to be identified in mammals. There were three DMRs that have been identified in the mouse IGF2 gene: maternally methylated DMR0 located in exon U1, and paternally methylated DMR1 and DMR2 located in upstream of promoter 1 and exon 6, respectively (Feil et al., 1994; Moore et al., 1997). In humans, the regions homologous to mouse DMR0 and DMR2 have been shown to be differentially methylated, whereas the DMR1 is not methylated (Cui et al., 2002; Sullivan et al., 1999). The results of DMR1 and DMR2 knockout mice tests demonstrated that DMR1 has a silencer function (Constancia et al., 2000) and DMR2 has an activator function (Murrell et al., 2001). Regarding the control of IGF2 expression, the model of IGF2/H19 locus has the chromatin loop and has been proposed to explain the interactions among DMRs in this locus (Murrell et al., 2004). This DMR that contains CCCTC binding factor (CTCF) binding sites is located in the IGF2 and histocompatibility (H19) locus upstream of the H19 promoter, and CTCF-binding proteins regulate transcription of both genes. IGF2 is expressed in the paternal chromosome with a methylated DMR and H19 is expressed in the maternal chromosome with an unmethylated DMR (Chao and D’Amore, 2008; Killian et al., 2001; Zhang et al., 2004). The bovine IGF2 gene was localized to bovine chromosome 29, which harbors quantitative trait locus (QTLs) for meat, milk, and health traits in cattle (Casas et al., 2003; Schulman et al., 2004). It is a potent mitogen that is involved in placental and fetal development (Chao and D’amore, 2008; Curchoe et al., 2005). A different methylation pattern was identified within a region of the last exon of the bovine and porcine IGF2 gene, suggesting the presence of an intragenic DMR, and it has been shown to be more highly methylated in spermatozoa than in oocytes (Gebert et al., 2006; Han et al., 2008). This methylated DMR is involved in the initiation of IGF2 transcription, contributing to a high rate of gene transcription (Murrell et al., 2001). This study is the first to compare the DNA methylation profiles in the DMR of the last exon of the IGF2 gene in six tissues and organs (muscle, heart, liver, spleen, lung and kidney) and their relationships to mRNA expression patterns of fetal and adult using two-tail samples of Chinese Qincuan beef cattle breed with different growth performance. The objective was to identify the relation between epigenetic modifications and gene expression changes in cattle, which possibly contributed to animal breeding and genetics.

357

2. Materials and methods 2.1. Ethics statement The study protocol was approved by the Regulations for the Administration of Affairs Concerning Experimental Animals (Ministry of Science and Technology, China, revised 2004) and approved by the Institutional Animal Care and Use Committee (College of Animal Science and Technology, Northwest A&F University, China). Bovine embryos of slaughtered Qinchuan cows were collected from Tumen Abattoir, a local slaughterhouse of Xi'An, China. Adult Qinchuan cattle were obtained from Shannxi Kingbull Animal Husbandry Co. Ltd. (Baoji, China). Adult animals were allowed access to feed and water ad libitum under normal conditions and were humanely sacrificed as necessary to ameliorate suffering. 2.2. Tissue samples Samples of six tissues and organs (longissimus dorsi muscle, heart, liver, spleen, lungs, and kidney) from 8 male individuals (4 individuals per stage) were harvested for RNA and DNA isolated within 10 min after slaughter at two key stages of myogenesis and muscle maturation: 90 days at embryo (fetal bovine, FB), and 24-month-old (adult bovine, AB). Fetal age (gestation period 280 days) was estimated based on crown-rump length (Richardson et al., 1990). There is no direct and collateral blood relationship within the last 3 generations among these cattle from each group. All fresh tissue samples were collected and divided into 1.5 mL plastic centrifuge tubes (each sample weighing around 100 mg) and immediately frozen in liquid nitrogen and stored at −80 °C until RNA and DNA extraction. 2.3. RNA preparation and quantitative real-time PCR (qPCR) Total RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The integrity of the total RNA was checked by running 0.8% agarose gel and the concentration was determined by using a NanoDrop spectrophotometer (ND-1000, Wilmington, DE). Approximately 2 μg of total RNA was mixed with 2 μL of oligo (dT)18 (0.25 μg/μL), 4 μL of dNTPs (2.5 mM each) and 5.4 μL of RNase-free ddH2O and incubated at 65 °C for 5 min, then placed in ice bath for 2 min, and then 4 μL of 5× first-strand buffer, 1 μL of DTT (0.1 M), 1 μL of RNase inhibitor (40 U/μL) and 0.6 μL of superscript III reverse transcriptase (200 U/μL) (Invitrogen, Carlsbad, CA, USA) were added and incubated at 50 °C for 55 min and 70 °C for 15 min. The cDNA samples were stored at −20 °C. The qPCR was performed using the SYBR Premix Ex Taq kit (Takara, Dalian, China) on a CFX96 Real-Time PCR detection system (Bio-Rad, USA). The primers used are given in Table 1. Reactions were carried out in a 25 μL volume containing 12.5 μL of 2× SYBR Green PCR Master Mix. The thermal profile for the qPCR was 95 °C for 3 min followed by 40 cycles of 95 °C for 20s, 60 °C for 30 s and 70 °C for 30 s. Data were normalized to the geometric mean of data from bovine GAPDH and

Table 1 Primers used for BSP and qPCR analyses. Gene

Primer sequences (5′-3′)

Accession no.

Annealing (°C)

Product size (bp)

IGF2-DMR

F: TAATATGATATTTGGAAGTAGT R: ACATTTTTAAAAATATTATTCT F: TCTGTGCGGCGGGGAGCTGGT R: AGTCTCCAGCAGGGCCAGGTCG F: CGACTTCAACAGCGACACTCAC R: CCCTGTTGCTGTAGCCAAATTC F: GTCATCACCATCGGCAATGAG R: AATGCCGCAGGATTCCATG

EU518675.1

50.4

420

EU518675.1

60.0

154

NM_001034034

60.0

118

BT030480.1

60.0

84

IGF2-qPCR GAPDH-qPCR ACTB-qPCR F: forward primer; R: reverse primer.

358

Y.-Z. Huang et al. / Gene 534 (2014) 356–361

ACTB was used as endogenous control genes. Relative expression levels of objective mRNAs were calculated using the ΔΔCt method (Livak and Schmitteg, 2001).

by one-way ANOVA using the SPSS software (version 16). Differences were considered to be statistically significant at P b 0.05 or P b 0.01. 3. Results

2.4. DNA preparation and sodium bisulphite treatment 3.1. Expression profile Genomic DNA was extracted following the standard procedures using TIANamp Genomic DNA Kit (Tiangen, Beijing, China). DNA treatment with sodium bisulphite was performed using the EZ DNA Methylation Kit (Zymo Research, USA) according to the manufacturer’s protocol, except that the conversion temperature was changed to 55 °C. The modified DNA samples were diluted in 10 μL of distilled water and should be immediately used in BSP or stored at −80 °C until PCR amplification. Three separate bisulphite modification treatments were performed for each DNA sample. 2.5. Bisulphite sequencing polymerase chain reaction (BSP) The BSP primers were designed by the online MethPrimer software (Li and Dahiya, 2002). The sequences of the PCR primers used for amplifying the targeted products are shown in Table 1. The details of BSP amplified nucleotide sequences of IGF2 DMR are shown in Fig. 3. We used hot start DNA polymerase (Zymo Taq Premix, Zymo Research, USA) for BSP. PCR was performed in 50μL of reaction volume, containing 200 ng/50 μL genomic DNA, 0.3–1 μM of each primer, and Zymo Taq Premix 25 μL. The PCR was performed with a DNA Engine Thermal Cycler (Bio-Rad, USA) using the following program: 10 min at 95 °C, followed by 45 cycles of denaturation for 30 s at 94 °C, annealing for 40 s at 50.4 °C and extension for 30 s at 72 °C, with a final extension at 72°C for 7min. The PCR products were gel purified using Gel Purification Kit (Sangon, Shanghai, China). The purified fragments were subcloned into the pGEM T-easy vector (Promega, Madison, WI, USA). Different positive clones for each subject were randomly selected for sequencing (Sangon, Shanghai, China). Three independent amplification experiments were performed for IGF2 gene in each sample. We sequenced 6 clones from each independent set of amplification and cloning; hence, there were 18 clones for the IGF2 DMR in each sample. The final sequence results were processed by online QUMA software (Kumaki et al., 2008). 2.6. Combined bisulphite restriction analysis (COBRA) The COBRA technique is a variation of bisulfite sequencing and combines bisulfite conversion based polymerase chain reaction with restriction digestion. The surplus of gel purified PCR products also used for BSP analysis from the three repeats were mixed together and then digested with restriction enzyme Taq I (TaKaRa, Dalian, China) for the 20th CpG site of the IGF2 DMR. The digested fragments were electrophoresed on 3% agarose gel. During sodium bisulfite treatment, unmethylated cytosine residues were converted to thymine, whereas methylated cytosine residues were retained as cytosine. The PCR products hold a natural Taq I endonuclease restriction site (T^CGA), when the CpG dinucleotides are methylated; otherwise, the site cannot be digested if one or more CpG dinucleotides within its recognition sequence were un-methylated. Therefore, in the mixed population of resulting PCR fragments, the ratio of band intensity of digested fraction to the combined intensities of both digested and undigested fractions reflected the levels of DNA methylation on the restriction sites.

To detect the tissue distribution of bovine IGF2 mRNA, the qPCR was carried out with cDNA from six cattle tissues (LDM, heart, liver, spleen, lungs, and kidney). The relative expression levels of the IGF2 gene in six tissues from fetal bovine and adult bovine are shown in Fig. 1. The result of qPCR analysis showed that IGF2 has a broad tissue distribution in all examined tissues from each stage. The results indicate that the expression levels of IGF2 were significantly down-regulated in the muscle (P b 0.01), heart (P b 0.01), lung (P b 0.05), and spleen (P b 0.01) tissues during the two developmental stages. In adult animals, the expression of IGF2 in liver and kidney was high as compared to other tissues. However, the expression levels did not significantly decrease in liver (P = 0.166) and kidney (P = 0.862) during the two different stages. The expression profile of the IGF2 gene in all tested bovine tissues and organs suggests that the bovine IGF2 gene may be more relevant to the highly conserved biological process in mammalians. Therefore, further study to discover their regulatory functions is needed. 3.2. DNA methylation analysis by BSP The CpG islands located in the intragenic IGF2 DMR were predicted using online software and amplified by PCR. The identities of all amplified PCR products were verified by sequencing. The methylation patterns of the CpG islands were determined using bisulfite-assisted sequencing. The DNA methylation pattern of the intragenic IGF2 DMR in the bovine six tissues (muscle, heart, liver, spleen, lung and kidney) analysed by BSP is shown in Fig. 2. There were 28 CpG sites (Fig. 3) that were identified in all of the clones. On the basis of the methylation pattern of each of the clones, we found that at least 10 alleles were different for each bovine group. Methylation data from BSP sequencing were analysed by computing the percentage of methylated CpGs of the total number of CpGs using QUMA software. BSP amplified sequences of DMR (420 bp) have 28 CpGs, and we sequenced 18 clones in each sample. Hence, there was the total 504 CpGs of IGF2 DMR in muscle of FB group, and the percentage of methylated CpGs is 395/504 = 78.4%. The DNA methylation levels have not changed much among different tissues from the control group FB animals, suggesting that

2.7. Statistical analysis We calculated the total percentage of methylated CpGs in each group by the QUMA software and compared the methylation pattern among two groups. Data are expressed as mean ± standard error (mean ± SE) from two independent experiments. The levels of gene expression and DNA methylation among the three groups were tested

Fig. 1. Expression pattern of the IGF2 gene was analyzed in six bovine tissues. IGF2 mRNA expression was normalized to the geometric mean of the two suitable housekeeping genes (GAPDH and ACTB) and expressed relative to gene expression in the fetal bovine group. Error bars represent standard error of the mean (SEM). Each column values represent the means ± SEM of three replicates.

Y.-Z. Huang et al. / Gene 534 (2014) 356–361

359

Fig. 2. DNA methylation patterns of six tissues and organs in the fetal bovine (FB) group and adult bovine (AB) group analyzed by BSP. Each line represents one individual bacterial clone, and each circle one single CpG dinucleotide. Open circles show unmethylated CpGs and black circles methylated CpGs. The black arrows show the 20th CpG site by COBRA analyses. (A) Muscle. (B) Heart. (C) Liver. (D) Lung. (E) Spleen. (F) Kidney.

DNA methylation is maintained at approximately steady levels in the fetal bovine, which indicated that the DNA methylation level values were 78.4 ± 5.31%, 75.6 ± 6.82%, 72.8 ± 6.47%, 76.4 ± 5.73%, 79.4 ± 6.21% and 80.2 ± 6.33% for muscle, heart, liver, spleen, lung and kidney, respectively. Statistical results showed that the 24-monthold adult bovine group animals had significantly higher DNA methylation levels in muscle (P b 0.01), heart (P b 0.01), lung (P b 0.01), and spleen (P b 0.05) than the day 90 bovine embryos fetal bovine group animals. The DNA methylation levels of intragenic IGF2 DMR showed no significant difference in liver (P = 0.180) and kidney (P = 0.155) between fetal bovine group and adult bovine group, respectively.

3.3. DNA methylation analysis by COBRA To validate that the BSP sequencing results reflect the overall methylation status, we further performed COBRA analysis using restriction enzymes Taq I for intragenic IGF2 DMR (total 28 CpG sites, Fig. 3) on the same bisulphite-treated PCR amplification products that were used for BSP sequencing. During the sodium bisulphite treatment, unmethylated cytosine residues were converted to thymine, whereas methylated cytosine residues were retained as cytosine. The restriction sites “TCGA” for Taq I (20th CpG site) will be cleaved when all CpG dinucleotides within its recognition sequence are methylated (Fig. 3); otherwise, the site will be retained if one or

Fig. 3. BS-PCR amplified nucleotide sequences of IGF2 DMR. Nucleotide sequences for a 420 bp IGF2 DMR (total 28 CpG site) fragment (upper strands) and its bisulfite-converted version (lower strands). Primer sequences are underlined. Squared nucleotides (CpG sites) contain Taq I (“TCGA”) (20th CpG site) restriction sites for COBRA analyses.

360

Y.-Z. Huang et al. / Gene 534 (2014) 356–361

Fig. 4. DNA methylation patterns of six tissues and organs in the fetal bovine (AB, n = 4) and adult bovine (FB, n = 4) analyzed by COBRA. Gel = 3% agarose gel electrophoretic patterns. M = DNA molecular weight marker is marker I (600, 500, 400, 300, 200, and 100 bp). Lanes A1 and A2, FB muscle; lanes A3 and A4, AB muscle; lanes B1 and B2, FB heart; lanes B3 and B4, AB heart; lanes C1 and C2, FB liver; lanes C3 and C4, AB liver; lanes D1 and D2, FB lung; lanes D3 and D4, AB lung; lanes E1 and E2, FB spleen; lanes E3 and E4, AB spleen; lanes F1 and F2, FB kidney; lanes F3 and F4, AB kidney.

more CpG dinucleotides within its recognition sequence are unmethylated. Therefore, in the mixed population of resulting PCR fragments, the fraction that has a cleaved or retained restriction site reflects the percentage DNA methylation in the original genomic DNA. BSP amplified nucleotide sequences and a cleavage CpG site of intragenic IGF2 DMR is shown in Fig. 4. At the 20th CpG site, digestion of the 420 bp PCR fragment of IGF2 DMR with Taq I resulted in fragment lengths of 420, 249 and 171 bp band for the D4 (adult bovine lung), E12 (fetal bovine spleen) and F3 (adult bovine kidney) by COBRA, indicating that the methylation levels of the 20th CpG site in the restriction site in those samples are approximately 50% (Fig. 4). The results were consistent with the BSP sequencing results, which confirm that the BSP sequencing results are reliable. 4. Discussion In the past several years, currently epigenetics is partly overlooked in livestock production. However, a great deal of research has been done on, for example, quantitative and molecular genetics; in contrast, very little has been done in the field of epigenetics (Cooney et al., 2002; de Koning, 2001). DNA methylation has been popularly investigated due to its heritable epigenetic modifications of the genome and has been implicated in the regulation of most cellular processes. It has a large impact on the regulation of gene expression and is critical in establishing patterns of gene repression during development (Cedar and Bergman, 2009). DNA methylations of IGF2 DMRs not only vary in different tissues but are also extensively changed during the perinatal period in normal mouse tissues (Weber et al., 2001). In the present study, we examined the mRNA expression and DNA methylation levels of imprinted gene IGF2 in two key stages of myogenesis and muscle maturation to determine whether epigenetic modification of imprinted genes was responsible for fetal and adult growth and development. The relative gene expression levels of six tissues between fetal bovine and adult bovine, whereas the adult bovine group exhibited a significantly lower mRNA level compared to controls

(FB group). However, the adult bovine group exhibited a significantly higher DNA methylation level than the fetal bovine group. DNA methylation plays an important role in the regulation of gene expression, and the proper DNA methylation is essential for normal gene function (Jones and Takai, 2001; Morgan et al., 2005). DNA methylation regulates gene expression at two levels: transcriptional gene silencing (TGS) and posttranscriptional gene silencing (PTGS). The TGS involves the inhibition of transcription and is associated with the hyper-methylation of promoter sequences. The PTGS mechanism does not affect the rate of transcription but rather is involved in the post-transcriptional degradation, and is associated with the hyper-methylation of transcribed or coding sequences (Paszkowski and Whitham, 2001). On the other hand, it is reported that epigenetic status can be influenced by environmental factors (Jaenisch and Bird, 2003). In our study, we found that DNA methylation was higher in adult bovine group than in the fetal bovine group, and we speculate that variations of DNA methylation patterns after birth are sensitive to environmental factors. Epigenetic modifications are heritable changes in gene expression not encoded by the DNA sequence. The epigenome is a dynamic entity influenced by predetermined genetic programs or external environmental cues (Down et al., 2008). It has been commonly accepted that both epigenetic mechanisms, DNA methylation modification at the gene’s promoter regions (5′ of the gene) and microRNA (miRNA) regulation at the 3′ untranslated regions (3’-UTRs), are important in gene expression regulation (Su et al., 2011). In addition, transcription factors also participate in the regulation of gene expression. These results suggest that DNA methylation may cooperate with other factors to regulate gene expression. Interactions among these factors may counteract the negative effect of one or more of them. In addition, there is a noticeable tendency for the low DNA methylation to elevate the gene expression and more data are required to reveal the exact influence of this tendency. The extent of DNA methylation and gene expression in the genome as a whole and the status of other epigenetic modifications are still

Y.-Z. Huang et al. / Gene 534 (2014) 356–361

unknown in fetal bovine and adult bovine. Therefore, additional studies are needed to elucidate the significance of these unknown epigenetic variations in the development of fetal and adult cattle. 5. Conclusions This study is the first to report changes in the methylation and expression patterns of the intragenic IGF2 DMR in six tissues between fetal and adult bovine at two-tail samples of Chinese Qincuan beef cattle breed with different growth performance. The 24-month-old adult bovine group exhibited a significantly lower mRNA level and higher DNA methylation level than the 90 days at embryo fetal bovine group, and this characteristic may be useful as a molecular marker for muscle developmental in cattle and as a model for studies in other species, potentially contributing to an improvement of marker-assisted selection in beef cattle breeding program. Competing interests The authors have declared that no competing interests exist. Acknowledgements This study was supported by the National 863 Program of China (grant no. 2013AA102505), National Natural Science Foundation of China (grant no. 31272408), Agricultural Science and Technology Innovation Projects of Shaanxi Province (grant no. 2012NKC01-13), and Program of National Beef Cattle and Yak Industrial Technology System (grant no. CARS-38). References Bird, A., 2002. DNA methylation patterns and epigenetic memory. Genes Dev. 16, 6–21. Casas, E., Shackelford, S.D., Keele, J.W., Koohmaraie, M., Smith, T.P., Stone, R.T., 2003. Detection of quantitative trait loci for growth and carcass composition in cattle. J. Anim. Sci. 81, 2976–2983. Cedar, H., Bergman, Y., 2009. Linking DNA methylation and histone modification: patterns and paradigms. Nat. Rev. Genet. 10 (5), 295–304. Chao, W., D’Amore, P.A., 2008. IGF2: epigenetic regulation and role in development and disease. Cytokine Growth Factor Rev. 19, 111–120. Chuang, J.C., Jones, P.A., 2007. Epigenetics and MicroRNAs. Pediatr. Res. 61 (5 Pt 2), 24R–29R. Constancia, M., et al., 2000. Deletion of a silencer element in Igf2 results in loss of imprinting independent of H19. Nat. Genet. 26 (2), 203–206. Cooney, A.C., Apurva, A.D., Wolff, L.G., 2002. Maternal methyl supplements in mice affect epigenetic variation and DNA methylation of offspring. J. Nutr. 132, 2393S–2400S. Cui, H., et al., 2002. Loss of imprinting in colorectal cancer linked to hypomethylation of H19 and IGF2. Cancer Res. 62 (22), 6442–6446. Curchoe, C., et al., 2005. Promoter-specific expression of the imprinted IGF2 gene in cattle (Bos taurus). Biol. Reprod. 73, 1275–1281. De Koning, D.J., 2001. Identification of (non-) Mendelian factors affecting pork production. (Doctoral thesis) Animal Breeding and Genetics Group, Department of Animal Sciences, Wageningen University. Dindot, S.V., Kent, K.C., Evers, B., Loskutoff, N., Womack, J., Piedrahita, J.A., 2004. Conservation of genomic imprinting at the XIST, IGF2, and GTL2 loci in the bovine. Mamm. Genome 15, 966–974.

361

Down, T.A., et al., 2008. A Bayesian deconvolution strategy for immunoprecipitationbased DNA methylome analysis. Nat. Biotechnol. 26 (7), 779–785. Egger, G., Liang, G., Aparicio, A., Jones, P.A., 2004. Epigenetics in human disease and prospects for epigenetic therapy. Nature 429, 457–463. Feil, R., Walter, J., Allen, N.D., Reik, W., 1994. Developmental control of allelic methylation in the imprinted mouse IGF2 and H19 genes. Development 120, 2933–2943. Gebert, C., et al., 2006. The bovine IGF2 gene is differentially methylated in oocyte and sperm DNA. Genomics 88, 222–229. Giannoukakis, N., Deal, C., Paquette, J., Goodyer, C.G., Polychronakos, C., 1993. Parental genomic imprinting of the human IGF2 gene. Nat. Genet. 4, 98–101. Han, D.W., et al., 2008. Methylation status of putative differentially methylated regions of porcine IGF2 and H19. Mol. Reprod. Dev. 75, 777–784. Jaenisch, R., Bird, A., 2003. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat. Genet. 33, 245–254 (Suppl.). Jones, P.A., Baylin, S.B., 2002. The fundamental role of epigenetic events in cancer. Nat. Rev. Genet. 3, 415–428. Jones, P.A., Takai, D., 2001. The role of DNA methylation in mammalian epigenetics. Science 293, 1068–1070. Killian, J.K., et al., 2001. Monotreme IGF2 expression and ancestral origin of genomic imprinting. J. Exp. Zool. 291, 205–212. Kumaki, Y., et al., 2008. QUMA: quantification tool for methylation analysis. Nucleic Acids Res. 36, W170–W175. Li, L.C., Dahiya, R., 2002. MethPrimer: designing primers for methylation PCRs. Bioinformatics 18, 1427–1431. Li, Q., et al., 2011. Genome-wide mapping of DNA methylation in chicken. PLoS One 6 (5), e19428. Li, M., et al., 2012. An atlas of DNA methylomes in porcine adipose and muscle tissues. Nat. Commun. 3, 850. Lippman, Z., et al., 2004. Role of transposable elements in heterochromatin and epigenetic control. Nature 430 (6998), 471–476. Livak, K.J., Schmitteg, T.D., 2001. Analysis of relative gene expression data using quantitative real-time PCR and the 2[−delta delta c(t)] method. Methods 25, 402–408. Moore, T., et al., 1997. Multiple imprinted sense and antisense transcripts, differential methylation and tandem repeats in a putative imprinting control region upstream of mouse Igf2. Proc. Natl. Acad. Sci. U. S. A. 94 (23), 12509–12514. Morgan, H.D., Santos, F., Green, K., Dean, W., Reik, W., 2005. Epigenetic reprogramming in mammals. Hum. Mol. Genet. 14 (Spec No 1), R47–R58. Murrell, A., et al., 2001. An intragenic methylated region in the imprinted IGF2 gene augments transcription. EMBO Rep. 2, 1101–1106. Murrell, A., Heeson, S., Reik, W., 2004. Interaction between differentially methylated regions partitions the imprinted genes IGF2 and H19 into parent-specific chromatin loops. Nat. Genet. 36, 889–893. Paszkowski, J., Whitham, S., 2001. Gene silencing and DNA methylation processes. Curr. Opin. Plant Biol. 4, 123–129. Plass, C., Soloway, P.D., 2002. DNA methylation, imprinting and cancer. Eur. J. Hum. Genet. 10, 6–16. Rhee, I., et al., 2002. DNMT1 and DNMT3b cooperate to silence genes in human cancer cells. Nature 416 (6880), 552–556. Richardson, C., et al., 1990. Estimation of the developmental age of the bovine fetus and newborn calf. Vet. Rec. 126, 279–284. Schulman, N.F., Vitala, M.S., Koning, J.D., Virta, J., Maki-Tanila, A., Vilkki, J.H., 2004. Quantitative trait loci for health in Finnish Ayrshire cattle. J. Dairy Sci. 87, 443–449. Su, Z., Xia, J., Zhao, Z., 2011. Functional complementation between transcriptional methylation regulation and posttranscriptional microRNA regulation in the human genome. BMC Genomics 12 (Suppl. 5), S15. Sullivan, M.J., et al., 1999. Relaxation of IGF2 imprinting in Wilms tumours associated with specific changes in IGF2 methylation. Oncogene 18 (52), 7527–7534. Takai, D., Jones, P.A., 2002. Comprehensive analysis of CpG islands in human chromosomes 21 and 22. Proc. Natl. Acad. Sci. U. S. A. 99, 3740–3745. Weber, M., et al., 2001. Extensive tissue-specific variation of allelic methylation in the Igf2 gene during mouse fetal development: relation to expression and imprinting. Mech. Dev. 101, 133–141. Zhang, S., et al., 2004. Genomic imprinting of H19 in naturally reproduced and cloned cattle. Biol. Reprod. 71, 1540–1544.