Intragenic modification of maize

Journal of Biotechnology 238 (2016) 35–41

Contents lists available at ScienceDirect

Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec

Intragenic modification of maize Erika V. Almeraya., Estela Sánchez-de-Jiménez. ∗ Department of Biochemistry, Chemistry Faculty, UNAM, Mexico

a r t i c l e

i n f o

Article history: Received 18 May 2016 Received in revised form 18 August 2016 Accepted 14 September 2016 Available online 15 September 2016 Keywords: Intragenic Cisgenic Maize Crop improvement Transgenic

a b s t r a c t The discovery of plant DNA recombination techniques triggered the development of a wide range of genetically modified crops. The transgenics were the first generation of modified plants; however, these crops were quickly questioned due to the artificial combination of DNA between different species. As a result, the second generation of modified plants known as cisgenic and/or intragenic crops arose as an alternative to genetic plant engineering. Cisgenic and/or intragenic crops development establishes the combination of DNA from the plant itself or related species avoiding the introduction of foreign genetic material, such as selection markers and/or reporter genes. Nowadays it has been made successful cisgenic and/or intragenic modifications in crops such as potato and apple. The present study shows the possibility of reaching similar approach in corn plants. This research was focused on achieve intragenic overexpression of the maize Rubisco activase (Rca) protein. The results were compared with changes in the expression of the same protein, in maize plants grown after 23 cycles of conventional selection and open field planting. Experimental evidence shows that maize intragenic modification is possible for increasing specific gene expression, preserving plant genome free of foreign DNA and achieving further significant savings in time and man labor for crop improvement. © 2016 Elsevier B.V. All rights reserved.

1. Introduction Genetic engineering induced the development of many transgenic crop plants; however, this originally promising method for crop improvement has been controversial since transgenic plants contain nucleotide sequences from species that are sexually incompatible in nature (Ryffel, 2014). The widespread application of transgenic techniques in comestible plants raised public concerns mainly about health safety (Domingo, 2016; Kamthan et al., 2016), although there is no scientific evidence that genetically modified crops harm human health (Fahlgren et al., 2016). Nevertheless, its use continues to be a topic of debate due to questions concerning intellectual property and biosafety issues involved in open field planting (Lucht, 2015; Ryffel, 2014; Yaqoob et al., 2016). To surmount these deficiencies, another generation of Genetically Modified Organisms (GMO) is being developed, known as cisgenic and/or intragenic crops. This methodology, in contrast to transgenics, only allow combinations of DNA sequences originated from the original plant and/or naturally compatible species (Ricroch and Hénard-Damave, 2015; Rommens, 2004; Schouten et al., 2006).

∗ Corresponding author at: Departamento de Bioquímica, Facultad de Química, Universidad Nacional Autónoma de México, Ciudad Universitaria, 04510, Mexico. E-mail address: [email protected] (E. Sánchez-de-Jiménez.). http://dx.doi.org/10.1016/j.jbiotec.2016.09.009 0168-1656/© 2016 Elsevier B.V. All rights reserved.

The term cisgenesis initially specified the use of entire genes, i.e. regulatory and coding regions in a sense orientation. Later, the intragenesis concept was used to describe the combination of genes or intergenic fragments from the same or related plants. However, although each of these terms establishes different specifications, both plant breeding approaches share the principle of transgenes absence in the improved final product (Espinoza et al., 2013; Schouten and Jacobsen, 2008; Singh et al., 2015). Most cisgenic and/or intragenic plants described so far have been obtained using Agrobacterium plasmid to transfer the desired unit of DNA cloned on the T-DNA or P-DNA region, -a variation of T-DNA made exclusively from plant DNA- (Rommens et al., 2005). However, besides the desired sequence, small DNA fragments of the plasmid backbone can be detected in some lines of the improved plants, therefore these plants are considered nottruly cisgenic (Vanblaere et al., 2014). In other cases, cisgenic and/or intragenic plant production has been achieved by bombarding two linear DNA sequences, one with the desired gene and another with a marker gene from a non-plant organism to allow the recovery of successful DNA transfer events. Later, the descendants that inherited only the desired gene are selected through guided segregation (Romano et al., 2003; Yao et al., 2006). This strategy is successful in crop plants with short propagation life cycles. In the case of maize, this method would require a longer time and depends on the use of a previously established in vitro propagation system

36

E.V. Almeraya., E. Sánchez-de-Jiménez. / Journal of Biotechnology 238 (2016) 35–41

(Holme et al., 2013). There have been few DNA transformation studies in tropical maize lines (Assem, 2015), which means that maize experimentation is limited to a few model maize lines that are not used worldwide. However, our research group has established the proliferation and regeneration of maize embryonic calli from the ˜ race, Costeno ˜ variety (Garrocho-Villegas et al., 2012). This Tuxpeno ˜ race is important because many maize varieties from the Tuxpeno have been adapted to grow in different countries. In this research, the intragenic model was adapted in order to modify specific protein expression in maize plants. We look forward for to the transgene absence principle, not only in the final product, but also even during the transformation process. In this study, regulatory sequences originated from the maize genome were used to achieve maize Rubisco activase (Rca) protein overexpression. Rca is a protein expressed in the chloroplast that determines the rate of atmospheric CO2 fixation in the plant (Hazra et al., 2015). Rca kinetics have been documented in different studies, so Rca has become the focus of researchers aiming to improve plant photosynthetic capacity to increase yield as well as plant adaptation to harsh climatic conditions (Kurek et al., 2007; Sage et al., 2008; Salvucci et al., 2006; Thieulin-Pardo et al., 2015; von Caemmerer et al., 2005; Yamori et al., 2012). Previous phenotypic and molecular analysis in a maize population monitored for 23 cycles of conventional open field seeding, showed Rca expression changes during this period. In those studies, Rca content was analyzed in the original crop Z0 and in the cultivars obtained through agronomic selection cycles aimed to produce greater yield: Z5 , Z10 , Z15 , Z20 y Z23 . Rca exhibited four-fold higher expression in Z23 with respect to Z0 (Morales et al., 1999). In this context, the efforts of the present research were oriented towards the molecular characterization of intragenic Rca overexpression changes in maize, in order to examine whether the increment response is comparable with the Rca expression levels reached after conventional selection and culture of maize plants.

cloning and purification. Those sites were set between the extremes of the three sequences. The cassette was synthesized and subcloned using GenScript USA (Piscataway, NJ, USA) in the puc 57 plasmid (5530 bp, PM = 3,594,500 g/mol). This plasmid was replicated in E. coli cells. The intragenic cassette was isolated from the puc 57 plasmid prior to bombardment (1 ␮g/␮l) using digestion reactions with PstI and DraI to eliminate the plasmid fractions that are not required for the plant.

2.3. Corn transformation with intragenic construct Maize embryogenic calli were twice bombarded using particle preparation and standard biolistic process (Sanford et al., 1993) with an effective delivery of 0.8 ␮g of the intragenic construct precipitated on 0.5 mg tungsten particles (0.4 ␮m diameter) per shot. The composition of all media culture were made according to previously described by Garrocho-Villegas et al. (2012). For each assay, 0.3 g calli were placed in the center of each one of 10 Petri dishes of N6 P medium solidified with 3.5 g/L gelrite. As control, the same quantity of calli was treated with only tungsten particles. After 24 h of bombardment, the calli were transferred to N6 P medium with 2.5 g/L gelrite. They were maintained at room temperature in the dark for one week. The calli were subsequently transferred 3 times, every 15 to 20 days, to a fresh N6 P medium. Plant regeneration occurred throughout another 3 subcultures diminishing the auxin concentration in the N6 P medium (50%, 25% and 0%, respectively) without adding a selection agent. The resultant plants were maintained in MS medium enriched with 1 mg/L of indole butyric acid to aid the rooting process. At this stage, subcultures were generated every 25 to 35 days in glass bottles. Finally, when plants developed approximately 7 cm of primary root, they were planted in organic substrate (Sunshine No 3) in 1 L pots. They were covered with transparent plastic and kept in the greenhouse at 25–35 ◦ C with 12-h light/dark photoperiods. The plastic covers were gradually perforated until they were removed completely.

2. Materials and methods 2.4. Identification of intragenic corn plants 2.1. Plant material To obtain intragenic Rca-overexpressing plants, immature ˜ corn embryos of the Costeno ˜ variety were used to generate Tuxpeno calli culture (Garrocho-Villegas et al., 2012). As controls, unmodified plants of the same type of corn were used. This material was provided by the Instituto Forestal de Investigaciones Agropecuarias, Zacatepec, México and in vitro cultivated in the Plant Tissue Culture Lab from Faculty of Chemistry, UNAM. Maize plants with increased Rca expression obtained through traditional agronomic selection were obtained by planting seeds ˜ corn, Zacatecas 58 variety, from the Z0 and Z23 of Cónico Norteno cultivars. The seeds were kindly provided by Dr. José Molina Galán from the Colegio de Postgraduados, Montecillo, Estado de México (Morales et al., 1999). 2.2. Intragenic construction Intragenic construction (Fig. 1) generated a linear cassette of 2827 bp composed of the promoter sequence (969 bp) of the small subunit Rubisco (Rco) enzyme encoded by ZmRBSC-m3 in maize, followed by the ZmRca gene coding sequence, with its own peptide signal for chloroplast entry (1302 bp) (access number AAG22094.3) (Ayala-Ochoa et al., 2004) and the terminator sequence (488 bp) from the same source as the promoter (Schäffner and Sheen, 1991; Viret et al., 1994). In addition, the intragenic cassette contained 68 bp that correspond to restriction enzyme sites to facilitate

The intragenic plants were identified through end-point PCR using Taq polymerase Kapa 3G, with oligonucleotide Pairs 1 and 2 designed to detect the overexpression cassette at two different union fragments. Table 1 describes the oligonucleotides used. The results were visualized in agarose gels. The 18 S gene was used as an internal control.

2.5. Analysis of Rca expression During the flowering stage, 1 cm2 samples were harvested from the leaves immediately above the ear from the identified intragenic plants and their controls, as well as from plants of the Z0 and Z23 cultivars. The Rca mRNA was quantified using real-time RT-PCR with TRR oligos (Table 1). Total RNA was isolated by Quick–RNA MiniPrep (Zymmo Research) with DNase. Starting with 1 ␮g of RNA, cDNA was synthesized with dT oligos (Thermo Scientific Maxima H Minus First Strand), quantified with NanoDrop 2000 Thermo Scientific, and the real-time PCR reaction was performed with SYBR GreenER qPCR SuperMix Universal Life Sciences according to manufacturer instructions. The Rca mRNA expression was normalized with respect to the reference high mobility group gene (Hmg), access number AJ131373. The data were analyzed statistically using t Student’s test for independent samples (p = 0.05). The Rca protein amount was analyzed by triplicate using Western blots (Agrisera antibody, product code: AS10 700), according to Yamori and von (2011). Gels of total protein extracts were analyzed

E.V. Almeraya., E. Sánchez-de-Jiménez. / Journal of Biotechnology 238 (2016) 35–41

37

Fig. 1. Diagram of the intragenic cassette used to overexpress maize Rca in corn plants. a) PstI cut sites used to isolate the intragenic cassette are shown. b) Oligonucleotides used to identify intragenic plants. The oligos were designed to amplify the chimeric union of sequences that make up the cassette: Rubisco (Rco) promoter and terminator joined to Rubisco activase (Rca) coding region.

Table 1 List of oligonucleotides used. Oligos

Amplicon (bp)

Sequence

Location





Par 1

1302

Fw 5 - GAACTTCATGACCCTCCCAAACATC -3 Rv 5 - CACGGTGTCGTCGTATAGTATTAGTC -3

Rca-coding Region Rubisco Terminator

Par 2

1662

Fw 5 - GTAAGCTTGAGCTCCCTTTAATCTGG -3 Rv: 5 - CGTTGATGAAGAGGCAGGACATCTT -3

Rubisco Promoter Rca-coding Region

18S

180

Fw 5 - GGAAACTTACCAGGTCCAGACATAG -3 Rv 5 - GTGGCCTAAACGGCCATAGTCCCTC -3

18S gene-coding Region

TRR

201

Fw 5 - GATGAACATCGCCGACAACC -3 Rv 5 - CGGAAGATGCCCTTGCAGA -3

Rca-coding region

Hmg

79

Fw 5 -TTGGACTAGAAATCTCGTGCTGA -3 Rv 5 - GCTACATAGGGAGCCTTGTCCT-3

Hmg gene-coding Region

CIS

227

Fw 5 - GTGTGGGGGAGCCTACTACA-3 Rv 5 - TGTTGCTGCTGGAACTTTTG -3

Rubisco Promoter Rca-coding Region

using relative densitometry (densitometry units/area) with respect to control plants (Bio Rad Image Lab Software).

Table 2 Summary of the biolistic test carried out to obtain intragenic Rca-overexpressing plants. 173 days after bombardment.

2.6. Rca copy number determination

Particle bombarded

Initial mass of callus (g)

Seedlings regenerated

Plants with inserted cassette

Genomic DNA was extracted from every identified intragenic plant and their controls, as well as plants from Z0 and Z23 cultivars. The integration times of Rca coding region in each plant was determined using real-time RT-PCR with SYBR GreenER (Life Sciences) and TRR oligos (Table 1). Additionally, CIS oligonucleotides were used to identify the chimeric union of the Rco promoter – Rca gene inserted in the DNA from intragenic plants. Each RT-PCR was performed in triplicate. Standard curves were generated with 1000 pg, 10 pg, 0.1 pg and 0.001 pg of the puc 57 plasmid to estimate the amount of amplified sequence present in the corresponding plant genome. We consider 2.4 Gb as the size of maize DNA (http:// www.gramene.org/) and an average molecular weight of base pair: 650 Da, to obtain the gene copy number per plant. The results were normalized to the Hmg gene. The oligonucleotides pairs were validated through disassociation and efficiency curves.

Intragenic cassette H2 O (negative control)

3 3

164 87 **

5 0

3. Results and discussion 3.1. Identification of Rca-overexpressing intragenic plants To obtain Rca-overexpressing intragenic maize, a biolistic process was used to transfer the intragenic cassette directly. Because

**

Less number plant recovered because of space limitations.

the purpose of generating the intragenic plants was to maintain maize DNA integrity, -referred as the absence of foreign DNA integrations-, the entire transformation process was performed without chemical selection agents. Table 2 shows the number of regenerated seedlings after 173 days from bombardment. The results indicates that it is possible to obtain marker gene free corn plants using an intragenic approach. DNA of maize leaves obtained after the regeneration and acclimatization process was analyzed to identify intragenic plants through amplification of the Rca chimeric unions with the promoter and/or terminator of the Rubisco enzyme in the intragenic construct. Fig. 1 describes the oligonucleotides used. During this stage, 5 intragenic plants were identified out of a total of 164 regenerated plants; this indicate 3% of the transformation events were satisfactorily recovered (Fig. 2). This efficiency is comparable to a previous report in which a similar marker-free strategy was applied to potato explants transformed by Agrobacterium (de Vetten et al., 2003).

38

E.V. Almeraya., E. Sánchez-de-Jiménez. / Journal of Biotechnology 238 (2016) 35–41

Fig. 2. Identification of intragenic plants. Plants 1, 2, 4, 5, and 9 were identified as intragenic plants. Positive controls: amplification using the puc57-Rca plasmid as template and 18 S gene amplification. Negative control: amplification reactions with untransformed plants (wo/t) and reactions without template (NTC).

Fig. 4. Immunodetection of Rubisco activase in total protein extracts during filling stage of grain. a) Western blot with total protein extracts in overexpressing intragenic plants 1, 2, 4, 5, and 9 compared to non-transformed control plants from the ˜ b) Analysis of the cultivars obtained through agronomic same genotype (Tuxpeno). selection Z0 and Z23 cultivars compared with each other. c) Densitometry analysis of Rca content in 5 ␮g of total protein per plant.

Fig. 3. Analysis of mRNA Rca expression. Relative mRNA Rca content on intragenic plants with respect to controls and in plants obtained through classic agronomic improvement, Z23 , with respect to the Z0 starting cultivar.

In addition, a second transformation experiment that identified 10 intragenic plants was completed, indicating that the process is reproducible. This provides more biological material in order to evaluate the Rca overexpression effect at agronomic level (Unpublished work). 3.2. Rca expression in intragenic and agronomically modified plants The maize plants with confirmation of the intragenic cassette insertion and controls, as well as those planted with seeds from both Z0 and Z23 cultivars, were analyzed to determine the specific Rca mRNA and protein expression. Fig. 3 shows the mRNA analysis. It was found that quantity of Rca mRNA varies among the intragenic plants. Plant 1 expressed 200% more mRNA than the control plants, while plants 5 and 9 expressed only about 25% more RNA. Plants 2 and 4 did not show differences on the Rca mRNA accumulation when compared to controls. Meanwhile, Z23 plants that underwent classical agronomic procedure had approximately 5 times more accumulation of Rca mRNA than Z0 plants. The results show that the maize selection system used

to obtain a higher grain yield (Morales et al., 1999), also led to the selection of corn modified for greater expression or accumulation of Rubisco activase mRNA. Although plants 1, 5 and 9 showed increases in their mRNA content, the protein analysis showed that only plant 5 effectively increased its expression of Rca protein (Fig. 4). Consistent with this analysis, the intragenic line 5 accumulated 50% more Rca protein content than the control plants. While agriculturally improved cultivar Z23 , increased its Rca expression by 200% when compared to Z0 . Although not of the same magnitude, these results demonstrated that intragenic plants overexpressed Rca, just as Z23 plants exceeded the Rca content of their respective Z0 control plants. In general, the analysis of Rca expression showed that plants generated after 23 cycles of agricultural selection (Z23 ) express about 2 times the Rca protein and up to five times more Rca-coding mRNA in relation to its predecessors (Z0 ). This means that, proportionately, the expression of protein and Rca mRNA increased by 10–20% in each agricultural cycle. In contrast, our results for intragenic plants showed an increase of up to 50% for the protein content and up to 200% of the mRNA accumulation in different plants. This indicates that a sustained increase in the intragenic expression of Rca could potentially generate the same or even better results compared to agronomic procedure in significantly less time. 3.3. Rca copy number determination in intragenic and agronomically modified plants The Rca copy number in intragenic plants was calculated using real-time PCR with specific TRR oligos to amplify part of the Rca-

E.V. Almeraya., E. Sánchez-de-Jiménez. / Journal of Biotechnology 238 (2016) 35–41

Fig. 5. Analysis of Rca copy number. Genomic quantification of Rca copies on intragenic plants 1, 4, 5, and 9 compared to non-transformed control plants and agronomically selected Z0 and Z23 plants compared with each other.

coding region (Table 1). The results are shown in Fig. 5. It was found that plants 4, 5, and 9 registered 1 more copy of Rca with respect to the control while, plant 1 did not show more insertions than the control. Although a similar number of Rca integrations was observed between lines 4, 5 and 9, only the plant 5 showed the highest Rca protein content (Figs. 3 and 4). The molecular mechanism followed to reach those results in any plant, remains unknown, although sequence context of each integration is possibly the most important factor that drives differences on Rca expression or stability levels. Interestingly, plant 1 particularly increased its mRNA accumulation even though did not show more Rca insertions than the control. This result strongly suggests some understatement on the PCR technique or that incomplete cassette insertions took place. This last condition also would explain the lack of quantifiable detection of the chimeric union (Rubisco promoter-Rca protein) with a different set of oligos named CIS (Table 1), with respect to the results obtained with the TRR oligos. Since each pair of oligonucleotides used was designed to amplify different parts of the intragenic cassette, these data suggest that incomplete cassette insertions took place. According with these results, each plant acquired a unique Rca expression profile derived from a particular event of transformation which is different for each intragenic plant due to random insertion by bombardment. With respect to the agronomically cultivated plants, they did not show a significant difference in the Rca copy number from one cultivar to another. Those data were normalized with respect to the amplification of Hmg gene. The experimental technique used in this study does not offer information regarding the changes in the location of the gene integration, and this difference could explain the variations in Rca expression observed in the intragenic plants as well as in the agronomically cultivated plants. In this respect, it is recognized that during the domestication and improvement of this crop, DNA rearrangements have occurred (Shi and Lai, 2015). For more than 10,000 years, maize has been subject to an evolutionary process directed by humans, from the extensive improvement process that occurred during its domestication on Mexican territory to the diverse product that is currently known as maize. Evolutionary studies that have been carried out with this crop, have shown that changes in maize DNA have been primarily in the regulatory sequences (Wang et al., 1999). Considering the increased amount of sequencing and analysis data of complete genomes, in wild varieties as well as their improved cultivars, crop domestication tends to reduce genetic diversity, particularly for selected genes during domestication, diversification and/or improvement processes, which is known as a genetic bottleneck. However, studies in maize and soybean have shown a genetic expansion process that introduces additional alleles during the crop improvement and adaptation process (Jiao et al., 2012;

39

Lam et al., 2010). In these studies, the authors have detected an excess of alleles in the improved cultivars with respect to their wild ancestors. The increase in sequences number has been based on preexisting alleles in addition to new combinations that persist and increase during the domestication and improvement process, proven in studies in which polymorphisms have been detected in the genomes of improved plant varieties (Jiao et al., 2012; Tian et al., 2010). Changes in nucleotide sequences have not been the only source of maize diversification, but it is thought that changes in genetic expression as well as different epigenetic processes could also play an important role in the maize domestication and diversification process (Shi and Lai, 2015). The mechanisms regulating changes in gene expression are complex, and the modification systems based on genetic engineering provide some information on these mechanisms. The results from the intragenic plants of this research, demonstrate that it is possible to emulate changes in expression that routinely occur in plant modification through traditional agriculture techniques.

4. Conclusions The transgenic method is the most widely used technique for plant genetic engineering (Yadav et al., 2015). Although this method has been applied to different plant systems, it is not the best option for maize modification. Particularly in Mexico, center of maize domestication, transgenic corn has generated countless social and cultural arguments strongly opposing efforts to improve maize by this technique due to serious concerns related to contamination or even loss of native varieties (Dalton, 2009). In this regard, there are controversial reports of unintended releases of ˜ transgenic maize in Mexico (Pineyro-Nelson et al., 2009). This fed concerns about gene flow process, because of uncertainty about consequences for irreversible contamination of native maize gene pool (Acevedo et al., 2011). Instead, since DNA integrity is maintained, the intragenic and/or cisgenic model can be used as a better maize modification option. Because new genetic rearrangements or acquired combinations are based, on the same set of genes naturally found in a plant genome. For this reason, there is no ecological risk associated with natural gene flow and contamination derived from the presence of foreign DNA. Our results showed that intragenic transformation process can be used as an experimental tool for maize genetic modification. The method could be extended to different genes in order to study plant adaptation, improvement in nutrient uptake or stress induced response. This study shows the molecular characterization of Rca expression in intragenic plants, but it is necessary an extensive analysis for a growing number of intragenic plants, in order to examinate accurate Rca overexpression effect on maize yield and/or photosynthetic capacity at agronomic level. However, the evaluation of this first intragenic maize model is a truly advance in the maize improvement field; it opens opportunities for comprehensive research at open field culture, without maize transgenic concerns. In this regard, there are other ways for plant genome editing such as through zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and more recently with CRISPR-Cas9 system. This latter method has proved experimentally accessible in a broad range of organisms. Its use is based on the introduction of an endonuclease (usually from Streptococcus pyogenes), guided by an RNA sequence to induce a cut in the DNA. The molecular process of repairing is then exploited to promote changes in the DNA sequence (Ding et al., 2016). However, their application on plant biotechnology is still facing the same challenges to insert the molecular components for

40

E.V. Almeraya., E. Sánchez-de-Jiménez. / Journal of Biotechnology 238 (2016) 35–41

targeted edition. Nowadays, the insertion is mostly based on common process Agrobacterium or biolistic. Also, remains the question of nuclease integration, which is from bacteria origin, and the off-target issue (Paul and Qi, 2016). Recent studies have showed successful plant targeted edition without the introduction of foreign DNA in protoplasts (Woo et al., 2015). However, there are many species recalcitrant to regenerate from these cell type. In the ideal situation, the plant genome edition need to be achieved with these advanced tools in a cisgenic and/or intragenic context. Other crops modified with a intragenic and/or cisgenic approach have been shown to possess similar characteristics to those obtained by conventional agricultural techniques (Chizzali et al., 2016; Joshi et al., 2011) as shown in public surveys taken to measure the level of acceptance of these organisms in Europe and India (Delwaide et al., 2015; Shew et al., 2016). For this reason, there are a growing number of studies and patents for intragenic and/or cisgenic products from different crops like: alfalfa (Weeks et al., 2008), apple (Chizzali et al., 2016; Joshi et al., 2011), banana (Mlalazi et al., 2012), barley (Holme et al., 2012), potato (Chawla et al., 2012; Rommens et al., 2008), strawberry (Schaart et al., 2004) and wheat (Gadaleta et al., 2008) among others(Cardi, 2016; Garrocho-Villegas et al., 2016; Holme et al., 2013). The European Food Safety Authority (EFSA) has issued an opinion to the use of these genetic modified organisms (EFSA, 2012). This discussion has been extended to other parts of the world, however in Mexico; there are no distinction between genetically modified organisms. Therefore, the cisgenic and/or intragenic will be regulated under the same rules as transgenic organisms. In this intragenic modification system, the insertion does not represent a problem of genetic contamination due to the certainty of transgenes absence. So this transformation system can be used without ecological risks. The intragenic approach also opens the possibility of expanding its use for different genes with proven improvement characteristics. In light of the broad demand for adapted and improved maize cultivars (Chopra, 2014; McKersie, 2015), we believe that an intragenic system is a valuable process in assisting conventional agronomic improvement, particularly for the potential reduction on time, human labor and cropland required. Thus, the present study shows the possibility of recovering transformed maize plants using genetic engineering techniques without compromising the integrity of maize DNA.

Funding sources This research was supported by Consejo Nacional de Ciencia y Tecnología, CONACyT [grant numbers PDCPN-2013/213872, 252001] conducted to solve national problems; and Ph.D. scholarship [229516].

Author contribution statement EA and ES designed the research strategy and analyze the results, EA performed the experiments. All authors read and approved the manuscript.

Declaration of interest The authors declare that they have no conflict of interest.

Acknowledgments We thank Dr. Verónica Garrocho-Villegas for her useful comments to improve the manuscript, and to Dr. Alberto J DonayreTorres for his advice on the intragenic construct design.

References Acevedo, F., Huerta, E., Burgeff, C., Koleff, P., Sarukhán, J., 2011. Is transgenic maize what Mexico really needs? Nat. Biotechnol. 29, 23–24, http://dx.doi.org/10. 1038/nbt.1752. Assem, S.K., 2015. Maize, Tropical (Zea mays L.), in: Agrobacterium Protocols: Volume 1, Methods in Molecular Biology, Vol. 1223. doi: 10.1007/978-1-4939-1695-5 9. Ayala-Ochoa, A., Vargas-Suárez, M., Loza-Tavera, H., León, P., Jiménez-García, L.F., Sánchez-De-Jiménez, E., 2004. In maize, two distinct ribulose 1,5-bisphosphate carboxylase/oxygenase activase transcripts have different day/night patterns of expression. Biochimie 86, 439–449, http://dx.doi.org/10.1016/j.biochi.2004. 06.007. Cardi, T., 2016. Cisgenesis and genome editing: combining concepts and efforts for a smarter use of genetic resources in crop breeding. Plant Breed. 135, 139–147, http://dx.doi.org/10.1111/pbr.12345. Chawla, R., Shakya, R., Rommens, C.M., 2012. Tuber-specific silencing of asparagine synthetase-1 reduces the acrylamide-forming potential of potatoes grown in the field without affecting tuber shape and yield. Plant Biotechnol. J. 10, 913–924, http://dx.doi.org/10.1111/j.1467-7652.2012.00720.x. Chizzali, C., Gusberti, M., Schouten, H.J., Gessler, C., Broggini, G.A.L., 2016. Cisgenic Rvi6 scab-resistant apple lines show no differences in Rvi6 transcription when compared with conventionally bred cultivars. Planta 243, 635–644, http://dx. doi.org/10.1007/s00425-015-2432-z. Chopra S., 2014. Techniques and Tools of Modern Plant Breeding: Field Crops, in: A., R.A. et (Ed.), Plant Biotechnology: Experience and Future Prospects. doi: 10.1007/978-3-319-06892-3 3. Dalton, R., 2009. Mexico’s transgenic maize under fire. Nature 462, 404. Delwaide, A.C., Nalley, L.L., Dixon, B.L., Danforth, D.M., Nayga, R.M., Van Loo, E.J., Verbeke, W., 2015. Revisiting GMOs: are there differences in European consumers’ acceptance and valuation for cisgenically vs transgenically bred rice? PLoS One 10, 1–16, http://dx.doi.org/10.1371/journal.pone.0126060. Ding, Y., Li, H., Chen, L.-L., Xie, K., 2016. Recent advances in genome editing using CRISPR/Cas9. Front. Plant Sci. 7, 1–12, http://dx.doi.org/10.3389/fpls.2016. 00703. de Vetten, N., Wolters, A., Raemakers, K., van der Meer, I., ter Stege, R., Heeres, E., Heeres, P., Visser, R., 2003. A transformation method for obtaining marker-free plants of a cross-pollinating and vegetatively propagated crop. Nat. Biotechnol. 21, 439–442, http://dx.doi.org/10.1038/nbt801. Domingo, J.L., 2016. Safety assessment of GM plants: an updated review of the scientific literature. Food Chem. Toxicol. 95, 12–18, http://dx.doi.org/10.1016/j. fct.2016.06.013. EFSA, 2012. Scientific opinion addressing the safety assessment of plants developed through cisgenesis and intragenesis. EFSA J. 10, 2561, http://dx.doi. org/10.2903/j.efsa.2012.2561. Espinoza, C., Schlechter, R., Herrera, D., Torres, E., Serrano, A., Medina, C., Arce-Johnson, P., 2013. Cisgenesis and intragenesis: new tools for improving crops. Biol. Res. 46, 323–331, http://dx.doi.org/10.4067/S071697602013000400003. Fahlgren, N., Bart, R., Herrera-Estrella, L., Rellán-Álvarez, R., Chitwood, D.H., Dinneny, J.R., 2016. Plant scientists: GM technology is safe. Science 351, 824, http://dx.doi.org/10.1126/science.351.6275.824-a. Gadaleta, A., Giancaspro, A., Blechl, A.E., Blanco, A., 2008. A transgenic durum wheat line that is free of marker genes and expresses 1Dy10. J. Cereal Sci. 48, 439–445, http://dx.doi.org/10.1016/j.jcs.2007.11.005. Garrocho-Villegas, V., Jesús Olivera, M.T., Quintanar, E.S., 2012. Maize Somatic Embryogenesis: Recent Features to Improve Plant Regeneration, in: Loyola-Vargas V.M., and Ochoa-Alejo, N. (Ed.), Plant Cell Culture Protocols, Methods in Molecular Biology. pp. 173–182. doi: 10.1007/978-1-61779-818-4 14. Garrocho-Villegas, V., Almeraya, E.V., de Jiménez, E.S., 2016. Maize Somatic Embryogenesis: Agronomic Features for Improving Crop Productivity, in: Loyola-Vargas, V.M, and Ochoa-Alejo, N. (Ed.), Somatic Embryogenesis: Fundamental Aspects and Applications. pp. 201–211. doi: 10.1007/978-3-319-33705-0. Hazra, S., Henderson, J.N., Liles, K., Hilton, M.T., Wachter, R.M., 2015. Regulation of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) activase: product inhibition, cooperativity, and magnesium activation. J. Biol. Chem. 290, 24222–24236, http://dx.doi.org/10.1074/jbc.M115.651745. Holme, I.B., Dionisio, G., Brinch-Pedersen, H., Wendt, T., Madsen, C.K., Vincze, E., Holm, P.B., 2012. Cisgenic barley with improved phytase activity. Plant Biotechnol. J. 10, 237–247, http://dx.doi.org/10.1111/j.1467-7652.2011.00660. x. Holme, I.B., Wendt, T., Holm, P.B., 2013. Intragenesis and cisgenesis as alternatives to transgenic crop development. Plant Biotechnol. J. 11, 395–407, http://dx.doi. org/10.1111/pbi.12055.

E.V. Almeraya., E. Sánchez-de-Jiménez. / Journal of Biotechnology 238 (2016) 35–41 Jiao, Y., Zhao, H., Ren, L., Song, W., Zeng, B., Guo, J., Wang, B., Liu, Z., Chen, J., Li, W., Zhang, M., Xie, S., Lai, J., 2012. Genome-wide genetic changes during modern breeding of maize. Nat. Genet. 44, 812–815, http://dx.doi.org/10.1038/ng.2312. Joshi, S.G., Schaart, J.G., Groenwold, R., Jacobsen, E., Schouten, H.J., Krens, F.A., 2011. Functional analysis and expression profiling of HcrVf1 and HcrVf2 for development of scab resistant cisgenic and intragenic apples. Plant Mol. Biol. 75, 579–591, http://dx.doi.org/10.1007/s11103-011-9749-1. Kamthan, A., Chaudhuri, A., Kamthan, M., Datta, A., 2016. Genetically modified (GM) crops: milestones and new advances in crop improvement. Theor. Appl. Genet., http://dx.doi.org/10.1007/s00122-016-2747-6. Kurek, I., Chang, T.K., Bertain, S.M., Madrigal, A., Liu, L., Lassner, M.W., Zhu, G., 2007. Enhanced Thermostability of Arabidopsis Rubisco activase improves photosynthesis and growth rates under moderate heat stress. Plant Cell 19, 3230–3241, http://dx.doi.org/10.1105/tpc.107.054171. Lam, H.-M., Xu, X., Liu, X., Chen, W., Yang, G., Wong, F.-L., Li, M.-W., He, W., Qin, N., Wang, B., Li, J., Jian, M., Wang, J.J., Shao, G., Wang, J.J., Sun, S.S.-M., Zhang, G., 2010. Resequencing of 31 wild and cultivated soybean genomes identifies patterns of genetic diversity and selection. Nat. Genet. 42, 1053–1059, http:// dx.doi.org/10.1038/ng.715. Lucht, J.M., 2015. Public acceptance of plant biotechnology and GM crops. Viruses 7, 4254–4281, http://dx.doi.org/10.3390/v7082819. McKersie, B., 2015. Planning for food security in a changing climate. J. Exp. Bot. 66, 3435–3450, http://dx.doi.org/10.1093/jxb/eru547. Mlalazi, B., Welsch, R., Namanya, P., Khanna, H., Geijskes, R.J., Harrison, M.D., Harding, R., Dale, J.L., Bateson, M., 2012. Isolation and functional characterisation of banana phytoene synthase genes as potential cisgenes. Planta 236, 1585–1598, http://dx.doi.org/10.1007/s00425-012-1717-8. Morales, A., Ortega-Delgado, M.L., Molina-Galán, J., de Jiménez, E.S., 1999. Importance of Rubisco activase in maize productivity based on mass selection procedure. J. Exp. Bot. 50, 823–829, http://dx.doi.org/10.1093/jxb/50.335.823. Paul, J.W., Qi, Y., 2016. CRISPR/Cas9 for plant genome editing: accomplishments, problems and prospects. Plant Cell Rep. 35, 1–11, http://dx.doi.org/10.1007/ s00299-016-1985-z. ˜ A., Van Heerwaarden, J., Perales, H.R., Serratos-Hernández, J.A., Pineyro-Nelson, Rangel, A., Hufford, M.B., Gepts, P., Garay-Arroyo, A., Rivera-Bustamante, R., Álvarez-Buylla, E.R., 2009. Resolution of the Mexican transgene detection controversy: error sources and scientific practice in commercial and ecological contexts. Mol. Ecol. 18, 4145–4150, http://dx.doi.org/10.1111/j.1365-294X. 2009.04369.x. Ricroch, A.E., Hénard-Damave, M.-C., 2015. Next biotech plants: new traits, crops, developers and technologies for addressing global challenges. Crit. Rev. Biotechnol. 8551, 1–16, http://dx.doi.org/10.3109/07388551.2015.1004521. Romano, A., Raemakers, K., Bernardi, J., Visser, R., Mooibroek, H., 2003. Transgene organisation in potato after particle bombardment-mediated (co-)transformation using plasmids and gene cassettes. Transgenic Res. 12, 461–473, http://dx.doi.org/10.1023/A:1024267906219. Rommens, C.M., Bougri, O., Yan, H., Humara, J.M., Owen, J., Swords, K., Ye, J., 2005. Plant-derived transfer DNAs. Plant Physiol. 139, 1338–1349, http://dx.doi.org/ 10.1104/pp.105.068692. Rommens, C.M., Yan, H., Swords, K., Richael, C., Ye, J., 2008. Low-acrylamide French fries and potato chips. Plant Biotechnol. J. 6, 843–853, http://dx.doi.org/10. 1111/j.1467-7652.2008.00363.x. Rommens, C.M., 2004. All-native DNA transformation: a new approach to plant genetic engineering. Trends Plant Sci. 9, 457–464, http://dx.doi.org/10.1016/j. tplants.2004.07.001. Ryffel, G.U., 2014. Transgene flow: facts, speculations and possible countermeasures. GM Crops Food 5, 249–258, http://dx.doi.org/10.4161/ 21645698.2014.945883. Sage, R.F., Way, D.A., Kubien, D.S., 2008. Rubisco, Rubisco activase, and global climate change. J. Exp. Bot. 59, 1581–1595, http://dx.doi.org/10.1093/jxb/ ern053. Salvucci, M.E., DeRidder, B.P., Portis, A.R., 2006. Effect of activase level and isoform on the thermotolerance of photosynthesis in Arabidopsis. J. Exp. Bot. 57, 3793–3799, http://dx.doi.org/10.1093/jxb/erl140. Sanford, J.C., Smith, F.D., Russell, J.A., 1993. Optimizing the biolistic process for different biological applications. Methods Enzymol. 217, 483–509, http://dx. doi.org/10.1016/0076-6879(93)17086-K. Schäffner, a R., Sheen, J., 1991. Maize rbcS promoter activity depends on sequence elements not found in dicot rbcS promoters. Plant Cell 3, 997–1012, http://dx. doi.org/10.1105/tpc.3.9.997.

41

Schaart, J.G., Krens, F.A., Pelgrom, K.T.B., Mendes, O., Rouwendal, G.J.A., 2004. Effective production of marker-free transgenic strawberry plants using inducible site-specific recombination and a bifunctional selectable marker gene. Plant Biotechnol. J. 2, 233–240, http://dx.doi.org/10.1111/j.1467-7652. 2004.00067.x. Schouten, H.J., Jacobsen, E., 2008. Cisgenesis and intragenesis, sisters in innovative plant breeding. Trends Plant Sci., http://dx.doi.org/10.1016/j.tplants.2008.04. 005. Schouten, H.J., Krens, F.A., Jacobsen, E., 2006. Cisgenic plants are similar to traditionally bred plants: international regulations for genetically modified organisms should be altered to exempt cisgenesis. EMBO Rep. 7, 750–753, http://dx.doi.org/10.1038/sj.embor.7400769. Shew, A.M., Nalley, L.L., Danforth, D.M., Dixon, B.L., Nayga, R.M., Delwaide, A.C., Valent, B., 2016. Are all GMOs the same? Consumer acceptance of cisgenic rice in India. Plant Biotechnol. J. 14, 4–7, http://dx.doi.org/10.1111/pbi.12442. Shi, J., Lai, J., 2015. Patterns of genomic changes with crop domestication and breeding. Curr. Opin. Plant Biol. 24, 47–53, http://dx.doi.org/10.1016/j.pbi. 2015.01.008. Singh A., Joshi M., Devi E.L., 2015. Alternative to Transgenesis: Cisgenesis and Intragenesis, in: Advances in Plant Breeding Strategies: Breeding, Biotechnology and Molecular Tools. pp. 345–367. doi: 10.1007/978-3-319-22521-0 1. Thieulin-Pardo, G., Avilan, L., Kojadinovic, M., Gontero, B., 2015. Fairy tails: flexibility and function of intrinsically disordered extensions in the photosynthetic world. Front. Mol. Biosci. 2, 23, http://dx.doi.org/10.3389/ fmolb.2015.00023. Tian, Z.X., Wang, X.B., Lee, R., Li, Y.H., Specht, J.E., Nelson, R.L., McClean, P.E., Qiu, L.J., Ma, J.X., 2010. Artificial selection for determinate growth habit in soybean. Proc. Natl. Acad. Sci. U. S. A. 107, 8563–8568, http://dx.doi.org/10.1073/pnas. 1000088107. von Caemmerer, S., Hendrickson, L., Quinn, V., Vella, N., Millgate, A.G., Furbank, R.T., 2005. Reductions of Rubisco activase by antisense RNA in the C4 plant Flaveria bidentis reduces Rubisco carbamylation and leaf photosynthesis. Plant Physiol. 137, 747–755, http://dx.doi.org/10.1104/pp.104.056077. Vanblaere, T., Flachowsky, H., Gessler, C., Broggini, G.A.L., 2014. Molecular characterization of cisgenic lines of apple Gala carrying the Rvi6 scab resistance gene. Plant Biotechnol. J. 12, 2–9, http://dx.doi.org/10.1111/pbi.12110. Viret, J., Mabrouk, Y., Bogorad, L., 1994. Transcriptional photoregulation of cell-type-preferred expression of maize rbcS-m3: 3 and 5 sequences are involved. Proc. Natl. Acad. Sci. U. S. A. 91, 8577–8581. Wang, R.L., Stec, A., Hey, J., Lukens, L., Doebley, J., 1999. The limits of selection during maize domestication. Nature 398, 236–239, http://dx.doi.org/10.1038/ 18435. Weeks, J.T., Ye, J., Rommens, C.M., 2008. Development of an in planta method for transformation of alfalfa (Medicago sativa). Transgenic Res. 17, 587–597, http://dx.doi.org/10.1007/s11248-007-9132-9. Woo, J.W., Kim, J., Kwon, S., Il., Corvalán, C., Cho, S.W., Kim, H., Kim, S.-G., Kim, S.-T., Choe, S., Kim, J.-S., 2015. DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat. Biotechnol. 33, 1162–1164, http://dx.doi.org/10.1038/nbt.3389. Yadav, U.P., Ayre, B.G., Bush, D.R., 2015. Transgenic approaches to altering carbon and nitrogen partitioning in whole plants: assessing the potential to improve crop yields and nutritional quality. Front. Plant Sci. 6, 275, http://dx.doi.org/10. 3389/fpls.2015.00275. Yamori W., von C.S., 2011. Quantification of Rubisco Activase Content in Leaf ExtractsNo Title, in: Carpentier, R. (Ed.), Photosynthesis Research Protocols, Methods in Molecular Biology, Vol. 684. pp. 383–391. doi: 10.1007/978-1-60761-925-3 30. Yamori, W., Masumoto, C., Fukayama, H., Makino, A., 2012. Rubisco activase is a key regulator of non-steady-state photosynthesis at any leaf temperature and, to a lesser extent, of steady-state photosynthesis at high temperature. Plant J. 71, 871–880, http://dx.doi.org/10.1111/j.1365-313X.2012.05041.x. Yao, Q., Cong, L., Chang, J.L., Li, K.X., Yang, G.X., He, G.Y., 2006. Low copy number gene transfer and stable expression in a commercial wheat cultivar via particle bombardment. J. Exp. Bot. 57, 3737–3746, http://dx.doi.org/10.1093/jxb/ erl145. Yaqoob, A., Shahid, A.A., Samiullah, T.R., Rao, A.Q., Khan, M.A.U., Tahir, S., Mirza, S.A., Husnain, T., 2016. Risk assessment of Bt crops on the non-target plant associated insects and soil organisms. J. Sci. Food Agric, http://dx.doi.org/10. 1002/jsfa.7661.