- Email: [email protected]
Intraorganellar calcium imaging in Arabidopsis seedling roots using the GCaMP variants GCaMP6m and R-CEPIA1er
Journal of Plant Physiology 246–247 (2020) 153127
Contents lists available at ScienceDirect
Journal of Plant Physiology journal homepage: www.elsevier.com/locate/jplph
Intraorganellar calcium imaging in Arabidopsis seedling roots using the GCaMP variants GCaMP6m and R-CEPIA1er
T
Jin Luo1, Lvli Chen1, Feifei Huang, Ping Gao, Heping Zhao, Yingdian Wang, Shengcheng Han* Beijing Key Laboratory of Gene Resource and Molecular Development, College of Life Sciences, Beijing Normal University, Beijing 100875, China
ARTICLE INFO
ABSTRACT
Keywords: Calcium imaging NES-GCaMP6m NLS-GCaMP6m CRT1a-R-CEPIA1er Arabidopsis seedling roots
Ca2+ acts as a universal second messenger in eukaryotes. In animals, a wide variety of environmental and developmental stimuli trigger Ca2+ dynamics in organelles, such as the cytoplasm, nucleus, and endoplasmic reticulum (ER). However, ER Ca2+ ([Ca2+]er) homeostasis and its contributions in cytosolic and/or nucleosolic Ca2+ dynamics in plants remain elusive. GCaMPs are comprised of a circularly permutated form of enhanced green fluorescent protein fused to calmodulin and myosin light-chain kinase M13 and used for monitoring Ca2+ dynamics in mammalian cells. Here, we targeted a high-affinity variant of GCaMP with nuclear export signal in the cytoplasm (NES-GCaMP6m), with a nuclear-localised signal in the nucleus (NLS-GCaMP6m), and a lowaffinity variant of GCaMP, also known as calcium-measuring organelle-entrapped protein indicators (CEPIA), with a signal peptide sequence of the ER-localised protein Calreticulin 1a in the ER lumen (CRT1a-R-CEPIA1er) for intraorganellar Ca2+ imaging in Arabidopsis. We found that cytosolic Ca2+ ([Ca2+]cyt) increases induced by 250 mM sorbitol as an osmotic stress stimulus, 50 μM abscisic acid (ABA), or 1 mM carbachol (CCh) were mainly due to extracellular Ca2+ influx, whereas nucleosolic Ca2+ ([Ca2+]nuc) increases triggered by osmotic stress, ABA, or CCh were contributed by [Ca2+]er release. In addition, [Ca2+]er dynamics presented specific patterns in response to different stimuli such as osmotic stress, ABA, or CCh, indicating that Ca2+ signalling occurs in the ER in plants. These results provide valuable insights into subcellular Ca2+ dynamics in response to different stresses in Arabidopsis root cells and prove that GCaMP imaging is a useful tool for furthering our understanding of plant organelle functions.
1. Introduction Ca2+ acts as a second messenger to regulate a number of biological processes in eukaryotes, such as gene expression, fertilisation, cell proliferation, development, and responses to various biotic and abiotic stresses (Berridge et al., 2000; Dodd et al., 2010). Various stimuli induce [Ca2+] increases in the cytoplasm (Berridge et al., 2003) as well as in organelles such as the nucleus (Charpentier and Oldroyd, 2013; Huang et al., 2017; Krebs et al., 2012), chloroplasts (McAinsh and Pittman, 2009; Nomura et al., 2012), mitochondria (Wagner et al., 2016), and ER (Bonza et al., 2013), which are shaped by the channels, pumps, and carriers localised on the plasma membrane and organelle
membranes. The heterogeneity of Ca2+ distribution in different cellular compartments is the foundation of Ca2+ signalling. In plants, the main calcium stores are the vacuole, ER, and apoplast, which have free [Ca2+] in the millimolar range. However, the free [Ca2+] in the cytoplasm, nucleus, chloroplast, and mitochondria is approximately 100–200 nM (Stael et al., 2012). The resulting ∼5,000-fold difference between calcium stores and the protoplast space enables the generation of calcium signals via the rapid entering of Ca2+ into the protoplast through membrane-localised Ca2+-permeable channels in response to environmental and developmental stimuli. Then Ca2+ is transported into the Ca2+ stores by Ca2+ pumps and carriers to recover to the resting low level of [Ca2+]cyt (Bonza et al., 2013; Edel et al., 2017;
Abbreviations: ABA, abscisic acid; CCh, carbachol; TG, thapsigargin; ER, endoplasmic reticulum; NES, nuclear export signal; NLS, nuclear-localised signal; GECI, genetically-encoded calcium indicator; NES-GCaMP6m, cytoplasm-localised GCaMP6m indicator protein; NLS-GCaMP6m, nuclear-localised GCaMP6m indicator protein; CRT1a-R-CEPIA1er, ER-targeted red calcium-measuring organelle-entrapped protein indicator 1; SERCA, Sarco/ER Ca2+-dependent ATPase; OICIcyt, osmotic stress-induced [Ca2+]cyt increase; OICInuc, osmotic stress-induced [Ca2+]nuc increase; AICOcyt, ABA-induced [Ca2+]cyt oscillation; AICOnuc, ABA-induced [Ca2+]nuc oscillation; CICIcyt, CCh-induced [Ca2+]cyt increase; CICInuc, CCh-induced [Ca2+]nuc increase ⁎ Corresponding author. E-mail address: [email protected] (S. Han). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.jplph.2020.153127 Received 5 December 2019; Received in revised form 14 January 2020; Accepted 14 January 2020 Available online 23 January 2020 0176-1617/ © 2020 Elsevier GmbH. All rights reserved.
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
sequence to visualise Ca2+ dynamics in different Ca2+ stores of mammalian cells (Suzuki et al., 2014). In eukaryotic cells, the ER, which represents an essential Ca2+ storage organelle, connects with the nucleus to form a contiguous lumen and releases Ca2+ into the cytoplasm and nucleoplasm in response to various stimuli (Berridge, 2009; Bootman et al., 2009; Huang et al., 2017; Krebs et al., 2012). ER luminal Ca2+ dynamics are critical to many functions of the ER. The overload and depletion of ER Ca2+ stores have detrimental effects on the entire cell (Coe and Michalak, 2009). In mammalian cells, Ca2+ is released from the ER upon stimulation via inositol 1,4,5-trisphosphate receptors (IP3Rs) and ryanodine receptors (RyRs) and reloaded into the ER lumen through sarco-endoplasmic reticulum Ca2+-ATPase (SERCA), which restores the [Ca2+]er to its original high level (Berridge, 2009; Berridge et al., 2003). In addition, depletion of ER Ca2+ store leads to activation of the plasma membrane-localised calcium release-activated channel Orai1 by ER membrane-localised stromal interaction molecule 1 (STIM1), also known as the store-operated calcium entry (SOCE) (Parekh et al., 2005; Patterson et al., 1999). It has been reported that plants contain two major types of Ca2+ pumps ― ECA (for ER-type Ca2+-ATPase) and ACA (for autoinhibited Ca2+-ATPase), and CaCAs (Ca2+/cation antiporters). Accordingly, ECA1, ACA2, and CCX2 have been shown to be localised to the ER membrane (Corso et al., 2018; Hwang et al., 2000; Liang et al., 1997). However, their contribution to cytosolic, nucleosolic, and ER Ca2+ dynamics needs further investigation. In addition, IP3 is a secondary messenger in plants, but Orai1, IP3Rs, and STIM1 are absent from land plants (Edel et al., 2017; Wheeler and Brownlee, 2008). Therefore, the role of the ER in Ca2+ dynamics in plant cells is still unclear. Here, we generated transgenic Arabidopsis plants expressing NES-GCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er that separately targeted the cytoplasm, nucleus, and ER by fusing to specific organelletargeted signal sequences with Ca2+ indicator proteins. Using this toolkit, we monitored the dynamics of [Ca2+]cyt, [Ca2+]nuc, and [Ca2+]er in response to three stimuli with different pharmacologic manipulations of the calcium store. The results showed that the different stimuli triggered changes in [Ca2+]cyt, [Ca2+]nuc, and [Ca2+]er, and the increases of [Ca2+]cyt and [Ca2+]nuc in response to stimuli were attributable to Ca2+ influx from the extracellular space and to Ca2+ release from the ER in Arabidopsis root cells, respectively.
McAinsh and Pittman, 2009). Therefore, various tools for investigating Ca2+ dynamics with high temporal and spatial resolution are required to elucidate the contribution of different cellular compartments to calcium signalling. Because of the lack of subcellular targeting information and their inaccessibility for loading, calcium dyes are not suitable for monitoring spatiotemporal changes of [Ca2+] in plants. Therefore, instead, genetically encoded calcium indicators (GECIs) fused with a protein or tag of interest are used to detect Ca2+ dynamics in specific subcellular locations in transgenic plants. GECIs can be classified into three types: chemiluminescent reporters, based on the aequorin photoprotein (Robert et al., 2000); Cameleon, a fluorescence resonance energy transfer (FRET)-based Ca2+ indicator protein, comprises a cyan fluorescent protein (CFP), calmodulin (CaM), a Ca2+ binding protein, and the myosin light-chain kinase M13 (MLCK), which interacts with Ca2+bound CaM and a yellow-fluorescent-protein (YFP) variant (Miyawaki et al., 1997); and the single fluorophore sensor GCaMP, a circularly permutated form of enhanced green fluorescent protein (cpEGFP) that is fused to CaM and MLCK (Nakai et al., 2001; Ohkura et al., 2005). The aequorin-based system was established to determine [Ca2+]cyt in whole plants in response to a number of signals (Knight et al., 1991, 1992, 1996, 1997), as well as the calcium level in the nucleus (Pauly et al., 2000), mitochondrion (Logan and Knight, 2003), and chloroplast (Johnson et al., 1995). However, the low turnover rate of the luminescent reaction and low light emission of aequorin limited the spatiotemporal resolution of [Ca2+] in whole plants (Plieth, 2001; Shimomura, 2006). These problems were overcome by fusion with green (GFP) or red (RFP) fluorescent protein to independently monitor [Ca2+] in various subcellular domains within mammalian cells, which triggers the intramolecular chemiluminescence resonance energy transfer that shifts the luminescence emission towards the wavelength of the fluorescent protein (Alonso et al., 2009; Curie et al., 2007; Manjarres et al., 2008). However, no aequorin-GFP/RFP fusion protein has been applied to monitor [Ca2+] in plants. A huge variety of Cameleons with different Ca2+ sensitivities for organelle-specific Ca2+ in various cellular organelles have been generated via point-mutations of YFP, CaM, or MLCK, and used to determine [Ca2+] in the mitochondria, nucleus, cytosol, ER, Golgi apparatus, or endosomes of single living cells (Nagai et al., 2002, 2004; Palmer et al., 2004, 2006; Truong et al., 2001; Waldeck-Weiermair et al., 2012, 2015). We and other groups have determined the [Ca2+] in the cytosol and nucleus using organelle-targeted Cameleon YC 3.6 in response to various stimuli in plants (Huang et al., 2017; Krebs et al., 2012). On the basis of FRET, Cameleons have the advantages of accuracy and broad applicability for calcium signalling in eukaryotes; however, they also have the disadvantages of complicated operation and insensitivity to slight [Ca2+] changes in subcellular domains. Therefore, GCaMPs, another type of GECI, which are simple to use and exhibit a high signal-to-noise ratio for [Ca2+] changes in response to stimuli, can be used for monitoring calcium signalling at the subcellular level. Nakai et al. (2001) showed that the fluorescence changes of GCaMP in response to the application of drugs or electrical stimulation were up to ∼4.5-fold in living cells, and GCaMP exhibited an apparent dissociation constant (Kd) for Ca2+ of 235 nM in vitro. Based on the three-dimensional structures of GCaMP2 with or without Ca2+ (Akerboom et al., 2009; Wang et al., 2008), a series of improved GCaMP variants was developed using a combination of protein structure–guided mutagenesis and semi-rational library screening methods (Chen et al., 2013; Suzuki et al., 2014; Tian et al., 2009). GCaMP6 indicators (including GCaMP6f, GCaMP6m, and GCaMP6s) have a higher sensitivity for Ca2+ than commonly used synthetic calcium dyes and can be used to detect individual action potentials with high reliability in neuronal cells (Chen et al., 2013). In addition, low-affinity Ca2+binding CEPIA1 (Calcium-measuring organelle-Entrapped Protein Indicator 1) generated by a point mutation of GCaMP2 had a Kd for Ca2+ of 500–600 μM in vitro and fused with an organelle-retention signal
2. Materials and methods 2.1. DNA constructs The NES (nuclear export signal) and NLS (nuclear localisation signal) sequences (described in Huang et al., 2017) were fused to the Nterminus of GCaMP6m from the pGP-CMV-GCaMP6m vector Addgene plasmid #40754 Chen et al., 2013) using the forward primer 5′-ATGC TGCAGAACGAGCTTGCTCTTAAGTTGGCTGGACTTGATATTAACAAGA CTGGAGGAATGGGTTCTCATCATCATCATCATC-3′ (NES sequence underlined) or 5′-ATGCTGCAGCCTAAGAAGAAGAGAAAGGTTGGAGGAA TGGGTTCTCATCATCATCATCATC-3′ (NLS sequence underlined) and the reverse primer 5′-ACCTCTACAAATGTGGTATGGCTG-3′, respectively. The PCR products were subcloned into a pJET1.2/blunt cloning vector (CloneJET PCR Cloning Kit #K1231; Thermo Scientific, USA). Next, the sequences were digested with BamHI and NotI and cloned into the pENTR™1A vector (Invitrogen, USA). Finally, pENTR™1A-NESGCaMP6m and pENTR™1A-NLS-GCaMP6m were separately digested with ApalI and recombined with the pCAMBIA2300-Ubi destination vector using a Gateway LR II kit (Invitrogen, USA) to generate UBI:NESGCaMP6m and UBI:NLS-GCaMP6m constructs. The first 66-bp signal peptide sequence of the ER-localised protein Calreticulin 1a (CRT1a; At1g56340) (Christensen et al., 2010) was synthesised using the forward primer 5′-ATGGCGAAACTAAACCCTAA ATTCATCTCTTTGATTCTTTTCGCTCTCGTGGTGATCGTCTCTGCT-3′ and the reverse primer 5′-AGCAGAGACGATCACCACGAGAGCGAAAA 2
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
(TG), and with 200 μL of Ca2+-free bathing solution buffer plus 2 mM ethylene glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA). To monitor the fluorescence signals in the roots of transgenic plants, we used an inverted fluorescence microscope (Axio Observer A1; Zeiss) equipped with an iXon3 EMCCD camera (Oxford Instruments, UK), a Lambda DG4 fluorescent light source (Sutter Instruments, USA), Bright Line filter sets (Semrock Inc., USA), and MetaFluor software (Molecular Devices, USA). Dynamic calcium images were collected every 2 s at room temperature through a 40× oil objective lens (N.A.1.30; Zeiss). GCaMP6m fluorescence was excited at 482 ± 18 nm and collected at 520 ± 28 nm. R-CEPIA1er fluorescence was excited at 559 ± 34 nm and collected at 630 ± 69 nm. The fluorescence data were collected and analysed using MATLAB R2014a software and plotted using GraphPad Prism 5.0 software. The average fluorescence change in response to each stimulus represents the mean value of 20–30 root cells from at least six independent seedlings, each of which provided three to six root cells. Analysis of statistical significance was performed using unpaired Student’s t-test in GraphPad Prism 5.0 software. The results are presented as the means ± standard deviation (SD).
GAATCAAAGAGATGAATTTAGGGTTTAGTTTCGCCAT-3′ and cloned into vector pENTR™1A between the DraI and BamHI sites. Next, the RCEPIA1er fragment was digested using BamHI and XbaI from the pCMVR-CEPIA1er vector Addgene plasmid # 58,216 Suzuki et al., 2014) and ligated into pENTR™1A-CRT1a to generate the construct pENTRY1ACRT1a-R-CEPIA1er. Finally, CRT1a-R-CEPIA1er was recombined into the pMDC32-Ubi destination vector using a Gateway LR II kit (Invitrogen) to generate the UBI: CRT1a-R-CEPIA1er construct. All constructs were confirmed via sequencing. 2.2. Arabidopsis growth and transformation Seed germination and growth of Arabidopsis thaliana (Col-0 ecotype) seedlings were performed as described previously (Huang et al., 2017). The constructs UBI:NES-GCaMP6m, UBI:NLS-GCaMP6m, and UBI: CRT1a-R-CEPIA1er were separately introduced into Agrobacterium GV3101, and transformed into Arabidopsis plants to generate the NESGCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er transgenic lines using the floral-dip method (Clough and Bent, 1998). The transformants were selected on 1/2 Murashige and Skoog (MS) medium containing 50 mg/mL hygromycin B (Sigma-Aldrich, USA). The three independent lines of T3-generation homozygous transformants carrying a single insertion were used in subsequent experiments.
3. Results 3.1. Subcellular localisation of NES-GCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er
2.3. Subcellular localisation of NES-GCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er in the roots and guard cells of transgenic Arabidopsis lines
In order to detect Ca2+ dynamics in the cytoplasm, nucleus, and ER, we generated transgenic Arabidopsis plants expressing a high-affinity variant of GCaMP in the cytoplasm (NES-GCaMP6m) or nucleus (NLSGCaMP6m), and a low-affinity variant of GCaMP in the ER lumen (CRT1a-R-CEPIA1er). First, we fused the NES or NLS sequence to the Nterminus of GCaMP6m to generate the plant expression vector NESGCaMP6m or NLS-GCaMP6m, and the first 66-bp signal peptide sequence of CRT1a to the N-terminus of R-CEPIA1 to generate CRT1a-RCEPIA1er (Figure S1). After transforming viaAgrobacterium GV3101 and screening using antibiotics, the single-insertion homozygous transgenic plants were ready to use for assaying the subcellular localisation of GCaMP6m and R-CEPIA1er. We found that NES-GCaMP6m was localised in the cytoplasm, NLS-GCaMP6m in the nucleus, and CRT1a-RCEPIA1er in the ER in the mature root zones of five-day-old transgenic Arabidopsis seedlings (Fig. 1). However, the fluorescence produced by GCaMP6m and R-CEPIAer in guard cells of four-week-old rosette leaves was negligible, because GCaMP6m and R-CEPIA1er lacking the intact GFP or RFP (Chen et al., 2013; Suzuki et al., 2014) lead their fluorescence weak and interference by chloroplast auto-fluorescence (Figure S2). Therefore, we only used NES-GCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er to monitor Ca2+ dynamics in the cytoplasm, nucleus, and ER of Arabidopsis root cells, respectively.
Five-day-old seedlings of the NES-GCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er transgenic lines were placed on glass slides filled with 1/2 MS incubation buffer. The fluorescence in the root cells was observed under 20× magification (Plan-Apochromat 20×/0.8 M27 objective). GCaMP6m fluorescence was excited at 488 nm and collected at 518–550 nm, and R-CEPIA1er fluorescence was excited at 555 nm and collected at 585–640 nm; the pinhole size was 1 AU. The autofluorescence was excited at 488 nm and collected at 580 nm. In addition, the leaves of four-week-old transgenic Arabidopsis were used to assess the subcellular localisation of NES-GCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er in guard cells. The epidermis of the leaves was immersed in 1/2 MS incubation buffer. To ensure that stomata were fully opened, the glass slides were placed in a growth chamber under 2 h of light exposure. Guard cells were observed under a 63× magnification (Plan-Apochromat 63×/1.4 oil objective). Other image acquisition parameters were the same as those for root cells. Fluorescence was visualised using a Zeiss LSM 700 confocal microscope (Zeiss, Germany). 2.4. Measurement of [Ca2+] in NES-GCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er transgenic lines
3.2. Osmotic stress-induced [Ca2+]cyt increase (OICIcyt) was mainly due to extracellular Ca2+ influx, whereas osmotic stress-induced [Ca2+]nuc increase (OICInuc) was due to ER Ca2+ release
After germination, Arabidopsis seedlings were grown vertically in half-strength MS medium for five to seven days and their roots were prepared for Ca2+ imaging following the method of Huang et al. (2017). The roots were immobilised on coverslips using 1 % (w/v) lowmelting-point agarose (Amresco, USA) and exposed for Ca2+ imaging by digging a small tunnel in the agarose. The coverslips were placed on Attofluor® Cell Chambers (Invitrogen) to form a perfusion chamber. Seedlings were preincubated with 200 μL of bathing solution buffer (1/ 2 MS, 1 % sucrose, and 10 mM 2-(N-morpholino)ethanesulphonic acid (MES), using potassium hydroxide for pH adjustment to 5.8) for 30–40 min and the mature zone of the Arabidopsis roots was selected for Ca2+ measurements. For stimuli treatments, an equal volume of 500 mM sorbitol, 100 μM ABA, or 1 mM CCh in the same bathing solution buffer was separately perfused into the chamber. For pharmacologic manipulations of calcium stores, seedlings were preincubated with 200 μL of bathing solution buffer containing 1 mM GdCl3 or 10 μM thapsigargin
The five-day-old Arabidopsis seedlings expressing NES-GCaMP6m and NLS-GCaMP6m were used to monitor changes in [Ca2+]cyt and [Ca2+]nuc in response to 250 mM sorbitol, respectively. We found that osmotic stress triggers a rapid increase in [Ca2+]cyt (OICIcyt) or [Ca2+]nuc (OICInuc) in the mature root-cell zone in NES-GCaMP6m (Fig. 2A-C) or NLS-GCaMP6m (Fig. 2D-F) plants, respectively, and the ΔF/Frest value reached ∼0.6 for both [Ca2+]cyt and [Ca2+]nuc. GdCl3, a trivalent lanthanide cation, is used to compete with Ca2+ for a channel binding site and block current flow through voltage-gated calcium channels (Lansman, 1990). TG inhibits SERCA, leading to the depletion of the ER Ca2+ storage and an increase in [Ca2+]cyt (Thomas and Hanley, 1994), and EGTA is a calcium chelator. Therefore, we pretreated root cells with these three compounds to study the roles of the 3
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
Fig. 1. Subcellular localisation of NES-GCaMP6m, NLS-GCaMP6m, and CTR1a-R-CEPIA1er in the roots of stable transgenic Arabidopsis lines. The fluorescence signals of NES-GCaMP6m (A), NLS-GCaMP6m (B), and CTR1a-R-CEPIA1er (C) were detected in the root cells of five-day-old transgenic Arabidopsis seedlings. Green or red fluorescence indicates GCaMP6m or R-CEPIA1er, respectively. Autofluorescence (AF) indicates chloroplastic autofluorescence. Merge indicates the combination of green or red fluorescence with AF. WL indicates white light background. The images were obtained from one optic section using a Zeiss LSM 700 confocal microscope. Scale bars, 20 μm. At least three independent experiments were performed.
calcium stores in OICIcyt and OICInuc. Both GdCl3 and EGTA inhibited OICIcyt, and EGTA had a more significant effect on OICIcyt than did GdCl3. However, TG had no effect on OICIcyt (Fig. 2A-C). In addition, OICInuc was impaired by TG and EGTA, but not by GdCl3 (Fig. 2D-F). Furthermore, we monitored the change of [Ca2+]er with prolonged incubation of 1 mM GdCl3, 10 μM TG, or 2 mM EGTA, respectively, and found that TG and EGTA, but not GdCl3, markedly decrease the [Ca2+]er in the root cells of transgenic Arabidopsis lines containing CRT1a-R-CEPIA1er (Figure S3). These results indicated that long-term incubation of EGTA in bathing solution chelates both extracellular and ER Ca2+, which is the reason for EGTA decreasing both OICIcyt and OICInuc in Arabidopsis root cells.
GCaMP6m after adding stimulating buffer for 300 s (Fig. 3D-F). Furthermore, we used GdCl3, TG, or EGTA to pretreat Arabidopsis root cells, and found that AICOcyt is impaired by GdCl3 and EGTA, but not by TG; and AICOnuc was impaired by TG and EGTA, but not by GdCl3. These results suggested that AICOcyt contributes to Ca2+ influx from the extracellular space, and AICOnuc to Ca2+ release from the ER, which is in accordance with the role of Ca2+ storage on OICIcyt and OICInuc in Arabidopsis root cells.
3.3. ABA-induced [Ca2+]cyt oscillation (AICOcyt) was impaired by GdCl3 and EGTA, but not by TG; and ABA-induced [Ca2+]nuc oscillation (AICOnuc) was impaired by TG and EGTA, but not by GdCl3
In animal cells, CICIcyt is mediated by ER-localised IP3 receptors (Ding et al., 1997; Lock et al., 2017) and/or plasma membrane-localised transient receptor potential (TRP) channels (Griffin et al., 2018; Wu et al., 2002). However, the presence of CICIcyt and CICInuc in plants remains elusive. Here, we found that 1 mM CCh triggers the [Ca2+]cyt and [Ca2+]nuc increases in the root cells of transgenic Arabidopsis lines containing NES-GCaMP6m and NLS-GCaMP6m, respectively (Fig. 4). In addition, GdCl3 and EGTA, but not TG, impaired CICIcyt (Fig. 4A-C); and TG and EGTA, but not GdCl3, disrupted CICInuc (Fig. 4D-F). These results indicate that the Ca2+ ext is essential for stimulus-triggered increases
3.4. CCh-induced [Ca2+]cyt increase (CICIcyt) was impaired by GdCl3 and EGTA, but not by TG; and CCh-induced [Ca2+]nuc increase (CICInuc) was impaired by TG and EGTA, but not by GdCl3
Previous studies showed that ABA induces [Ca2+]cyt oscillations to regulate plant growth, development, and adaption to environmental stress (Allen et al., 2001; Islam et al., 2010; Vishwakarma et al., 2017). Accordingly, AICOcyt occurred in the root cells of transgenic Arabidopsis lines containing NES-GCaMP6m (Fig. 3A-C). In addition, we observed AICOnuc in the root cells of transgenic Arabidopsis lines containing NLS4
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
Fig. 2. The osmotic stress-induced [Ca2+]cyt increase (OICIcyt) was impaired by GdCl3 and EGTA, but not by TG; whereas the osmotic stressincrease induced [Ca2+]nuc (OICInuc) was impaired by TG and EGTA, but not by GdCl3. (A) and (D): Changes in [Ca2+]cyt (A) or [Ca2+]nuc (D) in response to osmotic stress (250 mM sorbitol) were monitored in the root cells of the NES-GCaMP6m or NLSGCaMP6m transgenic lines with or without pretreatment with 1 mM GdCl3, 10 μM TG, or 2 mM EGTA. Regions of interest (ROI) are indicated by black-bordered rectangles and ovals in (A) and (D), respectively, and were used to monitor [Ca2+]cyt in (B) and (C), and [Ca2+]nuc in (E) and (F), respectively, in Arabidopsis root cells expressing NES-GCaMP6m or NLSGCaMP6m. Relative [Ca2+]cyt or [Ca2+]nuc is represented by the change in emission fluorescence (ΔF/Frest) (pseudo-colour bar at bottom right). Scale bars, 50 μm. (B) and (E): Time course of OICIcyt (B) and OICInuc (E) in Arabidopsis root cells expressing NESGCaMP6m or NLS-GCaMP6m with or without pretreatment with 1 mM GdCl3, 10 μM TG, or 2 mM EGTA. (C) and (F): Effects of pretreatments on OICIcyt (C) and OICInuc (F) in root cells. The treatments were similar to those described in (B) and (E) (n = 25–35 cells from at least six different seedlings, each of which provided four to six root cells). Error bars indicate standard deviation (SD). NS, no significance change; *, P < 0.05 (unpaired Student’s t-test).
5
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
Fig. 3. The ABA-induced [Ca2+]cyt oscillation (AICOcyt) was disrupted by GdCl3 and EGTA, but not by TG; whereas the ABA-induced [Ca2+]nuc oscillation (AICOnuc) was disrupted by TG and EGTA, but not by GdCl3. (A) and (D): Changes in [Ca2+]cyt (A) and [Ca2+]nuc (D) in response to 50 μM ABA were monitored in the root cells of the NES-GCaMP6m and NLS-GCaMP6m transgenic lines, respectively, with or without pretreatment with 1 mM GdCl3, 10 μM TG, or 2 mM EGTA. The ROI indicated by black-bordered rectangles and ovals in (A) and (D), respectively, were used to monitor [Ca2+]cyt in (B) and (C) and [Ca2+]nuc in (E) and (F), respectively, in Arabidopsis root cells expressing NESGCaMP6m or NLS-GCaMP6m. Relative [Ca2+]cyt or [Ca2+]nuc is represented by emission fluorescence changes (ΔF/Frest) (pseudo-colour bar at bottom right). Scale bars, 50 μm. (B) and (E): Time course of AICOcyt (B) and AICOnuc (E) in Arabidopsis root cells expressing NES-GCaMP6m or NLS-GCaMP6m with or without pretreatment with 1 mM GdCl3, 10 μM TG, or 2 mM EGTA. (C) and (F): Effects of pretreatments on AICOcyt (C) and AICOnuc (F) in root cells. The treatments were similar to those described in (B) and (E) (n = 25–35 cells from at least six seedlings, each of which provided four to six root cells). Error bars indicate SD. NS, no significance change; *, P < 0.05 (unpaired Student’s t-test).
6
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
Fig. 4. The CCh-induced [Ca2+]cyt increase (CICIcyt) was impaired by GdCl3 and EGTA, but not by TG; whereas the CCh-induced [Ca2+]nuc increase (CICInuc) was impaired by TG and EGTA, but not by GdCl3. (A) and (D): Changes in [Ca2+]cyt (A) and [Ca2+]nuc (D) in response to 1 mM CCh were monitored in the root cells of transgenic NESGCaMP6m or NLS-GCaMP6m lines with and without pretreatment with 1 mM GdCl3, 10 μM TG, or 2 mM EGTA. The ROI indicated by black-bordered rectangles and ovals in (A) and (D), respectively, were used to monitor [Ca2+]cyt in (B) and (C), and [Ca2+]nuc in (E) and (F), respectively, in Arabidopsis root cells expressing NES-GCaMP6m or NLS-GCaMP6m. Relative [Ca2+]cyt or [Ca2+]nuc is represented by emission fluorescence changes (ΔF/Frest) (pseudo-colour bar at bottom right). Scale bars, 50 μm. (B) and (E): Time course of CICIcyt (B) and CICInuc (E) in Arabidopsis root cells expressing NES-GCaMP6m or NLS-GCaMP6m with or without pretreatment with 1 mM GdCl3, 10 μM TG, or 2 mM EGTA. (C) and (F): Effects of pretreatments on CICIcyt (C) and CICInuc (F) in root cells. The treatments were similar to those described in (B) and (E) (n = 25–35 cells from at least six seedlings, each of which provided four to six root cells). Error bars indicate SD. NS, no significant change; *, P < 0.05 (unpaired Student’s t-test).
7
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
Fig. 5. The [Ca2+]er in Arabidopsis root cells increased in response to osmotic stress and ABA, and decreased in response to CCh. (A), (C), and (E): Changes in [Ca2+]er in response to 250 mM sorbitol (A), 50 μM ABA (C), or 1 mM CCh (E) were monitored in the root cells of the transgenic CTR1a-R-CEPIA1er line. The ROIs indicated by black-bordered rectangles in (A), (C), and (E) were used to monitor [Ca2+]er in (B), (D), and (F), respectively. Relative [Ca2+]er is represented by emission fluorescence changes (ΔF/Frest) (pseudo-colour bar at bottom right). Scale bars, 50 μm. (B), (D) and (F): Time course of relative [Ca2+]er in response to 250 mM sorbitol (B), 50 μM ABA (D), or 1 mM CCh (F) in Arabidopsis root cells expressing CTR1a-R-CEPIA1er. At least five independent experiments were performed, each of which included at least four ROI.
in [Ca2+]cyt, and ER Ca2+ storage plays a unique role in stimulustriggered increases in [Ca2+]nuc in plants.
unfolded protein response, leading to mammalian cell death and diseases (Mekahli et al., 2011). To explore the role of [Ca2+]er in cytosolic and nucleosolic Ca2+ signalling in plants, we used transgenic Arabidopsis seedlings expressing CTR1a-R-CEPIA1er to monitor [Ca2+]er dynamics under different stimuli. Firstly, 250 mM sorbitol induced a rapid increase in [Ca2+]er (Fig. 5A and B), but 50 μM ABA induced an increase in [Ca2+]er in root cells after ∼900 s (Fig. 5C and D). Interestingly, we found that the CCh-triggered [Ca2+]er decrease occurred rapidly and was sustained for 1000 s in root cells Fig. 5E and F). These
3.5. [Ca2+]er dynamics in response to osmotic-stress, ABA, and CCh in Arabidopsis root cells ER Ca2+ homeostasis is maintained by SERCA pumping Ca2+ into the ER and the ryanodine (RyR) and IP3 receptors releasing Ca2+ from the ER. ER Ca2+ dysregulation causes ER stress and activates the 8
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
results showed that ER [Ca2+] dynamics follow stimulus-specific patterns in Arabidopsis, indicating that Ca2+ signalling also occurs in the ER in plants.
1998). Although there is little data on the calcium storage properties of the ER in plants, the existence of calreticulin, a Ca2+ storage protein of the ER, in both plants and animals indicates that the ER of plants has a similar range of [Ca2+] as animals (Nagata et al., 2004). Therefore, a low-affinity and high-capacity Ca2+ indicator is required for monitoring the change of ER [Ca2+]. The Cameleon D4 variant has an in vitro Kd for Ca2+ of 195 μM (Palmer et al., 2006). Bonza et al. (2013) generated an ER-targeting Cameleon reporter protein, CRT-D4ER, by fusing Cameleon D4 with a CRT signal peptide and used this indicator protein to monitor the free [Ca2+] in the ER lumen of Arabidopsis root cells. They found that various stimuli, such as external ATP, L-Glu, and NaCl, separately triggered an increase in [Ca2+]cyt, which was accompanied by ER Ca2+ accumulation. These results are similar to our findings using CRT1a-R-CEPIAer to assess the [Ca2+]er dynamics in response to sorbitol and ABA in Arabidopsis root cells. Furthermore, CCh induced a decrease in [Ca2+]er in Arabidopsis root cells. In addition, these stimuli can induce an increase in [Ca2+]nuc in plants. We also performed pharmacologic manipulations of calcium stores using GdCl3, TG, and EGTA to evaluate their contribution to changes in [Ca2+]cyt and [Ca2+]nuc. The results suggest that the ER plays a role as a source for Ca2+ release, which contributes to the Ca2+ distribution in plants.
4. Discussion In mammalian cells, the ER Ca2+ store is essential for cytosolic Ca2+ dynamics and regulates cell functions including ER stress and death (Mekahli et al., 2011). ER Ca2+ homeostasis is preserved by unloading Ca2+ through IP3Rs and RyRs and reloading via SERCA (Berridge, 2009; Berridge et al., 2003). However, little information is available about plants’ ER Ca2+ homeostasis and its contribution to cytosolic and nucleosolic Ca2+ dynamics. Using GCaMP variants fused with a protein or tag of interest to detect intraorganellar Ca2+ dynamics is therefore of great importance. In this study, the high-affinity Ca2+ reporter GCaMP6m fused with an NES or NLS sequence, and the lowaffinity Ca2+ reporter R-CEPIAer fused with CRT1a, were used to monitor the changes of [Ca2+]cyt, [Ca2+]nuc, and [Ca2+]er in response to three stimuli in Arabidopsis root cells, respectively. We found that osmotic stress and ABA induce increases in [Ca2+]cyt, [Ca2+]nuc, and [Ca2+]er. However, CCh induced increases in [Ca2+]cyt and [Ca2+]nuc and a decrease in [Ca2+]er. In addition, OICIcyt, AICOcyt, and CICIcyt were impaired by GdCl3 and EGTA, but not TG. Moreover, OICInuc, AICOnuc, and CICInuc were impaired by TG and EGTA, but not by GdCl3. Therefore, we can conclude that the increases in [Ca2+]cyt that were triggered by these three stimuli are mainly attributable to extracellular Ca2+ influx, whereas the increases in [Ca2+]nuc are mediated by ER Ca2+ release. Using NES-GCaMP6m and NLS-GCaMP6m, we showed that osmotic stress induced increases in [Ca2+]cyt and [Ca2+]nuc, respectively, in agreement with our previous results using an organelle-targeting Cameleon YC3.6 indicator (NES-YC and NLS-YC) (Huang et al., 2017). In addition, the value of ΔF/Frest reached ∼0.6 for [Ca2+]cyt and [Ca2+]nuc, respectively, when we used GCaMP6m to monitor [Ca2+]. However, the value of ΔEapp/Eapprest was ∼0.16 for [Ca2+]cyt and 0.82 for [Ca2+]nuc in the root cells of the NES-YC and NLS-YC plants. These results suggested that GCaMP6m is more sensitive to and suitable for detecting [Ca2+]cyt in response to a stimulus than YC is in plant cells, because the distribution of indicator proteins in the cytoplasm was more dispersed that that in the nucleus. A previous study showed that extracellular ABA triggers repetitive increases in [Ca2+]cyt in Arabidopsis guard cells expressing yellow Cameleon 2.1 (YC2.1) (Allen et al., 1999). In this study, a similar AICOcyt value was measured in Arabidopsis root cells expressing GCaMP6m. Furthermore, AICOnuc was first detected in Arabidopsis roots cells expressing GCaMP6m. These results indicate that cytosolic and nucleosolic calcium signalling are involved in ABA-regulated growth, stress response, and gene expression in plants. CCh is widely used for the study of Ca2+ signalling in animal cells. It binds to M3 muscarinic receptors and couples with Gq/11 protein to activate phospholipase C on the plasma membrane, which hydrolyses phosphatidylinositol (4,5) bisphosphate into IP3. Ultimately, the IP3 receptor on the ER membrane is activated, causing Ca2+ er release and an increase in [Ca2+]cyt (Ding et al., 1997). In addition, Wu et al. (Wu et al., 2002) found that human transient receptor potential 4 (HTrp4) regulates CCh-induced Ca2+ cyt entry in human embryonic kidney 293 cells. In this study, we found that CCh induces increases in [Ca2+]cyt and [Ca2+]nuc in Arabidopsis root cells. More interestingly, CCh also induced a decrease in [Ca2+]er in Arabidopsis root cells. These results suggested that the role of CCh in plants is similar to its role in animal cells, although no homologues of Trp or IP3R were found in higher plant genomes. The ER is a dynamic, continuous, membrane-bound organelle required for the synthesis of proteins and lipids, and regulation of intracellular [Ca2+] (English and Voeltz, 2013). In animals, the total [Ca2+] in the ER is estimated to be 2 mM, whereas free [Ca2+] varies from 50 to 500 μM (Coe and Michalak, 2009; Meldolesi and Pozzan,
5. Conclusion Using a high-affinity variant of GCaMP with nuclear export signal (NES-GCaMP6m), and with nuclear localised signal (NLS-GCaMP6m), and a low-affinity variant of GCaMP with signal peptide sequence of the ER-localised protein Calreticulin 1a (CRT1a-R-CEPIA1er), the [Ca2+] dynamics in cytoplasm, nucleus and ER were separately monitored in response to three different stimuli in Arabidopsis root cells. We found that osmotic stress, ABA and carbachol can induce both cytosolic and nucleosolic [Ca2+] increases. Moreover, cytosolic [Ca2+] increases triggered by these three stimuli were mainly due to extracellular Ca2+ influx, and nucleosolic [Ca2+] increases induced by these three stimuli were contributed by ER Ca2+ release. In addition, ER [Ca2+] dynamics presented specific patterns in response to these three stimuli. These results provide valuable insights into intraorganellar [Ca2+] dynamics in response to different stresses in Arabidopsis root cells and prove that GCaMP imaging is a useful tool for furthering our understanding of plant organelle calcium signalling. Authors’ contributions J.L., L.C., and S.H. designed and performed most of the experiments, analysed the data, and wrote the original draft of the manuscript. F.H. and P.G. conceived and designed the experiments and offered technical advice. H.Z. and Y.W. reviewed and edited the original draft of the manuscript. S.H. directed the study, approved the final draft, and acquired funding for the study. Declaration of Competing Interest The authors declare no conflicts of interest. Acknowledgments We are grateful to Dr Yunjun Wang, Beijing Normal University, for his technical support in calcium imaging. This work was funded by the National Natural Science Foundation of China (Grant No. 31970723). Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.jplph.2020.153127. 9
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
References
Lansman, J.B., 1990. Blockade of current through single calcium channels by trivalent lanthanide cations. Effect of ionic radius on the rates of ion entry and exit. J. Gen. Physiol. 95, 679–696. Liang, F., Cunningham, K.W., Harper, J.F., Sze, H., 1997. ECA1 complements yeast mutants defective in Ca2+ pumps and encodes an endoplasmic reticulum-type Ca2+ATPase in Arabidopsis thaliana. Proc. Natl. Acad. Sci. U. S. A. 94, 8579–8584. Lock, J.T., Smith, I.F., Parker, I., 2017. Comparison of Ca2+ puffs evoked by extracellular agonists and photoreleased IP3. Cell Calcium 63, 43–47. Logan, D.C., Knight, M.R., 2003. Mitochondrial and cytosolic calcium dynamics are differentially regulated in plants. Plant Physiol. 133, 21–24. Manjarres, I.M., Chamero, P., Domingo, B., Molina, F., Llopis, J., Alonso, M.T., GarciaSancho, J., 2008. Red and green aequorins for simultaneous monitoring of Ca2+ signals from two different organelles. Pflugers Arch. 455, 961–970. McAinsh, M.R., Pittman, J.K., 2009. Shaping the calcium signature. New Phytol. 181, 275–294. Mekahli, D., Bultynck, G., Parys, J.B., De Smedt, H., Missiaen, L., 2011. Endoplasmicreticulum calcium depletion and disease. Cold Spring Harb. Perspect. Biol. 3. Meldolesi, J., Pozzan, T., 1998. The endoplasmic reticulum Ca2+ store: a view from the lumen. Trends Biochem. Sci. 23, 10–14. Miyawaki, A., Llopis, J., Heim, R., McCaffery, J.M., Adams, J.A., Ikura, M., Tsien, R.Y., 1997. Fluorescent indicators for Ca2+ based on green fluorescent proteins and calmodulin. Nature 388, 882–887. Nagai, T., Ibata, K., Park, E.S., Kubota, M., Mikoshiba, K., Miyawaki, A., 2002. A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat. Biotechnol. 20, 87–90. Nagai, T., Yamada, S., Tominaga, T., Ichikawa, M., Miyawaki, A., 2004. Expanded dynamic range of fluorescent indicators for Ca2+ by circularly permuted yellow fluorescent proteins. Proc. Natl. Acad. Sci. U. S. A. 101, 10554–10559. Nagata, T., Iizumi, S., Satoh, K., Ooka, H., Kawai, J., Carninci, P., Hayashizaki, Y., Otomo, Y., Murakami, K., Matsubara, K., et al., 2004. Comparative analysis of plant and animal calcium signal transduction element using plant full-length cDNA data. Mol. Biol. Evol. 21, 1855–1870. Nakai, J., Ohkura, M., Imoto, K., 2001. A high signal-to-noise Ca2+ probe composed of a single green fluorescent protein. Nat. Biotechnol. 19, 137–141. Nomura, H., Komori, T., Uemura, S., Kanda, Y., Shimotani, K., Nakai, K., Furuichi, T., Takebayashi, K., Sugimoto, T., Sano, S., et al., 2012. Chloroplast-mediated activation of plant immune signalling in Arabidopsis. Nat. Commun. 3, 926. Ohkura, M., Matsuzaki, M., Kasai, H., Imoto, K., Nakai, J., 2005. Genetically encoded bright Ca2+ probe applicable for dynamic Ca2+ imaging of dendritic spines. Anal. Chem. 77, 5861–5869. Palmer, A.E., Jin, C., Reed, J.C., Tsien, R.Y., 2004. Bcl-2-mediated alterations in endoplasmic reticulum Ca2+ analyzed with an improved genetically encoded fluorescent sensor. Proc. Natl. Acad. Sci. U. S. A. 101, 17404–17409. Palmer, A.E., Giacomello, M., Kortemme, T., Hires, S.A., Lev-Ram, V., Baker, D., Tsien, R.Y., 2006. Ca2+ indicators based on computationally redesigned calmodulin-peptide pairs. Chem. Biol. 13, 521–530. Parekh, A.B., James, W., Putney, J., 2005. Store-operated calcium channels. Physiol. Rev. 85, 757–810. Patterson, R.L., van Rossum, D.B., Gill, D.L., 1999. Store-operated Ca2+ entry: evidence for a secretion-like coupling model. Cell 98, 487–499. Pauly, N., Knight, M.R., Thuleau, P., van der Luit, A.H., Moreau, M., Trewavas, A.J., Ranjeva, R., Mazars, C., 2000. Control of free calcium in plant cell nuclei. Nature 405, 754–755. Plieth, C., 2001. Plant calcium signaling and monitoring: pros and cons and recent experimental approaches. Protoplasma 218, 1–23. Robert, V., Pinton, P., Tosello, V., Rizzuto, R., Pozzan, T., 2000. Recombinant aequorin as tool for monitoring calcium concentration in subcellular compartments. In: Thorner, J., Emr, S.D., Abelson, J.N. (Eds.), In Methods in Enzymology. Academic Press, pp. 440–456. Shimomura, O., 2006. Bioluminescence: Chemical Principles and Methods. World Scientific Publishing 470 pp. Stael, S., Wurzinger, B., Mair, A., Mehlmer, N., Vothknecht, U.C., Teige, M., 2012. Plant organellar calcium signalling: an emerging field. J. Exp. Bot. 63, 1525–1542. Suzuki, J., Kanemaru, K., Ishii, K., Ohkura, M., Okubo, Y., Iino, M., 2014. Imaging intraorganellar Ca2+ at subcellular resolution using CEPIA. Nat. Commun. 5, 4153. Thomas, D., Hanley, M.R., 1994. Pharmacological tools for perturbing intracellular calcium storage. In: Nuccitelli, R. (Ed.), In Methods in Cell Biology. Academic Press, pp. 65–89. Tian, L., Hires, S.A., Mao, T., Huber, D., Chiappe, M.E., Chalasani, S.H., Petreanu, L., Akerboom, J., McKinney, S.A., Schreiter, E.R., et al., 2009. Imaging neural activity in worms, flies and mice with improved GCaMP calcium indicators. Nat. Methods 6, 875. Truong, K., Sawano, A., Mizuno, H., Hama, H., Tong, K.I., Mal, T.K., Miyawaki, A., Ikura, M., 2001. FRET-based in vivo Ca2+ imaging by a new calmodulin-GFP fusion molecule. Nat. Struct. Biol. 8, 1069–1073. Vishwakarma, K., Upadhyay, N., Kumar, N., Yadav, G., Singh, J., Mishra, R.K., Kumar, V., Verma, R., Upadhyay, R.G., Pandey, M., et al., 2017. Abscisic acid signaling and abiotic stress tolerance in plants: a review on current knowledge and future prospects. Front. Plant Sci. 8, 161.
Akerboom, J., Rivera, J.D.V., Guilbe, M.M.R., Malavé, E.C.A., Hernandez, H.H., Tian, L., Hires, S.A., Marvin, J.S., Looger, L.L., Schreiter, E.R., 2009. Crystal structures of the GCaMP calcium sensor reveal the mechanism of fluorescence signal change and aid rational design. J. Biol. Chem. 284, 6455–6464. Allen, G.J., Kwak, J.M., Chu, S.P., Llopis, J., Tsien, R.Y., Harper, J.F., Schroeder, J.I., 1999. Cameleon calcium indicator reports cytoplasmic calcium dynamics in Arabidopsis guard cells. Plant J. 19, 735–747. Allen, G.J., Chu, S.P., Harrington, C.L., Schumacher, K., Hoffmann, T., Tang, Y.Y., Grill, E., Schroeder, J.I., 2001. A defined range of guard cell calcium oscillation parameters encodes stomatal movements. Nature 411, 1053–1057. Alonso, M.T., Manjarrés, I.M., García-Sancho, J., 2009. Modulation of calcium signalling by intracellular organelles seen with targeted aequorins. Acta Physiol. 195, 37–49. Berridge, M.J., 2009. Inositol trisphosphate and calcium signalling mechanisms. Biochim. Biophys. Acta 1793, 933–940. Berridge, M.J., Lipp, P., Bootman, M.D., 2000. The versatility and universality of calcium signalling. Nat. Rev. Mol. Cell Biol. 1, 11–21. Berridge, M.J., Bootman, M.D., Roderick, H.L., 2003. Calcium signalling: dynamics, homeostasis and remodelling. Nat. Rev. Mol. Cell Biol. 4, 517–529. Bonza, M.C., Loro, G., Behera, S., Wong, A., Kudla, J., Costa, A., 2013. Analyses of Ca2+ accumulation and dynamics in the endoplasmic reticulum of Arabidopsis root cells using a genetically encoded Cameleon sensor. Plant Physiol. 163, 1230–1241. Bootman, M.D., Fearnley, C., Smyrnias, I., MacDonald, F., Roderick, H.L., 2009. An update on nuclear calcium signalling. J. Cell. Sci. 122, 2337–2350. Charpentier, M., Oldroyd, G.E., 2013. Nuclear calcium signaling in plants. Plant Physiol. 163, 496–503. Chen, T.W., Wardill, T.J., Sun, Y., Pulver, S.R., Renninger, S.L., Baohan, A., Schreiter, E.R., Kerr, R.A., Orger, M.B., Jayaraman, V., et al., 2013. Ultrasensitive fluorescent proteins for imaging neuronal activity. Nature 499, 295–300. Christensen, A., Svensson, K., Thelin, L., Zhang, W., Tintor, N., Prins, D., Funke, N., Michalak, M., Schulze-Lefert, P., Saijo, Y., et al., 2010. Higher plant calreticulins have acquired specialized functions in Arabidopsis. PLoS One 5 e11342-e11342. Clough, S.J., Bent, A.F., 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735–743. Coe, H., Michalak, M., 2009. Calcium binding chaperones of the endoplasmic reticulum. General Physiology and Biophysics 28 Spec No Focus F96–F103. Corso, M., Doccula, F.G., de Melo, J.R.F., Costa, A., Verbruggen, N., 2018. Endoplasmic reticulum-localised CCX2 is required for osmotolerance by regulating ER and cytosolic Ca2+ dynamics in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 115, 3966–3971. Curie, T., Rogers, K.L., Colasante, C., Brulet, P., 2007. Red-shifted aequorin-based bioluminescent reporters for in vivo imaging of Ca2+ signaling. Mol. Imaging 6, 30–42. Ding, K.H., Husain, S., Akhtar, R.A., Isales, C.M., Abdel-Latif, A.A., 1997. Inhibition of muscarinic-stimulated polyphosphoinositide hydrolysis and Ca2+ mobilization in cat iris sphincter smooth muscle cells by cAMP-elevating agents. Cell. Signal. 9, 411–421. Dodd, A.N., Kudla, J., Sanders, D., 2010. The language of calcium signaling. Annu. Rev. Plant Biol. 61, 593–620. Edel, K.H., Marchadier, E., Brownlee, C., Kudla, J., Hetherington, A.M., 2017. The evolution of calcium-based signalling in plants. Curr. Biol. 27, R667–R679. English, A.R., Voeltz, G.K., 2013. Endoplasmic reticulum structure and interconnections with other organelles. Cold Spring Harb. Perspect. Biol. 5, a013227. Griffin, C.S., Thornbury, K.D., Hollywood, M.A., Sergeant, G.P., 2018. Muscarinic receptor-induced contractions of the detrusor are impaired in TRPC4 deficient mice. Sci. Rep. 8, 9264. Huang, F., Luo, J., Ning, T., Cao, W., Jin, X., Zhao, H., Wang, Y., Han, S., 2017. Cytosolic and nucleosolic calcium signaling in response to osmotic and salt stresses are independent of each other in roots of Arabidopsis seedlings. Front. Plant Sci. 8, 1648. Hwang, I., Sze, H., Harper, J.F., 2000. A calcium-dependent protein kinase can inhibit a calmodulin-stimulated Ca2+ pump (ACA2) located in the endoplasmic reticulum of Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 97, 6224–6229. Islam, M.M., Hossain, M.A., Jannat, R., Munemasa, S., Nakamura, Y., Mori, I.C., Murata, Y., 2010. Cytosolic alkalization and cytosolic calcium oscillation in Arabidopsis guard cells response to ABA and MeJA. Plant Cell Physiol. 51, 1721–1730. Johnson, C., Knight, M., Kondo, T., Masson, P., Sedbrook, J., Haley, A., Trewavas, A., 1995. Circadian oscillations of cytosolic and chloroplastic free calcium in plants. Science 269, 1863–1865. Knight, M.R., Campbell, A.K., Smith, S.M., Trewavas, A.J., 1991. Transgenic plant aequorin reports the effects of touch and cold-shock and elicitors on cytoplasmic calcium. Nature 352, 524–526. Knight, M.R., Smith, S.M., Trewavas, A.J., 1992. Wind-induced plant motion immediately increases cytosolic calcium. Proc. Natl. Acad. Sci. U. S. A. 89, 4967–4971. Knight, H., Trewavas, A.J., Knight, M.R., 1996. Cold calcium signaling in Arabidopsis involves two cellular pools and a change in calcium signature after acclimation. Plant Cell 8, 489–503. Knight, H., Trewavas, A.J., Knight, M.R., 1997. Calcium signalling in Arabidopsis thaliana responding to drought and salinity. Plant J. 12, 1067–1078. Krebs, M., Held, K., Binder, A., Hashimoto, K., Den Herder, G., Parniske, M., Kudla, J., Schumacher, K., 2012. FRET-based genetically encoded sensors allow high-resolution live cell imaging of Ca2+ dynamics. Plant J. 69, 181–192.
10
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
for imaging Ca2+ dynamics of the endoplasmic reticulum. Sensors 15, 13052–13068. Wang, Q., Shui, B., Kotlikoff, M.I., Sondermann, H., 2008. Structural basis for calcium sensing by GCaMP2. Structure 16, 1817–1827. Wheeler, G.L., Brownlee, C., 2008. Ca2+ signalling in plants and green algae—changing channels. Trends Plant Sci. 13, 506–514. Wu, X., Babnigg, G., Zagranichnaya, T., Villereal, M.L., 2002. The role of endogenous human Trp4 in regulating carbachol-induced calcium oscillations in HEK-293 cells. J. Biol. Chem. 277, 13597–13608.
Wagner, S., De Bortoli, S., Schwarzlander, M., Szabo, I., 2016. Regulation of mitochondrial calcium in plants versus animals. J. Exp. Bot. 67, 3809–3829. Waldeck-Weiermair, M., Alam, M.R., Khan, M.J., Deak, A.T., Vishnu, N., Karsten, F., Imamura, H., Graier, W.F., Malli, R., 2012. Spatiotemporal correlations between cytosolic and mitochondrial Ca2+ signals using a novel red-shifted mitochondrial targeted cameleon. PLoS One 7, e45917. Waldeck-Weiermair, M., Bischof, H., Blass, S., Deak, A.T., Klec, C., Graier, T., Roller, C., Rost, R., Eroglu, E., Gottschalk, B., et al., 2015. Generation of red-shifted cameleons
11
Contents lists available at ScienceDirect
Journal of Plant Physiology journal homepage: www.elsevier.com/locate/jplph
Intraorganellar calcium imaging in Arabidopsis seedling roots using the GCaMP variants GCaMP6m and R-CEPIA1er
T
Jin Luo1, Lvli Chen1, Feifei Huang, Ping Gao, Heping Zhao, Yingdian Wang, Shengcheng Han* Beijing Key Laboratory of Gene Resource and Molecular Development, College of Life Sciences, Beijing Normal University, Beijing 100875, China
ARTICLE INFO
ABSTRACT
Keywords: Calcium imaging NES-GCaMP6m NLS-GCaMP6m CRT1a-R-CEPIA1er Arabidopsis seedling roots
Ca2+ acts as a universal second messenger in eukaryotes. In animals, a wide variety of environmental and developmental stimuli trigger Ca2+ dynamics in organelles, such as the cytoplasm, nucleus, and endoplasmic reticulum (ER). However, ER Ca2+ ([Ca2+]er) homeostasis and its contributions in cytosolic and/or nucleosolic Ca2+ dynamics in plants remain elusive. GCaMPs are comprised of a circularly permutated form of enhanced green fluorescent protein fused to calmodulin and myosin light-chain kinase M13 and used for monitoring Ca2+ dynamics in mammalian cells. Here, we targeted a high-affinity variant of GCaMP with nuclear export signal in the cytoplasm (NES-GCaMP6m), with a nuclear-localised signal in the nucleus (NLS-GCaMP6m), and a lowaffinity variant of GCaMP, also known as calcium-measuring organelle-entrapped protein indicators (CEPIA), with a signal peptide sequence of the ER-localised protein Calreticulin 1a in the ER lumen (CRT1a-R-CEPIA1er) for intraorganellar Ca2+ imaging in Arabidopsis. We found that cytosolic Ca2+ ([Ca2+]cyt) increases induced by 250 mM sorbitol as an osmotic stress stimulus, 50 μM abscisic acid (ABA), or 1 mM carbachol (CCh) were mainly due to extracellular Ca2+ influx, whereas nucleosolic Ca2+ ([Ca2+]nuc) increases triggered by osmotic stress, ABA, or CCh were contributed by [Ca2+]er release. In addition, [Ca2+]er dynamics presented specific patterns in response to different stimuli such as osmotic stress, ABA, or CCh, indicating that Ca2+ signalling occurs in the ER in plants. These results provide valuable insights into subcellular Ca2+ dynamics in response to different stresses in Arabidopsis root cells and prove that GCaMP imaging is a useful tool for furthering our understanding of plant organelle functions.
1. Introduction Ca2+ acts as a second messenger to regulate a number of biological processes in eukaryotes, such as gene expression, fertilisation, cell proliferation, development, and responses to various biotic and abiotic stresses (Berridge et al., 2000; Dodd et al., 2010). Various stimuli induce [Ca2+] increases in the cytoplasm (Berridge et al., 2003) as well as in organelles such as the nucleus (Charpentier and Oldroyd, 2013; Huang et al., 2017; Krebs et al., 2012), chloroplasts (McAinsh and Pittman, 2009; Nomura et al., 2012), mitochondria (Wagner et al., 2016), and ER (Bonza et al., 2013), which are shaped by the channels, pumps, and carriers localised on the plasma membrane and organelle
membranes. The heterogeneity of Ca2+ distribution in different cellular compartments is the foundation of Ca2+ signalling. In plants, the main calcium stores are the vacuole, ER, and apoplast, which have free [Ca2+] in the millimolar range. However, the free [Ca2+] in the cytoplasm, nucleus, chloroplast, and mitochondria is approximately 100–200 nM (Stael et al., 2012). The resulting ∼5,000-fold difference between calcium stores and the protoplast space enables the generation of calcium signals via the rapid entering of Ca2+ into the protoplast through membrane-localised Ca2+-permeable channels in response to environmental and developmental stimuli. Then Ca2+ is transported into the Ca2+ stores by Ca2+ pumps and carriers to recover to the resting low level of [Ca2+]cyt (Bonza et al., 2013; Edel et al., 2017;
Abbreviations: ABA, abscisic acid; CCh, carbachol; TG, thapsigargin; ER, endoplasmic reticulum; NES, nuclear export signal; NLS, nuclear-localised signal; GECI, genetically-encoded calcium indicator; NES-GCaMP6m, cytoplasm-localised GCaMP6m indicator protein; NLS-GCaMP6m, nuclear-localised GCaMP6m indicator protein; CRT1a-R-CEPIA1er, ER-targeted red calcium-measuring organelle-entrapped protein indicator 1; SERCA, Sarco/ER Ca2+-dependent ATPase; OICIcyt, osmotic stress-induced [Ca2+]cyt increase; OICInuc, osmotic stress-induced [Ca2+]nuc increase; AICOcyt, ABA-induced [Ca2+]cyt oscillation; AICOnuc, ABA-induced [Ca2+]nuc oscillation; CICIcyt, CCh-induced [Ca2+]cyt increase; CICInuc, CCh-induced [Ca2+]nuc increase ⁎ Corresponding author. E-mail address: [email protected] (S. Han). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.jplph.2020.153127 Received 5 December 2019; Received in revised form 14 January 2020; Accepted 14 January 2020 Available online 23 January 2020 0176-1617/ © 2020 Elsevier GmbH. All rights reserved.
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
sequence to visualise Ca2+ dynamics in different Ca2+ stores of mammalian cells (Suzuki et al., 2014). In eukaryotic cells, the ER, which represents an essential Ca2+ storage organelle, connects with the nucleus to form a contiguous lumen and releases Ca2+ into the cytoplasm and nucleoplasm in response to various stimuli (Berridge, 2009; Bootman et al., 2009; Huang et al., 2017; Krebs et al., 2012). ER luminal Ca2+ dynamics are critical to many functions of the ER. The overload and depletion of ER Ca2+ stores have detrimental effects on the entire cell (Coe and Michalak, 2009). In mammalian cells, Ca2+ is released from the ER upon stimulation via inositol 1,4,5-trisphosphate receptors (IP3Rs) and ryanodine receptors (RyRs) and reloaded into the ER lumen through sarco-endoplasmic reticulum Ca2+-ATPase (SERCA), which restores the [Ca2+]er to its original high level (Berridge, 2009; Berridge et al., 2003). In addition, depletion of ER Ca2+ store leads to activation of the plasma membrane-localised calcium release-activated channel Orai1 by ER membrane-localised stromal interaction molecule 1 (STIM1), also known as the store-operated calcium entry (SOCE) (Parekh et al., 2005; Patterson et al., 1999). It has been reported that plants contain two major types of Ca2+ pumps ― ECA (for ER-type Ca2+-ATPase) and ACA (for autoinhibited Ca2+-ATPase), and CaCAs (Ca2+/cation antiporters). Accordingly, ECA1, ACA2, and CCX2 have been shown to be localised to the ER membrane (Corso et al., 2018; Hwang et al., 2000; Liang et al., 1997). However, their contribution to cytosolic, nucleosolic, and ER Ca2+ dynamics needs further investigation. In addition, IP3 is a secondary messenger in plants, but Orai1, IP3Rs, and STIM1 are absent from land plants (Edel et al., 2017; Wheeler and Brownlee, 2008). Therefore, the role of the ER in Ca2+ dynamics in plant cells is still unclear. Here, we generated transgenic Arabidopsis plants expressing NES-GCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er that separately targeted the cytoplasm, nucleus, and ER by fusing to specific organelletargeted signal sequences with Ca2+ indicator proteins. Using this toolkit, we monitored the dynamics of [Ca2+]cyt, [Ca2+]nuc, and [Ca2+]er in response to three stimuli with different pharmacologic manipulations of the calcium store. The results showed that the different stimuli triggered changes in [Ca2+]cyt, [Ca2+]nuc, and [Ca2+]er, and the increases of [Ca2+]cyt and [Ca2+]nuc in response to stimuli were attributable to Ca2+ influx from the extracellular space and to Ca2+ release from the ER in Arabidopsis root cells, respectively.
McAinsh and Pittman, 2009). Therefore, various tools for investigating Ca2+ dynamics with high temporal and spatial resolution are required to elucidate the contribution of different cellular compartments to calcium signalling. Because of the lack of subcellular targeting information and their inaccessibility for loading, calcium dyes are not suitable for monitoring spatiotemporal changes of [Ca2+] in plants. Therefore, instead, genetically encoded calcium indicators (GECIs) fused with a protein or tag of interest are used to detect Ca2+ dynamics in specific subcellular locations in transgenic plants. GECIs can be classified into three types: chemiluminescent reporters, based on the aequorin photoprotein (Robert et al., 2000); Cameleon, a fluorescence resonance energy transfer (FRET)-based Ca2+ indicator protein, comprises a cyan fluorescent protein (CFP), calmodulin (CaM), a Ca2+ binding protein, and the myosin light-chain kinase M13 (MLCK), which interacts with Ca2+bound CaM and a yellow-fluorescent-protein (YFP) variant (Miyawaki et al., 1997); and the single fluorophore sensor GCaMP, a circularly permutated form of enhanced green fluorescent protein (cpEGFP) that is fused to CaM and MLCK (Nakai et al., 2001; Ohkura et al., 2005). The aequorin-based system was established to determine [Ca2+]cyt in whole plants in response to a number of signals (Knight et al., 1991, 1992, 1996, 1997), as well as the calcium level in the nucleus (Pauly et al., 2000), mitochondrion (Logan and Knight, 2003), and chloroplast (Johnson et al., 1995). However, the low turnover rate of the luminescent reaction and low light emission of aequorin limited the spatiotemporal resolution of [Ca2+] in whole plants (Plieth, 2001; Shimomura, 2006). These problems were overcome by fusion with green (GFP) or red (RFP) fluorescent protein to independently monitor [Ca2+] in various subcellular domains within mammalian cells, which triggers the intramolecular chemiluminescence resonance energy transfer that shifts the luminescence emission towards the wavelength of the fluorescent protein (Alonso et al., 2009; Curie et al., 2007; Manjarres et al., 2008). However, no aequorin-GFP/RFP fusion protein has been applied to monitor [Ca2+] in plants. A huge variety of Cameleons with different Ca2+ sensitivities for organelle-specific Ca2+ in various cellular organelles have been generated via point-mutations of YFP, CaM, or MLCK, and used to determine [Ca2+] in the mitochondria, nucleus, cytosol, ER, Golgi apparatus, or endosomes of single living cells (Nagai et al., 2002, 2004; Palmer et al., 2004, 2006; Truong et al., 2001; Waldeck-Weiermair et al., 2012, 2015). We and other groups have determined the [Ca2+] in the cytosol and nucleus using organelle-targeted Cameleon YC 3.6 in response to various stimuli in plants (Huang et al., 2017; Krebs et al., 2012). On the basis of FRET, Cameleons have the advantages of accuracy and broad applicability for calcium signalling in eukaryotes; however, they also have the disadvantages of complicated operation and insensitivity to slight [Ca2+] changes in subcellular domains. Therefore, GCaMPs, another type of GECI, which are simple to use and exhibit a high signal-to-noise ratio for [Ca2+] changes in response to stimuli, can be used for monitoring calcium signalling at the subcellular level. Nakai et al. (2001) showed that the fluorescence changes of GCaMP in response to the application of drugs or electrical stimulation were up to ∼4.5-fold in living cells, and GCaMP exhibited an apparent dissociation constant (Kd) for Ca2+ of 235 nM in vitro. Based on the three-dimensional structures of GCaMP2 with or without Ca2+ (Akerboom et al., 2009; Wang et al., 2008), a series of improved GCaMP variants was developed using a combination of protein structure–guided mutagenesis and semi-rational library screening methods (Chen et al., 2013; Suzuki et al., 2014; Tian et al., 2009). GCaMP6 indicators (including GCaMP6f, GCaMP6m, and GCaMP6s) have a higher sensitivity for Ca2+ than commonly used synthetic calcium dyes and can be used to detect individual action potentials with high reliability in neuronal cells (Chen et al., 2013). In addition, low-affinity Ca2+binding CEPIA1 (Calcium-measuring organelle-Entrapped Protein Indicator 1) generated by a point mutation of GCaMP2 had a Kd for Ca2+ of 500–600 μM in vitro and fused with an organelle-retention signal
2. Materials and methods 2.1. DNA constructs The NES (nuclear export signal) and NLS (nuclear localisation signal) sequences (described in Huang et al., 2017) were fused to the Nterminus of GCaMP6m from the pGP-CMV-GCaMP6m vector Addgene plasmid #40754 Chen et al., 2013) using the forward primer 5′-ATGC TGCAGAACGAGCTTGCTCTTAAGTTGGCTGGACTTGATATTAACAAGA CTGGAGGAATGGGTTCTCATCATCATCATCATC-3′ (NES sequence underlined) or 5′-ATGCTGCAGCCTAAGAAGAAGAGAAAGGTTGGAGGAA TGGGTTCTCATCATCATCATCATC-3′ (NLS sequence underlined) and the reverse primer 5′-ACCTCTACAAATGTGGTATGGCTG-3′, respectively. The PCR products were subcloned into a pJET1.2/blunt cloning vector (CloneJET PCR Cloning Kit #K1231; Thermo Scientific, USA). Next, the sequences were digested with BamHI and NotI and cloned into the pENTR™1A vector (Invitrogen, USA). Finally, pENTR™1A-NESGCaMP6m and pENTR™1A-NLS-GCaMP6m were separately digested with ApalI and recombined with the pCAMBIA2300-Ubi destination vector using a Gateway LR II kit (Invitrogen, USA) to generate UBI:NESGCaMP6m and UBI:NLS-GCaMP6m constructs. The first 66-bp signal peptide sequence of the ER-localised protein Calreticulin 1a (CRT1a; At1g56340) (Christensen et al., 2010) was synthesised using the forward primer 5′-ATGGCGAAACTAAACCCTAA ATTCATCTCTTTGATTCTTTTCGCTCTCGTGGTGATCGTCTCTGCT-3′ and the reverse primer 5′-AGCAGAGACGATCACCACGAGAGCGAAAA 2
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
(TG), and with 200 μL of Ca2+-free bathing solution buffer plus 2 mM ethylene glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA). To monitor the fluorescence signals in the roots of transgenic plants, we used an inverted fluorescence microscope (Axio Observer A1; Zeiss) equipped with an iXon3 EMCCD camera (Oxford Instruments, UK), a Lambda DG4 fluorescent light source (Sutter Instruments, USA), Bright Line filter sets (Semrock Inc., USA), and MetaFluor software (Molecular Devices, USA). Dynamic calcium images were collected every 2 s at room temperature through a 40× oil objective lens (N.A.1.30; Zeiss). GCaMP6m fluorescence was excited at 482 ± 18 nm and collected at 520 ± 28 nm. R-CEPIA1er fluorescence was excited at 559 ± 34 nm and collected at 630 ± 69 nm. The fluorescence data were collected and analysed using MATLAB R2014a software and plotted using GraphPad Prism 5.0 software. The average fluorescence change in response to each stimulus represents the mean value of 20–30 root cells from at least six independent seedlings, each of which provided three to six root cells. Analysis of statistical significance was performed using unpaired Student’s t-test in GraphPad Prism 5.0 software. The results are presented as the means ± standard deviation (SD).
GAATCAAAGAGATGAATTTAGGGTTTAGTTTCGCCAT-3′ and cloned into vector pENTR™1A between the DraI and BamHI sites. Next, the RCEPIA1er fragment was digested using BamHI and XbaI from the pCMVR-CEPIA1er vector Addgene plasmid # 58,216 Suzuki et al., 2014) and ligated into pENTR™1A-CRT1a to generate the construct pENTRY1ACRT1a-R-CEPIA1er. Finally, CRT1a-R-CEPIA1er was recombined into the pMDC32-Ubi destination vector using a Gateway LR II kit (Invitrogen) to generate the UBI: CRT1a-R-CEPIA1er construct. All constructs were confirmed via sequencing. 2.2. Arabidopsis growth and transformation Seed germination and growth of Arabidopsis thaliana (Col-0 ecotype) seedlings were performed as described previously (Huang et al., 2017). The constructs UBI:NES-GCaMP6m, UBI:NLS-GCaMP6m, and UBI: CRT1a-R-CEPIA1er were separately introduced into Agrobacterium GV3101, and transformed into Arabidopsis plants to generate the NESGCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er transgenic lines using the floral-dip method (Clough and Bent, 1998). The transformants were selected on 1/2 Murashige and Skoog (MS) medium containing 50 mg/mL hygromycin B (Sigma-Aldrich, USA). The three independent lines of T3-generation homozygous transformants carrying a single insertion were used in subsequent experiments.
3. Results 3.1. Subcellular localisation of NES-GCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er
2.3. Subcellular localisation of NES-GCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er in the roots and guard cells of transgenic Arabidopsis lines
In order to detect Ca2+ dynamics in the cytoplasm, nucleus, and ER, we generated transgenic Arabidopsis plants expressing a high-affinity variant of GCaMP in the cytoplasm (NES-GCaMP6m) or nucleus (NLSGCaMP6m), and a low-affinity variant of GCaMP in the ER lumen (CRT1a-R-CEPIA1er). First, we fused the NES or NLS sequence to the Nterminus of GCaMP6m to generate the plant expression vector NESGCaMP6m or NLS-GCaMP6m, and the first 66-bp signal peptide sequence of CRT1a to the N-terminus of R-CEPIA1 to generate CRT1a-RCEPIA1er (Figure S1). After transforming viaAgrobacterium GV3101 and screening using antibiotics, the single-insertion homozygous transgenic plants were ready to use for assaying the subcellular localisation of GCaMP6m and R-CEPIA1er. We found that NES-GCaMP6m was localised in the cytoplasm, NLS-GCaMP6m in the nucleus, and CRT1a-RCEPIA1er in the ER in the mature root zones of five-day-old transgenic Arabidopsis seedlings (Fig. 1). However, the fluorescence produced by GCaMP6m and R-CEPIAer in guard cells of four-week-old rosette leaves was negligible, because GCaMP6m and R-CEPIA1er lacking the intact GFP or RFP (Chen et al., 2013; Suzuki et al., 2014) lead their fluorescence weak and interference by chloroplast auto-fluorescence (Figure S2). Therefore, we only used NES-GCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er to monitor Ca2+ dynamics in the cytoplasm, nucleus, and ER of Arabidopsis root cells, respectively.
Five-day-old seedlings of the NES-GCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er transgenic lines were placed on glass slides filled with 1/2 MS incubation buffer. The fluorescence in the root cells was observed under 20× magification (Plan-Apochromat 20×/0.8 M27 objective). GCaMP6m fluorescence was excited at 488 nm and collected at 518–550 nm, and R-CEPIA1er fluorescence was excited at 555 nm and collected at 585–640 nm; the pinhole size was 1 AU. The autofluorescence was excited at 488 nm and collected at 580 nm. In addition, the leaves of four-week-old transgenic Arabidopsis were used to assess the subcellular localisation of NES-GCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er in guard cells. The epidermis of the leaves was immersed in 1/2 MS incubation buffer. To ensure that stomata were fully opened, the glass slides were placed in a growth chamber under 2 h of light exposure. Guard cells were observed under a 63× magnification (Plan-Apochromat 63×/1.4 oil objective). Other image acquisition parameters were the same as those for root cells. Fluorescence was visualised using a Zeiss LSM 700 confocal microscope (Zeiss, Germany). 2.4. Measurement of [Ca2+] in NES-GCaMP6m, NLS-GCaMP6m, and CRT1a-R-CEPIA1er transgenic lines
3.2. Osmotic stress-induced [Ca2+]cyt increase (OICIcyt) was mainly due to extracellular Ca2+ influx, whereas osmotic stress-induced [Ca2+]nuc increase (OICInuc) was due to ER Ca2+ release
After germination, Arabidopsis seedlings were grown vertically in half-strength MS medium for five to seven days and their roots were prepared for Ca2+ imaging following the method of Huang et al. (2017). The roots were immobilised on coverslips using 1 % (w/v) lowmelting-point agarose (Amresco, USA) and exposed for Ca2+ imaging by digging a small tunnel in the agarose. The coverslips were placed on Attofluor® Cell Chambers (Invitrogen) to form a perfusion chamber. Seedlings were preincubated with 200 μL of bathing solution buffer (1/ 2 MS, 1 % sucrose, and 10 mM 2-(N-morpholino)ethanesulphonic acid (MES), using potassium hydroxide for pH adjustment to 5.8) for 30–40 min and the mature zone of the Arabidopsis roots was selected for Ca2+ measurements. For stimuli treatments, an equal volume of 500 mM sorbitol, 100 μM ABA, or 1 mM CCh in the same bathing solution buffer was separately perfused into the chamber. For pharmacologic manipulations of calcium stores, seedlings were preincubated with 200 μL of bathing solution buffer containing 1 mM GdCl3 or 10 μM thapsigargin
The five-day-old Arabidopsis seedlings expressing NES-GCaMP6m and NLS-GCaMP6m were used to monitor changes in [Ca2+]cyt and [Ca2+]nuc in response to 250 mM sorbitol, respectively. We found that osmotic stress triggers a rapid increase in [Ca2+]cyt (OICIcyt) or [Ca2+]nuc (OICInuc) in the mature root-cell zone in NES-GCaMP6m (Fig. 2A-C) or NLS-GCaMP6m (Fig. 2D-F) plants, respectively, and the ΔF/Frest value reached ∼0.6 for both [Ca2+]cyt and [Ca2+]nuc. GdCl3, a trivalent lanthanide cation, is used to compete with Ca2+ for a channel binding site and block current flow through voltage-gated calcium channels (Lansman, 1990). TG inhibits SERCA, leading to the depletion of the ER Ca2+ storage and an increase in [Ca2+]cyt (Thomas and Hanley, 1994), and EGTA is a calcium chelator. Therefore, we pretreated root cells with these three compounds to study the roles of the 3
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
Fig. 1. Subcellular localisation of NES-GCaMP6m, NLS-GCaMP6m, and CTR1a-R-CEPIA1er in the roots of stable transgenic Arabidopsis lines. The fluorescence signals of NES-GCaMP6m (A), NLS-GCaMP6m (B), and CTR1a-R-CEPIA1er (C) were detected in the root cells of five-day-old transgenic Arabidopsis seedlings. Green or red fluorescence indicates GCaMP6m or R-CEPIA1er, respectively. Autofluorescence (AF) indicates chloroplastic autofluorescence. Merge indicates the combination of green or red fluorescence with AF. WL indicates white light background. The images were obtained from one optic section using a Zeiss LSM 700 confocal microscope. Scale bars, 20 μm. At least three independent experiments were performed.
calcium stores in OICIcyt and OICInuc. Both GdCl3 and EGTA inhibited OICIcyt, and EGTA had a more significant effect on OICIcyt than did GdCl3. However, TG had no effect on OICIcyt (Fig. 2A-C). In addition, OICInuc was impaired by TG and EGTA, but not by GdCl3 (Fig. 2D-F). Furthermore, we monitored the change of [Ca2+]er with prolonged incubation of 1 mM GdCl3, 10 μM TG, or 2 mM EGTA, respectively, and found that TG and EGTA, but not GdCl3, markedly decrease the [Ca2+]er in the root cells of transgenic Arabidopsis lines containing CRT1a-R-CEPIA1er (Figure S3). These results indicated that long-term incubation of EGTA in bathing solution chelates both extracellular and ER Ca2+, which is the reason for EGTA decreasing both OICIcyt and OICInuc in Arabidopsis root cells.
GCaMP6m after adding stimulating buffer for 300 s (Fig. 3D-F). Furthermore, we used GdCl3, TG, or EGTA to pretreat Arabidopsis root cells, and found that AICOcyt is impaired by GdCl3 and EGTA, but not by TG; and AICOnuc was impaired by TG and EGTA, but not by GdCl3. These results suggested that AICOcyt contributes to Ca2+ influx from the extracellular space, and AICOnuc to Ca2+ release from the ER, which is in accordance with the role of Ca2+ storage on OICIcyt and OICInuc in Arabidopsis root cells.
3.3. ABA-induced [Ca2+]cyt oscillation (AICOcyt) was impaired by GdCl3 and EGTA, but not by TG; and ABA-induced [Ca2+]nuc oscillation (AICOnuc) was impaired by TG and EGTA, but not by GdCl3
In animal cells, CICIcyt is mediated by ER-localised IP3 receptors (Ding et al., 1997; Lock et al., 2017) and/or plasma membrane-localised transient receptor potential (TRP) channels (Griffin et al., 2018; Wu et al., 2002). However, the presence of CICIcyt and CICInuc in plants remains elusive. Here, we found that 1 mM CCh triggers the [Ca2+]cyt and [Ca2+]nuc increases in the root cells of transgenic Arabidopsis lines containing NES-GCaMP6m and NLS-GCaMP6m, respectively (Fig. 4). In addition, GdCl3 and EGTA, but not TG, impaired CICIcyt (Fig. 4A-C); and TG and EGTA, but not GdCl3, disrupted CICInuc (Fig. 4D-F). These results indicate that the Ca2+ ext is essential for stimulus-triggered increases
3.4. CCh-induced [Ca2+]cyt increase (CICIcyt) was impaired by GdCl3 and EGTA, but not by TG; and CCh-induced [Ca2+]nuc increase (CICInuc) was impaired by TG and EGTA, but not by GdCl3
Previous studies showed that ABA induces [Ca2+]cyt oscillations to regulate plant growth, development, and adaption to environmental stress (Allen et al., 2001; Islam et al., 2010; Vishwakarma et al., 2017). Accordingly, AICOcyt occurred in the root cells of transgenic Arabidopsis lines containing NES-GCaMP6m (Fig. 3A-C). In addition, we observed AICOnuc in the root cells of transgenic Arabidopsis lines containing NLS4
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
Fig. 2. The osmotic stress-induced [Ca2+]cyt increase (OICIcyt) was impaired by GdCl3 and EGTA, but not by TG; whereas the osmotic stressincrease induced [Ca2+]nuc (OICInuc) was impaired by TG and EGTA, but not by GdCl3. (A) and (D): Changes in [Ca2+]cyt (A) or [Ca2+]nuc (D) in response to osmotic stress (250 mM sorbitol) were monitored in the root cells of the NES-GCaMP6m or NLSGCaMP6m transgenic lines with or without pretreatment with 1 mM GdCl3, 10 μM TG, or 2 mM EGTA. Regions of interest (ROI) are indicated by black-bordered rectangles and ovals in (A) and (D), respectively, and were used to monitor [Ca2+]cyt in (B) and (C), and [Ca2+]nuc in (E) and (F), respectively, in Arabidopsis root cells expressing NES-GCaMP6m or NLSGCaMP6m. Relative [Ca2+]cyt or [Ca2+]nuc is represented by the change in emission fluorescence (ΔF/Frest) (pseudo-colour bar at bottom right). Scale bars, 50 μm. (B) and (E): Time course of OICIcyt (B) and OICInuc (E) in Arabidopsis root cells expressing NESGCaMP6m or NLS-GCaMP6m with or without pretreatment with 1 mM GdCl3, 10 μM TG, or 2 mM EGTA. (C) and (F): Effects of pretreatments on OICIcyt (C) and OICInuc (F) in root cells. The treatments were similar to those described in (B) and (E) (n = 25–35 cells from at least six different seedlings, each of which provided four to six root cells). Error bars indicate standard deviation (SD). NS, no significance change; *, P < 0.05 (unpaired Student’s t-test).
5
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
Fig. 3. The ABA-induced [Ca2+]cyt oscillation (AICOcyt) was disrupted by GdCl3 and EGTA, but not by TG; whereas the ABA-induced [Ca2+]nuc oscillation (AICOnuc) was disrupted by TG and EGTA, but not by GdCl3. (A) and (D): Changes in [Ca2+]cyt (A) and [Ca2+]nuc (D) in response to 50 μM ABA were monitored in the root cells of the NES-GCaMP6m and NLS-GCaMP6m transgenic lines, respectively, with or without pretreatment with 1 mM GdCl3, 10 μM TG, or 2 mM EGTA. The ROI indicated by black-bordered rectangles and ovals in (A) and (D), respectively, were used to monitor [Ca2+]cyt in (B) and (C) and [Ca2+]nuc in (E) and (F), respectively, in Arabidopsis root cells expressing NESGCaMP6m or NLS-GCaMP6m. Relative [Ca2+]cyt or [Ca2+]nuc is represented by emission fluorescence changes (ΔF/Frest) (pseudo-colour bar at bottom right). Scale bars, 50 μm. (B) and (E): Time course of AICOcyt (B) and AICOnuc (E) in Arabidopsis root cells expressing NES-GCaMP6m or NLS-GCaMP6m with or without pretreatment with 1 mM GdCl3, 10 μM TG, or 2 mM EGTA. (C) and (F): Effects of pretreatments on AICOcyt (C) and AICOnuc (F) in root cells. The treatments were similar to those described in (B) and (E) (n = 25–35 cells from at least six seedlings, each of which provided four to six root cells). Error bars indicate SD. NS, no significance change; *, P < 0.05 (unpaired Student’s t-test).
6
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
Fig. 4. The CCh-induced [Ca2+]cyt increase (CICIcyt) was impaired by GdCl3 and EGTA, but not by TG; whereas the CCh-induced [Ca2+]nuc increase (CICInuc) was impaired by TG and EGTA, but not by GdCl3. (A) and (D): Changes in [Ca2+]cyt (A) and [Ca2+]nuc (D) in response to 1 mM CCh were monitored in the root cells of transgenic NESGCaMP6m or NLS-GCaMP6m lines with and without pretreatment with 1 mM GdCl3, 10 μM TG, or 2 mM EGTA. The ROI indicated by black-bordered rectangles and ovals in (A) and (D), respectively, were used to monitor [Ca2+]cyt in (B) and (C), and [Ca2+]nuc in (E) and (F), respectively, in Arabidopsis root cells expressing NES-GCaMP6m or NLS-GCaMP6m. Relative [Ca2+]cyt or [Ca2+]nuc is represented by emission fluorescence changes (ΔF/Frest) (pseudo-colour bar at bottom right). Scale bars, 50 μm. (B) and (E): Time course of CICIcyt (B) and CICInuc (E) in Arabidopsis root cells expressing NES-GCaMP6m or NLS-GCaMP6m with or without pretreatment with 1 mM GdCl3, 10 μM TG, or 2 mM EGTA. (C) and (F): Effects of pretreatments on CICIcyt (C) and CICInuc (F) in root cells. The treatments were similar to those described in (B) and (E) (n = 25–35 cells from at least six seedlings, each of which provided four to six root cells). Error bars indicate SD. NS, no significant change; *, P < 0.05 (unpaired Student’s t-test).
7
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
Fig. 5. The [Ca2+]er in Arabidopsis root cells increased in response to osmotic stress and ABA, and decreased in response to CCh. (A), (C), and (E): Changes in [Ca2+]er in response to 250 mM sorbitol (A), 50 μM ABA (C), or 1 mM CCh (E) were monitored in the root cells of the transgenic CTR1a-R-CEPIA1er line. The ROIs indicated by black-bordered rectangles in (A), (C), and (E) were used to monitor [Ca2+]er in (B), (D), and (F), respectively. Relative [Ca2+]er is represented by emission fluorescence changes (ΔF/Frest) (pseudo-colour bar at bottom right). Scale bars, 50 μm. (B), (D) and (F): Time course of relative [Ca2+]er in response to 250 mM sorbitol (B), 50 μM ABA (D), or 1 mM CCh (F) in Arabidopsis root cells expressing CTR1a-R-CEPIA1er. At least five independent experiments were performed, each of which included at least four ROI.
in [Ca2+]cyt, and ER Ca2+ storage plays a unique role in stimulustriggered increases in [Ca2+]nuc in plants.
unfolded protein response, leading to mammalian cell death and diseases (Mekahli et al., 2011). To explore the role of [Ca2+]er in cytosolic and nucleosolic Ca2+ signalling in plants, we used transgenic Arabidopsis seedlings expressing CTR1a-R-CEPIA1er to monitor [Ca2+]er dynamics under different stimuli. Firstly, 250 mM sorbitol induced a rapid increase in [Ca2+]er (Fig. 5A and B), but 50 μM ABA induced an increase in [Ca2+]er in root cells after ∼900 s (Fig. 5C and D). Interestingly, we found that the CCh-triggered [Ca2+]er decrease occurred rapidly and was sustained for 1000 s in root cells Fig. 5E and F). These
3.5. [Ca2+]er dynamics in response to osmotic-stress, ABA, and CCh in Arabidopsis root cells ER Ca2+ homeostasis is maintained by SERCA pumping Ca2+ into the ER and the ryanodine (RyR) and IP3 receptors releasing Ca2+ from the ER. ER Ca2+ dysregulation causes ER stress and activates the 8
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
results showed that ER [Ca2+] dynamics follow stimulus-specific patterns in Arabidopsis, indicating that Ca2+ signalling also occurs in the ER in plants.
1998). Although there is little data on the calcium storage properties of the ER in plants, the existence of calreticulin, a Ca2+ storage protein of the ER, in both plants and animals indicates that the ER of plants has a similar range of [Ca2+] as animals (Nagata et al., 2004). Therefore, a low-affinity and high-capacity Ca2+ indicator is required for monitoring the change of ER [Ca2+]. The Cameleon D4 variant has an in vitro Kd for Ca2+ of 195 μM (Palmer et al., 2006). Bonza et al. (2013) generated an ER-targeting Cameleon reporter protein, CRT-D4ER, by fusing Cameleon D4 with a CRT signal peptide and used this indicator protein to monitor the free [Ca2+] in the ER lumen of Arabidopsis root cells. They found that various stimuli, such as external ATP, L-Glu, and NaCl, separately triggered an increase in [Ca2+]cyt, which was accompanied by ER Ca2+ accumulation. These results are similar to our findings using CRT1a-R-CEPIAer to assess the [Ca2+]er dynamics in response to sorbitol and ABA in Arabidopsis root cells. Furthermore, CCh induced a decrease in [Ca2+]er in Arabidopsis root cells. In addition, these stimuli can induce an increase in [Ca2+]nuc in plants. We also performed pharmacologic manipulations of calcium stores using GdCl3, TG, and EGTA to evaluate their contribution to changes in [Ca2+]cyt and [Ca2+]nuc. The results suggest that the ER plays a role as a source for Ca2+ release, which contributes to the Ca2+ distribution in plants.
4. Discussion In mammalian cells, the ER Ca2+ store is essential for cytosolic Ca2+ dynamics and regulates cell functions including ER stress and death (Mekahli et al., 2011). ER Ca2+ homeostasis is preserved by unloading Ca2+ through IP3Rs and RyRs and reloading via SERCA (Berridge, 2009; Berridge et al., 2003). However, little information is available about plants’ ER Ca2+ homeostasis and its contribution to cytosolic and nucleosolic Ca2+ dynamics. Using GCaMP variants fused with a protein or tag of interest to detect intraorganellar Ca2+ dynamics is therefore of great importance. In this study, the high-affinity Ca2+ reporter GCaMP6m fused with an NES or NLS sequence, and the lowaffinity Ca2+ reporter R-CEPIAer fused with CRT1a, were used to monitor the changes of [Ca2+]cyt, [Ca2+]nuc, and [Ca2+]er in response to three stimuli in Arabidopsis root cells, respectively. We found that osmotic stress and ABA induce increases in [Ca2+]cyt, [Ca2+]nuc, and [Ca2+]er. However, CCh induced increases in [Ca2+]cyt and [Ca2+]nuc and a decrease in [Ca2+]er. In addition, OICIcyt, AICOcyt, and CICIcyt were impaired by GdCl3 and EGTA, but not TG. Moreover, OICInuc, AICOnuc, and CICInuc were impaired by TG and EGTA, but not by GdCl3. Therefore, we can conclude that the increases in [Ca2+]cyt that were triggered by these three stimuli are mainly attributable to extracellular Ca2+ influx, whereas the increases in [Ca2+]nuc are mediated by ER Ca2+ release. Using NES-GCaMP6m and NLS-GCaMP6m, we showed that osmotic stress induced increases in [Ca2+]cyt and [Ca2+]nuc, respectively, in agreement with our previous results using an organelle-targeting Cameleon YC3.6 indicator (NES-YC and NLS-YC) (Huang et al., 2017). In addition, the value of ΔF/Frest reached ∼0.6 for [Ca2+]cyt and [Ca2+]nuc, respectively, when we used GCaMP6m to monitor [Ca2+]. However, the value of ΔEapp/Eapprest was ∼0.16 for [Ca2+]cyt and 0.82 for [Ca2+]nuc in the root cells of the NES-YC and NLS-YC plants. These results suggested that GCaMP6m is more sensitive to and suitable for detecting [Ca2+]cyt in response to a stimulus than YC is in plant cells, because the distribution of indicator proteins in the cytoplasm was more dispersed that that in the nucleus. A previous study showed that extracellular ABA triggers repetitive increases in [Ca2+]cyt in Arabidopsis guard cells expressing yellow Cameleon 2.1 (YC2.1) (Allen et al., 1999). In this study, a similar AICOcyt value was measured in Arabidopsis root cells expressing GCaMP6m. Furthermore, AICOnuc was first detected in Arabidopsis roots cells expressing GCaMP6m. These results indicate that cytosolic and nucleosolic calcium signalling are involved in ABA-regulated growth, stress response, and gene expression in plants. CCh is widely used for the study of Ca2+ signalling in animal cells. It binds to M3 muscarinic receptors and couples with Gq/11 protein to activate phospholipase C on the plasma membrane, which hydrolyses phosphatidylinositol (4,5) bisphosphate into IP3. Ultimately, the IP3 receptor on the ER membrane is activated, causing Ca2+ er release and an increase in [Ca2+]cyt (Ding et al., 1997). In addition, Wu et al. (Wu et al., 2002) found that human transient receptor potential 4 (HTrp4) regulates CCh-induced Ca2+ cyt entry in human embryonic kidney 293 cells. In this study, we found that CCh induces increases in [Ca2+]cyt and [Ca2+]nuc in Arabidopsis root cells. More interestingly, CCh also induced a decrease in [Ca2+]er in Arabidopsis root cells. These results suggested that the role of CCh in plants is similar to its role in animal cells, although no homologues of Trp or IP3R were found in higher plant genomes. The ER is a dynamic, continuous, membrane-bound organelle required for the synthesis of proteins and lipids, and regulation of intracellular [Ca2+] (English and Voeltz, 2013). In animals, the total [Ca2+] in the ER is estimated to be 2 mM, whereas free [Ca2+] varies from 50 to 500 μM (Coe and Michalak, 2009; Meldolesi and Pozzan,
5. Conclusion Using a high-affinity variant of GCaMP with nuclear export signal (NES-GCaMP6m), and with nuclear localised signal (NLS-GCaMP6m), and a low-affinity variant of GCaMP with signal peptide sequence of the ER-localised protein Calreticulin 1a (CRT1a-R-CEPIA1er), the [Ca2+] dynamics in cytoplasm, nucleus and ER were separately monitored in response to three different stimuli in Arabidopsis root cells. We found that osmotic stress, ABA and carbachol can induce both cytosolic and nucleosolic [Ca2+] increases. Moreover, cytosolic [Ca2+] increases triggered by these three stimuli were mainly due to extracellular Ca2+ influx, and nucleosolic [Ca2+] increases induced by these three stimuli were contributed by ER Ca2+ release. In addition, ER [Ca2+] dynamics presented specific patterns in response to these three stimuli. These results provide valuable insights into intraorganellar [Ca2+] dynamics in response to different stresses in Arabidopsis root cells and prove that GCaMP imaging is a useful tool for furthering our understanding of plant organelle calcium signalling. Authors’ contributions J.L., L.C., and S.H. designed and performed most of the experiments, analysed the data, and wrote the original draft of the manuscript. F.H. and P.G. conceived and designed the experiments and offered technical advice. H.Z. and Y.W. reviewed and edited the original draft of the manuscript. S.H. directed the study, approved the final draft, and acquired funding for the study. Declaration of Competing Interest The authors declare no conflicts of interest. Acknowledgments We are grateful to Dr Yunjun Wang, Beijing Normal University, for his technical support in calcium imaging. This work was funded by the National Natural Science Foundation of China (Grant No. 31970723). Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.jplph.2020.153127. 9
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
References
Lansman, J.B., 1990. Blockade of current through single calcium channels by trivalent lanthanide cations. Effect of ionic radius on the rates of ion entry and exit. J. Gen. Physiol. 95, 679–696. Liang, F., Cunningham, K.W., Harper, J.F., Sze, H., 1997. ECA1 complements yeast mutants defective in Ca2+ pumps and encodes an endoplasmic reticulum-type Ca2+ATPase in Arabidopsis thaliana. Proc. Natl. Acad. Sci. U. S. A. 94, 8579–8584. Lock, J.T., Smith, I.F., Parker, I., 2017. Comparison of Ca2+ puffs evoked by extracellular agonists and photoreleased IP3. Cell Calcium 63, 43–47. Logan, D.C., Knight, M.R., 2003. Mitochondrial and cytosolic calcium dynamics are differentially regulated in plants. Plant Physiol. 133, 21–24. Manjarres, I.M., Chamero, P., Domingo, B., Molina, F., Llopis, J., Alonso, M.T., GarciaSancho, J., 2008. Red and green aequorins for simultaneous monitoring of Ca2+ signals from two different organelles. Pflugers Arch. 455, 961–970. McAinsh, M.R., Pittman, J.K., 2009. Shaping the calcium signature. New Phytol. 181, 275–294. Mekahli, D., Bultynck, G., Parys, J.B., De Smedt, H., Missiaen, L., 2011. Endoplasmicreticulum calcium depletion and disease. Cold Spring Harb. Perspect. Biol. 3. Meldolesi, J., Pozzan, T., 1998. The endoplasmic reticulum Ca2+ store: a view from the lumen. Trends Biochem. Sci. 23, 10–14. Miyawaki, A., Llopis, J., Heim, R., McCaffery, J.M., Adams, J.A., Ikura, M., Tsien, R.Y., 1997. Fluorescent indicators for Ca2+ based on green fluorescent proteins and calmodulin. Nature 388, 882–887. Nagai, T., Ibata, K., Park, E.S., Kubota, M., Mikoshiba, K., Miyawaki, A., 2002. A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat. Biotechnol. 20, 87–90. Nagai, T., Yamada, S., Tominaga, T., Ichikawa, M., Miyawaki, A., 2004. Expanded dynamic range of fluorescent indicators for Ca2+ by circularly permuted yellow fluorescent proteins. Proc. Natl. Acad. Sci. U. S. A. 101, 10554–10559. Nagata, T., Iizumi, S., Satoh, K., Ooka, H., Kawai, J., Carninci, P., Hayashizaki, Y., Otomo, Y., Murakami, K., Matsubara, K., et al., 2004. Comparative analysis of plant and animal calcium signal transduction element using plant full-length cDNA data. Mol. Biol. Evol. 21, 1855–1870. Nakai, J., Ohkura, M., Imoto, K., 2001. A high signal-to-noise Ca2+ probe composed of a single green fluorescent protein. Nat. Biotechnol. 19, 137–141. Nomura, H., Komori, T., Uemura, S., Kanda, Y., Shimotani, K., Nakai, K., Furuichi, T., Takebayashi, K., Sugimoto, T., Sano, S., et al., 2012. Chloroplast-mediated activation of plant immune signalling in Arabidopsis. Nat. Commun. 3, 926. Ohkura, M., Matsuzaki, M., Kasai, H., Imoto, K., Nakai, J., 2005. Genetically encoded bright Ca2+ probe applicable for dynamic Ca2+ imaging of dendritic spines. Anal. Chem. 77, 5861–5869. Palmer, A.E., Jin, C., Reed, J.C., Tsien, R.Y., 2004. Bcl-2-mediated alterations in endoplasmic reticulum Ca2+ analyzed with an improved genetically encoded fluorescent sensor. Proc. Natl. Acad. Sci. U. S. A. 101, 17404–17409. Palmer, A.E., Giacomello, M., Kortemme, T., Hires, S.A., Lev-Ram, V., Baker, D., Tsien, R.Y., 2006. Ca2+ indicators based on computationally redesigned calmodulin-peptide pairs. Chem. Biol. 13, 521–530. Parekh, A.B., James, W., Putney, J., 2005. Store-operated calcium channels. Physiol. Rev. 85, 757–810. Patterson, R.L., van Rossum, D.B., Gill, D.L., 1999. Store-operated Ca2+ entry: evidence for a secretion-like coupling model. Cell 98, 487–499. Pauly, N., Knight, M.R., Thuleau, P., van der Luit, A.H., Moreau, M., Trewavas, A.J., Ranjeva, R., Mazars, C., 2000. Control of free calcium in plant cell nuclei. Nature 405, 754–755. Plieth, C., 2001. Plant calcium signaling and monitoring: pros and cons and recent experimental approaches. Protoplasma 218, 1–23. Robert, V., Pinton, P., Tosello, V., Rizzuto, R., Pozzan, T., 2000. Recombinant aequorin as tool for monitoring calcium concentration in subcellular compartments. In: Thorner, J., Emr, S.D., Abelson, J.N. (Eds.), In Methods in Enzymology. Academic Press, pp. 440–456. Shimomura, O., 2006. Bioluminescence: Chemical Principles and Methods. World Scientific Publishing 470 pp. Stael, S., Wurzinger, B., Mair, A., Mehlmer, N., Vothknecht, U.C., Teige, M., 2012. Plant organellar calcium signalling: an emerging field. J. Exp. Bot. 63, 1525–1542. Suzuki, J., Kanemaru, K., Ishii, K., Ohkura, M., Okubo, Y., Iino, M., 2014. Imaging intraorganellar Ca2+ at subcellular resolution using CEPIA. Nat. Commun. 5, 4153. Thomas, D., Hanley, M.R., 1994. Pharmacological tools for perturbing intracellular calcium storage. In: Nuccitelli, R. (Ed.), In Methods in Cell Biology. Academic Press, pp. 65–89. Tian, L., Hires, S.A., Mao, T., Huber, D., Chiappe, M.E., Chalasani, S.H., Petreanu, L., Akerboom, J., McKinney, S.A., Schreiter, E.R., et al., 2009. Imaging neural activity in worms, flies and mice with improved GCaMP calcium indicators. Nat. Methods 6, 875. Truong, K., Sawano, A., Mizuno, H., Hama, H., Tong, K.I., Mal, T.K., Miyawaki, A., Ikura, M., 2001. FRET-based in vivo Ca2+ imaging by a new calmodulin-GFP fusion molecule. Nat. Struct. Biol. 8, 1069–1073. Vishwakarma, K., Upadhyay, N., Kumar, N., Yadav, G., Singh, J., Mishra, R.K., Kumar, V., Verma, R., Upadhyay, R.G., Pandey, M., et al., 2017. Abscisic acid signaling and abiotic stress tolerance in plants: a review on current knowledge and future prospects. Front. Plant Sci. 8, 161.
Akerboom, J., Rivera, J.D.V., Guilbe, M.M.R., Malavé, E.C.A., Hernandez, H.H., Tian, L., Hires, S.A., Marvin, J.S., Looger, L.L., Schreiter, E.R., 2009. Crystal structures of the GCaMP calcium sensor reveal the mechanism of fluorescence signal change and aid rational design. J. Biol. Chem. 284, 6455–6464. Allen, G.J., Kwak, J.M., Chu, S.P., Llopis, J., Tsien, R.Y., Harper, J.F., Schroeder, J.I., 1999. Cameleon calcium indicator reports cytoplasmic calcium dynamics in Arabidopsis guard cells. Plant J. 19, 735–747. Allen, G.J., Chu, S.P., Harrington, C.L., Schumacher, K., Hoffmann, T., Tang, Y.Y., Grill, E., Schroeder, J.I., 2001. A defined range of guard cell calcium oscillation parameters encodes stomatal movements. Nature 411, 1053–1057. Alonso, M.T., Manjarrés, I.M., García-Sancho, J., 2009. Modulation of calcium signalling by intracellular organelles seen with targeted aequorins. Acta Physiol. 195, 37–49. Berridge, M.J., 2009. Inositol trisphosphate and calcium signalling mechanisms. Biochim. Biophys. Acta 1793, 933–940. Berridge, M.J., Lipp, P., Bootman, M.D., 2000. The versatility and universality of calcium signalling. Nat. Rev. Mol. Cell Biol. 1, 11–21. Berridge, M.J., Bootman, M.D., Roderick, H.L., 2003. Calcium signalling: dynamics, homeostasis and remodelling. Nat. Rev. Mol. Cell Biol. 4, 517–529. Bonza, M.C., Loro, G., Behera, S., Wong, A., Kudla, J., Costa, A., 2013. Analyses of Ca2+ accumulation and dynamics in the endoplasmic reticulum of Arabidopsis root cells using a genetically encoded Cameleon sensor. Plant Physiol. 163, 1230–1241. Bootman, M.D., Fearnley, C., Smyrnias, I., MacDonald, F., Roderick, H.L., 2009. An update on nuclear calcium signalling. J. Cell. Sci. 122, 2337–2350. Charpentier, M., Oldroyd, G.E., 2013. Nuclear calcium signaling in plants. Plant Physiol. 163, 496–503. Chen, T.W., Wardill, T.J., Sun, Y., Pulver, S.R., Renninger, S.L., Baohan, A., Schreiter, E.R., Kerr, R.A., Orger, M.B., Jayaraman, V., et al., 2013. Ultrasensitive fluorescent proteins for imaging neuronal activity. Nature 499, 295–300. Christensen, A., Svensson, K., Thelin, L., Zhang, W., Tintor, N., Prins, D., Funke, N., Michalak, M., Schulze-Lefert, P., Saijo, Y., et al., 2010. Higher plant calreticulins have acquired specialized functions in Arabidopsis. PLoS One 5 e11342-e11342. Clough, S.J., Bent, A.F., 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735–743. Coe, H., Michalak, M., 2009. Calcium binding chaperones of the endoplasmic reticulum. General Physiology and Biophysics 28 Spec No Focus F96–F103. Corso, M., Doccula, F.G., de Melo, J.R.F., Costa, A., Verbruggen, N., 2018. Endoplasmic reticulum-localised CCX2 is required for osmotolerance by regulating ER and cytosolic Ca2+ dynamics in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 115, 3966–3971. Curie, T., Rogers, K.L., Colasante, C., Brulet, P., 2007. Red-shifted aequorin-based bioluminescent reporters for in vivo imaging of Ca2+ signaling. Mol. Imaging 6, 30–42. Ding, K.H., Husain, S., Akhtar, R.A., Isales, C.M., Abdel-Latif, A.A., 1997. Inhibition of muscarinic-stimulated polyphosphoinositide hydrolysis and Ca2+ mobilization in cat iris sphincter smooth muscle cells by cAMP-elevating agents. Cell. Signal. 9, 411–421. Dodd, A.N., Kudla, J., Sanders, D., 2010. The language of calcium signaling. Annu. Rev. Plant Biol. 61, 593–620. Edel, K.H., Marchadier, E., Brownlee, C., Kudla, J., Hetherington, A.M., 2017. The evolution of calcium-based signalling in plants. Curr. Biol. 27, R667–R679. English, A.R., Voeltz, G.K., 2013. Endoplasmic reticulum structure and interconnections with other organelles. Cold Spring Harb. Perspect. Biol. 5, a013227. Griffin, C.S., Thornbury, K.D., Hollywood, M.A., Sergeant, G.P., 2018. Muscarinic receptor-induced contractions of the detrusor are impaired in TRPC4 deficient mice. Sci. Rep. 8, 9264. Huang, F., Luo, J., Ning, T., Cao, W., Jin, X., Zhao, H., Wang, Y., Han, S., 2017. Cytosolic and nucleosolic calcium signaling in response to osmotic and salt stresses are independent of each other in roots of Arabidopsis seedlings. Front. Plant Sci. 8, 1648. Hwang, I., Sze, H., Harper, J.F., 2000. A calcium-dependent protein kinase can inhibit a calmodulin-stimulated Ca2+ pump (ACA2) located in the endoplasmic reticulum of Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 97, 6224–6229. Islam, M.M., Hossain, M.A., Jannat, R., Munemasa, S., Nakamura, Y., Mori, I.C., Murata, Y., 2010. Cytosolic alkalization and cytosolic calcium oscillation in Arabidopsis guard cells response to ABA and MeJA. Plant Cell Physiol. 51, 1721–1730. Johnson, C., Knight, M., Kondo, T., Masson, P., Sedbrook, J., Haley, A., Trewavas, A., 1995. Circadian oscillations of cytosolic and chloroplastic free calcium in plants. Science 269, 1863–1865. Knight, M.R., Campbell, A.K., Smith, S.M., Trewavas, A.J., 1991. Transgenic plant aequorin reports the effects of touch and cold-shock and elicitors on cytoplasmic calcium. Nature 352, 524–526. Knight, M.R., Smith, S.M., Trewavas, A.J., 1992. Wind-induced plant motion immediately increases cytosolic calcium. Proc. Natl. Acad. Sci. U. S. A. 89, 4967–4971. Knight, H., Trewavas, A.J., Knight, M.R., 1996. Cold calcium signaling in Arabidopsis involves two cellular pools and a change in calcium signature after acclimation. Plant Cell 8, 489–503. Knight, H., Trewavas, A.J., Knight, M.R., 1997. Calcium signalling in Arabidopsis thaliana responding to drought and salinity. Plant J. 12, 1067–1078. Krebs, M., Held, K., Binder, A., Hashimoto, K., Den Herder, G., Parniske, M., Kudla, J., Schumacher, K., 2012. FRET-based genetically encoded sensors allow high-resolution live cell imaging of Ca2+ dynamics. Plant J. 69, 181–192.
10
Journal of Plant Physiology 246–247 (2020) 153127
J. Luo, et al.
for imaging Ca2+ dynamics of the endoplasmic reticulum. Sensors 15, 13052–13068. Wang, Q., Shui, B., Kotlikoff, M.I., Sondermann, H., 2008. Structural basis for calcium sensing by GCaMP2. Structure 16, 1817–1827. Wheeler, G.L., Brownlee, C., 2008. Ca2+ signalling in plants and green algae—changing channels. Trends Plant Sci. 13, 506–514. Wu, X., Babnigg, G., Zagranichnaya, T., Villereal, M.L., 2002. The role of endogenous human Trp4 in regulating carbachol-induced calcium oscillations in HEK-293 cells. J. Biol. Chem. 277, 13597–13608.
Wagner, S., De Bortoli, S., Schwarzlander, M., Szabo, I., 2016. Regulation of mitochondrial calcium in plants versus animals. J. Exp. Bot. 67, 3809–3829. Waldeck-Weiermair, M., Alam, M.R., Khan, M.J., Deak, A.T., Vishnu, N., Karsten, F., Imamura, H., Graier, W.F., Malli, R., 2012. Spatiotemporal correlations between cytosolic and mitochondrial Ca2+ signals using a novel red-shifted mitochondrial targeted cameleon. PLoS One 7, e45917. Waldeck-Weiermair, M., Bischof, H., Blass, S., Deak, A.T., Klec, C., Graier, T., Roller, C., Rost, R., Eroglu, E., Gottschalk, B., et al., 2015. Generation of red-shifted cameleons
11