Intrauterine exposure to flavonoids modifies antioxidant status at adulthood and decreases oxidative stress-induced DNA damage

Free Radical Biology and Medicine 57 (2013) 154–161

Contents lists available at SciVerse ScienceDirect

Free Radical Biology and Medicine journal homepage: www.elsevier.com/locate/freeradbiomed

Original Contribution

Intrauterine exposure to flavonoids modifies antioxidant status at adulthood and decreases oxidative stress-induced DNA damage Kimberly Vanhees a,n, Frederik J. van Schooten a, Sahar Barjesteh van Waalwijk van Doorn-Khosrovani a, Stefan van Helden a, Armelle Munnia c, Marco Peluso c, Jacob J. Briede´ b, Guido R.M.M. Haenen a, Roger W.L. Godschalk a a

Department of Toxicology, School for Nutrition, Toxicology & Metabolism (NUTRIM), Maastricht UMC þ, 6200 MD Maastricht, The Netherlands Department of Toxicogenomics, School for Oncology & Developmental Biology, Maastricht UMC þ , Maastricht University, 6200 MD Maastricht, The Netherlands c Cancer Risk Factor Branch, ISPO Cancer Prevention and Research Institute, 50139 Florence, Italy b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 4 June 2012 Received in revised form 17 September 2012 Accepted 21 December 2012 Available online 4 January 2013

Maternal intake of flavonoids, known for their antioxidant properties, may affect the offspring’s susceptibility to developing chronic diseases at adult age, especially those related to oxidative stress, via developmental programming. Therefore, we supplemented female mice with the flavonoids genistein and quercetin during gestation, to study their effect on the antioxidant capacity of lung and liver of adult offspring. Maternal intake of quercetin increased the expression of Nrf2 and Sod2 in fetal liver at gestational day 14.5. At adult age, in utero exposure to both flavonoids resulted in the increased expression of several enzymatic antioxidant genes, which was more pronounced in the liver than in the adult lung. Moreover, prenatal genistein exposure induced the nonenzymatic antioxidant capacity in the adult lung, partly by increasing glutathione levels. Prenatal exposure to both flavonoids resulted in significantly lower levels of oxidative stress-induced DNA damage in liver only. Our observations lead to the hypothesis that a preemptive trigger of the antioxidant defense system in utero had a persistent effect on antioxidant capacity and as a result decreased oxidative stress-induced DNA damage in the liver. & 2013 Elsevier Inc. All rights reserved.

Keywords: Quercetin Genistein Fetal programming Nrf2 Vitamin C GSH TEAC Enzymatic antioxidants Liver Lung Free radicals

Introduction Studies in humans and animals have shown that the in utero environment is an important determinant for the risk of several diseases at older age, including cancer [1,2] and metabolic [3,4] or cardiovascular disorders [3,5]. Because reactive oxygen species (ROS)1 are thought to play a role in the etiology of adult diseases, such as cardiovascular disease [6,7], diabetes [8,9], and cancer [10–12], one could speculate that intake of dietary antioxidants during pregnancy may provide an in utero environment that will result in an adapted antioxidant defense system of the offspring

Abbreviations: 8-oxo-dG, 8-oxo-7,8-dihydro-20 -deoxyguanosine; Cat, catalase; E14.5, embryonic day 14.5; ESR, electron spin resonance spectroscopy; Gpx3, glutathione peroxidase 3; GSH, reduced glutathione; GSSG, glutathione disulfide; Ho1, heme oxygenase 1; HPLC, high-pressure liquid chromatography; Keap1, Kelch-like ECH-associated protein 1; M1dG, malondialdehyde–deoxyguanosine; Nrf2, nuclear erythroid 2-related factor 2; PCR, polymerase chain reaction; ROS, reactive oxygen species; Sod2, superoxide dismutase 2; TEAC, Trolox equivalent antioxidant capacity n Corresponding author. Fax: þ31 43 3884146. E-mail address: [email protected] (K. Vanhees). 0891-5849/$ - see front matter & 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.freeradbiomed.2012.12.021

and may prevent the development of chronic diseases later in life. One major group of antioxidants in the human diet are the polyphenolic flavonoids [13]. The daily dietary intake of mixed flavonoids in the human population ranges from 65 to 250 mg/ day [14]. The most abundant flavonoid in the human diet is quercetin, which is mainly found in onions, apples, tea, and grapes [15]. Another widely consumed flavonoid is genistein, which is mainly found in soy products [16]. Flavonoids are thought to be beneficial to health because they act as antiinflammatory agents [17] and in some epidemiological studies they were associated with protection against cardiovascular [18,19] and neurodegenerative diseases [20,21]. These effects of flavonoids could result from their antioxidant properties [13,22]. However, pro-oxidant effects of flavonoids have also been reported [23,24]. In addition to antioxidant nutrients, cells also possess enzymatic antioxidants that protect them against endogenous and exogenous sources of oxidative stress, such as superoxide dismutase (Sod), which scavenges superoxide (O2  ), and catalase (Cat) and glutathione peroxidase (Gpx), which scavenge hydrogen peroxide (H2O2), and nonenzymatic antioxidants, such as

K. Vanhees et al. / Free Radical Biology and Medicine 57 (2013) 154–161

glutathione [25,26]. An important transcription factor that regulates gene expression to counteract oxidative stress is the nuclear erythroid 2-related factor 2 (Nrf2). This transcription factor is normally targeted for proteasomal degradation by binding to its chaperone Kelch-like ECH-associated protein (Keap1). However, ROS and electrophiles can alter the conformation of the Nrf2–Keap1 complex, resulting in the nuclear translocation of Nrf2 and upregulation of the expression of target genes (for instance, heme oxygenase 1, Ho1) [27,28]. The flavonoid quercetin was found to regulate the Nrf2 pathway and as such enhanced the antioxidant potential of cells [29,30]. Hur and Gray [28] stated that a pre-emptive activation of the Nrf2 pathway potentiates the level of a wide range of protective enzymes that counteract oxidative and environmental stresses and confers resistance to subsequent challenges of cellular stress. On the other hand, Breinholt et al. [31] showed that female rats exposed for 2 weeks to high doses of several flavonoids, including genistein and quercetin, had reduced activity of glutathione reductase, Cat, and Gpx in red blood cells. Still, these rats were protected from 2-amino-1-methyl-6-phenylimidazo[4,5–b]pyridine-induced oxidative stress as seen in the decreased levels of plasma malondialdehyde. These studies indicate that there is a close relation between flavonoid exposure and the enzymatic antioxidant defense system. Moreover, a pre-emptive trigger induced by increased levels of antioxidants in the environment could induce long-lasting alterations in the antioxidant defense system. Despite the possible health benefits provided by flavonoids in adulthood, there is still little known about their action during pregnancy and the effects they may exert on the offspring, though it is known that flavonoids pass the placenta and can accumulate in the fetus [32,33]. Therefore, we investigated whether prenatal exposure to genistein and quercetin could affect the antioxidant capacity even at adult age. To this end, we exposed female mice starting at 3 days before and throughout gestation to genistein (1 mmol/kg feed) or quercetin (1 mmol/kg feed). The expression of genes involved in the Nrf2 pathway and of several other antioxidant genes (Cat, Sod2, and Gpx3) was determined in liver and lung of adult offspring mice. Both organs were selected because they are sensitive to ROS-induced DNA damage because of their metabolizing (liver) or respiratory (lung) function. Gene expression was also assessed in the liver of fetuses exposed to genistein or quercetin at day 14.5 of gestation, though not in the lung, as it develops mainly in the final stages of pregnancy [34]. To study the nonenzymatic antioxidant capacity of liver and lung of 12-week-old mice prenatally exposed to genistein or quercetin, the Trolox equivalent antioxidant capacity (TEAC), total cellular glutathione level, vitamin C level, and presence of vitamin C radicals were determined. ROS-induced DNA damage was determined in adult mice by measuring 8-oxo-7,8-dihydro-20 -deoxyguanosine (8-oxo-dG) and malondialdehyde–deoxyguanosine (M1dG) levels in DNA from liver and lung.

Material and methods Mice and sample collection Female mice (129/SvJ:C57BL/6 J background) approximately 8 weeks of age received either normal chow (low-phytoestrogen¨ content complete feed for breeding mice; ssniff Spezialdiaten, Soest, Germany, n¼8) or the same chow supplemented with genistein (1 mmol (270 mg)/kg feed; LC Laboratories, Woburn, MA, USA, n ¼9) or with quercetin (1 mmol (302 mg)/kg feed; Sigma, Zwijndrecht, The Netherlands, n ¼8) from 3 days before conception until the end of gestation. After delivery all mothers and pups, regardless of their prenatal diet, received normal chow

155

and the offspring was sacrificed after anesthesia by cardiac puncture at 12 weeks of age. Five males were randomly selected from different litters per diet group. Liver and lung tissue from the same male offspring mice was never used for the same measurements, to avoid litter- and animal-specific effects. Simultaneously, the effects of genistein and quercetin exposure on the antioxidant defense system of fetuses were determined. Therefore, 8-week-old female mice (129/SvJ:C57BL/6J background; control n ¼5, genistein n ¼4, quercetin n ¼3) were mated overnight and conception day was determined by recognition of a vaginal plug the next morning (considered as day 0.5 of gestation). Female mice were placed on the same control or genistein- or quercetin-enriched chow as described above, starting 3 days before conception. On day 14.5 of pregnancy (E14.5), mice were sacrificed to isolate the livers of five fetuses per diet. Quantitative real-time PCR RNA was isolated from the liver of E14.5 fetuses and from the lung and liver of 12-week-old mice by homogenizing the tissue using TRIzol reagent (Invitrogen, Breda, Netherlands) according to the manufacturer’s instructions and using the Ultra-Turrax homogenizer (IKA, Staufen, Germany). Quantity and purity control of the RNA were spectrophotometrically assessed by using the Nanodrop 1000 (Thermo Scientific, Waltham, MA, USA). Next, 1 mg of RNA was used to synthesize cDNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA) following the manufacturer’s instructions. The reaction was performed using a Biometra Tprofessional thermocycler (Biometra, Leusden, The Netherlands). Quantitative real-time PCR was performed as previously described [35]. The primers used for quantitative realtime PCR are shown in Table 1. Liver and lung tissue homogenates To determine TEAC, total cellular glutathione, vitamin C level, and vitamin C radical formation in liver and lung tissue, liver and lung extracts were obtained by homogenizing the tissue in cold 10 mM Tris, 150 mM KCl buffer (pH 7.4), using the Ultra-Turrax homogenizer (IKA), followed by centrifugation at 4 1C for 15 min. Protein concentration of the homogenates was determined by the Lowry assay (Bio-Rad) with bovine serum albumin as a standard. Trolox equivalent antioxidant capacity The TEAC was quantified according to Fischer et al. [36]. The samples were deproteinized with a final concentration of 5% trichloroacetic acid. The samples were then incubated with ABTS radical solution prepared according the procedure described previously [36]. After 5 min incubation, the absorbance at 734 nm was determined. The assay was calibrated using solutions of the synthetic vitamin E analog Trolox. The TEAC is expressed in Trolox equivalents. Table 1 Overview of primers used for quantitative real-time PCR.

Cat Sod2 Gpx3 Keap1 Nrf2 Ho1 b-Actin

Forward primer (50 –30 )

Reverse primer (50 –30 )

AGCGACCAGATGAAGCAGTG CAGACCTGCCTTACGACTATGG CCTTTTAAGCAGTATGCAGGCA CGGGGACGCAGTGATGTATG CTTTAGTCAGCGACAGAAGGAC TCCAGAGTTTCCGCATAC CAAGAAGGAAGGCTGGAAAAGA

TCCGCTCTCTGTCAAAGTGTG CTCGGTGGCGTTGAGATTGTT CAAGCCAAATGGCCCAAGTT TGTGTAGCTGAAGGTTCGGTTA AGGCATCTTGTTTGGGAATGTG CGGACTGGGCTAGTTCA ACGGCCAGGTCATCACTATTG

156

K. Vanhees et al. / Free Radical Biology and Medicine 57 (2013) 154–161

Measurement of total cellular glutathione The total cellular glutathione (reduced glutathione (GSH) plus glutathione disulfide (GSSG)) was determined in liver and lung homogenates of adult mice as described by Julicher et al. [37]. GSH and GSSG calibrators were prepared fresh and contained the same amount of sulfosalicyclic acid (1.3% SSA in 10 mM HCl) as the tissue homogenates. Calibrators and tissue homogenates were treated identically. For the GSH measurements, 5,50 -dithiobis(2nitrobenzoic acid) (DTNB) was added to each sample. The absorbance was measured at 412 nm. For GSSG measurements, 2vinylpyridine (1:10) was added to the sample, after which the mixture was incubated for 1 h at room temperature. Next, DTNB and NADPH were added to the sample and the reaction was started by adding the enzyme glutathione reductase. The increase in absorbance at 412 nm of each sample was measured for 3 min. The total cellular concentration of glutathione in the samples was determined using the values obtained from the calibrators. Vitamin C concentration in liver and lung tissue To determine the vitamin C level, 250 ml of liver or lung homogenate was deproteinized using 10% trichloroacetic acid (1:4). Ascorbate was oxidized to dehydroascorbate using ascorbate oxidase. Subsequently, o-phenylene diamine was added, to convert dehydroascorbate into a fluorescent product that was quantified using HPLC. HPLC analysis of the samples was performed using a reverse-phase C18 column with methanol potassium phosphate buffer (20/80) as eluent and using a fluorescence detector with 355 nm as excitation and 425 nm as emission wavelength. Electron spin resonance spectroscopy To determine the presence of vitamin C radicals, liver and lung homogenates were placed on ice for direct measurements using electron spin resonance (ESR) spectroscopy. ESR spectra were recorded using the settings as previously described by Linschooten et al. [38] on a Bruker EMX 1273 spectrometer equipped with an ER 4119HS high-sensitivity resonator. Vitamin C radical signals, characterized by a doublet with a splitting constant (aH) of 1.8 G were quantified (in arbitrary units) through peak surface measurements using the WIN-EPR spectrum manipulation program.

micrococcal nuclease and spleen phosphodiesterase. Hydrolyzed samples were subsequently treated with 2.5 mg of nuclease P1 for 30 min at 37 1C. The nuclease P1-treated samples were incubated with 15–25 mCi of [g-32P]ATP (3000 Ci/mmol) and T4-polynucleotide kinase (0.75 U/ml) to generate 32P-labeled M1dG. Samples were applied to the origin of polyethyleneimine (PEI)–cellulose sheets (10  20 cm) and developed with 0.35 MgCl2 for 2.0 cm on a filter paper wick. Plates were developed in the opposite direction with 2.1 M lithium formate, 3.75 M urea (pH 3.75), and then run at the right angle to the previous development with 0.24 M sodium phosphate, 2.4 M urea (pH 6.4). Detection and quantification of M1dG and total nucleotides were obtained by a storage phosphorimaging technique employing intensifying screens (Molecular Dynamics, Sunnyvale, CA, USA) for 0.20–48 h. The screens were scanned using a Typhoon 9210 (Amersham, Buckinghamshire, UK). To process the data ImageQuant (Molecular Dynamics) was used. After background subtraction, the levels of M1dG adducts were expressed as relative adduct labeling (screen pixels in adducted nucleotides/screen pixels in total normal nucleotides). To calculate the levels of total normal nucleotides, aliquots of hydrolyzed DNA were appropriately diluted and reacted in the same mixtures used for M1dG labeling. The obtained 32P-labeled total nucleotides were separated on PEI–cellulose sheets using 280 mM ammonium sulfate and 50 mM sodium phosphate. The values measured for M1dG adducts were corrected across experiments based on the recovery of internal standard after the [32P]DNA postlabeling assay. Statistical analysis Statistical analysis was performed with the Statistical Package for Social Sciences (SPSS version 17 for Windows; SPSS, Inc., Chicago, IL, USA). ANOVA was used to assess the effects of maternal intake of genistein or quercetin on: (1) litter size at birth and at day 14.5 of gestation, (2) average pup weight at day 14.5 of gestation or postnatal day 5, (3) placental weight at day 14.5 of gestation, (4) percentage of males born, and (5) percentage of pups that died between birth and sacrifice day (week 12). Nested ANOVA was performed to investigate the effects of genistein or quercetin exposure on genes involved in the antioxidant defense system of the fetal liver (day 14.5 of gestation). ANOVA was applied to test differences in antioxidant gene expression, TEAC, total cellular glutathione level, vitamin C level, and radical formation and in oxidative stress-induced DNA damage in liver and lung of 12-week-old control mice compared to 12-week-old mice prenatally exposed to genistein or quercetin.

8-Oxo-dG measurements Genomic DNA was obtained by grinding frozen liver and lung tissue, followed by standard phenol extraction [39]. The DNAextraction procedure was optimized to minimize artificial induction of 8-oxo-dG, by using radical-free phenol, minimizing exposure to oxygen, and adding 1 mM deferoxamine mesylate and 20 mM 2,2,6,6-tetramethylpiperidine-N-oxyl. DNA concentrations were spectrophotometrically quantified at 260 nm. 8-Oxo-dG measurements were performed as described previously [40] using an HPLC apparatus with electrochemical detection. M1dG-adduct level measurements Genomic DNA was isolated from liver and lung tissue of adult mice using DNAzol reagent (Invitrogen, Bleiswijk, The Netherlands) following the manufacturer’s protocol and by homogenizing the tissue using an Ultra-Turrax homogenizer (IKA). [32P]DNA postlabeling of M1dG was performed as described previously [41]. Reference adduct standards were used for the optimization of the [32P]DNA postlabeling procedure. DNA (2 mg) was digested by

Results Maternal exposure to quercetin induced Nrf2 and Sod2 gene expression in liver of fetuses at day 14.5 of gestation To investigate whether exposure to genistein or quercetin could affect the expression of several antioxidant genes (Cat, Sod2, and Gpx3), including the key regulators of the Nrf2 oxidative stress response pathway, its negative regulator Keap1, and its downstream target gene Ho1, in the developing fetus, female mice were exposed via their diet to genistein (1 mmol/kg feed) or quercetin (1 mmol/kg feed) starting from 3 days before conception and female mice were sacrificed at day 14.5 of gestation. In utero exposure to genistein and quercetin did not seem to affect fetal development, as no significant changes in litter size or fetal and placental weight were observed at day 14.5 of gestation (Table 2). Next, the fetal liver was isolated to determine gene expression. In the quercetin-exposed group, we observed a significant elevation in the gene expression level of Sod2 (P ¼0.001)

K. Vanhees et al. / Free Radical Biology and Medicine 57 (2013) 154–161

157

Table 2 Characteristics of the control and genistein- or quercetin-exposed mouse litters.

Litter size during gestation at gestational day 14.5 Fetal weight (mg) Placental weight (mg) Litter size at birth Pup weight (g) at day 5 % males % deceased pups between birth and sacrifice day (week 12)

Control

Genistein

Quercetin

4.6 71.6 192.4 722.8 91.9 711.0 6.4 70.7 3.2 70.3 46.9 76.4 10.4 76.3

6.07 0.7 240.9 7 50.2 88.0 7 9.2 5.22 7 0.8 3.3 7 0.2 56.7 7 7.7 7.1 7 3.9

7.37 1.2 212.6 7 32.8 84.5 7 4.6 5.17 0.8 3.17 0.1 51.3 7 7.2 2.57 2.5

General characteristics of the litters exposed (prenatally) to genistein- or quercetin-supplemented or normal diet are shown. Results represent the mean 7 standard error. At day 14.5 of gestation: n¼ 5 for control litters, n¼ 4 for genistein-exposed litters, and n¼ 3 for quercetin-exposed litters. For litters that were born in the case of control or quercetin-supplemented diets, n¼8, and for litters that were born in the case of genistein-supplemented diet, n¼9.

and Nrf2 (P¼0.04, Fig. 1) at day 14.5 of gestation. No changes were found in the livers of genistein-exposed fetuses. Prenatal exposure to flavonoids induced the Nrf2 pathway in liver and antioxidant gene expression in both liver and lung of 12-weekold mice Prenatal exposure to genistein and quercetin did not affect average litter size at birth, average weight of the offspring measured at day 5 after birth, gender ratio, or the percentage of offspring mice that died before they were sacrificed at 12 weeks of age (Table 2). To investigate whether prenatal diet leads to measurable effects on expression of enzymatic antioxidant genes and the transcription factor Nrf2 at adulthood, we assessed gene expression of Cat, Sod2, Gpx3, Nrf2, Keap1, and Ho1 both in liver and in lung of adult offspring mice. In the liver of 12-week-old mice prenatally exposed to quercetin we found that Nrf2 (P¼0.002), Ho1 (P¼0.02), Cat (P¼0.04), and Gpx3 (P¼0.05) gene expression was increased compared to offspring mice of nonsupplemented mothers (Fig. 2A). Interestingly, of these genes the transcription factor Nrf2 was already upregulated in the liver of fetuses that were exposed to quercetin via their mother’s diet at day 14.5 of gestation. Adult mice prenatally exposed to genistein also showed a significant increase in gene expression of Nrf2 (P ¼0.01), whereas Cat was slightly (1.8-fold), though not significantly (P¼0.06), induced in the liver. In the lung of mice prenatally exposed to quercetin, Sod2 (P¼0.01) and Keap1 (P¼0.04) gene expression was significantly induced, whereas Nrf2 was only slightly, not statistically significantly (P¼0.09), induced. Mice prenatally exposed to genistein showed a significant increase in gene expression only for Gpx3 (P¼0.03) compared to the control animals (Fig. 2B). In addition, prenatal exposure to genistein also resulted in a modest increase in Sod2 gene expression (P¼0.07) in the lung of 12-weekold mice. So in general, the increase in gene expression of enzymes involved in the antioxidant network was the most pronounced in the liver of mice that were prenatally exposed to quercetin.

Fig. 1. Effects of maternal genistein and quercetin intake on antioxidant, Keap1, Nrf2, and Ho1 gene expression in the liver of E14.5 fetuses. mRNA expression levels of antioxidant genes (Cat, Sod2, and Gpx3), Keap1, Nrf2, and Ho1 were measured in the liver of E14.5 fetuses. Gray bars represent the genistein-exposed group (n¼ 5), black bars the quercetin-exposed group (n¼ 5), and white bars the control group (n¼ 5). Bars represent the normalized average fold change (calculated as 2  DDCT) and error bars represent the standard errors. *Po 0.05, ***Pr 0.001.

glutathione and vitamin C levels and the presence of vitamin C radicals in tissue extracts. No differences in TEAC were noticeable in liver tissues of adult mice prenatally exposed to genistein or quercetin. For the lung, however, prenatal exposure to genistein resulted in a significant increase in TEAC (Po0.05, Table 3). This suggests that prenatal exposure to genistein could affect the nonenzymatic antioxidant capacity, but only in the lung of adult mice. Moreover, GSH levels were significantly increased in the lung of mice prenatally exposed to genistein (P ¼0.02), suggesting that GSH contributed to this increase in TEAC. In addition, GSSG levels did not significantly differ between diet groups for both tissues (data not shown).

Prenatal exposure to genistein increases the nonenzymatic antioxidant capacity of the lung

Prenatal exposure to flavonoids decreased the scavenging of ROS by vitamin C in the lung tissue of adult mice

Although a relationship between maternal flavonoid intake during gestation and enzymatic antioxidant expression was observed, one cannot exclude that there might also be a longlasting effect in the nonenzymatic antioxidant capacity induced by the prenatal diet or in response to alterations in the enzymatic antioxidant defense system. Therefore, the nonenzymatic antioxidant capacity of both liver and lung of 12-week-old mice prenatally exposed to genistein or quercetin was determined. Hence, the TEAC was assessed, in combination with total cellular

First, the level of the antioxidant vitamin C was determined in liver and lung tissues of mice prenatally exposed to either genistein or quercetin and showed no differences compared to control mice. Next, the ROS-scavenging capacity of vitamin C was determined by measuring vitamin C radical levels in tissue homogenates using ESR spectroscopy. In the liver of mice prenatally exposed to genistein or quercetin there were no differences seen in the amount of vitamin C radicals compared to control mice (Table 3). In the lung,

158

K. Vanhees et al. / Free Radical Biology and Medicine 57 (2013) 154–161

in contrast, prenatal exposure to flavonoids resulted in a decrease in the amount of vitamin C radicals formed in vivo (P¼0.05 taking both flavonoids together) compared to control mice.

Prenatal exposure to flavonoids resulted in lower levels of oxidative stress-induced DNA damage in liver tissue of adult mice To investigate whether the observed differences in adaptation of the enzymatic and nonenzymatic antioxidant defense system after prenatal exposure to genistein or quercetin affected the oxidative stress-induced DNA damage, 8-oxo-dG levels were assessed in liver and lung tissue. A decrease in oxidative stressinduced DNA damage was found in the liver of mice prenatally exposed to genistein (P¼0.04) or quercetin (P¼0.003), as they displayed lower levels 8-oxo-dG compared to control mice (Fig. 3A). In the lung, prenatal exposure to genistein or quercetin had no effect on the amount of 8-oxo-dG levels compared to control mice (Fig. 3C). Oxidative stress can also induce DNA damage via lipid peroxidation, resulting in the formation of M1dG. Interestingly, these data confirmed the findings observed for 8-oxo-dG, because prenatal exposure to both genistein and quercetin resulted in decreased levels of M1dG adducts in liver (P¼ 0.008 for genistein and P ¼0.001 for quercetin; Fig. 3B), whereas no differences in the amount of M1dG adducts was detected in the lung of 12-week-old mice (Fig. 3D).

Discussion Effect of flavonoid exposure on antioxidant gene expression at day 14.5 of gestation

Fig. 2. Long-term effect of maternal genistein and quercetin intake on antioxidant, Keap1, Nrf2, and Ho1 gene expression in the liver and lung of 12-week-old offspring mice. mRNA expression levels of antioxidant genes (Cat, Sod2, and Gpx3), Keap1, Nrf2, and Ho1 were measured in the (A) liver and (B) lung of 12week-old offspring mice prenatally exposed to either genistein (gray bars, n¼ 5) or quercetin (black bars, n ¼5) compared to the control group (white bars, n¼ 5). Bars represent the normalized average fold change (calculated as 2  DDCT) and error bars represent the standard errors. #Pr 0.09, *Po 0.05, **Pr 0.01.

During development, exposure to quercetin resulted in an upregulation of Nrf2 gene expression in the fetal liver at day 14.5 of gestation. Nrf2 is the key transcription factor regulating the antioxidant response. It is normally targeted for proteasomal degradation by Keap1. However, it translocates into the nucleus when oxidative stress occurs, as oxidative stress results in a conformational change in Keap1 and therefore the release of Nrf2 [42]. The increase in Nrf2 gene expression could suggest an increased turnover of Nrf2 protein or impaired translation. However, it could also suggest that quercetin acts as a pro-oxidant in utero, which has also been shown in adult rats exposed to high levels of quercetin [43]. Genistein exposure also resulted in an increase in Nrf2 gene expression, but less significantly compared to quercetin, suggesting that differences seen in the antioxidant capacity of adult offspring could result from different pro-oxidant

Table 3 TEAC, cellular glutathione and vitamin C levels, and vitamin C radical level measured in the liver and lung of 12-week-old mice prenatally exposed to genistein or quercetin.

Liver TEAC (mmol/g) GSH (mmol/g) GSSG (mmol/g) Vitamin C (mmol/g) Vitamin C radical (1  105 AUC/g)a Lung TEAC (mmol/g) GSH (mmol/g) GSSG (mmol/g) Vitamin C (mmol/g) Vitamin C radical (1  105 AUC/g)a

Control

Genistein

Quercetin

54.27 8.9 186.7 7 25.1 13.37 2.9 21.57 4.4 0.37 0.2

41.8 7 4.1 177.3 7 22.6 16.5 7 2.9 20.27 1.7 0.47 0.2

40.9 7 8.7 159.3 7 21.5 20.8 7 4.1 21.2 7 1.8 0.3 7 0.1

50.37 4.7 19.27 1.3 0.57 0.1 7.57 1.7 8.57 0.6

64.6 7 3.9b 24.6 7 1.3b 0.47 0.1 19.2 7 7.2 7.2 7 0.3c

49.3 7 4.6 14.8 7 2.7 1.0 7 0.3 8.2 7 4.2 7.2 7 0.2c

For each measurement n¼ 5 for all three diets. AUC, area under the curve. Data represent the mean 7 standard error. a b c

Vitamin C radical was quantified as arbitrary units. Po 0.05. P¼ 0.05, combining both flavonoid groups compared to control.

K. Vanhees et al. / Free Radical Biology and Medicine 57 (2013) 154–161

159

Fig. 3. ROS-induced DNA damage in liver and lung tissue of 12-week-old offspring mice prenatally exposed to genistein or quercetin. (A, C) 8-Oxo-dG levels and (B, D) M1dG adducts were assessed as a measure for ROS-induced DNA damage in the liver (A, B) and lung (C, D) of 12-week-old offspring mice prenatally exposed to either genistein (n¼ 5) or quercetin (n¼ 5) compared to the control group (n¼5). Data represent the mean 7 standard error. RAL, relative adduct labeling. *P o 0.05, **Pr 0.01, ***P r0.001.

capacities of genistein and quercetin. Although Nrf2 gene expression was elevated in exposed fetuses compared to control fetuses, expression of a major target gene of Nrf2, namely Ho1, was only modestly elevated. This could indicate that translation of Nrf2 is indeed impaired or that upon a quercetin- or genistein-induced trigger Nrf2 gene expression will be induced, though Nrf2 proteins may not translocate into the nucleus to perform their function. Nrf2 has to reach a threshold before it can enter the nucleus and induce downstream effects [42]. Therefore, it may be that this threshold has not yet been reached in our model at gestational day 14.5. Fetuses exposed to quercetin were also found to have increased gene expression of Sod2. Sod2 normally converts O2  , a by-product of the mitochondrial electron transport chain, into H2O2 and O2. De Marchi et al. [44] showed that rat liver mitochondria exposed to quercetin had an increased production of O2  , which could explain the upregulation of Sod2 gene expression seen in fetuses exposed to quercetin. Effect of in utero exposure to flavonoids on lung antioxidant capacity in adult offspring At adult age, prenatal exposure to genistein and quercetin resulted in higher levels of Nrf2 gene expression in the lung. However, the expression of Keap1 was also enhanced and was comparable to the expression of Nrf2. Therefore, we assume that the oxidative stress response pathway was activated to a lesser degree, which was confirmed by the modest increase in Ho1 gene expression. In the lung, prenatal exposure to genistein and quercetin also resulted in the upregulation of Sod2 and Gpx3 gene expression at adult age, whereas Cat gene expression remained unaffected. Though prenatal exposure to flavonoids had only mild effects on lung enzymatic antioxidant expression at adult age, prenatal exposure to genistein did result in significant increases in TEAC and GSH levels in the lung. This suggests that the increase in GSH level may partly contribute to the increase seen in TEAC level of lung tissue of

adult mice. Vitamin C levels were also increased in lungs of adult mice prenatally exposed to genistein; though not statistically significant, they could contribute to the increase in TEAC. The increase in vitamin C level could be explained by the fact that mice, unlike humans, synthesize vitamin C from glucose in the liver [45]. As genistein exposure can result in an increased uptake of glucose by cells [16], mice prenatally exposed to genistein could be programmed to produce increased amounts of vitamin C by increasing the uptake of glucose. Vitamin C radicals were measured in lung homogenates as they may provide a stable signal for oxidative stress [38]. At adult age, the amount of vitamin C radicals present in the lung was slightly decreased in mice prenatally exposed to flavonoids, which could be due to the moderate change in enzymatic antioxidant expression and nonenzymatic antioxidant capacity. Though prenatal exposure to genistein increased the nonenzymatic antioxidant capacity of the lung at adult age, no changes in 8oxo-dG or M1dG level were found for prenatal exposure to genistein, as was the case for prenatal exposure to quercetin. Effect of in utero exposure to flavonoids on liver antioxidant capacity in adult offspring The liver of adult mice prenatally exposed to genistein and quercetin showed a totally different adaptation of the enzymatic and nonenzymatic antioxidant network compared to the lung. Here, adult mice prenatally exposed to genistein, but especially to quercetin, had increased gene expression of Nrf2, without an increased gene expression of Keap1. Moreover, they also showed an increased expression of the Nrf2 target gene Ho1, suggesting that the increased expression of Nrf2 also resulted in an increased downstream effect, modulating oxidative stress responses. Prenatal exposure to genistein and quercetin also resulted in the increased expression of the antioxidant genes Cat and Gpx3 at adult age. Both antioxidants are responsible for scavenging H2O2. Their mRNAs are shown to accumulate in utero to be translated in advance of birth, as these enzymes are needed from then onward for protection against oxidative stress

160

K. Vanhees et al. / Free Radical Biology and Medicine 57 (2013) 154–161

Table 4 Overview of adaptations made by the antioxidant defense system of fetal/adult liver and adult lung due to (prenatal) exposure to genistein or quercetin. Fetal liver

Enzymatic antioxidants Sod2 Nrf2 Ho1 Cat Gpx3 Keap1 Nonenzymatic antioxidants TEAC GSH DNA damage 8-Oxo-dG M1dG

Adult liver

Adult lung

Genistein

Quercetin

Genistein

Quercetin

Genistein

Quercetin

–a – – – – –

mmm m – – – –

– mm – – – –

– mm m m m –

– – – – m –

mm – – – – m

n.d. –

n.d. –

– –

– –

m m

– –

n.d. –

n.d. –

k kk

kk kk

– –

– –

n.d., not determined. m/k, Po 0.05; mm/kk, Pr 0.01; mmm/kkk, P r0.001. a

Nonsignificant result.

by aerobic respiration [46]. Therefore, it is possible that the effects of genistein and quercetin exposure on the induction of expression of these genes could not be observed during midgestation, but longlasting effects seen in adult offspring were induced at later time points of gestation or in early life. Although prenatal exposure to genistein and quercetin resulted in the upregulation of the gene expression of enzymatic antioxidants at adult age, it had no effect on the total nonenzymatic antioxidant capacity. Though in the lung of adult mice the increase in GSH seems to be associated with the increase in Gpx3 gene expression, in the liver of adult mice no association between Gpx3 gene expression and GSH was found. This may be due to the fact that other components contributed more to the protection against oxidative stress, namely the activation of the Nrf2 pathway, which is not active in the case of the lung. Prenatal exposure to both genistein and quercetin resulted in lower levels of 8-oxo-dG and M1dG at adult age. We assume this is the result of increased expression of enzymatic antioxidant genes. The fact that at adult age liver and lung responded differently to the in utero genistein and quercetin exposure, in regard to the nonenzymatic and enzymatic antioxidant defense system, could be explained by the fact that the liver is largely differentiated before birth [47], whereas the lung develops mainly in the final stages of pregnancy and even continues to develop after birth [34]. Therefore, the different responses of both tissues to flavonoids may be the result of a difference in maturation state of the organ during exposure. The observation that changes in gene expression due to in utero exposure to genistein and quercetin are maintained throughout life suggests that epigenetic mechanisms may play a role. In addition, we previously reported that prenatal exposure to both genistein [48] and quercetin [40] indeed affects DNA methylation, mainly in liver [35]. Biological relevance of flavonoid dose used for prenatal exposure In our study pregnant mice were exposed to approximately 26.7–36.7 mg/kg bw genistein and 33.3–46.7 mg/kg bw quercetin per day. In the Western diet, the average dietary intake of quercetin is in the range of 0.1–1 mg/kg bw per day [49] and the average human dietary isoflavone intake lies between 0.01 and 0.6 mg/kg bw per day [50]. Therefore, the dose we administered to mice seems high. However, it is a biologically relevant dose as both flavonoids are freely available as dietary supplements with a daily recommended dose that can be as high as 1–2 g per day [51,52], which correspond to 14–28 mg for a person weighing 70 kg. It should be noted, however, that the metabolism of flavonoids differs between humans and mice. For instance,

Jacobs et al. [53] showed that the metabolic profile of the semisynthetic flavonoid monoHER is different in mice and humans. Moreover, it is noteworthy that the metabolism of flavonoids differs between fetuses and adults. For instance, human fetal cord blood has higher genistein levels than maternal serum [54], suggesting that fetuses could be exposed to even higher concentration compared to their mothers.

Conclusion The most important novel finding presented in this work is that in utero exposure to quercetin, and to a lesser extent to genistein, resulted in lower levels of oxidative stress-induced DNA damage in the liver of adult mice. This may have resulted from persistent adaptations made in the antioxidant defense system. For the liver, prenatal exposure to both flavonoids mainly affected the enzymatic antioxidant defense system and seemed to result in the activation of the Nrf2 pathway, whereas for the lung prenatal exposure to genistein increased the nonenzymatic antioxidant defense system (overview of the results is presented in Table 4). This suggests that an in utero trigger of the antioxidant system has long-lasting effects that may alter the protection against adult chronic diseases in which oxidative stress is involved, though further research is warranted.

Acknowledgments The authors sincerely thank Lou Maas for measuring 8-oxo-dG levels and Marie-Jose´ Drittij for the TEAC, total cellular glutathione, and vitamin C measurements. This work was supported by Grant 06A031 from the American Institute for Cancer Research. Animal experiments were approved by the institution’s ethics committee on experimental animals, according to national legislation. References [1] Vanhees, K.; de Bock, L.; Godschalk, R. W.; van Schooten, F. J.; van Waalwijk van Doorn-Khosrovani, S. B. Prenatal exposure to flavonoids: implication for cancer risk. Toxicol. Sci. 120:59–67; 2011. [2] Ahlgren, M.; Sorensen, T.; Wohlfahrt, J.; Haflidadottir, A.; Holst, C.; Melbye, M. Birth weight and risk of breast cancer in a cohort of 106,504 women. Int. J. Cancer 107:997–1000; 2003. [3] Vickers, M. H.; Breier, B. H.; Cutfield, W. S.; Hofman, P. L.; Gluckman, P. D. Fetal origins of hyperphagia, obesity, and hypertension and postnatal amplification by hypercaloric nutrition. Am. J. Physiol. Endocrinol. Metab. 279:E83–87; 2000.

K. Vanhees et al. / Free Radical Biology and Medicine 57 (2013) 154–161

[4] Dolinoy, D. C.; Weidman, J. R.; Waterland, R. A.; Jirtle, R. L. Maternal genistein alters coat color and protects Avy mouse offspring from obesity by modifying the fetal epigenome. Environ. Health Perspect. 114:567–572; 2006. [5] Barker, D. J. The intrauterine environment and adult cardiovascular disease. Ciba Found. Symp. 156:3-10; discussion 10-16; 1991. [6] Touyz, R. M. Reactive oxygen species and angiotensin II signaling in vascular cells—implications in cardiovascular disease. Braz. J. Med. Biol. Res. 37:1263–1273; 2004. [7] Yoshizumi, M.; Tsuchiya, K.; Tamaki, T. Signal transduction of reactive oxygen species and mitogen-activated protein kinases in cardiovascular disease. J. Med. Invest. 48:11–24; 2001. [8] Li, M.; Dou, L.; Jiao, J.; Lu, Y.; Guo, H. B.; Man, Y.; Wang, S.; Li, J. NADPH oxidase 2-derived reactive oxygen species are involved in dysfunction and apoptosis of pancreatic beta-cells induced by low density lipoprotein. Cell. Physiol. Biochem. 30:439–449; 2012. [9] Muhammad, S.; Bierhaus, A.; Schwaninger, M. Reactive oxygen species in diabetes-induced vascular damage, stroke, and Alzheimer’s disease. J. Alzheimers Dis. 16:775–785; 2009. [10] Azad, N.; Rojanasakul, Y.; Vallyathan, V. Inflammation and lung cancer: roles of reactive oxygen/nitrogen species. J. Toxicol. Environ. Health B Crit. Rev. 11:1–15; 2008. [11] Oliveira, C. P.; Kassab, P.; Lopasso, F. P.; Souza, H. P.; Janiszewski, M.; Laurindo, F. R.; Iriya, K.; Laudanna, A. A. Protective effect of ascorbic acid in experimental gastric cancer: reduction of oxidative stress. World J. Gastroenterol. 9:446–448; 2003. [12] van de Wetering, C. I.; Coleman, M. C.; Spitz, D. R.; Smith, B. J.; Knudson, C. M. Manganese superoxide dismutase gene dosage affects chromosomal instability and tumor onset in a mouse model of T cell lymphoma. Free Radic. Biol. Med. 44:1677–1686; 2008. [13] Ross, J. A.; Kasum, C. M. Dietary flavonoids: bioavailability, metabolic effects, and safety. Annu. Rev. Nutr. 22:19–34; 2002. [14] Erdman, J. W., Jr.; Balentine, D.; Arab, L.; Beecher, G.; Dwyer, J. T.; Folts, J.; Harnly, J.; Hollman, P.; Keen, C. L.; Mazza, G.; Messina, M.; Scalbert, A.; Vita, J.; Williamson, G.; Burrowes, J. Flavonoids and heart health: proceedings of the ILSI North America Flavonoids Workshop, May 31–June 1, 2005, Washington, DC. J. Nutr. 137:718S-737S; 2007. [15] Aherne, S. A.; O’Brien, N. M. Dietary flavonols: chemistry, food content, and metabolism. Nutrition 18:75–81; 2002. [16] Marik, R.; Allu, M.; Anchoori, R.; Stearns, V.; Umbricht, C. B.; Khan, S. Potent genistein derivatives as inhibitors of estrogen receptor alpha-positive breast cancer. Cancer Biol. Ther. 11:883–892; 2011. [17] Boots, A. W.; Drent, M.; de Boer, V. C.; Bast, A.; Haenen, G. R. Quercetin reduces markers of oxidative stress and inflammation in sarcoidosis. Clin. Nutr. 30:506–512; 2011. [18] Loke, W. M.; Proudfoot, J. M.; Hodgson, J. M.; McKinley, A. J.; Hime, N.; Magat, M.; Stocker, R.; Croft, K. D. Specific dietary polyphenols attenuate atherosclerosis in apolipoprotein E-knockout mice by alleviating inflammation and endothelial dysfunction. Arterioscler. Thromb. Vasc. Biol. 30:749–757; 2010. [19] Mahn, K.; Borras, C.; Knock, G. A.; Taylor, P.; Khan, I. Y.; Sugden, D.; Poston, L.; Ward, J. P.; Sharpe, R. M.; Vina, J.; Aaronson, P. I.; Mann, G. E. Dietary soy isoflavone induced increases in antioxidant and eNOS gene expression lead to improved endothelial function and reduced blood pressure in vivo. FASEB J 19:1755–1757; 2005. [20] Heo, H. J.; Lee, C. Y. Protective effects of quercetin and vitamin C against oxidative stress-induced neurodegeneration. J. Agric. Food Chem. 52:7514–7517; 2004. [21] Mercer, L. D.; Kelly, B. L.; Horne, M. K.; Beart, P. M. Dietary polyphenols protect dopamine neurons from oxidative insults and apoptosis: investigations in primary rat mesencephalic cultures. Biochem. Pharmacol. 69:339–345; 2005. [22] Formica, J. V.; Regelson, W. Review of the biology of quercetin and related bioflavonoids. Food Chem. Toxicol. 33:1061–1080; 1995. [23] Boots, A. W.; Li, H.; Schins, R. P.; Duffin, R.; Heemskerk, J. W.; Bast, A.; Haenen, G. R. The quercetin paradox. Toxicol. Appl. Pharmacol. 222:89–96; 2007. [24] Ullah, M. F.; Shamim, U.; Hanif, S.; Azmi, A. S.; Hadi, S. M. Cellular DNA breakage by soy isoflavone genistein and its methylated structural analogue biochanin A. Mol. Nutr. Food Res. 53:1376–1385; 2009. [25] Gebicki, J. M.; Nauser, T.; Domazou, A.; Steinmann, D.; Bounds, P. L.; Koppenol, W. H. Reduction of protein radicals by GSH and ascorbate: potential biological significance. Amino Acids 39:1131–1137; 2010. [26] Seifried, H. E.; Anderson, D. E.; Fisher, E. I.; Milner, J. A. A review of the interaction among dietary antioxidants and reactive oxygen species. J. Nutr. Biochem. 18:567–579; 2007. [27] Siow, R. C.; Mann, G. E. Dietary isoflavones and vascular protection: activation of cellular antioxidant defenses by SERMs or hormesis? Mol. Aspects Med 31:468–477; 2010. [28] Hur, W.; Gray, N. S. Small molecule modulators of antioxidant response pathway. Curr. Opin. Chem. Biol. 15:162–173; 2011. [29] Niestroy, J.; Barbara, A.; Herbst, K.; Rode, S.; van Liempt, M.; Roos, P. H. Single and concerted effects of benzo[a]pyrene and flavonoids on the AhR and

[30]

[31]

[32]

[33]

[34] [35]

[36]

[37]

[38]

[39]

[40]

[41]

[42] [43] [44]

[45] [46]

[47] [48]

[49] [50] [51] [52]

[53]

[54]

161

Nrf2-pathway in the human colon carcinoma cell line Caco-2. Toxicol. In Vitro 25:671–683; 2011. Chow, J. M.; Shen, S. C.; Huan, S. K.; Lin, H. Y.; Chen, Y. C. Quercetin, but not rutin and quercitrin, prevention of H2O2-induced apoptosis via anti-oxidant activity and heme oxygenase 1 gene expression in macrophages. Biochem. Pharmacol. 69:1839–1851; 2005. Breinholt, V.; Lauridsen, S. T.; Dragsted, L. O. Differential effects of dietary flavonoids on drug metabolizing and antioxidant enzymes in female rat. Xenobiotica 29:1227–1240; 1999. Bonacasa, B.; Siow, R. C.; Mann, G. E. Impact of dietary soy isoflavones in pregnancy on fetal programming of endothelial function in offspring. Microcirculation 18:270–285; 2011. Schroder-van der Elst, J. P.; van der Heide, D.; Rokos, H.; Morreale de Escobar, G.; Kohrle, J. Synthetic flavonoids cross the placenta in the rat and are found in fetal brain. Am. J. Physiol. 274:E253–256; 1998. Ten Have-Opbroek, A. A. Lung development in the mouse embryo. Exp. Lung Res. 17:111–130; 1991. Vanhees, K.; van Schooten, F. J.; Moonen, E. J.; Maas, L. M.; Barjesteh van Waalwijk, van Doorn-Khosrovani, S.; Godschalk, R. W. Maternal intake of quercetin during gestation alters ex vivo benzo[a]pyrene metabolism and DNA adduct formation in adult offspring. Mutagenesis 27:445–451; 2012. Fischer, M. A.; Gransier, T. J.; Beckers, L. M.; Bekers, O.; Bast, A.; Haenen, G. R. Determination of the antioxidant capacity in blood. Clin. Chem. Lab. Med. 43:735–740; 2005. Julicher, R. H.; Sterrenberg, L.; Haenen, G. R.; Bast, A.; Noordhoek, J. Sex differences in the cellular defence system against free radicals from oxygen or drug metabolites in rat. Arch. Toxicol. 56:83–86; 1984. Linschooten, J. O.; Laubenthal, J.; Cemeli, E.; Baumgartner, A.; Anderson, D.; Sipinen, V. E.; Brunborg, G.; Haenen, G. R.; Fthenou, E.; Briede, J. J.; van Schooten, F. J.; Godschalk, R. W. Incomplete protection of genetic integrity of mature spermatozoa against oxidative stress. Reprod. Toxicol. 32:106–111; 2011. Godschalk, R. W.; Maas, L. M.; Van Zandwijk, N.; van ’t Veer, L. J.; Breedijk, A.; Borm, P. J.; Verhaert, J.; Kleinjans, J. C.; van Schooten, F. J. Differences in aromatic–DNA adduct levels between alveolar macrophages and subpopulations of white blood cells from smokers. Carcinogenesis 19:819–825; 1998. Vanhees, K.; Godschalk, R. W.; Sanders, A.; van Waalwijk van Doorn-Khosrovani, S. B.; van Schooten, F. J. Maternal quercetin intake during pregnancy results in an adapted iron homeostasis at adulthood. Toxicology 290:350–358; 2011. Peluso, M.; Srivatanakul, P.; Munnia, A.; Jedpiyawongse, A.; Ceppi, M.; Sangrajrang, S.; Piro, S.; Boffetta, P. Malondialdehyde–deoxyguanosine adducts among workers of a Thai industrial estate and nearby residents. Environ. Health Perspect. 118:55–59; 2010. Li, W.; Kong, A. N. Molecular mechanisms of Nrf2-mediated antioxidant response. Mol. Carcinog. 48:91–104; 2009. Choi, E. J.; Chee, K. M.; Lee, B. H. Anti- and prooxidant effects of chronic quercetin administration in rats. Eur. J. Pharmacol. 482:281–285; 2003. De Marchi, U.; Biasutto, L.; Garbisa, S.; Toninello, A.; Zoratti, M. Quercetin can act either as an inhibitor or an inducer of the mitochondrial permeability transition pore: a demonstration of the ambivalent redox character of polyphenols. Biochim. Biophys. Acta 1787:1425–1432; 2009. Naidu, K. A. Vitamin C in human health and disease is still a mystery? An overview Nutr. J 2:7; 2003. el-Hage, S.; Singh, S. M. Temporal expression of genes encoding free radicalmetabolizing enzymes is associated with higher mRNA levels during in utero development in mice. Dev. Genet 11:149–159; 1990. Zaret, K. S. Regulatory phases of early liver development: paradigms of organogenesis. Nat. Rev. Genet. 3:499–512; 2002. Vanhees, K.; Coort, S.; Ruijters, E. J.; Godschalk, R. W.; van Schooten, F. J.; Barjesteh van Waalwijk van Doorn-Khosrovani, S. Epigenetics: prenatal exposure to genistein leaves a permanent signature on the hematopoietic lineage. FASEB J 25:797–807; 2011. Egert, S.; Rimbach, G. Which sources of flavonoids: complex diets or dietary supplements? Adv. Nutr 2:8–14; 2011. Manach, C.; Scalbert, A.; Morand, C.; Remesy, C.; Jimenez, L. Polyphenols: food sources and bioavailability. Am. J. Clin. Nutr. 79:727–747; 2004. Espin, J. C.; Garcia-Conesa, M. T.; Tomas-Barberan, F. A. Nutraceuticals: facts and fiction. Phytochemistry 68:2986–3008; 2007. Harwood, M.; Danielewska-Nikiel, B.; Borzelleca, J. F.; Flamm, G. W.; Williams, G. M.; Lines, T. C. A critical review of the data related to the safety of quercetin and lack of evidence of in vivo toxicity, including lack of genotoxic/carcinogenic properties. Food Chem. Toxicol. 45:2179–2205; 2007. Jacobs, H.; Koek, G. H.; Peters, R.; Moalin, M.; Tack, J.; van der Vijgh, W. J.; Bast, A.; Haenen, G. R. Differences in pharmacological activities of the antioxidant flavonoid monoHER in humans and mice are caused by variations in its metabolic profile. Clin. Pharmacol. Ther. 90:852–859; 2011. Todaka, E.; Sakurai, K.; Fukata, H.; Miyagawa, H.; Uzuki, M.; Omori, M.; Osada, H.; Ikezuki, Y.; Tsutsumi, O.; Iguchi, T.; Mori, C. Fetal exposure to phytoestrogens—the difference in phytoestrogen status between mother and fetus. Environ. Res. 99:195–203; 2005.