Introduction of dsRNA-specific ribonuclease pac1 into Impatiens walleriana provides resistance to Tomato spotted wilt virus

Scientia Horticulturae 164 (2013) 499–506

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Introduction of dsRNA-specific ribonuclease pac1 into Impatiens walleriana provides resistance to Tomato spotted wilt virus Sneˇzana Miloˇsevic´ a,∗ , Ana Simonovic´ a , Aleksandar Cingel a , Dragana Nikolic´ b , Slavica Ninkovic´ a , Angelina Subotic´ a a b

Institute for Biological Research, University of Belgrade, Bul. despota Stefana 142, 11060 Belgrade, Serbia Institute of Molecular Genetics and Genetic Engineering, University of Belgrade, Vojvode Stepe 444a, 11010 Belgrade, Serbia

a r t i c l e

i n f o

Article history: Received 26 April 2013 Received in revised form 30 August 2013 Accepted 15 October 2013 Keywords: dsRNA-specific ribonuclease Impatiens walleriana Nicotiana tabacum pac1 TSWV Virus resistance

a b s t r a c t The production of several popular impatiens cultivars in Serbia suffers substantial losses due to high incidence of Tomato spotted wilt virus (TSWV) infections. Since TSWV, like majority of plant viruses, has RNA genome and replicates via double-stranded RNA (dsRNA) intermediates, it is a good target for dsRNA-specific endonuclease encoded by pac1 gene from Schizosaccharomyces pombe. In order to introduce resistance to TSWV, Impatiens walleriana, as well as referent species Nicotiana tabacum, were transformed with Agrobacterium tumefaciens C58C1pac1 bearing a binary vector pKT-Lpac1. The transformation and regeneration was successful in both plant species, but the transformation efficiency was higher in tobacco. The obtained pac1-transformed impatiens and tobacco lines were challenged with TSWV by manual inoculation in vitro. I. walleriana clones expressing pac1 were completely resistant to TSWV. Some of the transgenic tobacco lines also showed complete resistance, while others were infected, but with lower frequency, prolonged incubation period and milder symptoms in comparison to untransformed plants. Comparison of morphological parameters including shoot length, number of nodes, leaf length and number of axillary buds per plant between control and transformed lines revealed that pac1 expression does not alter the morphology of the transformants. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Viruses belonging to genus Tospovirus, family Bunyaviridae, such as tomato spotted wilt virus (TSWV) and impatiens necrotic spot virus (INSV), are known as a very serious pathogens that are easily transmitted by flower thrips. They infect a number of horticultural species including chrysanthemum, petunia, impatiens, snapdragon and others (Daughtrey et al., 1997). Vegetative propagation of flowers increases the risk of transmitting viral diseases to the progeny and further spread in new production areas via international trade (Braiser, 2008). The highly polyphagous nature, the efficiency of transmission, the rapidity with which new variants arise, and difficulties in the control of the vectors, make TSWV one of the most feared plant viruses by growers worldwide. The current list of TSWV

Abbreviations: BAP, benzylaminopurine; CPPU, N-(2-chloro-4-pyridyl)-Nphenylurea; DAS-ELISA, double antibody sandwich enzyme-linked immunosorbent assay; DPI, days post inoculation; dsRNA, double-stranded RNA; INSV, Impatiens necrotic spot virus; Km, kanamycin; LB, Luria-Bertani medium; MS, Murashighe and Skoog basal media; NPT II, neomycin phosphotransferase II; pac1, dsRNA-specific ribonuclease; TDZ, thidiazuron; TSWV, Tomato spotted wilt virus. ∗ Corresponding author. Tel.: +381 11 2078393; fax: +381 11 2761433. ´ E-mail address: [email protected] (S. Miloˇsevic). 0304-4238/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.scienta.2013.10.015

hosts consists of 1090 plants species (Parrella et al., 2003). In Serbia, TSWV is a production constraint to tomato, pepper, potato, tobacco, onion, garlic and ornamentals such as Impatiens (Ðekic´ ´ 2010; Miloˇsevic´ et al., 2008; Stankovic´ et al., 2011; Miloˇsevic, et al., 2011, 2012a,b). The production of several popular Impatiens walleriana and I. hawkerii cultivars grown in private nurseries in Serbia suffered substantial losses due to high incidence of TSWV infections in 2006. when a high percentage of mother plants showed local leaf and tip necrosis, chlorotic rings and mosaic, ´ 2010; Miloˇsevic´ et al., 2011, leaf distortion and death (Miloˇsevic, 2012b). Several in vitro propagation and regeneration methods have been developed for eradicating viruses from infected tissues and production of virus-free plants, including thermotherapy (Koubouris et al., 2007; Miloˇsevic´ et al., 2012a), cryotherapy (Wang and Valkonen, 2009) and meristem-tip propagation (Miloˇsevic´ et al., 2011, 2012a,b). Resistance to viruses may be introduced into crops by various genetic manipulations (Sudarshana et al., 2007; Clarke et al., 2008). R-proteins, the basis of innate plant immunity, may be introduced into sensitive crops either by conventional breeding or by transgenic approaches. Animal-derived recombinant anti-viral antibodies can be ectopically expressed in plant cells granting specific resistance (Safarnejad et al., 2011). Pathogenderived resistance is also artificial and is based on expression of

500

S. Miloˇsevi´c et al. / Scientia Horticulturae 164 (2013) 499–506

sequences that initiate RNA silencing of viral sequences (SimónMateo and García, 2011) or on expression of viral structural genes in the host plants, such as wild-type or altered coat proteins that interfere with viral particle assembly (Beachy, 1999). All of these approaches, however, may provide resistance only to one virus or its close relatives and there is always a possibility that mutated viral strains escape the established resistance. The fact that the majority of plant viruses are RNA viruses, which replicate through double-stranded RNA (dsRNA) intermediates, allows for targeting dsRNA structures instead of specific viral sequences or proteins by genetic manipulations. pac1 ribonuclease isolated from Schizosaccharomyces pombe, a highly active ds-specific endoribonuclease that cleaves long dsRNAs and small hairpin RNAs (Rotondo and Frendewey, 1996; Rotondo et al., 1997) have been successfully introduced into several plant species conferring a broad resistance or tolerance to viral and viroid pathogens (Watanabe et al., 1995; Sano et al., 1997; Ishida et al., 2002; Toguri et al., 2003; Ogawa et al., 2005). The aim of this work is stable integration of pac1 gene into I. walleriana, a valued potted and bedding flower (Balsaminaceae), in order to protect it from TSWV infections and possibly from other viral infections as well. TSWV, containing a tripartite ambisense RNA genome (Mandal et al., 2008) is a good target for suppression by pac1 (Ogawa et al., 2005). Along with impatiens, we also introduced pac1 into Nicotiana tabacum. More than 20 viruses, including TSWV, occur in tobacco naturally (Gooding, 1991), so viral diseases are one of the most important limiting factors in tobacco industry. Tobacco has already been successfully transformed with pac1 and the transformants showed partial tolerance to tomato mosaic virus, cucumber mosaic virus and potato virus Y (Watanabe et al., 1995). Since tobacco is an extremely versatile model plant for tissue culture and genetic engineering (Ganapathi et al., 2004; Clemente, 2006), is hyper-susceptible to viral infections (Gleba et al., 2004) and can be experimentally infected with more than hundred of viral species (Gooding, 1991), we used it as a reference to evaluate the efficiencies of transformation, regeneration and in vitro inoculation protocols used for impatiens. 2. Materials and methods 2.1. Plant material The in vitro culture of I. walleriana plants was initiated from Busy Lizzi Safari mixed F2 seeds (Johnsons Seeds, UK), while the tobacco seeds cv. Wisconsin 38 were obtained from The Botanical Garden of Nijmegen. The seeds were surface-sterilized in 10% commercial bleach (5% hypochlorite) for 15 min, washed in sterile water and set to germinate on plates with MS (Murashige and Skoog, 1962) medium. All cultures were maintained at 24 ± 2 ◦ C under fluorescent light of 40 ␮mol m−2 s−1 16 h light/8 h dark photoperiod. 2.2. Bacterial strains and constructs A binary vector pKT-Lpac1, derived from pBI121 (Toguri et al., 2003), was kindly provided by dr Toguri. The T-DNA region of the plasmid features kanamycin (Km) resistance, due to neomycin phosphotransferase II (npt II) gene driven by nopaline synthetase promoter, as well as RNA-virus resistance, conferred in host plants by RNA-specific ribonuclease pac1 cassette with 35S promoter. The pKT-Lpac1 was introduced into Agrobacterium tumefaciens strain C58C1 by elctroporation. The obtained A. tumefaciens C58C1pac1 was used for transformation of both I. walleriana and N. tabacum. The bacteria were cultured on solid (LB) medium (Bertani, 1951) supplemented with 100 mg l−l Km. Bacterial suspension used for transformation was prepared by transferring a single bacterial

colony to liquid LB medium, and the suspension with OD600 of 0.6 was used. 2.3. Transformation of impatiens and tobacco with A. tumefaciens C58C1pac1 I. walleriana nodal segments (∼5 mm long) with one axillary bud were longitudinally cut, needle pricked to inflict epidermal injuries, and immersed into the bacterial suspension. A total of 135 I. walleriana explants were inoculated, along with control explants that were immersed in sterile LB medium. The explants were shook in bacterial suspensions for 50 min, 2 h or 20 h in darkness. A total of 72 tobacco leaf discs, approximately 5 mm in diameter, from four weeks old in vitro grown plantlets were also inoculated with A. tumefaciens C58C1pac1 for 10 or 30 min. The explants were cocultivated with bacteria in darkness for 3 days on basal media (MS) supplemented with 100 ␮M acetosyringone. After the co-cultivation, the explants were washed with 1 g l−l cefotaxime solution and blotted on sterile filter paper. Out of 135 I. walleriana explants, 75 were transferred onto a shoot-induction MS medium supplemented with 0.1 ␮M N-(2-chloro-4-pyridyl)-Nphenylurea (CPPU), while the remaining 60 explants were cultured on media with 0.1 ␮M thidiazuron (TDZ). All cultures also contained 500 mg l−l cefotaxime and 100 mg l−l Km. The medium for tobacco regeneration (Uzelac et al., 2006) contained 5 ␮M benzylaminopurine (BAP), 300 mg l−l cefotaxime and 50 mg l−l Km. The explants were transferred to a fresh shoot-induction medium containing antibiotics every 3–4 weeks. The regenerated Km-resistant shoots were maintained on the same medium for the next few months. The success of the transformation was confirmed by the presence and expression of the pac1 gene in the Km-resistant lines. Genomic DNA was isolated by CTAB method described by Zhou et al. (1994). Comparison of different methods for total RNA isolation from Impatiens tissues rich in phenolics revealed that the optimal method was CTAB extraction/LiCL precipitation protocol described by Gasic et al. (2004). A 1000 bp pac1 fragment was amplified from genomic DNA samples using specific primers Fpac1: 5 -GCCGACAGCACCCAGTTCAC and Rpac1: 5 CCTGCCGTAAGTTTCACCTCACC and GeneAmp® Gold PCR Reagent Kit (Applied Biosystems, UK) components according to manufacturer’s protocol. That the pac1 amplification is a consequence of its integration into the plant genome and not bacterial contamination was confirmed by the absence of bacterial virG amplification with primers FvirG: 5 -GCCGACAGCACCCAGTTCAC and RvirG: 5 CCTGCCGTAAGTTTCACCTCACC that produce a 390 bp fragment. The PCR program consisted of initial denaturation (95 ◦ C/5 min) followed by 38 cycles of denaturation (95 ◦ C/1 min), annealing (at 52 ◦ C for pac1 or 60 ◦ C for virG, for 1 min), and extension (72 ◦ C/2 min), with final extension for 10 min at 72 ◦ C. The expression of pac1 gene was determined by RT-PCR, using GeneAmp® Gold RNA PCR Reagent Kit (Applied Biosystems) according to manufacturer’s recommendations, with oligo-dT primers in the reverse transcription step and gene-specific primers in the amplification step. For both PCR and RT-PCR analyses, DNA or RNA isolated from non-transformed plants were used for negative control, while purified plasmids were used as positive control. The amplicons were analyzed electrophoretically. 2.4. Inoculation of test plants with TSWV in vitro As a source of TSWV for plant inoculation in disease resistance tests, one infected I. hawkerii plant with developed symptoms was used. The presence of TSWV in I. hawkerii was confirmed by DASELISA, RT-PCR and sequencing of the isolate, as described earlier (Miloˇsevic´ et al., 2011). Shoot tips of infected plants (2 cm long) were thoroughly washed under running tap water and surface

S. Miloˇsevi´c et al. / Scientia Horticulturae 164 (2013) 499–506

501

sterilized with 10% sodium hypochlorite for 15 min before 4–5 rinses in sterile deionized water. The inoculum was prepared by grinding leaves in a chilled sterile mortar and pestle, and homogenizing them in 1:2 (w:v) freshly prepared sterile ice cold 0.01 M K-phosphate buffer containing 0.01 M Na-sulfite, pH 7.0, under a laminar hood. Autoclaved Carborundum (600 grit) was added to the sap as 10% suspension. The saps were used to inoculate leaves of ten I. walleriana and N. tabacum plants of each transformed line, at the two to five-leaf development stages. Fingers with sterile latex gloves were dipped into the sap and gently rubbed over the leaves’ surface of each plantlet. The inoculum was maintained on ice until the inoculation was completed. After inoculation, the plantlets were sprayed with sterile deionized water and kept in a growth chamber. The development of TSWV symptoms was monitored daily. The presence of TSWV in the inoculated plants was tested by DAS-ELISA 30 days following inoculation, as described previously (Miloˇsevic´ et al., 2011). 3. Results and discussion

Fig. 1. Sensitivity of I. walleriana explants to Kanamycin. For each indicated Km concentration, 10 uniformely sized I. walleriana explants were planted and grown for four weeks, when the number od roots per explant was recorded as an indicator of sensitivity to antibiotic. Statistical difference at a significance level of P < 0.05 is indicated in different letters.

3.1. Determination of selective kanamycin concentration for I. walleriana In order to determine suitable Km concentration for reliable discrimination between the transformed and non-transformed impatiens clones, a kanamycin sensitivity test was performed. For each Km concentration (0, 10, 25, 50 and 100 mg l−l ), 10 uniformly sized I. walleriana explants were planted and grown in jars for four weeks. The impatiens explants planted on MS containing 10 mg l−l Km grew slower in comparison to the control explants, but developed roots and axillary shoots normally. Explants grown on 25 mg l−l Km rooted well, but had reduced number of axillary shoots, while explants on 50 mg l−l Km were retarded, with a single root and few axillary shoots that developed with a delay in comparison to the control. I. walleriana explants set on 100 mg l−l Km did not produce roots at all, and had only a few axillary shoots which developed slower in comparison to other treatments. Sensitivity of impatiens explants to Km was presented as a number of developed roots per explant (Fig. 1). Based on these results, it was decided to perform the selection on 100 mg l−l Km. Dan et al. (2010) found that the concentration of 50 mg l−l Km completely inhibited root growth in untransformed I. walleriana cv. Accent Red. This could be assigned to higher sensitivity of the cultivar used in their study. Since there was no significant difference in percentage of shoots producing roots on 25, 35 and 50 mg l−l Km, the autors decided to use non-lethal Km concentration of 35 mg l−l , in order to allow recovery of transgenic plants having low expression of nptII.

3.2. Transformation and regeneration of I. walleriana Duration of inoculation, as one of important factors affecting transformation and regeneration efficiency, has to be optimized for each plant species (Karthikeyan et al., 2012). Preliminary results on nodal segments with axillary buds as explants showed that inoculation for 10, 20 or 30 min was unfruitful (data not shown). Inoculation of explants with slow shaking in bacterial suspension for 2 h was effective, resulting in PCR positive lines, while longer inoculation did not improve the frequency of transformation (Table 1). Prolonged inoculation did not produce any transgenic shoots; many of the explants inoculated for 20 h and grown on CPPU, ceased growing on selective medium within two weeks, became vitrified and eventually wilted. It is possible that Agrobacterium infectivity decreased, since the exponential growth stage was over. Longer exposure to Agrobacterium can also lead to overgrowth of explants with bacterial cells, resulting in complete loss of regeneration ability of the transformed cells (Liu and Pijut, 2010). The composition of shoot growth medium was another determinant factor of successful impatiens transformation (Table 1). All positive lines were grown on TDZ containing medium. TDZ is an efficient plant growth regulator shown to enhance not only regeneration (Jones et al., 2007), but also Agrobacterium-mediated transformation (Thirukkumaran et al., 2009). TDZ was also superior

Table 1 Transformation efficiency of I. walleriana and N. tabacum explants with A. tumefaciens C58C1pac1. Duration of inoculation I. walleriana 50 min 2h 20 h Total N. tabacum 10 min 30 min Total

Cytokinin ␮M

No. of inoculated explants

No. of lines that survived 5 passages on Km

PCR-positive/analyzed lines

RT-PCR-positive lines

0.1 TDZ 0.1 CPPU 0.1 TDZ 0.1 CPPU 0.1 TDZ 0.1 CPPU 135

9 16 31 31 20 28 54 (40%)

3 (33.33%) 6 (37.50%) 17 (54.84%) 12 (38.71%) 13 (65.00%) 3 (10.71%) 4/35

0/3 0/5 4/7 0/7 0/10 0/3 2

0 0 2 0 0 0

5 BAP

38 34 38 (52.78%)

25 (65.79%) 13 (38.23%) 15/19

14/14 1/5 15

14 1

72

In both species the transformation of the explants depended on duration of inoculation. In the case of I. walleriana, the choice of cytokinin apllied for the regeneration also affected the efficiency of transformation. Of Km-resistant lines, 35 out of 54 impatiens and 19 out of 38 tobacco lines were further analyzed by PCR and RT-PCR. Transformation of tobacco was more efficient in comparison to impatiens.

502

S. Miloˇsevi´c et al. / Scientia Horticulturae 164 (2013) 499–506

Fig. 2. Transformation and regeneration of I. walleriana. Shoots were induced from nodal segments with axillary buds in both control plants (a) and putative transformants (b) on MS medium containing 0.1 ␮M TDZ, 7 days after innoculation. Tansformed shoots grown for 4 weeks on selective medium (100 mg l−l Km and 500 mg l−l cefotaxime) supplemented with either 0.1 ␮M TDZ (c) or 0.1 ␮M CPPU (d) and (e) thrived well, while the control plants (f) did not survive the Km treatment. Transformed shoots survived five passages of Km (100 mg l−l ) selection spontaneously rooted on solid hormone-free MS medium (g). Transformed lines i6 and i8 showed no visible morphological differences in comparison to control plants (cp) after 4 weeks on hormone-free MS medium (h).

in comparison to other growth regulators in promoting regeneration from I. walleriana cotiledonary nodes (Baxter, 2005; Dan et al., 2010). Showing both auxin and cytokinin-like effects (Yancheva et al., 2003), TDZ is highly efficient in regeneration processes in various plant species by modifying endogenous levels of phytohormones and by induction or enhancement of a number of physiological and biochemical processes (Guo et al., 2011). After three days of co-cultivation, I. walleriana explants were selected on MS medium supplemented with 100 mg l−l Km, with addition of CPPU or TDZ. Axillary buds were developed within seven days both in control (Fig. 2a) and inoculated (Fig. 2b) explants. Individual shoots were excised and transferred to the fresh medium every 4 weeks. The efficiency of axillary buds formation in potentially transformed tissue depended on the applied cytokinin: the shoots elongated faster on selective media (100 mg l−l Km and 500 mg l−l cefotaxime) containing 0.1 ␮M TDZ (Fig. 2c), but were more numerous on 0.1 ␮M CPPU (Fig. 2d and e), as descibed previously (Subotic´ et al., 2008). The control explants completely necrotized after 5 passages on selective media with 100 mg l−l Km regardless of the applied cytokinin (Fig. 2f). Out of 135 inoculated I. walleriana explants, 54 (40%) survived five subcultures of Km selection (Table 1). The Km-resistant explants were then transferred to antibiotic- and hormone-free MS medium. At first these explants grew slower in comparison to the control plants that were cultured without antibiotics, but caught up in the next passage and spontaneously rooted (Fig. 2g). The presence of pac1 in I. walleriana genome was confirmed in 4 out of 35 analyzed lines (i3, i6, i8 and i10, Fig. 3) showing a 1000-bp

amplified fragment. All of the pac1-positive lines were inoculated for 2 h and regenerated on TDZ (Table 1). This procedure gave rise to 23.52% of surviving shoots being true transformed shoots, with final transformation efficiency of 12.81% (four positive lines out of 31 explants). None of the tested lines was contaminated with residual A. tumefaciens that survived the cefotaxime treatment, as confirmed by the absence of virG amplification (Fig. 3), meaning that the amplified pac1 was not of bacterial origin. RT-PCR amplification of a 1000bp pac1 segment revealed that pac1 is expressed in lines i6 and i8 (Fig. 3), so the transformation was successful, but with low efficiency. Negative results for i3 and i10 lines suggest either very low pac1 expression or possibly its silencing, due to inadequate insertion site. It is hard to explain how 40% of the explants survived the Km selection, and yet only 4 lines had pac1 successfully amplified, but it is possible that the integration and expression of nptII was more effective in comparison to pac1 gene. Independent integration of selectable marker and a gene of interest cassettes from the same vector were shown in many cases, for example for nptII and chalcone synthase integration into Bidens pilosa genome (Wang et al., 2012). Notably, it has been reported that up to 90% of kanamycinsurvived shoots could be non-transformed (Dan et al., 2010). Even though the regeneration protocol starting with I. walleriana nodal segments with axillary buds was successful, the frequency of transformation was low (12.81%). Other research groups also found I. walleriana to be recalcitrant to tissue culture and transformation manipulations (Baxter, 2005; Dan et al., 2010). Successful

S. Miloˇsevi´c et al. / Scientia Horticulturae 164 (2013) 499–506

503

Fig. 3. PCR and RT-PCR confirmation of impatiens and tobacco transformation with pac1. Presence of pac1 gen was confirmed by PCR amplification of a 1000 bp fragment in four I. walleriana lines (i3, i6, i8 and i10), as well as in 15 N. tobacco lines (t2–t4 and t8–t12 are shown). That the pac1 amplification was not due to bacterial contamination was confirmed by the absence of virG amplification product of 390 bp in all pac1-positive lines. As determined by RT-PCR analyses, pac1 is expressed in two impatiens lines (i6 and i8), as well as in 15 tobacco lines (t2–t4 and t8–t14, but with very faint t8 band, are shown). N – Untransformed control plants as a negative control; i1–i11 – I. walleriana potential transformants; t2–t15 – N. tabacum potential transformants; At – A. tumefaciens C58C1pac1 used as a positive control in PCR reactions.

Fig. 4. Transformation and regeneration of N. tabacum. Calli were induced from leaf explants on MS medium with 5 ␮M BAP in contol untransformed culture (a) and in transformed culture on selective medium containing 50 mg l−l Km and 300 mg l−l cefotaxime, (c) 7 days after inoculation. The control leaf explant culture did not survive on selective medium. (b) Shoot regeneration on MS medium with 5 ␮M BAP occured both in control explants (d) and in transformed culture on medium supplemented with 50 mg l−l Km and 300 mg l−l cefotaxime. (e) Regenerated plants after four weeks on MS medium: control plants without antibiotics, (f) control plants grown on selective medium (g) and transformed plants on selective medium. (h) Rooting of the transgenic plants occured spontaneously on hormone-free MS medium. (i) Transformed lines t13 and t16 showed no visible morphological differences in comparison to control plants (cp) after two weeks on hormone-free MS medium (j).

I. walleriana regeneration was achieved from cotiledonary nodes, after elaborate optimization, but no stable transformation has been obtained with these explants (Baxter, 2005). A high-frequency transformation protocol with A. tumefaciens bearing a GFP binary reporter vector has been eventually developed using in vitro multiple bud cultures as explants (Dan et al., 2010). 3.3. Transformation and regeneration of N. tabacum Transformation of tobacco with A. tumefaciens C58C1pac1 was performed using leaf discs as target explants. This is a well established protocol used widely for rapid evaluation of transgenes in

higher plants (Clemente, 2006), including pac1-derived resistance (Watanabe et al., 1995). Both control explants (Fig. 4a) and inoculated leaf discs (Fig. 4c) developed calli on 5 ␮M BAP within 7 days following inoculation. The inoculation for 10 min was more effective than longer inoculation for 30 min (Table 1). While the inoculated explants thrived on medium containing 50 mg l−l Km and 300 mg l−l cefotaxime (Fig. 4c), the control explants did not survive if placed on selective medium (Fig. 4b). Shoots regenerated from calli in both control (Fig. 4d) and transformed explants (Fig. 4e) on inductive medium supplemented with 5 ␮M BAP, and one shoot from each leaf disk was further propagated. Resistance to Km was confirmed in 4-weeks old shoots by comparing control

504

S. Miloˇsevi´c et al. / Scientia Horticulturae 164 (2013) 499–506

Fig. 5. pac1-transformed impatiens and tobacco are resistant to TSWV infection. Control and pac1-transformed impatiens and tobacco plants were challenged with TSWV by manual in vitro inoculation. The symptoms of the infection were observed after four weeks: (a) control I. walleriana plants inoculated with TSWV display chlorotic spots, leaf distortion and necrosis as visible symptoms of infection; (b) pac1-transformed I. walleriana line i6 appear healthy four weeks following inoculation; (c) mottle along leaf nervature on control N. tabacum plants and (d) transformed N. tabacum, line t19, inoculated with TSWV with no signs of infection.

(Fig. 4f and g) and transformed shoot culture (Fig. 4h). Rooting was spontaneous on hormone-free MS medium (Fig. 4i). From 72 inoculated discs e.g. regenerants, 38 lines survived five subcultures of Km selection, of which 19 Km-resistant lines were further analyzed (Table 1 and Fig. 3). The presence of pac1 as well as its expression was confirmed in 15 transgenic lines (t2–t4, t8–t17, t19 and t21), as presented in Fig. 3, indicating higher transformation frequency than in impatiens plants. 3.4. Screening for TSWV resistance in vitro To test whether the transformed impatiens and tobacco lines were resistant to TSWV, all I. walleriana lines where presence of pac1 gene was confirmed (i3, i6, i8 and i10) and four selected tobacco lines that express pac1 gene (t3, t4, t15 and t19) were challenged with TSWV. The plants were inoculated manually with abrasive, which is a routine technique for the evaluation of virus resistance, but the entire inoculation and screening process was performed in vitro. Only a few papers describe similar in vitro inoculation protocols. Russo and Slack (1998) used glass rods with abrasive silicon carbide for in vitro inoculation of three Solanaceae species, potato, tomato and tobacco, with Potato virus Y and Cucumber mosaic virus. The method we developed for inoculation with TSWV is similar to simple and efficient in vitro method for testing Lettuce mosaic virus resistance in lettuce culture, developed by Mazier et al. (2004). Putative virus-resistant transgenic plants are usually transferred from tissue culture to a greenhouse or a growth chamber to screen for virus resistance and to monitor symptoms development (Mandal et al., 2008). This is a costly and timeconsuming process, constrained by environmental safety issues, especially when handling recombinant or quarantine viruses and genetically modified plants. Regardless of the method, additional advantages of in vitro inoculation and screening include decreased space requirements for propagation and maintenance of lines and easier controlling of the environment including light, temperature and other pathogens and pests (Russo and Slack, 1998). The inoculated plants were observed daily for development of the symptoms. The majority of control impatiens plants (7 out of 10 inoculated, Table 2) developed symptoms including chlorotic spots, blisters, local necrotic lesions and leaf deformations (Fig. 5a),

12–21 days post inoculation (DPI). The presence of the virus was confirmed in all symptomatic plants by DAS-ELISA test, performed 30 DPI. All but one (9/10) control tobacco plants initially produced chlorotic spots (8–10 DPI), while leaf deformation and mottles along veins (Fig. 5c) developed 8–16 DPI. Two control plants were systemically infected (with necrotic spots on newly developed leaves), and two plants died a week following symptoms recording. Serological analyses, however, confirmed the TSWV presence in all the remaining plants, including the asymptomatic one (Table 2). Since the majority of challenged impatiens plants and all control tobacco plants were infected, we could conclude that the method of in vitro inoculation was successful. Manual transmission of TSWV is not very efficient in certain host species, resulting in many ‘escapes’, as reported for mechanical transmission of TSWV to peanut (Mandal et al., 2006, 2008). Plant growth environment, growth stage, source of inoculum, antioxidants and abrasives were found to influence the rate of mechanical transmission of viruses, but manual inoculation also depends on the experimenter’s skill, as uneven hand pressure while rubbing lamina may cause damage to the leaves. The higher inoculation efficiency of tobacco in comparison to impatiens may be due to different leaves’ size, surface and softness, which can influence the inoculum coverage and penetration (Mandal et al., 2008). Transformed I. walleriana lines i6 and i8, which accumulated pac1 transcript (Fig. 3) were completely resistant to TSWV, as no symptoms were developed within 30 DPI, and the ELISA test was negative (Fig. 5b and Table 2). Interestingly, even i3 and i10 lines with undetectable pac1 expression showed lower incidence of infection, delayed symptom development and milder symptoms in comparison to control plants (Table 2). Expression of 35S-driven transgenes may vary not only among independent transformants or individuals of the same line, but also between leaves on the same plant and within a leaf (van Leeuwen et al., 2001), so it is possible that i3 and i10 lines actually had some (low) pac1 expression that was hardly detectable by RT-PCR. All of the tobacco lines challenged with TSWV accumulated the pac1 transcript (Fig. 3), but only t3 and t19 lines showed complete resistance (Fig. 5d), while t4 and t15 were infected, but with lower frequency, prolonged incubation period and somewhat milder symptoms in comparison to untransformed plants (Table 2). The presence of the symptoms was

S. Miloˇsevi´c et al. / Scientia Horticulturae 164 (2013) 499–506

505

Table 2 Screening for TSWV resistance in vitro. No. of symptomatic plants

Pac1 expression

Incubation period (DPI)

Type of symptoms

No. TSWV positive plants by DAS-ELISA

I. walleriana control i3 i6 i8 i10

7/10 2/10 0/10 0/10 3/10

– − + + −

12–21 18–24 19–20

cs, bs, nll, d, ld cs, nll cs, nll

7/10 2/10 0/10 0/10 3/10

N. tabacum control t3 t4 t15 t19

9/10 0/10 3/10 4/10 0/10

– + + + +

8–16 11–19 12–19 -

mnn, ld, si cs, d, mnn mo, da, d -

8a /8 0/10 3/10 4/10 0/10

Lines

TSWV was mechanically transmitted in vitro to 10 plantlets of each of I. walleriana and N. tabacum transformed lines and controls. In some plants the inoculation caused development of the following symptoms: bs, blister and sunken part; cs, chlorotic spots; d, distortion; da, dark areas; ld, leaf deformation; mnn, mottle near leaf’s nerves; mo, mottle; nll, necrotic local lesion; si, systemic infection. Incubation period, e.g. days post inoculation (DPI) when the symptoms developed is indicated. All the plants were tested for the presence of TSWV by DAS-ELISA at 30 DPI. a Two of the control plants died from infection before the DAS-ELISA test performed, so 8 plantlets were analyzed. Table 3 Morphological traits of I. walleriana and N. tabacum pac1 transformants. Line I. walleriana Control i6 i8 N. tabacum Control t3 t4 t9 t10 t11 t12 t13 t15 t16 t17 t19

Shoot length (mm)

Number of nodes per plant

Number of leaves per plant

Leaf length (mm)

Number of axillary buds per plant

93.33 ± 0.11a 89.20 ± 0.10a 78.67 ± 0.09a

10.67 ± 0.33a 10.40 ± 0.40a 10.00 ± 0.36a

12.33 ± 0.18a 13.00 ± 0.14a 11.83 ± 0.10a

29.20 ± 0.67b 27.42 ± 0.41ab 24.76 ± 0.17a

1.67 ± 0.33a 1.60 ± 0.20a 1.83 ± 0.18a

9.26 9.20 8.93 9.27 10.50 11.50 10.80 10.37 5.80 9.07 10.3 5.23

± ± ± ± ± ± ± ± ± ± ± ±

0.24b 0.53b 0.38b 0.47b 0.32b 0.48b 0.46b 0.79b 0.17a 0.28b 0.15b 0.34a

11.00 ± 0.58bcd 10.33 ± 0.88bc 8.67 ± 0.33ab 10.33 ± 0.33bc 14.67 ± 0.27d 11.67 ± 0.18bcd 12.00 ± 0.59bcd 13.67 ± 0.5cd 7.00 ± 0.17a 12.00 ± 0.63bcd 13.00 ± 0.7cd 8.33 ± 0.33ab

7.23 7.33 7.50 7.20 6.87 7.63 7.33 6.50 4.40 5.70 6.70 4.90

± ± ± ± ± ± ± ± ± ± ± ±

0.50cd 0.56cd 0.36cd 0.15cd 0.18d 0.19d 0.14cd 0.56bcd 0.12a 0.19bc 0.59bcd 0.10ab

1.33 1.67 1.67 1.67 1.67 2.33 2.00 3.00 2.33 2.00 1.30 1.00

± ± ± ± ± ± ± ± ± ± ± ±

0.13ab 0.03abc 0.33abc 0.11abc 0.23abc 0.09cd 0.17bc 0.31d 0.16cd 0.13bc 0.09ab 0.07a

Morphometric parameters were determined for 10 plants of each transformed line and control in order to evaluate the effect of pac1 expression on morphology of the transformants. Statistical difference at a significance level of P < 0.05 is indicated in different letters.

in accordance with ELISA results. Our results are consistent with previously reported results for pac1-transformed tobacco, which showed a decrease in lesion numbers when challenged with Tomato mosaic virus, and a delay in the appearance of symptoms when inoculated with Cucumber mosaic virus or Potato virus Y (Watanabe et al., 1995). Transgenic Chrysanthemum plants bearing pac1 showed significantly lower infection frequency with TSWV than control plants (Ogawa et al., 2005). These effects of pac1 dsRNase-mediated resistance in transformed plants are probably due to (partial) inhibition of virus replication in each cell (Watanabe et al., 1995). The introduction of pac1 may protect plants not only from a variety of viruses, but also from viroids, such as Potato spindle tuber viroid that can be digested by pac1 gene product in vitro (Sano et al., 1997; Ishida et al., 2002) or Chrysanthemum stunt viroid (Ishida et al., 2002; Toguri et al., 2003, Ogawa et al., 2005). Since pac1 introduction was shown to confer broad spectrum of resistance against multiple plant viruses and viroids (Watanabe et al., 1995; Ishida et al., 2002; Ogawa et al., 2005), the obtained I. walleriana transgenes are likely resistant to some other viruses beside TSWV. 3.5. Morphological traits of pac1-transgenic I. walleriana and N. tabacum Transformed I. walleriana and N. tabacum that express pac1 were compared with control plants in morphological traits including

shoot length, number of nodes per plant, number of leaves, leaf length, and the number of axillary buds (Table 3). For all the recorded parameters there were no statistically significant differences between the transgenic and control impatiens plants, except that the leaves were somewhat shorter in transformed plants (Table 3). Most of the tobacco lines also did not differ significantly from the untransformed lines, except that lines t15 and t19 were smaller than control plants. It can be concluded that the pac1 expression does not significantly alter morphology of the regenerants. The obtained results are in concordance with earlier findings that pac1 gene expression caused no detrimental effects on tobacco regeneration, physiology, morphology or fertility (Watanabe et al., 1995). Also, the pac1 transgenic chrysanthemums did not look different from the non-transgenic plants (Ishida et al., 2002). 4. Conclusions A successful transformation and regeneration protocol starting with nodal segments with axillary buds has been developed for I. walleriana, a plant known to be recalcitrant to tissue culture manipulations and transformation. However, the protocol may be further optimized in order to increase its efficiency. The developed manual in vitro method for inoculation of plants with TSWV is very effective, as most of the inoculated plants were infected. Expression of pac1 transgene provides complete and effective protection against

506

S. Miloˇsevi´c et al. / Scientia Horticulturae 164 (2013) 499–506

TSWV in I. walleriana, while transgenic tobacco lines explain either complete resistance or enhanced tolerance to TSWV, evident as lower incidence of infection, delayed symptoms and milder symptoms in comparison to the untransformed plants. Importantly, pac1 expression does not affect the morphology of the transformants. It would be interesting to challenge the obtained transgenic I. walleriana lines with other viruses, especially with INSV, since pac1 should provide a very broad resistance to viral and viroid diseases. Acknowledgments We thank Dr. Toshihiro Toguri, Plant Laboratory, Kirin Brewery Co., Japan, for providing vector pKT-Lpac1 used in this work. We also thank Dr. Branka Uzelac, Institute for Biological Research “Sinisa Stankovic” for the tobacco in vitro culture. This study was supported by the Ministry of Education, Science and Technological Development of the Republic of Serbia, Project TR-31019. References Baxter, A., 2005. Regeneration and Transformation of Impatiens walleriana using Cotyledonary Node Culture. Master of Science in Horticulture, State University, Blacksburg. Beachy, R.N., 1999. Coat-protein-mediated resistance to tobacco mosaic virus: discovery mechanisms and exploitation. Philos. Trans. R. Soc. Lond. B Biol. Sci. 354 (1383), 659–664. Bertani, G., 1951. Studies on lysogenesis, I. The mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol. 62, 293–300. Braiser, C.M., 2008. The biosecurity threat to the UK and global environment from international trade in plants. Plant Pathol. 57, 792–808. Clarke, J.L., Spetz, C., Haugslien, S., Xing, S., Dees, M.W., Moe, R., Blystad, D.R., 2008. Agrobacterium tumefaciens-mediated transformation of poinsettia, Euphorbia pulcherrima, with virus-derived hairpin RNA constructs confers to Poisettia mosaic virus. Plant Cell Rep. 27, 1027–1038. Clemente, T., 2006. Nicotiana (Nicotiana tobaccum, Nicotiana benthamiana). In: Wang, K. (Ed.), Agrobacterium protocols. Methods in Molecular Biology 343, Vol. 1, 2nd ed. Humana Press Inc., New Jersey, pp. 143–154. Dan, Y., Baxter, A., Zhang, S., Pantazis, C.J., Veilleux, R.E., 2010. Development of efficient plant regeneration and transformation system for impatiens using Agrobacterium tumefaciens and multiple bud cultures as explants. BMC Plant Biol. 10, 165. Daughtrey, M.L., Jones, R.K., Moyer, J.W., Daub, M.E., 1997. Tospoviruses strike the greenhouse industry – INSV has become a major pathogen on flower crops. Plant Dis. 81, 1220–1230. ´ I., Bulajic, ´ A., Vuˇcurovic, ´ A., Ristic, ´ D., Krstic, ´ B., 2008. Influence of Tomato SpotÐekic, ted WiltVirus uneven distribution on its serological detection in tomato, Pepper Ornamentals. Pestic. Phytomed. (Belgrade) 23, 225–234 (in Serbian). Ganapathi, T.R., Suprasanna, P., Rao, P.S., Bapat, V.A., 2004. Tobacco (Nicotiana tabacum L.) – a model system for tissue culture interventions and genetic engineering. Indian J. Biotechnol. 3, 171–184. Gasic, K., Hernandez, A., Korban, S.S., 2004. RNA extraction from different apple tissues rich in polyphenols and polysaccharides for cDNA library construction. Plant Mol. Biol. Rep. 22, 437a-437g. Gooding, G.V., 1991. Disease caused by viruses. In: Shew, H.D., Lucas, G.B. (Eds.), Compendium of Tobacco Diseases. American Phytopathological Society, St. Paul, MN, pp. 41–47. Gleba, Y., Marillonnet, S., Klimyuk, V., 2004. Engineering viral expression vectors for plants: the full virus and the deconstructed virus strategies. Curr. Opin. Plant Biol. 7, 182–188. Guo, B., Haider, A.B., Zeb, A., Xu, L.L., Wei, Y.H., 2011. Thidiazuron: a multidimensional plant growth regulator. Afr. J. Biotechnol. 10 (45), 8984–9000. Ishida, I., Tukahara, M., Yoshioka, M., Ogawa, T., Kakitani, M., Toguri, T., 2002. Production of anti-virus, viroid plants by genetic manipulations. Pest Manage. Sci. 58, 1132–1136. Jones, M.P.A., Cao, J., O’Brien, R., Murch, S.J., Saxena, P.K., 2007. The mode of action of thidiazuron: auxins, indoleamines and ion channels in the regeneration of Echinacea purpurea L. Plant Cell Rep. 26, 1481–1490. Karthikeyan, A., Valarmathi, A., Nandini, S., Nandhakumar, M.R., 2012. Genetically modified crops: insect resistance. Biotechnology 11, 119–126. Koubouris, G.C., Maliogka, V.I., Efthimiou, K., Katis, N.I., Vasilakakis, M.D., 2007. Elimination of Plum pox virus through in vitro thermotherapy and shoot tip culture compared to conventional heat treatment in apricot cultivar Bebecou. J. Gen. Plant Pathol. 73 (5), 370–373. Liu, X., Pijut, P., 2010. Agrobacterium-medicated transformation of mature Prunus serotina (black cherry) and regeneration of trangenic shoots. Plant Cell Tissue Organ Cult. 101, 49–57.

Mandal, B., Csinos, A.S., Martinez-Ochoa, N., Pappu, H.R., 2008. A rapid and efficient inoculation method for Tomato spotted wilt virus. J. Virol. Methods 149, 195–198. Mandal, B., Pappu, H.R., Csinos, A.S., Culbreath, A.K., 2006. Response of peanut, pepper, tobacco, and tomato cultivars to two bilogically distinct isolates of Tomato spotted wilt virus. Plant Dis. 90 (9), 1150–1155. Mazier, M., German-Retana, S., Flamain, F., Dubois, V., Botton, E., Sarnette, V., Le Gall, O., Candresse, T., Maisonneuve, B., 2004. A simple and efficient method for testing Lettuce mosaic virus resistance in in vitro cultivated lettuce. J. Virol. Methods 116 (2), 123–131. ´ S., Cingel, A., Jevremovic, ´ S., Stankovic, ´ I., Bulajic, ´ A., Krstic, ´ B., Subotic, ´ A., Miloˇsevic, 2012a. Virus Elimination from Ornamental Plants Using In Vitro Culture Techniques. Pestic. Phytomed. (Belgade) 27 (3), 203–211. ´ S., Simonovic, ´ A., Cingel, A., Jevremovic, ´ S., Todorovi c, ´ S., Filipovic, ´ B., Miloˇsevic, ´ A., 2012b. Response of antioxidative enzymes to long-term Tomato spotSubotic, ted wilt virus infection and virus elimination by meristem-tip culture in two Impatiens species. Physiol. Mol. Plant Pathol. 79, 79–88. ´ S., Subotic, ´ A., Bulajic, ´ A., Ðekic, ´ I., Jevremovic, ´ S., Vuˇcurovic, ´ Miloˇsevic, ´ B., 2011. Elimination of TSWV from Impatiens hawkerii A., Krstic, Bull and regeneration of virus-free plant. Electron J. Biotechnol. 1, 4, http://dx.doi.org/10.2225/vol14-issue-1-fulltext/5. ´ S., 2010. Regeneration and Genetic Transformation of Plants Impatiens Miloˇsevic, walleriana L. and Impatiens hawkerii Bull. in vitro culture (in Serbian). University of Belgrade, Serbia, Doctoral dissertation. Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol. Plant 15, 473–497. Ogawa, T., Toguri, T., Kudoh, H., Okamura, M., Momma, T., Yoshioka, M., Kato, K., Hagiwara, Y., Sano, T., 2005. Double-stranded RNA-specific ribonuclease confers tolerance against Chrysanthemum Stunt Viroid and Tomato Spotted Wilt Virus in transgenic Chrysanthemum plants. Breed. Sci. 55, 49–55. Parrella, G., Gognalons, P., Gebre-Selassie, K., Vovlas, C., Marchoux, G., 2003. An update of the host range of Tomato spotted wilt virus. J. Plant Pathol. 85, 227–264. Rotondo, G., Frendewey, D., 1996. Purification and characterization of the Pac1 ribonuclease of Schizosaccharomyces pombe. Nucleic Acids Res. 24 (12), 2377–2386. Rotondo, G., Huang, J.Y., Frendewey, D., 1997. Substrate structure requirements of the Pac1 ribonuclease from Schizosaccharmyces pombe. RNA 3 (10), 1182–1193. Russo, P., Slack, S.A., 1998. Tissue culture methods for the screening and analysis of putative virus-resistant transgenic potato plants. Phytopathology 88, 437–441. Safarnejad, M.R., Jouzani, G.S., Tabatabaei, M., Twyman, R.M., Schillberg, S., 2011. Antibody-mediated resistance against plant pathogens. Biotechnol. Adv. 29 (6), 961–971. Sano, T., Nagayama, A., Ogawa, T., Ishida, I., Okada, Y., 1997. Transgenic potato expressing a double-stranded RNA-specific ribonuclease is resistant to potato spindle tuber viroid. Nat. Biotechnol. 15 (12), 1290–1294. Simón-Mateo, C., García, J.A., 2011. Antiviral strategies in plants based on RNA silencing? Biochim. Biophys. Acta 1809 (11–12), 722–731. ´ I., Bulajic, ´ A., Vuˇcurovic, ´ A., Ristic, ´ D., Milojevic, ´ K., Berenji, J., Krstic, ´ Stankovic, B., 2011. Status of tobacco viruses in Serbia and molecular characterization of tomato spotted wilt virus isolates. Acta Virol. 55, 337–347. ´ A., Jevremovic, ´ S., Cingel, A., Miloˇsevic, ´ S., 2008. Effect of urea-type Subotic, cytokininon axillary shoots regeneration of Impatiens walleriana L. Biotechnol. Biotechnol. 22 (3), 817–819. Sudarshana, M.R., Roy, G., Falk, B.W., 2007. Methods for engineering resistance to plant viruses. Methods Mol. Biol. 354, 183–195. Thirukkumaran, G., Ntui, V.O., Khan, R.S., Mii, M., 2009. Thidiazuron: an efficient plant growth regulator for enhancing Agrobacterium-mediated transformation in Petunia hybrida. Plant Cell Tissue Organ Cult. 99, 109–115. Toguri, T., Ogawa, T., Kakitani, M., Tukahara, M., Yoshioka, M., 2003. Agrobacteriummediated transformation of Chrysanthemum (Dendranthema grandiflora) plants with a disease resistence gene (pac1). Plant Biotechnol. 20 (2), 121–127. ´ J., Janoˇsevic, ´ D., Ninkovic, ´ S., Budimir, S., 2006. Shoot apiUzelac, B., Atanackovic, cal meristem structure in transgenic tobacco. In: IV Balkan Botanical Congress: Plant, Fungal and Habitat Diversity Investigation and Conservation, Sofia, Bulgaria, p. 148. van Leeuwen, W., Ruttink, T., Borst-Vrenssen, A.W., van der Plas, L.H., van der Krol, A.R., 2001. Characterization of position-induced spatial and temporal regulation of transgene promoter activity in plants. J. Exp. Bot. 52 (358), 949–959. Wang, C.-H., Hsu, S.-Y., Chen, P.-Y., To, K.-Y., 2012. Transformation and characterization of transgenic Bidens pilosa L. Plant Cell Tiss. Organ Cult. 109, 457–464. Wang, Q., Valkonen, J.P.T., 2009. Cryotherapy of shoot tips: novel pathogen eradication method. Trends Plant Sci. 14 (3), 119–122. Watanabe, Y., Ogawa, T., Takahashi, H., Ishida, I., Takeuchi, Y., Yamamoto, M., Okada, Y., 1995. Resistence against multiple plant viruses in plants mediated by a double stranded-RNA specific ribonuclease. FEBS Lett. 372, 165–168. Yancheva, S.D., Golubowicz, S., Fisher, E., Lev-Yadun, S., Flaishman, M.A., 2003. Auxin type and timing of application determine the activation of the developmental program during in vitro organogenesis in apple. Plant Sci. 165, 299–309. Zhou, X., Guangcheng, C., Rufa, L., Yongru, S., Wenbin, L., 1994. A rapid and efficient DNA extraction method of genus Fagopyrum for RAPD analysis. In: Proceedings of IPBA, Rogla, pp. 171–175.