Invertebrate p53-like mRNA isoforms are differentially expressed in mussel haemic neoplasia

Marine Environmental Research 66 (2008) 412–421

Contents lists available at ScienceDirect

Marine Environmental Research journal homepage: www.elsevier.com/locate/marenvrev

Invertebrate p53-like mRNA isoforms are differentially expressed in mussel haemic neoplasia Annette F. Muttray a,*, Patricia M. Schulte b, Susan A. Baldwin a a b

University of British Columbia, Department of Chemical and Biological Engineering, 2360 East Mall, Vancouver, BC, Canada V6T 1Z3 University of British Columbia, Department of Zoology, 2370-6270 University Blvd., Vancouver, BC, Canada V6T 1Z4

a r t i c l e

i n f o

Article history: Received 20 June 2007 Received in revised form 13 June 2008 Accepted 19 June 2008

Keywords: Mytilus Haemic neoplasia p53 p63/p73 DNp63/73 isoforms Genetic biomarker Cancer

a b s t r a c t Mussels of the genus Mytilus are widely used in environmental monitoring. They can develop a leukaemia-like disease, haemic neoplasia, which could be induced, in part, by environmental stressors. The molluscan p53 tumor suppressor gene family was previously shown to be involved in haemic neoplasia at the protein level. The purpose of this study was the quantification of molluscan p53-like isoforms at the mRNA level in mussels with haemic neoplasia compared to normal controls. The three isoforms monitored were a p53-like, a TAp63/73-like containing an intact transactivation (TA) domain, and an NH2-terminally truncated p63/73 isoform termed DNp63/p73-like that lacks the full TA domain. Using a comprehensive data set of 62 individual Mytilus trossulus and reverse transcription real-time PCR, we found that both the p53 and the DNp63/73 isoforms were up-regulated in neoplastic haemocytes compared to normal haemocytes (p < 0.0001). In contrast, the mRNA levels of the non-truncated isoform TAp63/73 did not change significantly in mussels with the disease at a = 0.01 (p = 0.0141), in contrast to previous findings at the protein level. Correlations in mRNA levels between the truncated isoform and the full-length isoforms in normal haemocytes were lost in neoplastic haemocytes. The increase in mRNA concentration of the truncated DNp63/73 isoform in molluscan haemic neoplasia is similar to observations in many human cancers and cell lines and underlines the phylogenetically ancient oncogenic role of this isoform. Ó 2008 Elsevier Ltd. All rights reserved.

1. Introduction Mussels of the genus Mytilus are distributed widely in boreal and temperate waters of both hemispheres (Gosling, 1992) and have been used for many years in aquaculture and environmental monitoring (Goldberg and Bertine, 2000; Venier et al., 2006). Mytilus trossulus, among other bivalve species, has a naturally high propensity to develop disseminated or haemic neoplasia (a leukaemia-like disease of the haemolymph) (Elston et al., 1992). Haemic neoplasia is characterized by continuously dividing enlarged malignant haemocytes, which display a high nucleus to cytoplasm ratio and have lost their normal functionality (Mix, 1983). The disease occurs, at least in part, in response to environmental stressors (Brown, 1980; Reinisch et al., 1984; Farley et al., 1991; Van Beneden, 1994; McGladdery et al., 2001; St-Jean et al., 2005), but a viral or cumulative etiology has also been suggested by many authors (for instance Brown, 1980; Barber, 2004; Romalde et al., 2007). Many cancers in humans (Clapp, 2000) and marine animals (Bhaskaran et al., 1999; Xu et al., 2002) have been attributed to * Corresponding author. Tel.: +1 604 731 2915; fax: +1 604 677 5627. E-mail address: [email protected] (A.F. Muttray). 0141-1136/$ - see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.marenvres.2008.06.004

environmental exposures to carcinogens. It is therefore important to include cancer biomarkers in marine environment monitoring. The p53 family proteins have central roles in tumor suppression and embryonic development in vertebrate animals. The family consists of p53 (Lane and Crawford, 1979), and the more recently discovered homologs p63 and p73 (Kaghad et al., 1997; Yang et al., 1998). While all family members contain the highly conserved DNA binding domain (DBD), p63 and p73 are characterized by an additional C-terminal region, the sterile alpha motif (SAM), which is implicated in protein-protein interactions in developmental processes (Thanos and Bowie, 1999). Expression and activity of p53 are increased in response to DNA damage, and functional p53 serves as a transcription factor for genes associated with cell cycle arrest and apoptosis, thus preventing the proliferation of aberrant cells (Vogelstein et al., 2000). p53 mutations have been shown to occur in approximately 50% of all human cancers (Vousden and Lu, 2002), and p63 and 73 have been implicated in stem cell identity, neurogenesis, epithelial development, natural immunity and homeostatic control (Kaghad et al., 1997; Yang et al., 1998, 2002). In some tumor cell lines, p73 is induced in response to DNA damage, mediating a p53-independent cell death pathway (Urist et al., 2004).

A.F. Muttray et al. / Marine Environmental Research 66 (2008) 412–421

In invertebrate animals, p53-like proteins have been discovered, such as CEP-1 in the worm Caenorhabditis elegans (Lu and Abrams, 2006), DMP53 in the fly Drosophila melanogaster, and various homologs in different molluscan models (Schmale and Bamberger, 1997; Kelley et al., 2001; Cox et al., 2003; Muttray et al., 2005, 2007; Goodson et al., 2006). Molluscan family members, more so than CEP-1 or DMP53, show high sequence similarity to their vertebrate counterparts. Thus, molluscan p53 isoform transcription may afford a relevant but simple model to describe core properties of this ancient network. While vertebrate p53, p63, and p73 originate from separate genes, molluscan p53 isoforms are likely splice variants originating from one gene, based on Southern blotting experiments and the finding that their core DNA binding domain sequences are identical (Van Beneden et al., 1997; Kelley et al., 2001; Muttray et al., 2005, 2007; Goodson et al., 2006). The nomenclature for p53 homologs in the molluscs is in flux, and there is some debate on p53 sequences isolated from Mytilus sp. by different laboratories (Muttray and Baldwin, 2007; Rotchell and Ciocan, 2007). As a result this literature can be confusing. For example, some authors have termed all of the molluscan p53 homologs ‘‘p63”, with and without a SAM domain, (Goodson et al., 2006) based on the finding that molluscan p53 family members are most homologous to vertebrate p63 and the ancestral phylogenetic position of p63 (Yang et al., 2002). However, the majority of authors have termed the molluscan homologs in accordance with their structural domains consistent with the vertebrate nomenclature, and this nomenclature is also adopted in the current paper. Thus, the p53 isoform was identified and named based on the lack of the SAM domain (Muttray et al., 2005), while the TAp63/73 isoform was named based on the presence of the SAM domain (Muttray et al., 2007). In addition, a DNp63/73 isoform was identified in M. edulis and M. trossulus (Muttray et al., 2007), which is truncated at the NH2-terminal transactivation domain. Similar NH2-terminally truncated isoforms exist in mammalian systems (Ishimoto et al., 2002) where they lack the apoptotic properties of p53/p63/p73, and are able to inhibit the tumor-suppressive functions of p53 and p73 in many cancers (Cuadros et al., 2006, Concin et al., 2004 #331). Thus, DNp73 has a strong oncogenic potential and has been suggested as a biomarker in human cancers (Concin et al., 2004). The expression of p53 proteins during haemic neoplasia has been studied in Mytilus edulis and the soft-shell clam Mya arenaria (Barker et al., 1997; Kelley et al., 2001; McGladdery et al., 2001; Stephens et al., 2001; Jessen-Eller et al., 2002; Cox et al., 2003, St-Jean et al., 2005). Using an antibody to the central DNA binding domain of the M. arenaria p53/p73, it was found that p53 and/or p63/73 is expressed in the cytoplasm of leukaemic animals instead of the nucleus where it is required as a transcription factor (Kelley et al., 2001). In addition, a protein band with a size corresponding to p63/73 was present only in leukaemic haemocytes of M. arenaria, while a band corresponding to p53 was present at equal levels in normal and leukaemic haemocytes (Kelley et al., 2001; Stephens et al., 2001). Using a cross-reactive antibody specific to the homodimerization domain of the surf clam Spisula solidissima p63/73 (Cox et al., 2003), it was shown that p63/73 was expressed at higher levels in leukaemic haemocytes when compared to normal haemocytes of M. edulis (St-Jean et al., 2005). Since these initial studies found that some p53 family members were up-regulated in endstage haemic neoplasia cells, we wanted to investigate if the same patterns would be observed for transcription of these isoforms. Furthermore, our objective was to test the association between p53 isoform gene expression and the haemic neoplasia end point as part of our work to evaluate the use of gene expression in ecosystem monitoring programs. Using isoform-specific quantitative real-time reverse transcription PCR, we analyzed haemocytes from 62 individual M. trossulus

413

animals, which were identified as normal or leukaemic by phase contrast microscopy of the haemolymph. The results show that the p53 and the DNp63/73 isoforms are expressed at significantly higher mRNA levels in leukaemic haemocytes when compared with normal haemocytes. This finding provides support for an ancient proliferative role of the DNp63/73 isoform, and also suggests the potential for p53 as a biomarker for this disease in the context of environmental studies. 2. Materials and methods 2.1. Animal collection Adult M. trossulus were collected from continuously submerged cages located in Burrard Inlet, Vancouver, British Columbia. Cages were initially stocked with random samples from a mussel population at Hopkins Landing, Sunshine Coast, BC, in February of 2006. Mussels were transported to the laboratory and stored in aerated water drawn from the locations and depths of the cages. Mussels were placed in a cold room set to the temperature measured in the field, with frequent seawater changes. Processing of mussel samples was started the same day after sampling and continued, if necessary, the following day. All animals were processed in accordance with the Department of Fisheries and Oceans License Authorizing Fish Collection For Scientific Purposes 06.18 and the University of British Columbia Animal Care Protocol A05-0057R001. 2.2. Haemolymph collection Haemolymph was withdrawn from the posterior adductor mussel using a pre-chilled 3 ml, 21G-syringe and screened by phase contrast microscopy for contamination by gametes or bacteria and particulates, and presence/absence of haemic neoplasia. Absence of haemic neoplasia was defined by the occurrence of only normal haemocytes (approximately 106 cells per ml), which were predominately granular and adhesive with pseudopodia (Fig. 1A). Presence of haemic neoplasia was defined by high cell proliferation (approximately 108 cells per ml) and 100 percent round non-adhesive cells with no or very few and short pseudopodia (Fig. 1B). Transitional samples and samples contaminated with other particles were excluded from further analysis. Aliquots (0.2 ml) of haemic neoplasia and whole normal cell samples (1–2 ml) were spun down (425g, 3 min, 4–6 °C), the supernatant was removed, and cell samples were stored at 80 °C until RNA extraction. Phase contrast micrographs were obtained using a Zeiss Axioplan 2 epifluorescent microscope fitted with a DVC CCD color video camera. Images were captured by Northern Eclipse 6.0 (Empix, Mississauga, ON, Canada) software. 2.3. Nucleic acid processing Total RNA was extracted using the EZNA Total RNA Kit (Omega Bio-tek, Doraville, GA) and eluted with 40 ll of hot diethylpyrocarbonate- (DEPC-) treated water. Mussel species was confirmed using the contaminating 18S rDNA in the RNA extracts by RFLPPCR on the internal transcribed spacer (ITS) region using the HhAI enzyme (Invitrogen) as previously described (Heath et al., 1995; Muttray et al., 2007). RNA extracts were then treated with DNaseI (Invitrogen, Burlington, ON) according to manufacturer’s instructions. RNA concentrations were measured in triplicate for each sample using a NanoDropÒ ND-1000 UV–vis Spectrophotometer (NanoDrop Technologies, Wilmington, DE). The coefficients of variation (or relative standard deviation, defined as standard deviation/mean  100%) was not larger than 0.8%. Purity was assessed at 280 and 230 nm. One microgram of RNA was used for reverse

414

A.F. Muttray et al. / Marine Environmental Research 66 (2008) 412–421

2.4. Real time PCR analysis of gene transcription

Fig. 1. Phase contrast microscopy image of (A) normal haemocytes, and (B) leukaemic haemocytes in M. trossulus.

Real-time PCR was performed using the qPCR MasterMix Plus for SYBRÒ Green I (Eurogentec North America, Inc., San Diego, CA) and the ABI Prism 7000 Real Time PCR System (Applied Biosystems, Foster City, CA). Primers specific to M. trossulus p53, TAp63/ 73 and DNp6373 isoforms were designed with the assistance of the Primer ExpressTM software (Applied Biosystems) (Fig. 2). Primer sequences were as follows (50 –30 direction): p53-F, TGTGTAGACTGAGGGATTCATTGG; p53-R, TTCACCTTCTTCATCAGTTTGTTTTT; TAp63/73-F, AATATGGAACTCCCGTCCAGATC; TAp63/73-R, TGTTATTATTGTATCCTTGAGAACGC; DNp6373-F, AAATTTGAGAGAACTGGATTTACAACC; DNp6373-R, TGTGATTGTATCATTGTAAGGACTTGAT. Real time PCR was performed in triplicate for each sample in a 12 ll reaction volume containing 6 ll 2 reaction buffer (including 5 mM MgCl2), 200 nm each primer, and 2 ll of 0.1 sample cDNA. The PCR amplification was performed as follows: 2 min at 50 °C, 10 min at 95 °C, and 40 cycles of 15 s at 95 °C and 1 min at 60 °C. PCR products were subjected to melt curve analysis, and selected samples were electrophoresed to verify that only one product was present. Amplicons from one sample were sequenced to confirm amplification of the correct isoform sequence. Control reactions were performed with no cDNA template or with non-reverse transcribed RNA to determine the level of background DNA contamination after DNaseI treatment. No DNA contamination was detected. The reactions were performed in 96-well plates, each plate containing a standard dilution series. A 1:1 mix of two randomly selected control samples (one leukaemic, one normal) were used to develop a standard curve for all primer sets thus ensuring that the amplification efficiencies were similar between standard and samples. The standard was diluted in five fold increments, and all results were expressed relative to these standard curves. The relative standard deviation of the threshold values (Ct) between triplicates was less than 1%. Data analysis was carried out using the ABI Prism 7000 SDS Software Version 1.0. Threshold and baseline were set to 0.25 and cycles 6–15, respectively, for all plates. The efficiency (E) of amplification was determined from the slope of the standard curves according to the following formula:

 transcription using SuperScriptTM II reverse transcriptase (Invitrogen) and random hexamers, according to manufacturer’s instructions. Resulting cDNAs were stored at 20 °C. Experimental error was assessed by extracting one leukaemic sample in triplicate, transcribing 1 lg of total RNA for each triplicate and assaying the amount of cDNA in 2 ll of 0.01 cDNA using real-time PCR. Primer sequences were as follows (50 –30 direction): p18S-RT-2F (forward), AACTTTGTGCTGATCGCACG; p18S-RT-2R (reverse), CGTTTCTCATGCTCCCTCTC. PCR conditions are described below in detail. The relative standard deviation of the threshold values (Ct) between triplicates was 0.6%.

TAp63/73 M

TAD

M

E ¼ 10

1 slope

 ð1Þ

An efficiency of E = 2 represents 100% efficiency, i.e. a doubling of PCR product with every PCR cycle. 2.5. Statistical analysis All statistical analysis were conducted using JMP IN 5.1 (SAS Institute Inc., Cary, NC). All data sets were tested for normality using the Shapiro-Wilk test and, except for p53 data, were found to be non-normally distributed. The non-parametric Wilcoxon rank

DBD

SAM + HOMO

STOP

TAp63/73 p53

M

STOP

p53 M

ΔN

STOP

Δ Np63/73 Fig. 2. Currently known isoform architecture for the M. trossulus p53-like gene. Only coding regions are shown. Hatched regions indicate sequence differences between the isoforms. The real-time PCR primers for the various isoforms used in this study are indicated by arrows. M, start codon; STOP, stop codon; TAD, transactivation domain; DBD, DNA binding domain; SAM, sterile alpha motif, HOMO, homodimerization domain.

A.F. Muttray et al. / Marine Environmental Research 66 (2008) 412–421

sum test was used to compare the means of leukaemic with the means of normal sample groups for each isoform (with alpha = 0.01). To test for potential correlations between the transcription levels of the three isoforms in mussels belonging to either the normal or leukaemic population, the Spearman rank correlation test was used. p-Values < 0.01 were declared significant.

3. Results 3.1. Method validation A total of 63 mussel haemolymph samples were analyzed, of which 27 were normal (Fig. 1A) and 36 were end-stage leukaemic (Fig. 1B) according to phase contrast microscopy observations. All mussel samples were confirmed to be M. trossulus (data not shown). Total RNA extractions yielded a single non-degraded ribosomal RNA band with a size characteristic of 18S rRNA (Fig. 3A). This is in agreement with previous findings on other mollusks and invertebrates (Ishikawa, 1973; Barcia et al., 1997), and is likely due to a ‘‘break” in the 28S rRNA structure, which converts the 28S into components of the size of 18S during the extraction procedure. Real-time PCR analysis of the 18S rRNA component of the cDNA showed that normal and leukaemic samples had approximately equal amounts of ribosomal cDNA per 1 lg of total RNA reverse transcribed (relative standard deviation of the Ct of 0.45%). Only one normal sample showed a 24 times higher concentration of ribosomal cDNA and was removed from further analysis (n = 62). Therefore, normal and leukaemic samples were assumed to have equal amounts of transcribed cDNA and were compared directly to each other, normalized to 1 lg of total RNA. Selected real-time PCR amplicons were electrophoresed and the sizes of the resulting bands (p53, 168bp; TAp63/73, 65bp; DNp6373, 140bp) were of the expected sizes of the amplicons (Fig. 3B). Cloning and sequencing of the amplicons (previously described in (Muttray et al., 2005) confirmed the amplification of the intended targets. Real-time PCR melt curve analysis showed that p53 and TAp63/73 amplification always resulted in a single product with melting temperatures Tm of 76.3 and 72.2 °C, respectively (Fig. 3E, example for p53). Melt curve analysis of the DNp6373 isoform showed occasional peaks at lower Tm, which were likely the result of primer dimer amplification. Wells containing primer dimers were excluded from the analysis. The Tm of DNp6373 was 77.7 °C. The average efficiency of the real-time PCR reactions was calculated from the slopes of the standard curves (Fig. 3C and D). The average efficiency was 2.09 with standard deviation of 0.132 and efficiencies did not differ significantly between isoforms. 3.2. Isoform mRNA levels in normal and leukaemic haemocytes Using this comprehensive data set, we analyzed whether any of the three isoforms in the p53 family (p53, TAp63/73, or DNp63/73, were significantly up- or down-regulated at the mRNA level in either the normal or leukaemic haemocyte group. All isoforms were ubiquitously expressed in both leukaemic and normal haemocytes (Fig. 4). The lowest mRNA levels were found in the DNp63/73 isoform. Within each haemocyte group, p53 data points were distributed normally, while TAp63/73 and DNp63/73 data points were positively skewed. Therefore, Wilcoxon rank sum tests were used for the comparison. Each group contained a small number of outliers (as defined by being outside the 1.5 interquartile range) for each isoform, all of which were included in the analysis. The variances were different for the three isoforms, ranging from 0.0022 to 0.0645, and were independent of health status. p53 isoform mRNA levels showed the greatest difference (p < 0.0001) between leukaemic and normal haemocytes. The

415

mean mRNA levels were 0.22 (±0.01 standard error, SE) and 0.07 (±0.01SE) for leukaemic and normal haemocytes, respectively (Fig. 4). The DNp63/73 isoform also showed a significant difference (p < 0.0001) in mRNA levels, with a mean of 0.09 (±0.01 SE) and 0.03 (±0.02 SE) for leukaemic and normal haemocytes, respectively. In contrast to the other two isoforms, mRNA levels of the TAp63/73 isoform did not change between leukaemic and normal mussels at the predetermined a of 0.01 (with p = 0.0141), with respective group means of 0.14 (±0.04SE) and 0.23 (±0.05SE) (Fig. 4). The range of distribution of TAp63/73 data points is larger than the range of p53 or DNp63/73 data points. 3.3. Relationships between isoforms The balance in transcription of the p53 family members plays an important role in the development of tumors and the normal cell cycle. To determine potential alterations in transcriptional control between the isoforms we analyzed the correlation among isoforms in leukaemic and normal samples (Table 1). The strongest correlation was detected between DNp63/73 and p53 in normal haemocytes (r = 0.63, p = 0.0008), and a somewhat weaker correlation between DNp63/73 and TAp63/73 (r = 0.51, p = 0.0085). These correlations did not persist in leukaemic haemocytes.

4. Discussion 4.1. Isoform mRNA levels in normal and leukaemic haemocytes Our results strongly suggest the involvement of p53 and DNp63/73 mRNA in haemic neoplasia in M. trossulus, since both of these isoforms are expressed at significantly higher levels in the neoplastic versus normal cells (p < 0.0001). This up-regulation is not reflected in the TAp63/73 isoform, which was transcribed at levels similar to or lower than the average for most of the leukaemic haemocytes, with a wide dispersal of data points. This may be the result of differences in regulation pathways between the p53 and DNp63/73 isoforms and the TAp63/73 isoform. The increase in mRNA levels of the p53 isoform in leukaemic haemocytes may be counteracted by genetic changes that inhibit the activity of the tumor suppressor, as it was shown for example for Burkitt’s lymphoma (Balint and Reisman, 1996). While leukaemic haemocytes are a homogenous cell type, normal haemocytes are heterogeneous and can be divided morphologically into granular and agranular cells (Cheng, 1981), as well as into eosinophilic and basophilic cells (Pipe et al., 1997). We therefore expected to observe a higher variability in transcription data in the normal groups. Surprisingly, this was only the case for NFp63/73, but not for p53 or DNp63/73. We tested for potential correlations between the transcription levels of the three isoforms in mussels belonging to either the normal or leukaemic group. The DNp63/73 isoform data show a much higher correlation to p53 and TAp63/73 data in the normal than in the leukaemic group (Table 1). The correlations found in normal haemocytes appear to be lost in leukaemic haemocytes and therefore the balance that exists between the oncogenic DNp63/73 and tumor-suppressing p53 and TAp63/73 isoforms may be disturbed in haemic neoplasia. Pathways that potentially link these isoforms to each other may also be impaired. Similar deregulation of p53 isoform expression has been shown in many human cancers (reviewed in (Bourdon, 2007) and it is hypothesized that wild-type p53 activity may be modulated by the presence of other p53 isoforms. Because it is likely that only one p53 gene is present in molluscs, it is conceivable that there are more than the three currently known isoforms expressed from the Mytilus p53 gene. Based on the

416

A.F. Muttray et al. / Marine Environmental Research 66 (2008) 412–421

Samples

1 kb

A

B

18S + 28S rRNA

TA ΔN p63 p63 p53 /73 /73 400 300 200 100 bp

C

Quantitation Graph

Fluorescence

10

1 threshold = 0.25

0.5 0.1 0.02

0.004 Dilution

0.1 baseline 0.01 . Ct values

0.001 1

3

5

7

9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 Cycle

D

Ct

Standard curve 32 31 30 29 28 27 26 25 24

Slope: -2.972477 Intercept: 22.519041 R2: 0.994742

-3

-2.5

-2

-1.5 Log(Dilution)

-0.5

-1

Dissociation Curve

E 0.6

Derivative

0.4

0.2 0 60

65

70

75

80

85

90

95

Temperature ( °C) Fig. 3. Validation of Real Time PCR quantification. (A) Examples of non-denaturing agarose gel electrophoresis of total RNA isolated from three leukaemic haemocyte samples and treated with DNase I. Distinct rRNA bands indicate good RNA quality. Mytilus ribosomal RNA shows the classic molluscan appearance of only one18S band, likely due to a break in the 28S rRNA. (B) Agarose gel electrophoresis of real-time PCR amplicons from a normal sample. All three amplicons were subjected to sequencing. (C) Example of a real-time PCR quantitation graph using a p53 standard curve. Threshold (0.25) and baseline (6–15 Ct) were constant throughout all experiments. The dilution of the standards and the corresponding Ct values are indicated. (D) The real-time PCR standard curve for p53 generated from the quantitation graph in B. The logarithm of the dilutions of the standard is plotted against the Ct values. (E) Dissociation or melting curve for the p53 standard, generated between 62.5 and 90 °C. The Tm was determined as 76.3 °C.

417

A.F. Muttray et al. / Marine Environmental Research 66 (2008) 412–421

Fig. 4. Association between relative transcription levels for p53-, DNp63/73- and TAp63/73-like mRNA isoforms and haemocyte status, leukaemic (L; n = 37) and normal (N; n = 25), in M. trossulus. mRNA expression levels are relative to a standard dilution curve. Data points (°) represent the average of triplicate wells. The bars next to the individual data points represent, from top to bottom, standard deviation, standard error of the mean, and mean. The means diamonds graphic illustrates the group mean (center horizontal line), the 95% confidence interval (vertical points of diamond), overlap marks (top and bottom horizontal lines), and the width of the diamond indicates sample size. The dotted line shows the grand mean. If the 95% confidence intervals do not overlap, the group means are significantly different (but the reverse is not necessarily true). To equalize scale, two outliers were omitted from the TAp63/73 graph: relative expression level of 1.500 and 0.996 for L and N, respectively.

Table 1 Spearman rank correlations between the p53 isoforms described in the text in normal and leukaemic haemocytes Isoform

TAp63/73 DNp63/73 DNp63/73

By isoform

p53 p53 TAp63/73

Normal haemocytes

Leukaemic haemocytes

Spearman Rho

Prob > |Rho|

Spearman Rho

Prob > |Rho|

0.1750 0.6267 0.5144

0.4027 0.0008 0.0085

0.3678 0.2498 0.0801

0.0251 0.1359 0.6373

A significant correlation (p < 0.01) exists between DNp63/73 and both p53 and TAp63/73 in normal haemocytes.

placement of the real-time PCR primers (Fig. 2), the transcription data we provide here may include transcription of more than one isoform per primer set. For instance, the DNp63/73 primer set may have detected the known DNp63/73 as well as a potential DNp53. This has to be kept in mind when interpreting the data and will also affect the validity of the comparison between mRNA and protein levels (see Section 4.2). 4.2. Comparison between mRNA levels and previously reported protein data p53 protein levels were previously shown to be similar in leukaemic and normal clam (M. arenaria) haemocyte samples using an M. arenaria p53- and p73-specific polyclonal antibody (Kelley et al., 2001; Stephens et al., 2001), which is in contrast to our data at the mRNA level. This suggests the possibility of post-transcriptional regulation of this gene. Indeed, mRNA levels may not always reflect protein levels, especially as it is known that activity of p53 family proteins is largely regulated at the post-translational level in vertebrates (for a review see (Blandino and Dobbelstein, 2004). Unfortunately, the Mytilus p53 protein was not detectable using this antibody (St-Jean et al., 2005) and thus comparison between protein and mRNA data must be made across species, further complicating interpretation and opening the possibility that differences in mRNA and protein changes are the result of differences between

the two molluscan species. This p53- and p73-specific antibody detected one or two other proteins in Mya and Mytilus, which, based on size, are p63/73-like and were increased in expression level in leukaemic haemocytes from both species (Kelley et al., 2001; Stephens et al., 2001), which is not consistent with our data at the mRNA level. Similarly, an antibody to the p73 HOMO-domain of the surfclam S. solidissima (Cox et al., 2003) detected an increase in the intensity of p63/73-like bands in leukaemic Mytilus haemocytes, with a size equal to and greater than 66 kDa (St-Jean et al., 2005). Both antibodies, in theory, would be able to also detect DNp63/73 isoforms. Thus, the increase in p63/73-like proteins observed previously in Mya and Mytilus leukaemic haemocytes by other authors may be correlated with the increase in DNp63/73 mRNA but not with TAp63/73 mRNA levels observed here, but until the actual identity of the proteins detected by the antibodies can be confirmed, this hypothesis cannot be substantiated. Clearly, a more specific and coherent set of antibodies is required to clarify the relationships between mRNA and protein in the molluscan p53 family. 4.3. Comparison of molluscan mRNA isoform data with data on vertebrate p53/63/73 in tumors Under normal conditions, the mammalian p53 protein is kept at low levels in the cell by its relatively short half-life mediated by

418

A.F. Muttray et al. / Marine Environmental Research 66 (2008) 412–421

proteolytic turn over. Despite the large number of stress signals that input into the p53 pathway, we know almost nothing about how these diverse inputs are communicated to the p53 protein (Levine et al., 2006). It is likely that the functional, temporal and tissue or tumor-specific differences in mammalian p53, p63 and p73 expression are in part due to highly differentiated transcriptional regulation pathways. It has been shown that the expression of the various isoforms for each vertebrate family member is initially regulated at the mRNA transcriptional level in normal as well as tumor tissues (Bourdon et al., 2005). Molluscan models can offer an advantage over other models for studying the ancient normal and abnormal functions of p53 family members, as they likely contain only one p53-like gene and transcriptional regulation may be simpler. Despite limitations due to the differences in genetic organization between invertebrates and vertebrates, the following comparison between p53 family mRNA transcription in a molluscan cancer and in vertebrate cancers shows a number of analogous patterns. 4.3.1. Normal differentiated cells have a low constitutive p53 mRNA transcription which is, in part, regulated at the transcriptional level Normal molluscan haemocytes are thought to be terminally differentiated cells unable to further divide in primary cell culture. We and others (for instance Elston et al., 1992) have observed that cell division is drastically increased when these haemocytes undergo neoplastic transformation and we now show that p53 mRNA levels rise in neoplastic haemocytes. Expression of the vertebrate p53 gene is under tight transcriptional control during the normal cell cycle (Boggs and Reisman, 2005). p53 mRNA is maintained at low levels during G0/G1 growth arrest and increases with re-entry into the cell cycle. Importantly, this increase in p53 mRNA levels is due to an increase in transcription. For example, protein kinase C has been shown to be required for basal transcription of the vertebrate p53 gene, rather than p53 protein stabilization (Abbas et al., 2004). Down-regulation of protein kinase C by inhibitors inhibits transcription from the p53 promoter which has been suggested as a mechanism for tumor promotion. However, nothing is known about the pathways in molluscs. 4.3.2. p53 mRNA levels are significantly increased in molluscan haemic neoplasia and in some human cancers The mRNA levels of p53 are significantly increased in Mytilus haemic neoplasia. It has been shown for some human cancers that p53 activity is increased not only because of an increase in the stability of mutated p53, but also by an increase at the mRNA transcription level (Balint and Reisman, 1996). For instance, p53 mRNA as well as protein levels were found to be increased in human brain tumor samples, human neoplastic colon epithelia (Calabretta et al., 1986; Gope et al., 1991), and acoustic neuromas (Dayalan et al., 2006). Immortal oral keratinocyte cell lines harboring human papillomavirus-16 show an increase in p53 mRNA but not in protein, likely due to enhanced degradation of the p53 protein by the viral E6 protein (Li et al., 1992). Haemic neoplasia in molluscs has been compared to Burkitt’s lymphoma cells (Kelley et al., 2001). Some Burkitt’s lymphoma cell lines exhibit an increase in the abundance of p53 mRNA as compared to nontransformed cell lines (Balint and Reisman, 1996). Thus, the deregulated transcription of the p53 gene may be an additional genetic alteration in tumor cells. However, some human cancers show a marked decrease in p53 mRNA levels compared with normal cells, for instance high-level colorectal cancer (Tou et al., 2004), breast tumors (Raman et al., 2000), and diffuse astrocytomas (Stuart et al., 1995). This decrease is attributed to upstream regulatory processes, such as PAX-mediated transcriptional repression of p53 in the case of astrocytomas, and compromised HOXA5 transcriptional activation of p53 in the case of breast tumors. Both

cases emphasize the significance of transcriptional regulation of p53 expression. 4.3.3. DNp63/73 mRNA level is increased in mollusc haemic neoplasia and some human cancers, underlining its ancient role in oncogenesis and development Molluscan p53 family members may be related most closely to an ancestral p63 (Yang et al., 2002; Goodson et al., 2006). Expression of p63 has been studied most widely in vertebrate embryonic development and cancer (reviewed in Westfall and Pietenpol, 2004). In zebrafish, DNp63 is required for epidermal proliferation, specification and development, and the DNp63-regulated epidermal proliferation was due to transcriptional inhibition of p53 target genes (Lee and Kimelman, 2002). In mammals, DNp63 is hypothesized to have a crucial role in maintaining the epidermal stem cell population (Westfall and Pietenpol, 2004). Dysregulated expression of p63, sometimes in conjunction with amplification of its genomic locus, is a frequent occurrence in a subset of human epithelial cancers, and amplification of the p63 gene frequently results in overexpression of the DNp63 mRNA variant (Hibi et al., 2000). Examples show the predominant expression of the DNp63 over the TA mRNA isoform in cancerous tissues, such as lymphomas (Di Como et al., 2002) and urothelial carcinoma cell lines (Urist et al., 2002). These studies are in agreement with our findings in the molluscan haemic neoplasia model, where DNp63/73 mRNA expression is up-regulated in leukaemic haemocytes, in contrast to down-regulation of the TAp63/73 isoform. This relative up-regulation of DNp63/73 versus TAp63/73 isoforms may promote tumor growth in vertebrates (Bernassola et al., 2005). High levels of expression of DNp63 could endow tumor cells with stem celllike qualities by favoring their proliferation (Mills, 2005). Similar to DNp63, a significant percentage of tumors also specifically select for the dominant negative DNp73 isoforms, which strongly argues for their oncogenic role during tumorigenesis (Zaika et al., 2002). Increased transcription of DNp73 is frequent, for example, in neuroblastomas (Casciano et al., 2002), lung cancer (Uramoto et al., 2004), ovarian cancer (Concin et al., 2004), hepatocellular carcinomas (Muller et al., 2005) and childhood acute lymphoblastic leukaemia (Meier et al., 2006), and has thus been suggested as a biomarker of poor prognosis. The preferential up-regulation of DNp63/73 in bivalves might impose oncogenic activity that specifically interferes with the tumor suppressor function of p53 and TAp63/73, disabling apoptosis pathways. 4.4. Potential for p53 transcription as genetic biomarkers of neoplasia The prevalence of p53 mutations in many cancers as well as the linkage between environmental factors and some cancers (Clapp, 2000) has motivated investigations into the potential of p53 as a genetic biomarker for environmental genotoxins in both human populations (Cetin-Atalay and Ozturk, 2000; Fronza et al., 2000) and organisms in aquatic environments (Bhaskaran et al., 1999; Xu et al., 2002; Canesi et al., 2007). In human cancer studies, p53 mRNA and protein expression levels have been linked to environmental exposures to ionizing radiation, asbestos, the human teratogens phenytoin and phorbol esters, formaldehyde, and tobacco smoke condensate (Johnson et al., 1997; Gallagher and Sheehy, 2001; Shaham et al., 2003; Abbas et al., 2004; Palozza et al., 2004). Here, we show significant correlations between increased mRNA levels of p53 and DNp63/73 and haemic neoplasia in Mytilus. The oncogenic DN isoform has been implicated in a number of human tumors as a strong biomarker. In this invertebrate dataset, only five p53 data points overlapped between normal and leukaemic samples, thus making p53 a stronger candidate for a genetic biomarker than the DN isoform. In the case of DN, high mRNA levels indicate presence of the disease, while low mRNA levels can

A.F. Muttray et al. / Marine Environmental Research 66 (2008) 412–421

indicate both leukaemic and normal states, thus limiting the use of DN as a genetic biomarker. Clustering of p53 and DNp63/73 data points improves the diagnostic power that differentiates leukaemic from normal haemocytes (data not shown), and a combination of mRNA expression data rather than individual mRNA data points should be considered in future studies. The p53 family was shown previously to be down-regulated in mussels exposed to an organic pollutant mix (Dondero et al., 2006). However, as we know from vertebrate models, different isoforms have different functions and expression profiles and it is therefore important that monitoring tools can distinguish between them. However, a number of questions remain to be answered before p53 can be fully validated as a genetic biomarker of neoplasia. For example: do animal sex or other biological factors have an effect on p53 expression? What is the genetic diversity of the collected population? Is an increase in mRNA level already detectable during early transitional stages, when microscopic diagnosis of the disease is more difficult? What are confounding environmental conditions that may affect p53 upor down-regulation? For instance, (Canesi et al., 2007) showed that low concentrations of 17b-estradiol decrease the transcription of p53 in the digestive gland of mussels. Another study found that expression of stress genes (heatshock proteins, metallothionins) in the oyster Crassostrea gigas can change with water temperature and follow a seasonal pattern (Farcy et al., 2007). Are there other regulatory elements of the p53 pathway that are also differentially expressed in haemic neoplasia? If so, monitoring a combination of such genes may be better for predicting haemic neoplasia than upor down-regulation of a single gene. For instance, transcription and mutation of the ras gene may also play a role in haemic neoplasia in M. trossulus (Ciocan et al., 2006). And finally, are p53 mutations present that inhibit functionality of the protein and correlate with disease conditions? Only once validated, genetic markers of haemic neoplasia will be very useful for testing whether certain environmental conditions and agents are able to induce tumorigenesis in the marine environment.

5. Conclusions 1. We show that ancient p53 family members are differentially regulated at the transcriptional level during haemic neoplasia in M. trossulus. 2. End-stage haemic neoplasia in Mytilus is characterized by a significant increase in the mRNA levels of p53 and DNp63/73. This increase may serve as a biomarker for the disease upon further verification. 3. Based on knowledge gained from mammalian systems we postulate that the increased level of p53 observed in leukaemic haemocytes may be counteracted by an increase in the dominant negative oncogenic isoform DNp63/73. 4. The mRNA levels of the TAp63/73-like isoform decreased significantly in Mytilus haemic neoplasia. This is in contrast to previous observations at the protein level and requires further investigation. 5. The balance in mRNA levels that may exist between p53 and DNp63/73-like isoforms in normal haemocytes is not maintained in leukaemic haemocytes. 6. Genetic biomonitoring tools need to take into account different isoforms of gene products as they may have distinct transcription patterns and opposing functions.

Acknowledgements Funding for this project was provided by the Greater Vancouver Regional District (now Metro Vancouver), Integrated Resource

419

Consultants Inc., Richmond (BC), and by a National Science and Engineering Research Council of Canada Collaborative Research Development (CRD) Grant. We thank Farida Bishay and Albert van Roodselaar (GVRD), Mitch Herron (vessel Richardson Point) and the members of the laboratory at Integrated Resource Consultants Inc. for their generous support and acknowledge the anonymous reviewers. References Abbas, T., White, D., Hui, L., Yoshida, K., Foster, D.A., Bargonetti, J., 2004. Inhibition of human p53 basal transcription by down-regulation of protein kinase Cd. Journal of Biological Chemistry 279, 9970–9977. Balint, E., Reisman, D., 1996. Increased rate of transcription contributes to elevated expression of the mutant p53 gene in Burkitt’s lymphoma cells. Cancer Research 56, 1648–1653. Barber, B.J., 2004. Neoplastic diseases of commercially important marine bivalves. Aquatic Living Resources 17, 449–466. Barcia, R., Lopez-Garcia, J., Ramos-Martinez, J.I., 1997. The 28S fraction of rRNA in molluscs displays electrophoretic behaviour different from that of mammal cells. IUBMB Life 42, 1089–1092. Barker, C.M., Calvert, R.J., Walker, C.W., Reinisch, C.L., 1997. Detection of mutant p53 in clam leukemia cells. Experimental Cell Research 232, 240–245. Bernassola, F., Oberst, A., Melino, G., Pandolfi, P.P., 2005. The promyelocytic leukaemia protein tumour suppressor functions as a transcriptional regulator of p63. Oncogene 24, 6982–6986. Bhaskaran, A., May, D., Rand-Weaver, M., Tyler, C.R., 1999. Fish p53 as a possible biomarker for genotoxins in the aquatic environment. Environmental and Molecular Mutagenesis 33, 177–184. Blandino, G., Dobbelstein, M., 2004. p73 and p63: why do we still need them? Cell Cycle 3, 886–894. Boggs, K., Reisman, D., 2005. Increased p53 transcription prior to DNA synthesis is regulated through a novel regulatory element within the p53 promoter. Oncogene 25, 555–565. Bourdon, J.-C., 2007. p53 and its isoforms in cancer. British Journal of Cancer 97, 277–282. Bourdon, J.-C., Fernandes, K., Murray-Zmijewski, F., Liu, G., Diot, A., Xirodimas, D.P., Saville, M.K., Lane, D.P., 2005. p53 isoforms can regulate p53 transcriptional activity. Genes and Development 19, 2122–2137. Brown, R.S., 1980. The value of the multidisciplinary approach to research on marine pollution effects as evidenced in a three-year study to determine the etiology and pathogenesis of neoplasia in the soft-shell clam, Mya arenaria. Rapports et Proces-Verbaux des Reunions, Conseil International pour L’Exploration scientifique de la Mer Medeterranee Monaco 179, 125–128. Calabretta, B., Kaczmarek, L., Selleri, L., Torelli, G., Ming, P.-M.L., Ming, S.-C., Mercer, W.E., 1986. Growth-dependent expression of human Mr 53,000 tumor antigen messenger RNA in normal and neoplastic cells. Cancer Research 46, 5738–5742. Canesi, L., Borghi, C., Fabbri, R., Ciacci, C., Lorusso, L.C., Gallo, G., Vergani, L., 2007. Effects of 17b-estradiol on mussel digestive gland. In: General and Comparative Endocrinology, Proceedings of the 23rd Conference of European Comparative Endocrinologists: Part 2, vol. 135, pp. 40–46. Casciano, I., Mazzocco, K., Boni, L., Pagnan, G., Banelli, B., Allemanni, G., Ponzoni, M., Tonini, G.P., Romani, M., 2002. Expression of DeltaNp73 is a molecular marker for adverse outcome in neuroblastoma patients. Cell Death and Differentiation 9, 246–251. Cetin-Atalay, R., Ozturk, M., 2000. p53 Mutations as fingerprints of environmental carcinogens. Pure and Applied Chemistry 72, 995–999. Cheng, T.C., 1981. Bivalves. In: Ratcliffe, N.A., Rowley, A.F. (Eds.), Invertebrate Blood Cells 1. Academic Press, London, pp. 233–300. Ciocan, C.M., Moore, J.D., Rotchell, J.M., 2006. The role of ras gene in the development of haemic neoplasia in Mytilus trossulus. Marine Environmental Research 62, S147–S150. Clapp, R., 2000. Environment and health: 4. Cancer. Canadian Medical Association Journal 163, 1009–1012. Concin, N., Becker, K., Slade, N., Erster, S., Mueller-Holzner, E., Ulmer, H., Daxenbichler, G., Zeimet, A., Zeillinger, R., Marth, C., Moll, U.M., 2004. Transdominant DeltaTAp73 isoforms are frequently up-regulated in ovarian cancer. Evidence for their role as epigenetic p53 inhibitors in vivo.. Cancer Research 64, 2449–2460. Cox, R.L., Stephens, R.E., Reinisch, C.L., 2003. p63/73 Homologues in surf clam: novel signaling motifs and implications for control of expression. Gene 320, 49–58. Cuadros, M., Ribas, G., Fernandez, V., Rivas, C., Benitez, J., Martinez-Delgado, B., 2006. Allelic expression and quantitative RT-PCR study of TAp73 and DeltaNp73 in non-Hodgkin’s lymphomas. Leukemia Research 30, 170–177. Dayalan, A.H., Jothi, M., Keshava, R., Thomas, R., Gope, M.L., Doddaballapur, S.K., Somanna, S., Praharaj, S.S., Ashwathnarayanarao, C.B., Gope, R., 2006. Age dependent phosphorylation and deregulation of p53 in human vestibular schwannomas. Molecular Carcinogenesis 45, 38–46. Di Como, C.J., Urist, M.J., Babayan, I., Drobnjak, M., Hedvat, C.V., Teruya-Feldstein, J., Pohar, K., Hoos, A., Cordon-Cardo, C., 2002. p63 expression profiles in human normal and tumor tissues. Clinical Cancer Research 8, 494–501.

420

A.F. Muttray et al. / Marine Environmental Research 66 (2008) 412–421

Dondero, F., Piacentini, L., Marsano, F., Rebelo, M., Vergani, L., Venier, P., Viarengo, A., 2006. Gene transcription profiling in pollutant exposed mussels (Mytilus spp.) using a new low-density oligonucleotide microarray. Gene 376, 24–36. Elston, R.A., Moore, J.D., Brooks, K., 1992. Disseminated neoplasia in bivalve molluscs. Reviews in Aquatic Sciences 6, 405–466. Farcy, E., Voiseux, C., Lebel, J.-M., Fievet, B., 2007. Seasonal changes in mRNA encoding for cell stress markers in the oyster Crassostrea gigas exposed to radioactive discharges in their natural environment. Science of the Total Environment 374, 328–341. Farley, C.A., Plutschak, D.L., Scott, R.F., 1991. Epizootiology and distribution of transmissible sarcoma in Maryland softshell clams, Mya arenaria, 1984–1988. Environmental Health Perspectives 90, 35–41. Fronza, G., Inga, A., Monti, P., Scott, G., Campomenosi, P., Menichini, P., Ottaggio, L., Viaggi, S., Burns, P.A., Gold, B., Abbondandolo, A., 2000. The yeast p53 functional assay: a new tool for molecular epidemiology. Hopes and facts. Mutation Research/Reviews in Mutation Research 462, 293–301. Gallagher, E.P., Sheehy, K.M., 2001. Effects of phenytoin on glutathione status and oxidative stress biomarker gene mRNA levels in cultured precision human liver slices. Toxicological Sciences 59, 118–126. Goldberg, E.D., Bertine, K.K., 2000. Beyond the Mussel Watch – new directions for monitoring marine pollution. Science of the Total Environment 247, 165–174. Goodson, M.S., Crookes-Goodson, W.J., Kimbell, J.R., McFall-Ngai, M.J., 2006. Characterization and role of p53 family members in the symbiont-induced morphogenesis of the E uprymna scolopes light organ. Biological Bulletin 211, 7– 17. Gope, M.L., Chun, M., Gope, R., 1991. Comparative study of the expression of Rb and p53 genes in human colorectal cancers, colon carcinoma cell lines and synchronized human fibroblasts. Molecular and Cellular Biochemistry 107, 55–63. Gosling, E. (Ed.), 1992. Systematics and geographic distribution of Mytilus. The mussel Mytilus: ecology, physiology, genetics and culture. Elsevier Science Publishers, Amsterdam. Heath, D.D., Rawson, P.D., Hilbish, T.J., 1995. PCR-based nuclear markers identify alien blue mussel (Mytilus spp.) genotypes on the west coast of Canada. Canadian Journal of Fisheries and Aquatic Sciences 52, 2621–2627. Hibi, K., Trink, B., Patturajan, M., Westra, W.H., Caballero, O.L., Hill, D.E., Ratovitski, E.A., Jen, J., Sidransky, D., 2000. AIS is an oncogene amplified in squamous cell carcinoma. In: Proceedings of the National Academy of Sciences of the United States of America, vol. 97, 5462–5467. Ishikawa, H., 1973. Comparative studies on the thermal stability of animal ribosomal RNA’s. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 46, 217–227. Ishimoto, O., Kawahara, C., Enjo, K., Obinata, M., Nukiwa, T., Ikawa, S., 2002. Possible oncogenic potential of DeltaNp73: a newly identified isoform of human p73. Cancer Research 62, 636–641. Jessen-Eller, K., Kreiling, J.A., Begley, G.S., Steele, M.E., Walker, C.W., Stephens, R.E., Reinisch, C.L., 2002. A new invertebrate member of the p53 gene family is developmentally expressed and responds to polychlorinated biphenyls. Environmental Health Perspectives 110, 377–385. Johnson, N.F., Carpenter, T.R., Jaramillo, R.J., Liberati, T.A., 1997. DNA damageinducible genes as biomarkers for exposures to environmental agents. Environmental Health Perspectives 105, 913–918. Kaghad, M., Bonnet, H., Yang, A., Creancier, L., Biscan, J.C., Valent, A., Minty, A., Chalon, P., Lelias, J.M., Dumont, X., Ferrara, P., McKeon, F., Caput, D., 1997. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell 90, 809–819. Kelley, M.L., Winge, P., Heaney, J.D., Stephens, R.E., Farell, J.H., Van Beneden, R.J., Reinisch, C.L., Lesser, M.P., Walker, C.W., 2001. Expression of homologues for p53 and p73 in the softshell clam (Mya arenaria), a naturally-occurring model for human cancer. Oncogene 20, 748–758. Lane, D.P., Crawford, L.V., 1979. T antigen is bound to a host protein in SV40transformed cells. Nature 278, 261–263. Lee, H., Kimelman, D., 2002. A dominant-negative form of p63 is required for epidermal proliferation in zebrafish. Developmental Cell 2, 607–616. Levine, A.J., Hu, W., Feng, Z., 2006. The p53 pathway: what questions remain to be explored? Cell Death and Differentiation 13, 1027–1036. Li, S.L., Kim, M.S., Cherrick, H.M., Park, N.H., 1992. Low p53 level in immortal, nontumorigenic oral keratinocytes harboring HPV-16 DNA. European Journal of Cancer Part B, Oral Oncology 28B, 129–134. Lu, W.J., Abrams, J.M., 2006. Lessons from p53 in non-mammalian models. Cell Death and Differentiation 13, 909–912. McGladdery, S., Davidson, J., Quarrar, P., MacCallum, G., Arsenault, G., 2001. Investigation of Factors Associated with Proliferation of Haemic Neoplasia in Cultured and Wild Soft-Shell Clams (Mya arenaria), Charlottetown, PEI, Department of Health Management, Atlantic Veterinary College, University of Prince Edward Island. Meier, M., den Boer, M.L., Meijerink, J.P.P., Broekhuis, M.J.C., Passier, M.M.C.J., van Wering, E.R., Janka-Schaub, G.E., Pieters, R., 2006. Differential expression of p73 isoforms in relation to drug resistance in childhood T-lineage acute lymphoblastic leukaemia. Leukemia 20, 1377–1384. Mills, A.A., 2005. p53: link to the past, bridge to the future. Genes and Development 19, 2091–2099. Mix, M.C., 1983. Haemic neoplasia of bay mussels, Mytilus edulis L., from Oregon: occurence, prevalence, seasonality and histopathological progression. Journal of Fish Disease 6, 239–248.

Muller, M., Schilling, T., Sayan, A.E., Kairat, A., Lorenz, K., Schulze-Bergkamen, H., Oren, M., Koch, A., Tannapfel, A., Stremmel, W., Melino, G., Krammer, P.H., 2005. TAp73/DeltaNp73 influences apoptotic response, chemosensitivity and prognosis in hepatocellular carcinoma. Cell Death and Differentiation 12, 1564–1577. Muttray, A.F., Baldwin, S.A., 2007. Comment on Conservation of cancer genes in the marine invertebrate Mytilus edulis. Environmental Science & Technology 41, 4829–4831. Muttray, A.F., Cox, R.L., Reinisch, C.L., Baldwin, S.A., 2007. Identification of DeltaN isoform and polyadenylation site choice variants in molluscan p63/p73-like homologues. Marine Biotechnology 9, 217–230. Muttray, A.F., Cox, R.L., St-Jean, S.D., van Poppelen, P., Reinisch, C.L., 2005. Identification and phylogenetic comparison of p53 in two distinct mussel species (Mytilus). Comparative Biochemistry and Physiology Part C, Pharmacology, Toxicology and Endocrinology 140, 237–250. Palozza, P., Serini, S., Di Nicuolo, F., Boninsegna, A., Torsello, A., Maggiano, N., Ranelletti, F.O., Wolf, F.I., Calviello, G., Cittadini, A., 2004. Beta-Carotene exacerbates DNA oxidative damage and modifies p53-related pathways of cell proliferation and apoptosis in cultured cells exposed to tobacco smoke condensate. Carcinogenesis 28, 1315–1325. Pipe, R.K., Farley, S.R., Coles, J.A., 1997. The separation and characterisation of haemocytes from the mussel Mytilus edulis. Cell and Tissue Research 289, 537– 545. Raman, V., Martensen, S.A., Reisman, D., Evron, E., Odenwald, W.F., Jaffee, E., Marks, J., Sukumar, S., 2000. Compromised HOXA5 function can limit p53 expression in human breast tumours. Nature 405, 974–978. Reinisch, C.L., Charles, A.M., Stone, A.M., 1984. Epizootic neoplasia from softshell clams collected from New Bedford Harbour. Hazardous Waste 1, 73– 81. Romalde, J.L., Luz Vilarino, M., Beaz, R., Rodriguez, J.M., Diaz, S., Villalba, A., Carballal, M.J., 2007. Evidence of retroviral etiology for disseminated neoplasia in cockles (Cerastoderma edule). Journal of Invertebrate Pathology 94, 95–101. Rotchell, J.M., Ciocan, C.M., 2007. Response to comment on Conservation of cancer genes in the marine invertebrate Mytilus edulis. Environmental Science & Technology 41, 4832. Schmale, H., Bamberger, C., 1997. A novel protein with strong homology to the tumor suppressor p53. Oncogene 15, 1363–1367. Shaham, J., Bomstein, Y., Gurvich, R., Rashkovsky, M., Kaufman, Z., 2003. DNA-protein crosslinks and p53 protein expression in relation to occupational exposure to formaldehyde. Occupational and Environmental Medicine 60, 403–409. Stephens, R.E., Walker, C.W., Reinisch, C.L., 2001. Multiple protein differences distinguish clam leukemia cells from normal hemocytes: evidence for the involvement of p53 homologues. Comparative Biochemistry and Physiology Part C, Pharmacology, Toxicology and Endocrinology 129, 329–338. St-Jean, S.D., Stephens, R.E., Courtenay, S.C., Reinisch, C.L., 2005. Detecting p53 family proteins in leukemia cells of Mytilus edulis from Pictou Harbour, Nova Scotia. Canadian Journal of Fisheries and Aquatic Sciences 62, 2055–2066. Stuart, E.T., Haffner, R., Oren, M., Gruss, P., 1995. Loss of p53 function through PAXmediated transcriptional repression. EMBO Journal 14, 5638–5645. Thanos, C.D., Bowie, J.U., 1999. p53 family members p63 and p73 are SAM domaincontaining proteins. Protein Science 8, 1708–1710. Tou, S.I., Drye, E.R., Boulos, P.B., Hollingsworth, S.J., 2004. Activity (transcription) of the genes for MLH1, MSH2 and p53 in sporadic colorectal tumours with microsatellite instability. British Journal of Cancer 90, 2006–2012. Uramoto, H., Sugio, K., Oyama, T., Nakata, S., Ono, K., Morita, M., Funa, K., Yasumoto, K., 2004. Expression of deltaNp73 predicts poor prognosis in lung cancer. Clinical Cancer Research 10, 6905–6911. Urist, M., Tanaka, T., Poyurovsky, M.V., Prives, C., 2004. p73 induction after DNA damage is regulated by checkpoint kinases Chk1 and Chk2. Genes and Development 18, 3041–3054. Urist, M.J., Di Como, C.J., Lu, M.L., Charytonowicz, E., Verbel, D., Crum, C.P., Ince, T.A., McKeon, F.D., Cordon-Cardo, C., 2002. Loss of p63 expression is associated with tumor progression in bladder cancer. American Journal of Pathology 161, 1199– 1206. Van Beneden, R.J., 1994. Molecular analysis of bivalve tumors: models for environmental/genetic interactions. Environmental Health Perspectives Supplements 102, 81–83. Van Beneden, R.J., Walker, C.W., Laughner, E.S., 1997. Characterization of gene expression of a p53 homologue in the soft-shell clam (Mya arenaria). Molecular Marine Biology and Biotechnology 6, 116–122. Venier, P., De Pitta, C., Pallavicini, A., Marsano, F., Varotto, L., Romualdi, C., Dondero, F., Viarengo, A., Lanfranchi, G., 2006. Development of mussel mRNA profiling: can gene expression trends reveal coastal water pollution? Mutation Research/ Fundamental and Molecular Mechanisms of Mutagenesis 602, 121–134. Vogelstein, B., Lane, D., Levine, A.J., 2000. Surfing the p53 network. Nature 408, 307– 310. Vousden, K., Lu, X., 2002. Live or let die: the cell’s response to p53. Nature Reviews Cancer 2, 594–604. Westfall, M.D., Pietenpol, J.A., 2004. p63: molecular complexity in development and cancer. Carcinogenesis 25, 857–864. Xu, N., Shiraki, T., Yamada, T., Nakajima, M., Gauthier, J.M., Pfeiffer, C.J., Sato, S., 2002. Nucleotide sequence of the p53 cDNA of beluga whale (Delphinapterus leucas). Gene 288, 159–166. Yang, A., Kaghad, M., Caput, D., McKeon, F., 2002. On the shoulders of giants: p63, p73 and the rise of p53. Trends in Genetics 18, 90–95.

A.F. Muttray et al. / Marine Environmental Research 66 (2008) 412–421 Yang, A., Kaghad, M., Wang, Y., Gillett, E., Fleming, M.D., Dotsch, V., Andrews, N.C., Caput, D., McKeon, F., 1998. p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Molecular Cell 2, 305–316.

421

Zaika, A.I., Slade, N., Erster, S.H., Sansome, C., Joseph, T.W., Pearl, M., Chalas, E., Moll, U.M., 2002. DeltaNp73, a dominant-negative inhibitor of wild-type p53 and TAp73, is up-regulated in human tumors. Journal of Experimental Medicine 196, 765–780.