Inverting enantioselectivity of Burkholderia gladioli esterase EstB by directed and designed evolution

Journal of Biotechnology 129 (2007) 109–122

Inverting enantioselectivity of Burkholderia gladioli esterase EstB by directed and designed evolution Mirela Ivancic a , Goran Valinger a,1 , Karl Gruber b , Helmut Schwab a,∗ a

Institut f¨ur Molekulare Biotechnologie, Technische Universit¨at Graz, Petersgasse 14, 8010 Graz, Austria b Research Centre Applied Biocatalysis, Petersgasse 14, 8010 Graz, Austria Received 9 March 2006; received in revised form 29 September 2006; accepted 9 October 2006

Abstract Esterase EstB from Burkholderia gladioli, showing moderate S-enantioselectivity (ES = 6.1) in the hydrolytic kinetic resolution of methyl-␤-hydroxyisobutyrate, was subjected to directed evolution in order to reverse its enantioselectivity. After one round of ep-PCR, saturation mutagenesis and high-throughput screening, it was found that different mutations at position 152 (in the vicinity of the active site) increase, decrease and even reverse the natural enantioselectivity of this enzyme. The newly created Renantioselectivity of the esterase mutein (ERapp = 1.5) has been further enhanced by a designed evolution strategy involving random mutations close to the active site. Based on the three-dimensional structure nineteen amino acid residues have been selected as mutation sites for saturation mutagenesis. Mutations at three sites (135, 253 and 351) were found to increase R-enantioselectivity. Successive rounds of saturation mutagenesis at these “hot spots” resulted in an increase in R-enantioselectivity from ERapp = 1.5 for the parent mutant to ERapp = 28.9 for the best variant which carried four amino acid substitutions. Our results prove designed evolution followed by high-throughput screening to be an efficient strategy for engineering enzyme enantioselectivity. © 2006 Elsevier B.V. All rights reserved. Keywords: Directed evolution; Enantioselectivity; Esterase; High-throughput screening

1. Introduction The growing need for enantiomerically pure pharmaceuticals led to the conception of numerous new ∗ Corresponding author. Tel.: +43 316 873 4070; fax: +43 316 873 4071. E-mail address: [email protected] (H. Schwab). 1 Present address: Pliva d.d., Prilaz Baruna Filipovica 25, 10000 Zagreb, Croatia.

0168-1656/$ – see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.jbiotec.2006.10.007

strategies for their preparation. Apart from transition metal catalysis preferred by organic chemists, biocatalysis by enzymes is now frequently applied in the asymmetric synthesis. Enzymes can show high chemo-, regio- and stereoselectivity, work at ambient temperature and exhibit high activity in aqueous solution and even in organic solvents, which makes them in some cases superior to chemical catalysts (Reetz and Jaeger, 2000; Bornscheuer and Pohl, 2001). However, an enzyme with the required substrate- and

110

M. Ivancic et al. / Journal of Biotechnology 129 (2007) 109–122

stereospecificity is very often not directly available from natural sources. Therefore, tailoring of a wildtype enzyme by protein engineering employing rational design (Penning and Jez, 2001) and directed evolution techniques (Arnold et al., 2003) may provide a suited biocatalyst. Rational design is based on molecular modelling as a guide for site-directed mutagenesis at specific positions in the enzyme (Rotticci et al., 2001, Cedrone et al., 2000). Such a redesign of an enzyme is only possible if reasonable 3D-structure data is available and rational attempts to improve enantioselectivity have in many cases not yet yielded the desired success (Hult and Berglund, 2003). However, some very successful examples of rational design leading even to industrial applications have also been reported (Glieder et al., 2003). Directed evolution represents an alternative strategy to rational protein design when no data on enzyme structure or catalytic mechanism are available (Reetz et al., 1997; Liebeton et al., 2000). The results obtained by directed evolution can also help us to improve our knowledge concerning enzymes function (Bornscheuer, 2001; Reetz, 2004). Reetz et al. first introduced a concept for the development of enantioselective enzymes based on directed evolution (Reetz et al., 1997; Liebeton et al., 2000). A non-selective lipase from Pseudomonas aeruginosa was evolved in five cycles of random mutagenesis coupled with saturation mutagenesis from E = 1.1 to 25.8 for the best performing mutant which carried five amino acid substitutions located outside the substrate-binding site. Enhanced enantioselectivity was explained by the increased flexibility of the mutant enzyme (Jaeger et al., 2001). A recent theoretical analysis of these mutations showed that surface mutations accumulated in directed evolution process were not significant for enantioselectivity (Bocola et al., 2004). By the application of combinatorial multiple cassette mutagenesis, the enantioselectivity was further increased to E = 51. The resulting improved lipase variant harboured six mutations only one of which was located directly at the active site near the bound substrate (Reetz et al., 2001). Two mutations pointing towards the active site, one near the active site and the other remote from the oxyanion hole, were found to act cooperatively in enhancing enantioselectivity. These mutations created a new binding pocket for ␣-chiral esters and exerted additional stabilization of the oxyanion by providing new hydrogen

bonding interactions. After successfully improving the enantioselectivity, Zha et al. (2001) tried to invert enantioselectivity of the wild-type lipase utilizing the same concept. Enantioselectivity of the lipase was reversed in three cycles of ep-PCR but only to a smaller degree. Applying a new strategy—i.e. the combination of epPCR at higher error rate with DNA shuffling—the R-selectivity of a particular lipase was further enhanced (Zha et al., 2001.). The most selective lipase variant reached ER = 30 and it contained eleven amino acid substitutions which were located at positions different from the “hot spots” identified in the evolution of the S-selectivity mutants. The majority of the introduced mutations were again located remote from the active site. Similar results were obtained after just one round of ep-PCR and saturation mutagenesis of a hydantoinase gene, where a single mutation was sufficient to convert a d-selective hydantoinase into an l-selective variant (May et al., 2000). Another successful example of inverting an enzyme’s natural enantioselectivity was reported by Koga et al. (2003). The lipase from Burkholderia cepacia, which shows rather high S-selectivity of ES = 33 towards ethyl 3-phenylbutyrate was evolved in a structure-guided manner by a combinatorial exchange of four amino acid residues located in the hydrophobic substrate-binding pocket. Thereby, two lipase variants with completely reversed enantioselectivity (ER = 33 and ER = 38) were identified by that approach. Esterase EstB from Burkholderia gladioli belongs to a novel class of esterases with homology to Penicillin binding proteins, notably DD-peptidases and class C ␤-lactamases (Petersen et al., 2001; Wagner et al., 2002). It hydrolyzes short-chain (
M. Ivancic et al. / Journal of Biotechnology 129 (2007) 109–122

111

Fig. 1. Enzymatic kinetic resolution of methyl-␤-hydroxyisobutyrate catalysed by esterase EstB.

reaction we investigated the possibility to reverse enantioselectivity of esterase EstB by two approaches: directed evolution and so-called designed evolution. Directed evolution of enzymes usually targets the entire protein and discovers beneficial mutations distant from the active site. Designed evolution approaches, on the other hand, focus on the region close to the substrate binding site, based on the assumption that residues contacting the substrate will contribute more significantly to the enantioselectivity than distant residues. In order to analyse large gene libraries we also developed simple high-throughput methods for rapid screening of enantioselectivity.

2. Materials and methods 2.1. General Methyl-(S)-␤-hydroxyisobutyrate and methyl-(R)␤-hydroxyisobutyrate were purchased from Fluka Chemie (Sigma–Aldrich Handels GmbH, Wien, Austria). Racemic mixtures were prepared by mixing equal amounts of each enantiomer. 2.2. Strains, vectors and culture conditions The estB gene was cloned downstream of the tac promoter into the vector pMS4708 to get plasmid pEP6EX (Petersen et al., 2001). The ampicillin resistance gene from plasmid pEP6EX was cleaved at BspI restriction sites and replaced by a BspI/BamHI fragment encoding kanamycin resistance from the plasmid pCK155 (Eberl et al., 1994) by blunt-end ligation to get plasmid pKEP6. Electro-competent E. coli TOP10F’

(Invitrogen) cells were used for gene library construction and basic genetic work. PCR products, prepared by modified protocol of the QuickChange site-directed mutagenesis kit (Stratagene. La Jolla, CA, USA), were transformed by electroporation into XL-10 Gold cells (Stratagene). Strain E. coli BL21 (Invitrogen) was used for overexpression of esterase variants. E.coli strains were routinely grown in Luria–Bertani (LB) medium. For selection of plasmids 30 or 40 mgL−1 of kanamycin were added to liquid media or agar plates, respectively (LB-Kan media). 2.3. Mutagenesis 2.3.1. Error prone PCR Random mutagenesis of the esterase gene was performed in a reaction volume of 50 ␮L that included 5 ng of template DNA, 10 pmol of each primer (pMSstart and pMSstop, Table 1), 200 ␮M dNTPs, 3 mM MgCl2 , 0.3 mM MnCl2 and 1 U of HotStar Taq DNA polymerase (Qiagen) in 1× PCR buffer (provided by supplier). Conditions for PCR were as follows: 15 min at 95 ◦ C, followed by 30 cycles of incubation at 98 ◦ C for 30 s, 66 ◦ C for 1 min and 72 ◦ C for 1.5 min and final incubation at 72 ◦ C for 5 min. PCR product was subcloned into the vector pEP6EX using the NdeI and HindIII sites replacing the wild-type esterase gene. 2.3.2. Saturation mutagenesis 2.3.2.1. Overlap extension PCR. Saturation mutagenesis at position 152 was performed by overlap extension PCR. Fig. 2 outlines the concept of the applied method. Mutagenic primer Ile152mut contained randomized nucleotides corresponding to the position 152 in protein sequence and it was used together with flanking

112

M. Ivancic et al. / Journal of Biotechnology 129 (2007) 109–122

Table 1 Primers Name

Sequence (5 → 3 )

pMSstart pMSstop Ile152mut Ile152bezmut

CATCGGCTCGTATAATGTGTGG TTCACTTCTGAGTTCGGCATGG GTCGCGCAGGTCMNNGCCGTCCGAGATGCCGAG GACCTGCGCGACTTCGATCTC

Degenerated primers A74a A74b L78Xa L78Xb Y133Xa Y133Xa L135a L135b DI1501a DI1501b Y181Xa Y181Xb A186Xa A186Xb L249a L249b H253a H253b AV2567a AV2567b S272a S272b GA2745a GA275b W348a W348b G349a G349b GV3502a GV3502b M377a M377b

GGACACGCTGTTCCGGCTCNNKTCGGTGACCAAGCCGATCG CGATCGGCTTGGTCACCGAMNNGAGCCGGAACAGCGTGTCC CTCGCTTCGGTGACCNNKCCGATCGTCGCGCTGGCGGTG CACCGC CAGCGCGACGATCGGMNNGGTCACCGAAGCGAG CACGTCGGGGCTCGGCNNKTGGCTGCTCGAGGGCGCCGGCTC GAGCCGGCGCCCTCGAGCAGCCAMNNGCCGAGCCCCGACGTG GTCGGGGCTCGGCTACTGGNNKCTCGAGGGCGCCGGCTCC GGAGCCGGCGCCCTCGAGMNNCCAGTAGCCGAGCCCCGAC CGACCGGCTCGGCATCTCGNNKGGCNNKGACCTGCGCGACTTCGATCTCG CGAGATCGAAGTCGCGCAGGTCMNNGCCMNNCGAGATGCCGAGCCGGTCG GCAGCGGCTGGCAGNNKTCGCTGGCGCTCGACGTGCTCG CGAGCACGTCGAGCGCCAGCGAMNNCTGCCAGCCGCTGC GCAGTATTCGCTGGCGCTCNNKGTGCTCGGCGCGGTGGTCG CGACCACCGCGCCGAGCACMNNGAGCGCCAGCGAATACTGC CGACGGCATCGAGGTGCCGNNKCCGGAAGGCCACGGCGCGGCCGTGC GCACGGCCGCGCCGTGGCCTTCCGGMNNCGGCACCTCGATGCCGTCG GGTGCCGCTGCCGGAAGGCNNKGGCGCGGCCGTGCGTTTCG CGAAACGCACGGCCGCGCCMNNGCCTTCCGGCAGCGGCACC CTGCCGGAAGGCCACGGCGCGNNKNNKCGTTTCGCGCCCTCCCGCGTG CACGCGGGAGGGCGCGAAACGMNNMNNCGCGCCGTGGCCTTCCGGCAG GAGCCGGGCGCCTATCCCNNKGGCGGCGCCGGCATGTACG CGTACATGCCGGCGCCGCCMNNGGGATAGGCGCCCGGCTC GAGCCGGGCGCCTATCCCTCGGGCNNKNNKGGCATGTACGGCTCGGCCGACG GTCGGCCGAGCCGTACATGCCMNNMNNGCCCGAGGGATAGGCGCCCGGCTC CACGCCGGGACGCTGCAANNKGGCGGCGTCTATGGCCATTCC GGAATGGCCATAGACGCCGCCMNNTTGCAGCGTCCCGGCGTG CACGCCGGGACGCTGCAATGGNNKGGCGTCTATGGCCATTCC GGAATGGCCATAGACGCCMNNCCATTGCAGCGTCCCGGCGTG GGACGCTGCAATGGGGCNNKNNKTATGGCCATTCCTGGTTCG CGAACCAGGAATGGCCATAMNNMNNGCCCCATTGCAGCGTCC CCAATACCGCCTACGAAGGCNNKTCGGGCCCGCTGACGATCG CGATCGTCAGCGGGCCCGAMNNGCCTTCGTAGGCGGTATTGG

primer pMSstart to amplify a 0.6 kb fragment of the estB gene. The internal primer Ile152bezmut had 12 nucleotides at the 5 end complementary to the 5 end of the mutagenic primer Ile152mut. First PCR was performed as follows: 1× buffer (supplied with enzyme), 10 ng of DNA template, 25 pmol of forward and reverse primer, 100 ␮M dNTPs and 1 U Tgo DNA polymerase (Roche). Reaction conditions: denaturation at 98 ◦ C for 5 min; 25 cycles at 98 ◦ C for 30 s, 66 ◦ C for 1 min and 72 ◦ C 1 min. Final incubation at 72 ◦ C, 2 min. In a second PCR gel-purified PCR products from PCR 1

were mixed together in a 1:1 molar ratio and fused by overlap extension PCR. The conditions were as follows: 1× reaction buffer (supplied with enzyme), 30 ng of fragment 1, 50 ng of fragment 2, 100 ␮M dNTPs and 1 U Tgo DNA polymerase (Roche). The reaction mixtures were heated at 98 ◦ C for 5 min, followed by seven cycles of incubation at 98 ◦ C for 30 s, 66 ◦ C for 1 min and 72 ◦ C 1 min. Flanking primers pMSstart and pMSstop (25 pmol) were added and previously described PCR program was repeated for 20 cycles except the incubation time at 72 ◦ C which was

M. Ivancic et al. / Journal of Biotechnology 129 (2007) 109–122

113

DpnI (New England Biolabs) for 2 h at 37 ◦ C, 3 ␮L of PCR product was desalted by membrane dialysis (Nitrocellulose membranes, Millipore) and used for transformation of electrocompetent XL-10 Gold cells (Stratagene). The resulting library usually contained more than 1200 transformants and approximately 200 of transformants were screened. To introduce nineteen independent mutations a set of degenerated primers (Table 1) was used. 2.4. Screening assays

Fig. 2. Saturation mutagenesis at position 152 by overlap extension PCR (Ling and Robinson, 1997; McPherson and Moeller, 2001).

prolonged to 1.5 min. Final incubation at 72◦ lasted for 5 min. The amplified esterase gene containing mutations was cloned using the KpnI and HindIII restriction sites replacing the wild-type esterase gene in the plasmid pKEP6. The following set of primers was used for PCR (Table 1): Ile152mut, Ile152bezmut, pMSstart and pMSstop. 2.3.2.2. Modified quikchange method. Saturation mutagenesis was performed applying a modified protocol of the QuikChange site-directed mutagenesis kit (Stratagene). In order to improve efficiency of the primer to DNA template binding (instead primer to primer binding), separate PCR reactions containing just one mutagenic primer were set up. Separate primer extension reactions contained 1× buffer (supplied with enzyme), 0.4 ␮M forward or reverse primer, 100 ␮M dNTPs, 1 U PfuUltra Hotstart DNA polymerase (Stratagene) and 30 ng DNA template in a total volume 25 ␮L. The reaction mixtures were heated at 98 ◦ C for 3 min, followed by four cycles of incubation at 98 ◦ C for 30 s, 66 ◦ C for 1 min and 72 ◦ C 12 min, and final incubation at 72 ◦ C for 20 min. Resulting PCR products were combined and after addition of 1 U PfuUltra the same PCR program was repeated for 13 cycles. After digestion with 20 U of

2.4.1. pH shift filter assay for random library screening For analysis of the unordered esterase gene library a simple and rapid screening assay based on pH shift was used. This assay was performed in two steps: (i) esterase active clones were identified; (ii) active clones were further analyzed with respect to their activities towards the R- and S-enantiomers of methyl␤-hydroxyisobutyrate. Grown transformants harbouring randomly mutated esterase genes were lifted from the LB agar plates onto filter papers and dried at 30 ◦ C for 30 min. Dried filter papers were soaked with screening solution containing Triton X 100 (0.6%), phenol red (2 gL−1 ), Tris–HCl buffer pH = 7.5 and 80 mM of racemic methyl-␤hydroxyisobutyrate. Hydrolysis of the ester was monitored visually by the change of the colonies’ color from red to yellow due to pH drop caused by released acid. Positive clones showing esterase activity were picked with toothpicks and plated on LB-Kan agar plates (master plate). Esterase active clones from the master plate were replica plated on two LB-Kan agar plates and incubated at 37 ◦ C overnight. Again grown cell material was lifted on filter paper, dried and than soaked with R and S screening solutions (described above) which contained instead of racemic, the pure enantiomers as substrates. Activity of mutants was monitored on the basis of the time needed for the colour change of the pH indicator, and compared to the wild-type esterase as control. Enantioselectivity was estimated from comparison the reactions with each enantiomer. 2.4.2. Two-step screening assay for selectivity determination A general outline of this method is shown in Fig. 3. Single cell colonies obtained from mutagenesis reac-

114

M. Ivancic et al. / Journal of Biotechnology 129 (2007) 109–122

Fig. 3. Schematic presentation of the setup of the two step screening assay.

tions were transferred into 96-well microtiter plates using the Qpix robot system (Genetix, UK). Each well contained 200 ␮L LB-Kan medium. After 20 h growth at 37 ◦ C, plates (master plates) were replica plated on LB-Kan agar plates supplemented with 0.1 mM IPTG. The plates were incubated at 30 ◦ C for 20 h. In a first step a visual filter screening assay similar to that outlined above was performed. Grown colonies on LB agar plates were lifted on a filter paper and dried at 30 ◦ C for half an hour. The dried filter papers were placed on 1.5 mL R and S assay solution, respectively. The S and R-assay solutions contained Triton X 100 (0.6%), phenol red (2 gL−1 ), Tris–HCl pH 7.5 (9 and 15 mM in S and R screening solution, respectively) and 80 mM of R- or S-methyl-␤-hydroxyisobutyrate. Esterase variants showing improved R-selectivity were identified by visual monitoring the rate of the colour change of the cell material from red to yellow and comparing it with parent mutant. In a second step selected clones were further quantitatively analyzed by a fluorescence assay in microtiter plates performed as follows. Selected mutants were cultivated in 96-deep well plates. Therefore, 10 ␮L cell suspension from a master microtiter plate were pipetted into the wells of a 96deep well plate containing 900 ␮L LB-Kan medium. After 3 h of cultivation at 30 ◦ C and 150 rpm, expression of esterase variants was induced by 0.1 mM IPTG. After 20 h of incubation, cells were harvested by cen-

trifugation at 2000 × g and 4 ◦ C for 1 h. Cell pellets were resuspended in 50 ␮L of 0.5% Triton X 100 and disrupted by freezing-thawing for three cycles and cell crude lysates were finally prepared by adding 600 ␮L Tris–HCl buffer (pH 7.0) followed by vigorous shaking. Alternatively, esterase variants were cultivated in 100 mL LB-Kan medium. Expression of esterase was started by addition of 0.1 mM IPTG when cell density had reached OD600 = 0.5–0.6 and cultivation was continued for another 20 h. After cell disruption by repeated cycles of freeze-thawing, cell debris were removed by centrifugation. The kinetics of pH drop resulting from ester hydrolysis was determined by measuring of decrease of fluorescein fluorescence which is highly dependent on the pH. The assay solutions contained fluorescein (5 nM), R- or S-methyl-␤-hydroxyisobutyrate (6.3 mM) in 8 mM Tris–HCl buffer, pH 7.0. Fluorescence measurements were performed with appropriately diluted (in reaction buffer) disrupted cell suspensions, crude cell lysates or purified esterase preparations. In order to increase accuracy of kinetic measurements, decrease of fluorescence was measured with both enantiomers for each esterase variant simultaneously. Esterase samples were transferred from a master plate to a new 96-well microtiter plate. The assay solutions (150 ␮L) containing either R- or S-substrate were rapidly added to reaction mixtures and mixed vigorously for 30 s

M. Ivancic et al. / Journal of Biotechnology 129 (2007) 109–122

on the plate shaker and placed in a plate reader (Fluostar, BMG). The decrease of fluorescence (excitation at 485 nm, emission at 520 nm) was followed approximately for 20–30 min for fast reacting enantiomer and between 30 and 60 min for the slowly reacting enantiomer. Activity was determined as initial rates (FU min−1 ) calculated from the slope of the linear part of the curve. Specific activity (FU mg−1 min−1 ) was defined by the ratio between initial rate and amount of protein used in the reaction. Apparent enantiomeric ratios (Eapp ) for esterase variants were calculated as ratio of specific activities towards R- and S-enantiomer (Chen et al., 1982; Henke and Bornscheuer, 1999). 2.5. Protein expression Plasmids of esterase muteins were retransformed into E coli BL21. For preparation of precultures 100 mL LB-Kan liquid medium were inoculated with a single colony grown on selective LB agar plates and grown for 16 h at 30 ◦ C and 150 rpm. 5 mL of preculture were inoculated into 250 mL LB-Kan medium and further cultivated at 30 ◦ C and 120 rpm for approximately 2–3 h until the optical density of the culture reached OD600 = 0.5. Esterase expression was induced by addition of 0.1 mM IPTG and cultivation was continued for another 10 h. The cells were harvested by centrifugation at 2300 × g for 10 min at 4 ◦ C, washed once with 0.1 M Tris–HCl buffer (pH = 7.5) and resuspended in 3 mL of the same buffer. After repeated three cycles of freezethawing, cell lysates were harvested by centrifugation for 60 min at 60000 g, and the supernatant was filtersterilized (Sartorius, 0.2 ␮m pore size) and further purified. 2.6. Purification of esterase 2.6.1. QFF column chromatography Crude cell lysate was purified using Pharmacia XK16 column containing 20 mL of QSepharoseR Fast Flow (QFF) matrix. Column was pre-equilibrated with buffer B (1 M NaCl in 0.01 M Tris–HCl, pH 7.5) following buffer A (0.01 M Tris–HCl, pH 7.5). Approximately 40–50 mg total protein of the cell crude lysate were loaded onto the column. Proteins were eluted at 4 mL min−1 applying step-wise increase of NaCl concentration: 1–20 min with buffer

115

A, 20–40 min with 50 mM NaCl in buffer A, 40–60 min with 100 mM NaCl in buffer A and 60–80 min with 200 mM NaCl in buffer A. Fractions of 10 mL were collected and assayed for esterase activity using pnitrophenylbutyrate. Esterase was eluted with 200 mM NaCl after 64 min. The purity of fractions showing esterase activity was monitored by SDS-PAGE. Chosen fraction were concentrated using spin column concentrators (Vivascience Vivaspin, size exclusion 30 kDa, Sartorius). Purified esterase variants were used for kinetic resolution of methyl-␤-hydroxyisobutyrate in experiments with pH-stat. 2.6.2. Quick purification of esterase Quick purification of mutant proteins was performed using Vivapure Maxi Q spin columns (Sartorius) based on positively charged anion-exchange membranes. The columns were pre-equilibrated with 25 mM Tris–HCl, pH = 7.5. Crude cell lysate (approximately 30–40 mg) was loaded onto the column which was than washed with 25 mM Tris–HCl, pH 7.5. Bound proteins were eluted applying step salt gradients (50, 100 and 200 mM NaCl in 25 mM Tris–HCl, pH 7.5). Fractions were assayed for esterase activity towards p-nitrophenylbutyrate and purity of esterase active fractions was further analyzed by SDS-PAGE. Fractions eluted with 200 mM NaCl had esterase activity. Selected fractions were pooled together and concentrated using spin columns concentrators (Vivascience Vivaspin, size exclusion 30 kDa, Sartorius). Prepared purified esterase variants were used for kinetic measurements using fluorescence assay. 2.7. Determination of protein concentration Protein concentration was determined according to Bradford (1976) using a commercial kit (Bio-Rad). Bovine serum albumin (Bio-Rad) was used as a standard. 2.8. Determination of esterase activity 2.8.1. Spectrophotometric assay using p-nitrophenylbutyrate The reaction mixture contained 4 mM p-nitrophenylbutyrate dissolved in 0.1 M Tris–HCl buffer pH = 7 and 1–10 ␮L of appropriately diluted enzyme prepa-

116

M. Ivancic et al. / Journal of Biotechnology 129 (2007) 109–122

ration. The amount of released p-nitrophenol was determined at 405 nm (ε = 9.594 mL ␮mol−1 cm−1 ) for 10 min at 25 ◦ C. One unit (U) of esterase activity was defined as the amount of the enzyme required for release 1 ␮mol of p-nitrophenol per min under assay conditions. 2.8.2. Titrimetric assay towards methyl-β-hydroxyisobutyrate Reactions with this substrate were performed in a pH-stat assay (Mettler D21 titrator) using 1.5 mg of purified esterase protein, 250 mg of ester in 50 ml of 0.01 M Tris–HCl pH 7. Constant pH 7 was maintained by automated addition of 0.1 M NaOH. The reactions were performed at 25 ◦ C and samples were withdrawn from reaction mixtures at different time intervals to determine enantiomer distribution by chiral GC. One unit (U) of esterase activity was defined as amount of the enzyme which liberates 1 ␮mol of ␤-hydroxyisobutyric acid per min at 25 ◦ C. 2.9. Determination of enantioselectivity by gas chromatography (GC) Samples from kinetic resolution experiments with racemic methyl-␤-hydroxyisobutyrate performed in pH-stat assays as described above were extracted with CH2 Cl2 under acidic conditions (pH ≈ 3). The samples were centrifuged, the organic phase was harvested, dried with Na2 SO4 and filtrated through HPLC membrane filters (Ø 3 mm, 0.2 ␮m, Nylon 66, Roth) prior to injection into a Shimadzu GC-15A with a Shimadzu C-R5A/C-R6A integrator using a Chirasil Dex column. Enantiomers were separated with baseline resolution by means of a temperature gradient of 10 ◦ C/min starting from 80 ◦ C (15 min) to 165 ◦ C with ∼5 b H2 . Retention times for Rand S-methyl-␤-hydroxyisobutyrate were 7.81 and 7.93 min, respectively. Enantiomeric excess (e.e.S ) was calculated from the corresponding peak areas, while conversion (c) was determined from the amount of used 0.1 M NaOH for neutralization of the released acid in pH-stat experiments. Enantioselectivity (E) was calculated using the following equation: E = ln[(1 − c)(1 − eeS )]/ln[(1 − c)(1 + eeS )] (Chen et al., 1982). The calculation of the enantiomeric ratio E was based on three to six independent measurements at conversions lower than 50%.

3. Results 3.1. Selectivity mutants from random mutagenesis Approximately 75,000 clones of an error prone PCR generated EstB mutein library (up to four amino acid substitutions per esterase gene) were screened for esterase active mutants with the two-step (approximately 6000 in second step) visual pH shift filter assay as described in Section 2. Three mutants with decreased and one with increased preference for the Senantiomer (mutant 304 2) were identified (Table 2). Esterase variants were overexpressed in E. coli BL21 and purified over a QFF column. The true enantiomeric ratio (E) was determined by titrimetric measurements in a pH-stat followed by enantiomeric purity analysis by gas chromatography (Table 2). In addition, activities of the mutant proteins towards rac-methyl␤-hydroxyisobutyrate were determined. Sequencing revealed that all three mutants with decreased Sselectivity had a mutation at the position 152. Mutant 301 6 had the amino acid substitution Ile152Val while mutants 301 2 and 302 8 shared the same mutation Ile152Thr. Besides this mutation, mutants 301 2 and 302 8 harboured additional mutations Ile245Val and Arg308Cys, respectively. 3.2. Saturation mutagenesis at position 152 The results from random mutagenesis of the entire esterase gene revealed a highly interesting position with respect to enantioselectivity behaviour of EstB. Therefore, saturation mutagenesis was performed applying the overlap extension PCR method. In order to introduce all natural amino acids at the chosen position, the designed mutagenic primer contained the degenerated codon NNN generating a mixture of 64 possible mutants. Approximately 600 generated esterase mutants were screened by the two-step fluorescence assay. Three types of mutants with respect to wild-type enantioselectivity were isolated: mutants with higher enantioselectivity for the S-enantiomer, mutants with lower enantioselectivity and mutants with switched enantiopreference towards the R-enantiomer (Fig. 4). In addition, mutants exhibiting an increased general esterase activity were also identified. Esterase variants were overexpressed in E. coli BL21 and purified. Activities towards the racemic sub-

M. Ivancic et al. / Journal of Biotechnology 129 (2007) 109–122

117

Table 2 Activities towards racemic methyl-␤-hydroxyisobutyrate and enantiomeric ratios (E) of the mutants isolated from the first random gene library Mutant

Mutation

Specific activity (U mg−1 )

Conversion (%)

ES

WT 301 301 302 304

– I152T,I245V I152V I152T, R308C E316V, G349C, A373T

2.7 3.4 4.0 3.9 7.9

33 36 38 37 49

6.1 3.4 3.3 3.1 8.8

2 6 8 2

increased the S-enantioselectivity. On the other hand, a mutation of this residue to Ser (mutant IL 1), Thr (mutant IL 4), Val (mutant IL 8) or Ala (mutant IA6) slightly decreased the S-selectivity. Most interestingly it was found that introduction of an asparagine at this position (mutant IL 6) reversed the enantiopreference of esterase EstB to the R-enantiomer (Table 3). 3.3. Designed evolution of EstB towards R-selectivity In order to further enhance the identified R-selectivity of variant IL 6, we applied a so-called designed evolution approach. Based on the three-dimensional structure of the esterase EstB nineteen amino acids in the vicinity of the catalytic nucleophile Ser75 (Fig. 5) were selected as potential sites for creating mutants affecting selectivity. The following amino acid residues were substituted by saturation mutagenesis: Ala74, Lys78, Tyr133, Leu135, Asp150, Tyr181, Asp186, Leu249, His253, Ala256, Val257, Ser272, Gly274, Ala275, Trp348, Gly349, Gly350, Val351 and Met377. The selected residues were substituted with all 19 naturally occuring amino acids using the modified QuikChange protocol and degenerated primers (Table 1) containing substituted codons for one or two amino acid residues depending on position of chosen

Fig. 4. Activities of Ile152 mutants towards R- and S-methyl-␤hydroxyisobutyrate. Esterase variants with enhanced and inverted enantioselectivity are circled as well as activity mutants.

strate, the apparent enantiomeric ratios (Eapp ) and the enantiomeric ratios (E) were determined for purified variants (Table 3). Esterase variants exhibited different activity behaviour towards the racemic substrate but several showed moderately higher activity compared to the wild type. Sequencing revealed that a substitution of Ile152 with Met (mutant IL 9) or Leu (mutant IL 3) slightly

Table 3 Specific activity towards racemic methyl-␤-hydroxyisobutyrate, enantiomeric ratio (E) and apparent enantiomeric ratio (Eapp ) of the Ile152 mutants Mutant

Mutation

Specific activity (Umg−1 )

Conversion (%)

E

Eapp

Enantio-preference

WT IL 3 IL 9 IL 8 IL 4 IA6 IL 1 IL 6

– I152L I152M I152V I152T I152A I152S I152N

2.6 3.6 2.5 3.7 4.2 – 0.65 1.36

33 37 29 36 42 – 13 22

6.1 12.5 9.1 3.4 3.5 – 1.2 1.4

5.6 12.4 8.6 3.9 – 3.8 1.4 1.5

S S S S S S S R

118

M. Ivancic et al. / Journal of Biotechnology 129 (2007) 109–122

Fig. 5. Close-up of the active site of EstB. Coordinates have been taken from PDB-entry 1ci9 (Wagner et al., 2002). Residues which were targeted in the designed evolution approach are shown in blue. Mutation sites which effected an increase in R-selectivity are shown in cyan. The catalytic nucleophile Ser75 (covalently modified by DFP) and Ile152, which was identified in the first directed evolution round, are shown in magenta. The figure was prepared using PyMol (http://www.pymol.org/).

mutation sites. Codons of the selected amino acids were substituted with degenerated codons NNK, generating a mixture of 32 possible esterase gene variants, coding for all twenty amino acids at the specific position. When primers contained two degenerated codons, the number of possible variants was 1024. We screened approxi-

mately 200 transformants of the mutein libraries with one exchanged position and about 3500 transformants of the mutein libraries containing two simultaneous amino acid substitutions. Mutants were screened by the two step screening assay summarized in Fig. 3. Mutants with improved R-selectivity were selected and sequenced. Substitutions at three amino acid positions in EstB (135, 253 and 351) were found to improve R-selectivity. Esterase protein of the respective clones was expressed, purified, and the behaviour with respect to activity and enantioselectivity determined (Table 4). The replacement of histidine at position 253 by leucine (mutant 157 18) slightly increased the R-selectivity. Similar behaviour was found for mutants 157 2 and 157 7, which contain the mutations Leu135His and Leu135Trp respectively. The greatest positive effect on R-enantioselectivity was affected by mutations at position 351. While the substitution of the original valine by alanine brought about a modest increase of R selectivity, the introduction of cysteine or serine at this position significantly improved the apparent enantiomeric ratio (Table 4). The introduction of the cysteine, however, drastically decreased the overall esterase activity compared to the parent mutant IL 6. On the other hand, the substitution with serine not only drastically increased R selectivity but doubled the general activity of this variant, even outperforming the wild-type enzyme. 3.4. Combination of mutations at identified positions In an effort to further improve enantioselectivity of the esterase EstB towards R-methyl-␤-hydroxyiso-

Table 4 Relative activities (aS , aR )a , apparent enantioselectivity (Eapp ) and specific activitiesb of the mutants created by saturation mutagenesis at positions 135, 253 and 351 Mutant

Mutation

aS

aR

Eapp

Specific activity (Umg−1 )

Enantio-preference

WT IL 6 157 2 157 7 157 18 CV1 CV3 CV7

– I152N L135H, I152N L135W, I152N I152N, H253L I152N, V351C I152N, V351A I152N, V351S

1 0.53 0.33 0.31 0.88 0.003 0.09 0.08

1 4.54 3.77 3.69 9.53 0.41 3.77 7.45

5.6 1.5 2.0 2.1 1.9 21.6 7.9 15.9

2.7 1.4 – – – 0.02 – 3.4

S R R R R R R R

a Relative activities towards R- and S-methyl-␤-hydroxyisobutyrate were defined by the ratio between esterase variant activity and wild-type esterase activity for S- and R-enantiomer. b Specific activities towards racemic methyl-␤-hydroxyisobutyrate were measured using an autotitrator.

M. Ivancic et al. / Journal of Biotechnology 129 (2007) 109–122

119

Table 5 Relative activities (aS , aR )a , apparent enantioselectivity (Eapp ) and specific activitiesb of the mutants created by saturation mutagenesis at positions 253 and 135 Mutant

Mutation

aS

aR

Eapp

Specific activity (U mg−1 )

Enantio-preference

SH1 SH5 SH10 LR2SH5 LR3SH5

I152N, V351S, H253W I152N, V351S, H253F I152N, V351S, H253M L135F;I152N, V351S, H253F L135W;I152N, V351S, H253W

0.17 0.10 0.09 0.10 0.03

19.1 13.5 11.5 15.7 4.3

20 25 24 29 27

– 2.8 – 3.0 0.4

R R R R R

a Relative activities towards R- and S-methyl-␤-hydroxyisobutyrate were defined by the ratio between esterase variant activity and wild-type esterase activity for S- and R-enantiomer. b Specific activities towards racemic methyl-␤-hydroxyisobutyrate were measured using an autotitrator.

butyrate we looked for combinations of mutations at positions 135, 253 and 351. Instead of introducing only the identified beneficial mutations by site-directed mutagenesis, however, we applied successive rounds of saturation mutagenesis at the defined positions. A first round of saturation mutagenesis was performed at position 253 starting with the mutein CV1 encoding for the so far best variant (Table 4). As the starting mutein already had low activity, so it was impossible to accurately measure the initial activities with our fluorescence assay using disrupted cell suspensions. Increasing the amount of the biocatalyst increased the turbidity of the reaction mixture which strongly interfered with the fluorescence measurements. In order to improve sensitivity of the measurements, cell crude lysates free from the cell debris were used. Fifty randomly chosen esterase variants were analyzed and mutants with further increased enantioselectivity were isolated and sequenced. Sequencing revealed that improved mutants contained phenylalanine (mutant CH1) and methionine (CH2) instead of histidine at position 253. Both esterase variants displayed an apparent enantioselectivity of ERapp ≈ 30. Due to their low activity, we further focused on the improvement of the second best mutant (CV7, I152N, V351S). Moderately improved esterase variants were created by saturation mutagenesis at the position 253: mutant SH1 (His253Trp), mutant SH5 (His253Phe) and mutant SH10 (His253Met) (Table 5). Enantioselectivity determination by the fluorescence assay for the best mutants SH5 and SH10 indicated ERapp values of 24.6 and 23.9, respectively. In case of the SH5 mutant, the activity towards the R-enantiomer was almost doubled compared to the parent enzyme (mutant CV7), while the activity towards non-preferred S-enantiomer did not

change significantly. However, the specific activity of the best mutant SH5 towards racemic methyl-␤hydroxyisobutyrate was slightly decreased compared to the CV7 variant. Further saturation mutagenesis was performed at position 135 of the gene encoding esterase variant SH5. Mutant LR2SH5 containing the mutation Leu135Phe showed the highest enantioselectivity (ERapp = 28.9). The additional mutation at position 135 enhanced only the activity towards the preferred enantiomer (Table 5). A similar effect on enantioselectivity (ERapp = 27.3) was found for the substitution Leu135Trp (mutant LR3SH5). The introduction of the tryptophane residue, however, markedly decreased the activity towards the racemic substrate as well as towards both enantiomers. Interestingly, all created R-selective mutants of EstB showed significantly decreased activities towards pnitrophenylbutyrate compared to the wild-type enzyme (Table 6).

Table 6 Specific activities towards racemic methyl-␤-hydroxyisobutyrate (S1) and p-nitrophenylbutyrate (S2) Mutant

Specific activity (S1) (U mg−1 )a

Specific activity (S2) (U mg−1 )

WT IL 6 CV1 CV7 SH1 SH5 SH10 LR2SH5 LR3SH5

2.7 1.4 0.02 3.4 – 2.8 – 3.0 0.4

92 58 6.5 68 24 35 34 30 13

a

These values were already shown in the Tables 4 and 5.

120

M. Ivancic et al. / Journal of Biotechnology 129 (2007) 109–122

4. Discussion Substitutions of amino acid residues in the esterase EstB sequence were studied with respect to enantioselectivity for a model reaction (Fig. 1). An initial round of ep-PCR revealed that the enantiopreference of EstB can be shifted in both directions, i.e. towards R- and S-enantiomer (Table 2). Three mutants with decreased (301 1, 301 6 and 302 8) and one with increased (304 2) enantioselectivity towards the S-enantiomer were identified. Interestingly, all mutants with decreased enantioselectivity shared substitutions at the position 152 located in the binding pocket of the acid portion of the substrate. Additional mutations Ile245Val and Arg308Cys were located distant from the active site on the protein surface and it was very unlikely that these mutations affected the enantioselectivity. The mutations at position 152 also increased the activity of variants compared to the wild-type enzyme. Applying saturation mutagenesis at this “hot spot”, esterase variants with increased (Ile152Leu, Ile152Met) and decreased (Ile152Val, Ile152Thr, Ile152Ala and Ile152Ser) Sselectivity could be isolated. Moreover, one specific mutation at this position (Ile152Asn, mutant IL 6) inverted the enzyme’s enantioselectivity (Table 3). One correlation also became evident: decreasing the size of the amino acid side chain at position 152 and increasing its polarity decreased the S-enantiopreference of the esterase variants compared to wild-type EstB. The identified hot spot for controlling the enantioselectivity (position 152) is located in the vicinity of the active site of the enzyme. This finding is opposite to most of the results obtained from directed evolution experiments (Henke and Bornscheuer, 1999; Liebeton et al., 2000; May et al., 2000; Horsman et al., 2003). Mutations distant from the active site were often identified as key residues that control the enzyme’s enantioselectivity. On the contrary, rational design predicted that amino acid residues close to the active site primarily influence enantioselectivity (Rotticci et al., 2001; Magnusson et al., 2001). Kazlauskas and coworkers attributed the reason for this disagreement of the obtained results to the strong bias of random mutagenesis towards mutations far from active site simply due to the much higher number of amino acid residues distant from the active site than close to it (Horsman et al., 2003). Bocola et al. (2004) provided insight into the

six mutations introduced during directed evolution of the enantioselective lipase from Pseudomonas aeruginosa. They pointed out that three accumulated surface mutations could increase activity as well as stability of enzyme under assay conditions although they were not significant for the enantioselectivity of the lipase. Only two of the six mutations, one near and one remote from the oxy-anion hole were found to directly increase enantioselectivity through creation of a new binding pocket for the ␣-chiral esters (Bocola et al., 2004). Based on our results and literature data on rational design we focussed on acid residues located close to active site and applied saturation mutagenesis at nineteen selected amino acid positions in the vicinity of catalytic nucleophile Ser75 to further evolve an Rselective esterase out of the variant IL 6. Introduction of bulky residues (e.g. His or Trp) instead of leucine at position 135, which is located in a hydrophobic tunnel, and the substitution His253Leu located in the binding pocket of the alcohol portion of the substrate slightly increased R-selectivity. In contrast, mutations introduced at position 351 significantly improved the R-selectivity of esterase EstB. However, substitution of the hydrophobic Val with the more polar Cys residue (mutant CV1) drastically reduced esterase activity. The Val351Ser mutant had a higher ERapp value compared to the Val351Ala mutant due to its higher activity towards the R-enantiomer, while activities towards the non-preferred S-enantiomer for both mutants were almost the same. Furthermore, the activity of the Val351Ser mutant (mutant CV7) towards racemic methyl-␤-hydroxyisobutyrate was doubled compared to the parent mutant (IL 6) and the Val351Ala mutant (CV3). We believe that the main-chain NH group of Val 351 together with the NH group of the Ser75 forms the oxyanion hole which is essential for the stabilization of the tetrahedral intermediate (Wagner et al., 2002). The side chain of the hydroxyl group of the newly introduced serine at position 351 may enable additional hydrogen bonding interactions with the tetrahedral intermediate which could further stabilize the transition state. Furthermore, the identified substitutions at position 351 increased the accessibility around the oxyanion hole, which could again be important in enantiorecognition. Similar results concerning the role of the oxyanion hole in stabilisation of the transition state and enantiorecognition were obtained with a few hydrolases such as subtilisin, papain, cutinase

M. Ivancic et al. / Journal of Biotechnology 129 (2007) 109–122

as well as lipase B from Candida antarctica (CALB) (Magnusson et al., 2001). Saturation mutagenesis at position 253 out of the so far best double mutants CV1 and CV7 slightly improved the enantioselectivity towards methyl-␤hydroxyisobutyrate. None of the improved esterase variants, however, contained leucine which was previously present in the best 253 mutant (157 18) showing that the individual positive effect of the single mutation was not additive. However, our results clearly showed that position 253 is indeed a “hot spot” and that introduction of more bulky hydrophobic amino acids (such as Phe, Met or Trp) instead of the more polar His has a positive effect on R-enantioselectivity. The substitutions His253Met or His253Phe in addition to mutations Ile152Asn and Val351Cys (CH2 and CH1) led to the creation of the most R-selective variants (ERapp ≈ 30). However, activities of these triple mutants were still lower than for the parent mutant CV1. Introduction of more bulky hydrophobic amino acids (such as Phe, Met or Trp) instead of the more polar His most probably reduced the size of the alcohol binding pocket which is able to accommodate relatively large alcohol portions of the substrate as found in 7-aminocephalosporinic acid, linalyl acetate, naphtyl-acetate etc. (Schlacher et al., 1998; Petersen et al., 2001.). A further round of saturation mutagenesis performed at position 135 of the second best esterase variant SH5 resulted in a slightly improved variant (LR2SH5, ERapp = 28.9) having instead of leucine at position 135 the more bulky phenylalanine. Introduction of the phenylalanine very likely also decreases the size of the acid binding pocket making it more appropriate for the R-enantiomer of the substrate. A similar effect on enantioselectivity was observed for the mutein with tryptophane at this position (LR3SH5). This mutation, however, drastically reduced the activity towards both ester enantiomers. All created R-selective variants (see Tables 4 and 5) showed different levels of relative activity towards R- and S-methyl-␤hydroxyisobutyrate, but none of them showed a higher activity towards the S-enantiomer than wild-type esterase. Consequently, activities towards the preferred R-enantiomer were further increased except for the variants containing the mutation Val351Cys. The same fashion of the change of relative activities towards preferred and non-prefered enantiomers was reported by Koga et al. (2003), who successfully inverted the enan-

121

tioselectivity of a lipase from Burkholderia cepacia KWI-56 applying a semi-random approach. The results obtained in this study confirmed our hypothesis that certain amino acid residues in the vicinity of the enzyme’s active site significantly control enantioselectivity. Four ‘hot spots’ in the esterase sequence were identified as crucial for R-selectivity improvement. They were found to independently control R-selectivity and the activity of the esterase EstB. The applied semi-random approach guided by the 3Dstructure of the protein proved to be a powerful strategy for the fast molecular adaptation of an enzyme for inverting and improving enantioselectivity.

References Arnold, F.H., Wintrode, P.L., Miyazaki, K., Gershenson, A., 2003. How enzymes adapt: lessons from directed evolution. A. Trends Biochem. Sci. 26, 100–106. Bocola, M., Otte, N., Jaeger, K.-E., Reetz, M.T., Thiel, W., 2004. Learning from directed evolution: theoretical investigations into cooperative mutations in lipase enantioselectivity. Chem. Biol. Chem. 5, 214–223. Bornscheuer, U.T., 2001. Directed evolution of enzymes for biocatalytic applications. Biocatal. Biotransform. 19, 84–96. Bornscheuer, U.T., Pohl, M., 2001. Improved biocatalysts by directed evolution and rationalprotein design. Curr. Opin. Chem. Biol. 5, 137–142. Chen, C.S., Fujimoto, Y., Sih, C.J., 1982. Quantitative analyses of biochemical kinetic resolution of enantiomers. J. Am. Chem. Soc. 104, 7294–7299. Cedrone, F., M´enez, A., Qu´em´eneur, E., 2000. Tailoring new enzyme function by rational redesign. Curr. Opin. Struct. Biol. 10, 405–410. Eberl, L., Kristensen, C.S., Givskov, M., Grohmann, E., Gerlitz, M., Schwab, H., 1994. Analysis of the multimer resolution system encoded by the parCBA operon of broad-host-range plasmid RP4. Mol. Microbiol. 12, 131–141. Glieder, A., Weis, R., Skranc, W., Poechlauer, P., Dreveny, I., Majer, S., Wubbolts, M., Schwab, H., Gruber K, 2003. Comprehensive step-by-step engineering of an (R)-hydroxynitrile lyase for largescale asymmetric synthesis. Angew. Chem. Int. Ed. Engl. 42, 4815–4818. Henke, E., Bornscheuer, U.T., 1999. Directed evolution of an estrase from Pseudomonas fluorescens. Random mutagenesis by errorprone PCR or mutator strain and identification of the mutants showing enhanced enantioselectivity by a resorufin-based fluorescence assay. Biol. Chem. 380, 1029–1033. Hult, K., Berglund, P., 2003. Engineered enzymes for improved organic synthesis. Curr. Opin. Biotechnol. 14, 395–400. Horsman, G.P., Liu, A.M.F., Henke, E., Bornscheuer, U.T., Kazlauskas, R.J., 2003. Mutations in distant residues moderately increase the enantioselectivity of Pseudomonas fluorescens

122

M. Ivancic et al. / Journal of Biotechnology 129 (2007) 109–122

esterase toward methyl 3-bromo-2-methylpropanoate and ethyl 3-phenylbutyrate. Chem. Eur. J. 9, 1933–1939. Jaeger, K.-E., Eggert, T., Eipper, A., Reetz, M.T., 2001. Directed evolution and the creation of enantioselective biocatalysts. Appl. Microbiol. Biotechnol. 55, 519–530. Koga, Y., Kato, K., Nakano, H., Yamane, T., 2003. Inverting enantioselectivity of Burkholderia cepacia KWI-56 lipase by combinatorial mutation and high-throughput screening using single-molecule PCR and In vitro expression. J. Mol. Biol. 331, 585–589. Liebeton, K., Zonta, A., Schimossek, K., Nardini, M., Lang, D., Dijkstra, B.W., Reetz, M.T., Jaeger, K.-E., 2000. Directed evolution of an enantioselective lipase. Chem. Biol. 7, 709–718. Ling, M.M., Robinson, B.H., 1997. Approaches to DNA mutagenesis: an overview. Anal. Biochem. 254, 157–178. Magnusson, A., Hult, K., Homlquist, M., 2001. Creation of an enantioselective hydrolase by engineered substrate-assisted catalysis. J. Am. Chem. Soc. 123, 4354–4355. May, O., Nguyen, P.T., Arnold, F.H., 2000. Inverting enantioselectivity by directed evolution of hydantoinase for improved production of l-methionine. Nat. Biotechnol. 18, 317–320. McPherson, M.J., Moeller, S.G., 2001. PCR Basics. BIOS Scientific Publishers Limited, Oxford, pp. 171–172. Penning, T.M., Jez, J.M., 2001. Enzyme redesign. Chem. Rev. 101, 3027–3046. Petersen, E.I., Valinger, G., Soelkner, B., Stubenrauch, G., Schwab, H., 2001. A novel esterase from Burkholderia gladioli which shows high deacetylation activity on cephalosporins is related to ␤-lactamases and DD-peptidases. J. Biotechnol. 89, 11–25. Reetz, M.T., 2004. Controlling the enantioselectivity of enzymes by directed evolution: practical and theoretical ramifications. Proc. Natl. Acad. Sci. U.S.A. 101, 5716–5722.

Reetz, M.T., Jaeger, K.-E., 2000. Enantioselective enzymes for organic synthesis created by directed evolution. Chem. Eur. J. 6, 407–412. Reetz, M.T., Zonta, A., Schimossek, K., Liebeton, K., Jaeger, K.E., 1997. Creation of enantioselective biocatalysts for organic chemistry by in vitro evolution. Angew. Chem. Int. Ed. Eng. 36, 2830–2832. Reetz, M.T., Wilensek, T.S., Zha, D., Jaeger, K.-E., 2001. Directed evolution of an enantioselective enzyme through combinatorial multiple-cassette mutagenesis. Angew. Chem. Int. Ed. 40, 3589–3591. Rotticci, D.J., Rotticci-Mulder, S., Denman, S., Norin, T., Hult, K., 2001. Improved enantioselectivity of the lipase by rational protein engineering. Chem. Biochem. 2, 766–770. Schlacher, A., Stanzer, T., Ospiran, I., Mischitz, M., Klingsbichel, E., Faber, K., Schwab, H., 1998. Detection of a new enzyme for stereoselective hydrolysis of linalyl acetate using simple plate assay for characterisation of cloned esterases from Burkholderia gladioli 62, 47–54. Wagner, U.G., Petersen, E.I., Schwab, H., Kratky, C., 2002. EstB from Burkholderia gladioli: a novel esterase with a ␤-lactamase fold reveals steric factors to discriminate between estrolytic and ␤-lactam cleaving activity. Prot. Sci. 11, 467–478. Valinger, G., Hermann, M., Wagner, U.G., Schwab, H., 2007. Stability and activity improvement of cephalosporin esterase EstB from Burkholderia gladioli by directed evolution and structural interpretation of muteins. J. Biotechnol. 129, 98– 108. Zha, D., Wilensek, S., Hermes, M., Jaeger, K.E., Reetz, M.T., 2001. Complete reversal of enantioselectivity of an enzymecatalyzed reaction by directed evolution. Chem. Commun. (Camb.), 2664–2665.