- Email: [email protected]
Investigation of FGF1 and FGFR gene polymorphisms in a group of Iranian patients with nonsyndromic cleft lip with or without cleft palate
International Journal of Pediatric Otorhinolaryngology 78 (2014) 731–736
Contents lists available at ScienceDirect
International Journal of Pediatric Otorhinolaryngology journal homepage: www.elsevier.com/locate/ijporl
Investigation of FGF1 and FGFR gene polymorphisms in a group of Iranian patients with nonsyndromic cleft lip with or without cleft palate Zahra Rafiqdoost a, Amir Rafiqdoost b, Houshang Rafiqdoost c, Mohammad Hashemi d, Jina Khayatzadeh a, Ebrahim Eskandari-Nasab d,* a
Department of Biology, Faculty of Science, Mashhad Branch, Islamic Azad University of Medical Sciences, Mashhad, Iran School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran c Department of Anatomy, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran d Department of Clinical Biochemistry, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 6 November 2013 Received in revised form 13 January 2014 Accepted 19 January 2014 Available online 27 January 2014
Objective: Nonsyndromic cleft lip with or without cleft palate (NS-CL/P) is one of the most common craniofacial malformations determined by the interaction between multiple genes and environmental risk factors. Genes coding for fibroblast growth factors and their receptors (FGF/FGFR genes) are considered as excellent candidate genes, which their proteins play important roles in craniofacial and palatal development. The aim of the current study was to assess the possible association between FGF1 rs34010 C>A and FGFR1 rs13317 A>G gene polymorphisms and susceptibility to NS-CL/P in an Iranian population. Design: This case–control retrospective study was performed on a total of 200 subjects including 100 NS-CL/P patients and 100 healthy unrelated controls. Tetra amplification refractory mutation systempolymerase chain reaction (T-ARMS-PCR) was used to detect FGF1 rs34010 C>A and FGFR1 rs13317 A>G SNPs. Results: Our data demonstrated that the FGF1 rs34010, CA and CA + AA genotypes were associated with a reduced risk of NS-CL/P the in codominant (CA vs. CC: OR = 0.29, 95%CI = 0.16–0.55, P = 0.001) and dominant (CA + AA vs. CC: OR = 0.36, 95%CI = 0.19–0.69, P = 0.001) tested inheritance models, respectively. Additionally, the analysis of FGF1/FGFR1 genotype combinations revealed that rs34010CA/rs13317AA and rs34010CA/rs13317AG combinations were associated with a lower risk of NS-CL/P (OR = 0.357, P = 0.008 for the rs34010CA/rs13317AA; OR = 0.226, P = 0.004 for the rs34010CA/ rs13317AG). Conclusions: Our findings suggest that the FGF1 rs34010 C/A polymorphism was associated with a decreased risk of NS-CL/P, and might act as a protective factor against NS-CL/P predisposition. ß 2014 Elsevier Ireland Ltd. All rights reserved.
Keywords: FGF1 FGFR1 Cleft lip and/or cleft palate Single nucleotide polymorphism
1. Introduction Clefts of the lip and/or palate (CL/P) are among the most common congenital birth defects worldwide [1]. Several signaling pathways, integrated into an intricate series of events under a rigorous control of expression network of developmental genes, are important in lip and palate development. Based on their association with particular malformative patterns or their occurrence as isolated defects, CL/P can be divided into syndromic or
* Corresponding author at: Department of Clinical Biochemistry, School of Medicine, Zahedan University of Medical Sciences, P.O. Box: 9861615881, Zahedan, Iran. Tel.: +98 9136326859; fax: +98 5413229792. E-mail address: [email protected] (E. Eskandari-Nasab). 0165-5876/$ – see front matter ß 2014 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.ijporl.2014.01.024
nonsyndromic, respectively. Both forms of CL/P are characterized by a strong genetic component. Syndromic forms are usually caused by chromosomal aberrations or monogenic diseases, whereas, nonsyndromic CL/P forms are derived by the interaction between genetic and environmental factors [2,3]. Isolated or nonsyndromic (without other associated abnormalities) CL/P (NS-CL/P) is a common congenitally developmental disorder affecting 1:700 births worldwide, although prevalence varies broadly based on geographic and socioeconomic status [4,5]. In general, Asian populations have a higher birth occurrence of clefting (1/500 births), Caucasians are intermediate (1/1000 births), and African populations have the lowest (1/2500 births). NS-CL/P patients frequently suffer major complications such as troubles with feeding, speech, hearing and psychologic maturation [2,6].
732
Z. Rafiqdoost et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 731–736
Thus far, several genome-wide association studies have recognized specific candidate genes and loci on chromosomal regions as a genetic risk factor for NS-CL/P [5]. Extensive research on DNA samples from NS-CL/P cases has shown the implication of mutations in FGF1, FGFR1, MSX1, PVRL1, TBX22 and IRF6 genes in the etiology of NS-CL/P [7]. Mammalian fibroblast growth factors (FGFs) (FGF1–FGF10 and FGF16–FGF23) control multiple developmental processes including craniofacial and palatal development (10). The biological activities of FGFs are conveyed by seven principal FGF receptor tyrosine kinases encoded by four distinct genes (FGFR1–FGFR4) [1]. It has been revealed that coordinated epithelial–mesenchymal interactions are essential during the initial stages of palate development and require an FGF signaling network, which mediates the epithelial–mesenchymal interaction involved in the development of palate and upper lip [8,9]. In addition, several lines of studies on animal models point to the involvement of FGFFGFR signaling in the pathogenesis of oral clefting [10,11]. Knockout mouse models for FGF10 and FGFR2b develop cleft palate, demonstrating the necessity of epithelial FGF signaling in normal palatogenesis. Cleft palate in FGF18/ mice has also signified the importance of the mesenchymal FGF signaling in palate development [12]. Sequencing of the coding region of genes in the FGF signaling pathway in NS-CLP cases revealed that missense and nonsense mutations in FGF genes might contribute to approximately 3–5% of NS-CLP [13]. Several case–control studies have also demonstrated the involvement of single nucleotide polymorphisms (SNPs) in FGF1, FGF3, FGF7, FGF8 and FGF10 in NS-CL/P predisposition [1,13– 17]. Additionally, mutations in FGFR1 have been shown to cause autosomal dominant Kallmann syndrome, which includes clefts in 30% of the cases. FGF1, one of the best characterized members of the FGF superfamily, is a powerful mitogen exhibiting strong action on numerous different cell types. It plays a role in various stages of embryonic development and morphogenesis, as well as in angiogenesis and wound healing processes [7,18]. The FGF1 gene is localized on chromosome 5q31.3–33.2 spanning more than 100 kb and contains three protein-coding exons. Recently, the FGF1 rs34010 C>A has shown evidence of association with susceptibility to NS-CL/P in Northeastern European populations [19]. Considering the crucial roles of FGF1 and FGFR1 in craniofacial development, any genetic variation causing disruption of the FGFFGFR signaling pathway may contribute to susceptibility to NS-CL/ P. Therefore, the present study aimed to evaluate the possible association between FGF1 rs34010 C>A and FGFR1 rs13317 A>G polymorphisms and susceptibility to NS-CL/P in an Iranian population.
Table 1 Primers sequence for detection of FGF1, rs34010 C/A and FGFR1, rs13317 A/G gene polymorphisms. Primer sequence (5–3)
Amplicons size
FGF1, rs34010 C>A Forward outer Reverse outer Forward inner (A) Reverse inner (C)
GGCCTCTACCCACTAGATGCCAGTAG CTGCTTTCATTATCAACCTGCACAGG GGAAACTTCATTGTGAGGGAGTCCA ACTGGTTGCCACATATGAAACTCAGG
428 bp
FGFR1, rs13317 A>G Forward outer Reverse outer Forward inner (A) Reverse inner (G)
AAAATGCAAAAATTATCCAGGCATGGTGG TGTAAGAAGCCAAGATCTGCGACAGTCC CCCTCTATGTGGGCATGGTTTTGACA GACATGTTCTCCTGCACTTAGAAGCCCC
390 bp
197 bp 281 bp
184 bp 260 bp
respectively) were obtained from the National Center for Biotechnology Information (NCBI). The polymorphisms were searched and primers for T-ARMS-PCR were designed (Table 1). The T-ARMS-PCR method uses two external primers (control band) and two inner primers (allele specific primers). This method simultaneously amplifies both alleles in one single-PCR tube. All primer sequences and fragments size are listed in Table 1. PCR was performed using commercially available Prime Taq premix (Genetbio, South Korea) according to the manufacturer recommended protocol. Into a 0.2-mL PCR tube with a final volume of 20 mL, 1 mL of template DNA (100 ng/mL), 0.7 mL of each primer (10 mM), 10 mL Taq premix and 6 mL DNase-free water were added. The cycling conditions for FGF1 rs34010 were an initial denaturation at 95 8C for 5 min followed by 30 cycles of 30 s at 95 8C, annealing temperature for 25 s at 58 8C and 30 s at 72 8C, with a final extension of 10 min at 72 8C. The PCR conditions for FGFR1 rs13317 polymorphism were 5 min at 95 8C followed by 30 cycles of 95 8C for 30 s, 60 8C for 27 s, 72 8C for 30 s followed by a final extension step for 10 min at 72 8C. PCR products were separated by standard electrophoresis on a 2% agarose gel containing 0.5 mg/ml ethidium bromide and visualized by transillumination with UV light. The products size for FGF1 rs34010 were 197 bp for A allele and 281 bp for C allele, while the product size for the two outer primers (control band) was 428 bp (Fig. 1). The amplicons size for the FGFR1 rs13317 were 184 bp for the A allele, 260 bp for the G allele and 390 bp for the control outer band (Fig. 2). The accuracy the PCR used for genotyping of both SNPs was examined by direct sequencing of the outer bands of FGF1 and FGFR1 polymorphisms. As shown in Fig. 3, the genotypes determined by T-ARMS-PCR method were completely concordant with those determined by sequencing. 2.1. Statistical analysis The statistical analyses of the data were done using the SPSS 18.0 software (SPSS Inc., Chicago IL, USA). The association between
2. Materials and methods The local Ethics Committee of the Zahedan University of Medical Sciences approved the project, and written informed consent was taken from all participants. Blood samples were collected in EDTA containing tubes from patients and healthy controls and stored at 20 8C until DNA extraction. Genomic DNA was extracted from the peripheral blood leukocytes by the ‘saltingout’ method as described previously [20]. The quality of the isolated DNA was checked by electrophoresis on 1% agarose gel, quantitated spectrophotometrically and stored at 20 8C till further use. For detection of FGF1 rs34010 and FGFR1 rs13317 polymorphisms, we performed tetra-ARMS-PCR, which has been established as a simple and rapid method for detection of SNPs [21–25]. The FGF1and FGFR1 genomic sequences (NT_029289.11 and NT_167187.1,
SNPs
[(Fig._1)TD$IG]
Fig. 1. Photograph of the PCR products of FGF1 rs34010 C>A polymorphism using TARMS-PCR method. The products size were: 197 bp for A allele, 281 bp for C allele and 428 bp for the outer (control) band. M: DNA marker; Lanes 1, 3: rs34010 CA; Lanes 2: rs34010 CC; Lane 4, 5: rs34010 AA.
[(Fig._2)TD$IG]
Z. Rafiqdoost et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 731–736
Fig. 2. Representative T-ARMS-PCR products to detect the FGFR1, rs13317 A>G polymorphism. The PCR products were 181 bp for A allele, 260 bp for G allele and 390 bp for the outer (control) band. M: DNA marker; Lanes 1, 4: rs13317 AG; Lanes 2: rs13317 AA; Lane 3: rs13317 GG.
genotypes and NS-CL/P was assessed by computing the odds ratio (OR) and 95% confidence intervals (95%CI) from logistic regression analyses. P-values below 0.05 were defined statistically significant. The Hardy–Weinberg equilibrium was tested with the x2 test for any of the SNPs under consideration. Linkage disequilibrium (LD) and frequencies of haplotypes in the controls and patients were estimated using SNPStats software [26]. 3. Results In this case–control retrospective study, a total of 200 subjects including 100 CL/P patients (61 male and 39 female) with an average age of 12.12 years (range: 1–54 y) and 100 normal subjects (61 male and 39 female) with an average age of 12.03 years (range:
733
1–51 y) were included. There was no significant difference between the groups regarding sex and age (P > 0.05). All participants were unrelated to each other. Of a total of 100 patients, 43 were cleft lip (CL), 26 were cleft lip with cleft palate (CLP) and 31 were cleft palate (CP). The frequencies of all SNPs were in Hardy–Weinberg equilibrium (HWE) in cases and controls (P > 0.05), except for the HWE of the FGF1, rs34010 SNP in the control group (P < 0.05). The distribution of genotype and allele frequencies of FGF1 and FGFR1 were shown in Table 2. A significant difference was observed between NS-CL/P patients and control group regarding FGF1 rs34010 polymorphism in the codominant and dominant tested inheritance models. In the codominant model, the FGF1 rs34010 CA genotype with a remarkably increased frequency in controls compared to CL/P patients (69% vs. 39%) was associated with a reduced risk of NS-CL/P (OR = 0.29, 95%CI = 0.16–0.55, P = 0.001). Additionally, in the dominant model, the CA + AA genotype was more frequent in the control group than in the cases (75% vs. 52%) and was a protective factor against NS-CL/P (OR = 0.36, 95%CI = 0.19–0.69, P = 0.001). However, allele frequency of rs34010 variation was not significantly different between NSCL/P patients and the control group (OR = 0.71, 95%CI = 0.46–1.09, P = 0.097). With respect to FGFR1, rs13317 A>G variant, we did not find any disparity between genotype frequencies of the variation in patients and controls in codominant, dominant and recessive tested inheritance models. Besides, the allele frequency of rs13317 G variant in NS-CL/P patients was similar to those observed in the control group (19.5% and 17% in cases and controls, respectively) and was not associated to NS-CL/P (OR = 1.18, 95% CI = 0.69–2.03, P = 0.517).
[(Fig._3)TD$IG]
Fig. 3. Sequencing analysis for the FGF1 and FGFR1 polymorphisms: A1, A2 and A3 are representatives of the FGF1 rs34010 AA, AC and CC genotypes, respectively. B1, B2 and B3 represent the FGFR1 rs13317 AA, AG and GG genotypes, respectively.
Z. Rafiqdoost et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 731–736
734
Table 2 The genotype and allele frequencies of FGF1 and FGFR1 SNPs between patients with nonsyndromic cleft lip and/or cleft palate (NS-CL/P) and control subjects. Polymorphism FGF1, rs34010 C>A Codominant CC CA AA Dominant CC CA + AA Recessive CC + CA AA Alleles C A FGFR1, rs13317 A>G Codominant AA AG GG Dominant AA AG + GG Recessive AA + AG GG Alleles A G
CL/P Patients n (%)
Controls n (%)
Odd Ratio (95%CI)
P-value
48 (48.0) 39(39.0) 13 (13.0)
25 (25.0) 69 (69.0) 6 (6.0)
1.00 0.29 (0.16–0.55) 1.13 (0.383–3.33)
– 0.001 0.827
48 (48.0) 52 (52.0)
25 (25.0) 75 (75.0)
1.00 0.36 (0.19–0.69)
– 0.001
87 (87.0) 13 (13.0)
94 (94.0) 6 (6.0)
1.00 2.34 (0.78–7.27)
– 0.091
135 (67.5) 65 (32.5)
119 (59.5) 81 (40.5)
1.00 0.71 (0.46–1.09)
– 0.097
67 (67.0) 27 (27.0) 6 (6.0)
67 (67.0) 32 (32.0) 1 (1.0)
1.00 0.84 (0.46–1.56) 6.00 (0.70–51.2)
– 0.588 0.101
67 (67.0) 33 (33.0)
67 (67.0) 33 (33.0)
1.00 0.99 (0.53–1.88)
– 0.999
94 (94.0) 6 (6.0)
99 (99.0) 1 (1.0)
1.00 6.31 (0.73–141.9)
– 0.054
161 (80.5) 39 (19.5)
166 (83.0) 34 (17.0)
1.00 1.18 (0.69–2.03)
– 0.517
3.1. LD and haplotype and genotype combination analysis of FGF1 and FGFR1 polymorphisms LD was tested by calculating Lewontin’s Delta0 coefficient and the correlation coefficient r2 [27]. Pairwise LD between the SNPs in FGF1 (rs34010) and FGFR1 (rs13317) was calculated for the cases and controls. The LD analysis of the FGF1, rs34010 and FGFR1, rs13317 SNPs demonstrated incomplete LD for the two SNPs in controls and NS-CL/P patients (rs34010/rs13317, D0 = 0.101, r2 = 0.001). Table 3 demonstrates the frequency of each genotype combination in NS-CL/P patients and controls. Two genotype
combinations, rs34010CA/rs13317AA and rs34010CA/rs13317AG, were more prevalent in healthy controls compared to NS-CL/P patients and were associated with a reduced risk of NS-CL/P (OR = 0.357, 95%CI: 0.167–0.764, P = 0.008 for the rs34010CA/ rs13317AA; OR = 0.226, 95%CI: 0.082–0.621, P = 0.004 for the rs34010CA/rs13317AG), However, no significant differences in the frequencies of subjects carrying other genotype combinations were observed between patients and controls (P > 0.05). Moreover, the Table 4 shows haplotype association analyses for FGF rs34010 C/A and FGFR1 rs13317A/G in NS-CL/P patients and controls, but no association between haplotypes and risk of NS-CL/P was found (P > 0.05).
Table 3 Distribution of genotype combinations for the FGF1, rs34010 and FGFR1, rs13317 variants between patients with nonsyndromic cleft lip and/or cleft palate (NS-CL/P) and control subjects. Genotype combinations
CL/P patients n = 67 (%)
Control n = 74 (%)
Odds ratioa (95% CI)
P-value
rs34010/rs13317 CC/AA CC/AG CC/GG CA/AA CA/AG CA/GG AA/AA AA/AG AA/GG
29 16 3 29 8 2 9 3 1
17 8 0 47 21 1 3 3 0
1 (Reference) 1.185 (0.418–3.359) – 0.357 (0.167–0.764) 0.226 (0.082–0.621) 1.334 (0.105–16.99) 1.824 (0.428–7.769) 0.568 (0.102–3.170) –
– 0.750 – 0.008 0.004 0.824 0.416 0.519 –
a
(29.0) (16.0) (3.0) (29.0) (8.0) (2.0) (9.0) (3.0) (1.0)
(17.0) (8.0) (0) (47.0) (21.0) (1.0) (3.0) (3.0) (0)
Adjusted for Age and Sex
Table 4 Results from the Haplotype association analyses for FGF1, rs34010 and FGFR1, rs13317, in patients with nonsyndromic cleft lip and/or cleft palate (NS-CL/P) and control subjects. Haplotypea
CL/P patients (%)
Control (%)
OR (95% CI)
P-value
FGF1, rs34010/FGFR1, rs13317 A/A A/G C/A C/G
54 (0.274) 10.28(0.051) 106.28(0.531) 28.72(0.144)
65.28(0.326) 15.72(0.079) 101.72(0.509) 17.28(0.086)
0.777 0.635 1.096 1.773
0.249 0.270 0.648 0.073
a
All frequencies <0.03 were ignored in this analysis.
(0.506–1.194) (0.282–1.431) (0.740–1.622) (0.942–3.336)
Z. Rafiqdoost et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 731–736
4. Discussion NS-CL/P is a common birth defect, and the source of substantial morbidity and mortality worldwide [4]. Orofacial development is a precisely harmonized process of cell proliferation, differentiation, migration and apoptosis [7]. Craniofacial defects appear when the two halves of the craniofacies that form the hard palate and/or lip fail to fuse completely. Clefting is thought to be the result of a failure in correct FGF signaling, because FGFs are involved in at least three stages of development. The first is cranial neural crest (CNC) cell induction, which involves cells originating from the ectoderm overlying the dorsal ridges of the neural tube [12]. These cells migrate into the pharyngeal arches and populate the frontonasal, maxillary and mandibular primordia. These tissues are responsible for development of the majority of facial structures such as the jaw, lip and palate which their formation is directed particularly by FGF signaling [7,14]. In advancing development, FGF signaling is present in both the epithelia and mesenchyme and mediates the epithelial–mesenchymal interaction [28,29]. Epithelial–mesenchymal interaction is an important mechanism for initiation of organogenesis in the craniofacial area. Early orofacial epithelium expresses inductive signals to the underlying mesenchyme, which together undergo morphogenesis in response to the inducing signal and feeds back to the epithelium for further development [28]. Cleft palate in Fgf18/ mice has also suggested that FGF signaling plays a role in the epithelial–mesenchymal interactions that dictate fusion and maturation of the developing palate [14]. In the current study we investigated the impact of FGF1 rs34010 C/A and FGFR1 rs13317A/G polymorphisms on NS-CL/P risk. Our results demonstrated that the FGF1 rs34010 CA (in the codominant model) and CA + AA (in the dominant model) genotypes were associated with a reduced risk of NS-CL/P. The results indicated that individuals carrying the FGF1 rs34010 CA or CA + AA genotypes had a 0.29- and 0.36-fold, respectively, reduced risk of developing NS-CL/P compared to those carrying the CC genotype. Our findings highlight the protective role of FGF1 rs34010 C/A polymorphism against susceptibility to NS-CL/P in our population. In agreement with our findings, Nikopensius et al. [19] have found an association between FGF1 rs34010 C/A polymorphism and risk of NS-CL/P. They reported that the minor allele of the FGF1 rs34010 C/A polymorphism is associated with a 0.689-fold reduced risk of NS-CL/P in Northeastern European populations. Their study was the first report suggesting the implication of FGF1 in NS-CL/P susceptibility. On the other hand our study failed to find an association between FGFR1, rs13317 A/G polymorphism and risk of NS-CL/P. Our results corroborate the association data presented by Wan, W. et al. [30] in which no association between FGFR1 rs13317 variation and NS-CL/P risk was demonstrated. However, FGFR1, rs13317 A/G polymorphism was associated with the risk of some diseases such as ossification of the posterior longitudinal ligament [31], fracture non-union [32] and rotator cuff disease [33]. The FGF family consists of 22 members. FGF1 (or acidic FGF) and FGF2 (or basic FGF) are prototypical members of the FGF family [34]. Binding of FGFs to FGFRs results in dimerization of a receptor that activates the receptor tyrosine kinase domain by autophosphorylation [18]. FGFs and their cell surface receptors (FGFRs) make up a large and complex family of signaling molecules that play important roles in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion [35]. FGF-FGFR signaling is active during palatogenesis, and genetic FGF mutations have been shown to contribute to 5% of cases of NS-CL/P. In children with NSCL/P, mutations in FGFR1, FGFR2, FGFR3, and FGF8 have been
735
identified [6,28,36]. The SNP rs34010 is located in intron 2 of the FGF1 gene, a non-coding region of the FGF1 locus. Growing evidence has demonstrated that genetic variation in non-coding regions may affect transcription, because some portions of noncoding DNA bind to transcription factors that activate or repress gene expression. It has also been shown that transcriptional regulatory elements can be found near exon/intron boundaries, so that SNPs in these regions may affect gene splicing by introducing cryptic splicing sites, resulting in exon skipping. Therefore, the FGF1 intronic SNP, rs34010, may contribute to NS-CL/P susceptibility through altering the expression levels of the FGF1 gene [37]. In conclusion, our data highlights the protective role of FGF1 rs34010 C/A polymorphism against susceptibility to NS-CL/P in an Iranian population. Although recent years have witnessed substantial achievement in expanding the knowledge of genetic component contributing to NS-CL/P, the majority of genetic variants predisposing to nonsyndromic oral clefts are yet to be discovered. Our study is the first report suggesting the implication of FGF1 gene variation in NS-CL/P susceptibility in an Asian/Iranian population. In our study, the FGF1 variation deviated from HWE in the control group. Although there is no clear explanation for the deviation of HWE, it could be due to multiple reasons including the small sample size, genetic drift or consanguineous marriages, which are popular in this region of the country. In fact, the relatively small sample size of our study is one limitation of our study, and could be the main reason for lack of HWE in our population. Future research with larger samples from different ethnicities is required to validate our findings. Conflicting interests The authors declare that there is no conflict of interest to disclose. Acknowledgement This paper was funded from MSc thesis grant of ZR from the deputy for Research, Mashhad Azad University of Medical Sciences. References [1] B.M. Riley, M.A. Mansilla, J. Ma, S. Daack-Hirsch, B.S. Maher, L.M. Raffensperger, et al., Impaired FGF signaling contributes to cleft lip and palate, Proc. Natl. Acad. Sci. U. S. A. 104 (2007) 4512–4517. [2] L. Stuppia, M. Capogreco, G. Marzo, D. La Rovere, I. Antonucci, V. Gatta, et al., Genetics of syndromic and nonsyndromic cleft lip and palate, J. Craniofac. Surg. 22 (2011) 1722–1726. [3] F. Carinci, L. Scapoli, A. Palmieri, I. Zollino, F. Pezzetti, Human genetic factors in nonsyndromic cleft lip and palate: an update, Int. J. Pediatr. Otorhinolaryngol. 71 (2007) 1509–1519. [4] B.M. Riley, R.E. Schultz, M.E. Cooper, T. Goldstein-McHenry, S. Daack-Hirsch, K.T. Lee, et al., A genome-wide linkage scan for cleft lip and cleft palate identifies a novel locus on 8p 11–23, Am. J. Med. Genet. A 143A (2007) 846–852. [5] H. Rafighdoost, M. Hashemi, A. Narouei, E. Eskanadri-Nasab, G. Dashti-Khadivaki, M. Taheri, Association between CDH1 and MSX1 gene polymorphisms and the risk of nonsyndromic cleft lip and/or cleft palate in a southeast Iranian population, Cleft Palate Craniofac. J. 50 (2013) e98–e104. [6] P. Krejci, J. Prochazkova, V. Bryja, A. Kozubik, W.R. Wilcox, Molecular pathology of the fibroblast growth factor family, Hum. Mutat. 30 (2009) 1245–1255. [7] E. Pauws, P. Stanier, FGF signalling and SUMO modification: new players in the aetiology of cleft lip and/or palate, Trends Genet. 23 (2007) 631–640. [8] J. Albuisson, C. Pecheux, J.C. Carel, D. Lacombe, B. Leheup, P. Lapuzina, et al., Kallmann syndrome: 14 novel mutations in KAL1 and FGFR1 (KAL2), Hum. Mutat. 25 (2005) 98–99. [9] Y.R. Jin, X.H. Han, M.M. Taketo, J.K. Yoon, Wnt9b-dependent FGF signaling is crucial for outgrowth of the nasal and maxillary processes during upper jaw and lip development, Development 139 (2012) 1821–1830. [10] K. Fujiwara, T. Yamada, K. Mishima, H. Imura, T. Sugahara, Morphological and immunohistochemical studies on cleft palates induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin in mice, Congenit. Anom. (Kyoto) 48 (2008) 68–73. [11] X. Huang, S.L. Goudy, T. Ketova, Y. Litingtung, C. Chiang, Gli3-deficient mice exhibit cleft palate associated with abnormal tongue development, Dev. Dyn. 237 (2008) 3079–3087.
736
Z. Rafiqdoost et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 731–736
[12] R. Rice, B. Spencer-Dene, E.C. Connor, A. Gritli-Linde, A.P. McMahon, C. Dickson, et al., Disruption of Fgf10/Fgfr2b-coordinated epithelial-mesenchymal interactions causes cleft palate, J. Clin. Invest. 113 (2004) 1692–1700. [13] R. Menezes, A. Letra, J. Ruff, J.M. Granjeiro, A.R. Vieira, Studies of genes in the FGF signaling pathway and oral clefts with or without dental anomalies, Am. J. Med. Genet. A 146A (2008) 1614–1617. [14] A.K. Snyder-Warwick, C.A. Perlyn, J. Pan, K. Yu, L. Zhang, D.M. Ornitz, Analysis of a gain-of-function FGFR2 Crouzon mutation provides evidence of loss of function activity in the etiology of cleft palate, Proc. Natl. Acad. Sci. U. S. A. 107 (2010) 2515–2520. [15] A. Mostowska, K.K. Hozyasz, P. Wojcicki, B. Biedziak, P. Paradowska, P.P. Jagodzinski, Association between genetic variants of reported candidate genes or regions and risk of cleft lip with or without cleft palate in the polish population, Birth Defects Res. A Clin. Mol. Teratol. 88 (2010) 538–545. [16] H. Wang, T. Zhang, T. Wu, J.B. Hetmanski, I. Ruczinski, H. Schwender, et al., The FGF and FGFR gene family and risk of cleft lip with or without cleft palate, Cleft Palate Craniofac. J. 50 (2013) 96–103. [17] T. Nikopensius, T. Jagomagi, K. Krjutskov, V. Tammekivi, M. Saag, I. Prane, et al., Genetic variants in COL2A1, COL11A2, and IRF6 contribute risk to nonsyndromic cleft palate, Birth Defects Res. A Clin. Mol. Teratol. 88 (2010) 748–756. [18] M. Zakrzewska, E. Marcinkowska, A. Wiedlocha, FGF-1: from biology through engineering to potential medical applications, Crit. Rev. Clin. Lab. Sci. 45 (2008) 91–135. [19] T. Nikopensius, I. Kempa, L. Ambrozaityte, T. Jagomagi, M. Saag, A. Matuleviciene, et al., Variation in FGF1, FOXE1, and TIMP2 genes is associated with nonsyndromic cleft lip with or without cleft palate, Birth Defects Res. A Clin. Mol. Teratol. 91 (2011) 218–225. [20] M. Hashemi, A.K. Moazeni-Roodi, A. Fazaeli, M. Sandoughi, G.R. Bardestani, D.M. Kordi-Tamandani, et al., Lack of association between paraoxonase-1 Q192R polymorphism and rheumatoid arthritis in southeast Iran, Genet. Mol. Res. 9 (2010) 333–339. [21] M. Hashemi, A. Moazeni-Roodi, A. Bahari, M. Taheri, A tetra-primer amplification refractory mutation system-polymerase chain reaction for the detection of rs8099917 IL28B genotype, Nucleosides Nucleotides Nucleic Acids 31 (2012) 55–60. [22] M. Hashemi, A.K. Moazeni-Roodi, A. Fazaeli, M. Sandoughi, M. Taheri, G.R. Bardestani, et al., The L55M polymorphism of paraoxonase-1 is a risk factor for rheumatoid arthritis, Genet. Mol. Res. 9 (2010) 1735–1741. [23] M. Hashemi, H. Hoseini, P. Yaghmaei, A. Moazeni-Roodi, A. Bahari, N. Hashemzehi, et al., Association of polymorphisms in glutamate–cysteine ligase catalytic subunit and microsomal triglyceride transfer protein genes with nonalcoholic fatty liver disease, DNA Cell Biol. 30 (2011) 569–575.
[24] M. Hashemi, E. Eskandari-Nasab, A. Fazaeli, A. Bahari, N.A. Hashemzehi, S. Shafieipour, et al., Association of genetic polymorphisms of glutathione-S-transferase genes (GSTT1, GSTM1, and GSTP1) and susceptibility to nonalcoholic fatty liver disease in Zahedan, Southeast Iran, DNA Cell Biol. 31 (2012) 672–677. [25] S.S. Hasani, M. Hashemi, E. Eskandari-Nasab, M. Naderi, M. Omrani, M. SheybaniNasab, A functional polymorphism in the miR-146a gene is associated with the risk of childhood acute lymphoblastic leukemia: a preliminary report, Tumour Biol. (2013). [26] X. Sole, E. Guino, J. Valls, R. Iniesta, V. Moreno, SNPStats: a web tool for the analysis of association studies, Bioinformatics 22 (2006) 1928–1929. [27] R.C. Lewontin, The detection of linkage disequilibrium in molecular sequence data, Genetics 140 (1995) 377–388. [28] X. Nie, K. Luukko, P. Kettunen, FGF signalling in craniofacial development and developmental disorders, Oral Dis. 12 (2006) 102–111. [29] P.T. Nguyen, T. Tsunematsu, S. Yanagisawa, Y. Kudo, M. Miyauchi, N. Kamata, et al., The FGFR1 inhibitor PD173074 induces mesenchymal-epithelial transition through the transcription factor AP-1, Br. J. Cancer 109 (2013) 2248–2258. [30] W.D. Wan, S.L. Yang, J.Y. Liu, Y.G. Cui, X.P. Zhou, F.F. Guo, et al., Correlation of the SNPs of FGFR1, FGF10, FGF18 with nonsyndromic cleft lip with or without palate in Chinese population, Beijing Da Xue Xue Bao 41 (2009) 409–413. [31] J.K. Jun, S.M. Kim, Association study of fibroblast growth factor 2 and fibroblast growth factor receptors gene polymorphism in Korean ossification of the posterior longitudinal ligament patients, J. Korean Neurosurg. Soc. 52 (2012) 7–13. [32] J.M. Guimaraes, I.C. Guimaraes, M.E. Duarte, T. Vieira, V.F. Vianna, M.B. Fernandes, et al., Polymorphisms in BMP4 and FGFR1 genes are associated with fracture nonunion, J. Orthop. Res. 31 (2013) 1971–1979. [33] G.D. Motta, M.V. Amaral, E. Rezende, R. Pitta, T.C. Dos Santos Vieira, M.E. Duarte, et al., Evidence of genetic variations associated with rotator cuff disease, J. Shoulder Elbow Surg. 23 (2013) 227–235. [34] S. Kang, S.Z. Li, N. Wang, R.M. Zhou, T. Wang, D.J. Wang, et al., Association between genetic polymorphisms in fibroblast growth factor (FGF)1 and FGF2 and risk of endometriosis and adenomyosis in Chinese women, Hum. Reprod. 25 (2010) 1806–1811. [35] R. Jiang, J.O. Bush, A.C. Lidral, Development of the upper lip: morphogenetic and molecular mechanisms, Dev. Dyn. 235 (2006) 1152–1166. [36] P. Carinci, E. Becchetti, T. Baroni, F. Carinci, F. Pezzetti, G. Stabellini, et al., Extracellular matrix and growth factors in the pathogenesis of some craniofacial malformations, Eur. J. Histochem. (51 Suppl. 1) (2007) 105–115. [37] T.E. Rohan, S.Q. Li, R. Hartwick, Kandel RA, p53 Alterations and protein accumulation in benign breast tissue and breast cancer risk: a cohort study, Cancer Epidemiol. Biomarkers Prev. 15 (2006) 1316–1323.
Contents lists available at ScienceDirect
International Journal of Pediatric Otorhinolaryngology journal homepage: www.elsevier.com/locate/ijporl
Investigation of FGF1 and FGFR gene polymorphisms in a group of Iranian patients with nonsyndromic cleft lip with or without cleft palate Zahra Rafiqdoost a, Amir Rafiqdoost b, Houshang Rafiqdoost c, Mohammad Hashemi d, Jina Khayatzadeh a, Ebrahim Eskandari-Nasab d,* a
Department of Biology, Faculty of Science, Mashhad Branch, Islamic Azad University of Medical Sciences, Mashhad, Iran School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran c Department of Anatomy, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran d Department of Clinical Biochemistry, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 6 November 2013 Received in revised form 13 January 2014 Accepted 19 January 2014 Available online 27 January 2014
Objective: Nonsyndromic cleft lip with or without cleft palate (NS-CL/P) is one of the most common craniofacial malformations determined by the interaction between multiple genes and environmental risk factors. Genes coding for fibroblast growth factors and their receptors (FGF/FGFR genes) are considered as excellent candidate genes, which their proteins play important roles in craniofacial and palatal development. The aim of the current study was to assess the possible association between FGF1 rs34010 C>A and FGFR1 rs13317 A>G gene polymorphisms and susceptibility to NS-CL/P in an Iranian population. Design: This case–control retrospective study was performed on a total of 200 subjects including 100 NS-CL/P patients and 100 healthy unrelated controls. Tetra amplification refractory mutation systempolymerase chain reaction (T-ARMS-PCR) was used to detect FGF1 rs34010 C>A and FGFR1 rs13317 A>G SNPs. Results: Our data demonstrated that the FGF1 rs34010, CA and CA + AA genotypes were associated with a reduced risk of NS-CL/P the in codominant (CA vs. CC: OR = 0.29, 95%CI = 0.16–0.55, P = 0.001) and dominant (CA + AA vs. CC: OR = 0.36, 95%CI = 0.19–0.69, P = 0.001) tested inheritance models, respectively. Additionally, the analysis of FGF1/FGFR1 genotype combinations revealed that rs34010CA/rs13317AA and rs34010CA/rs13317AG combinations were associated with a lower risk of NS-CL/P (OR = 0.357, P = 0.008 for the rs34010CA/rs13317AA; OR = 0.226, P = 0.004 for the rs34010CA/ rs13317AG). Conclusions: Our findings suggest that the FGF1 rs34010 C/A polymorphism was associated with a decreased risk of NS-CL/P, and might act as a protective factor against NS-CL/P predisposition. ß 2014 Elsevier Ireland Ltd. All rights reserved.
Keywords: FGF1 FGFR1 Cleft lip and/or cleft palate Single nucleotide polymorphism
1. Introduction Clefts of the lip and/or palate (CL/P) are among the most common congenital birth defects worldwide [1]. Several signaling pathways, integrated into an intricate series of events under a rigorous control of expression network of developmental genes, are important in lip and palate development. Based on their association with particular malformative patterns or their occurrence as isolated defects, CL/P can be divided into syndromic or
* Corresponding author at: Department of Clinical Biochemistry, School of Medicine, Zahedan University of Medical Sciences, P.O. Box: 9861615881, Zahedan, Iran. Tel.: +98 9136326859; fax: +98 5413229792. E-mail address: [email protected] (E. Eskandari-Nasab). 0165-5876/$ – see front matter ß 2014 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.ijporl.2014.01.024
nonsyndromic, respectively. Both forms of CL/P are characterized by a strong genetic component. Syndromic forms are usually caused by chromosomal aberrations or monogenic diseases, whereas, nonsyndromic CL/P forms are derived by the interaction between genetic and environmental factors [2,3]. Isolated or nonsyndromic (without other associated abnormalities) CL/P (NS-CL/P) is a common congenitally developmental disorder affecting 1:700 births worldwide, although prevalence varies broadly based on geographic and socioeconomic status [4,5]. In general, Asian populations have a higher birth occurrence of clefting (1/500 births), Caucasians are intermediate (1/1000 births), and African populations have the lowest (1/2500 births). NS-CL/P patients frequently suffer major complications such as troubles with feeding, speech, hearing and psychologic maturation [2,6].
732
Z. Rafiqdoost et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 731–736
Thus far, several genome-wide association studies have recognized specific candidate genes and loci on chromosomal regions as a genetic risk factor for NS-CL/P [5]. Extensive research on DNA samples from NS-CL/P cases has shown the implication of mutations in FGF1, FGFR1, MSX1, PVRL1, TBX22 and IRF6 genes in the etiology of NS-CL/P [7]. Mammalian fibroblast growth factors (FGFs) (FGF1–FGF10 and FGF16–FGF23) control multiple developmental processes including craniofacial and palatal development (10). The biological activities of FGFs are conveyed by seven principal FGF receptor tyrosine kinases encoded by four distinct genes (FGFR1–FGFR4) [1]. It has been revealed that coordinated epithelial–mesenchymal interactions are essential during the initial stages of palate development and require an FGF signaling network, which mediates the epithelial–mesenchymal interaction involved in the development of palate and upper lip [8,9]. In addition, several lines of studies on animal models point to the involvement of FGFFGFR signaling in the pathogenesis of oral clefting [10,11]. Knockout mouse models for FGF10 and FGFR2b develop cleft palate, demonstrating the necessity of epithelial FGF signaling in normal palatogenesis. Cleft palate in FGF18/ mice has also signified the importance of the mesenchymal FGF signaling in palate development [12]. Sequencing of the coding region of genes in the FGF signaling pathway in NS-CLP cases revealed that missense and nonsense mutations in FGF genes might contribute to approximately 3–5% of NS-CLP [13]. Several case–control studies have also demonstrated the involvement of single nucleotide polymorphisms (SNPs) in FGF1, FGF3, FGF7, FGF8 and FGF10 in NS-CL/P predisposition [1,13– 17]. Additionally, mutations in FGFR1 have been shown to cause autosomal dominant Kallmann syndrome, which includes clefts in 30% of the cases. FGF1, one of the best characterized members of the FGF superfamily, is a powerful mitogen exhibiting strong action on numerous different cell types. It plays a role in various stages of embryonic development and morphogenesis, as well as in angiogenesis and wound healing processes [7,18]. The FGF1 gene is localized on chromosome 5q31.3–33.2 spanning more than 100 kb and contains three protein-coding exons. Recently, the FGF1 rs34010 C>A has shown evidence of association with susceptibility to NS-CL/P in Northeastern European populations [19]. Considering the crucial roles of FGF1 and FGFR1 in craniofacial development, any genetic variation causing disruption of the FGFFGFR signaling pathway may contribute to susceptibility to NS-CL/ P. Therefore, the present study aimed to evaluate the possible association between FGF1 rs34010 C>A and FGFR1 rs13317 A>G polymorphisms and susceptibility to NS-CL/P in an Iranian population.
Table 1 Primers sequence for detection of FGF1, rs34010 C/A and FGFR1, rs13317 A/G gene polymorphisms. Primer sequence (5–3)
Amplicons size
FGF1, rs34010 C>A Forward outer Reverse outer Forward inner (A) Reverse inner (C)
GGCCTCTACCCACTAGATGCCAGTAG CTGCTTTCATTATCAACCTGCACAGG GGAAACTTCATTGTGAGGGAGTCCA ACTGGTTGCCACATATGAAACTCAGG
428 bp
FGFR1, rs13317 A>G Forward outer Reverse outer Forward inner (A) Reverse inner (G)
AAAATGCAAAAATTATCCAGGCATGGTGG TGTAAGAAGCCAAGATCTGCGACAGTCC CCCTCTATGTGGGCATGGTTTTGACA GACATGTTCTCCTGCACTTAGAAGCCCC
390 bp
197 bp 281 bp
184 bp 260 bp
respectively) were obtained from the National Center for Biotechnology Information (NCBI). The polymorphisms were searched and primers for T-ARMS-PCR were designed (Table 1). The T-ARMS-PCR method uses two external primers (control band) and two inner primers (allele specific primers). This method simultaneously amplifies both alleles in one single-PCR tube. All primer sequences and fragments size are listed in Table 1. PCR was performed using commercially available Prime Taq premix (Genetbio, South Korea) according to the manufacturer recommended protocol. Into a 0.2-mL PCR tube with a final volume of 20 mL, 1 mL of template DNA (100 ng/mL), 0.7 mL of each primer (10 mM), 10 mL Taq premix and 6 mL DNase-free water were added. The cycling conditions for FGF1 rs34010 were an initial denaturation at 95 8C for 5 min followed by 30 cycles of 30 s at 95 8C, annealing temperature for 25 s at 58 8C and 30 s at 72 8C, with a final extension of 10 min at 72 8C. The PCR conditions for FGFR1 rs13317 polymorphism were 5 min at 95 8C followed by 30 cycles of 95 8C for 30 s, 60 8C for 27 s, 72 8C for 30 s followed by a final extension step for 10 min at 72 8C. PCR products were separated by standard electrophoresis on a 2% agarose gel containing 0.5 mg/ml ethidium bromide and visualized by transillumination with UV light. The products size for FGF1 rs34010 were 197 bp for A allele and 281 bp for C allele, while the product size for the two outer primers (control band) was 428 bp (Fig. 1). The amplicons size for the FGFR1 rs13317 were 184 bp for the A allele, 260 bp for the G allele and 390 bp for the control outer band (Fig. 2). The accuracy the PCR used for genotyping of both SNPs was examined by direct sequencing of the outer bands of FGF1 and FGFR1 polymorphisms. As shown in Fig. 3, the genotypes determined by T-ARMS-PCR method were completely concordant with those determined by sequencing. 2.1. Statistical analysis The statistical analyses of the data were done using the SPSS 18.0 software (SPSS Inc., Chicago IL, USA). The association between
2. Materials and methods The local Ethics Committee of the Zahedan University of Medical Sciences approved the project, and written informed consent was taken from all participants. Blood samples were collected in EDTA containing tubes from patients and healthy controls and stored at 20 8C until DNA extraction. Genomic DNA was extracted from the peripheral blood leukocytes by the ‘saltingout’ method as described previously [20]. The quality of the isolated DNA was checked by electrophoresis on 1% agarose gel, quantitated spectrophotometrically and stored at 20 8C till further use. For detection of FGF1 rs34010 and FGFR1 rs13317 polymorphisms, we performed tetra-ARMS-PCR, which has been established as a simple and rapid method for detection of SNPs [21–25]. The FGF1and FGFR1 genomic sequences (NT_029289.11 and NT_167187.1,
SNPs
[(Fig._1)TD$IG]
Fig. 1. Photograph of the PCR products of FGF1 rs34010 C>A polymorphism using TARMS-PCR method. The products size were: 197 bp for A allele, 281 bp for C allele and 428 bp for the outer (control) band. M: DNA marker; Lanes 1, 3: rs34010 CA; Lanes 2: rs34010 CC; Lane 4, 5: rs34010 AA.
[(Fig._2)TD$IG]
Z. Rafiqdoost et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 731–736
Fig. 2. Representative T-ARMS-PCR products to detect the FGFR1, rs13317 A>G polymorphism. The PCR products were 181 bp for A allele, 260 bp for G allele and 390 bp for the outer (control) band. M: DNA marker; Lanes 1, 4: rs13317 AG; Lanes 2: rs13317 AA; Lane 3: rs13317 GG.
genotypes and NS-CL/P was assessed by computing the odds ratio (OR) and 95% confidence intervals (95%CI) from logistic regression analyses. P-values below 0.05 were defined statistically significant. The Hardy–Weinberg equilibrium was tested with the x2 test for any of the SNPs under consideration. Linkage disequilibrium (LD) and frequencies of haplotypes in the controls and patients were estimated using SNPStats software [26]. 3. Results In this case–control retrospective study, a total of 200 subjects including 100 CL/P patients (61 male and 39 female) with an average age of 12.12 years (range: 1–54 y) and 100 normal subjects (61 male and 39 female) with an average age of 12.03 years (range:
733
1–51 y) were included. There was no significant difference between the groups regarding sex and age (P > 0.05). All participants were unrelated to each other. Of a total of 100 patients, 43 were cleft lip (CL), 26 were cleft lip with cleft palate (CLP) and 31 were cleft palate (CP). The frequencies of all SNPs were in Hardy–Weinberg equilibrium (HWE) in cases and controls (P > 0.05), except for the HWE of the FGF1, rs34010 SNP in the control group (P < 0.05). The distribution of genotype and allele frequencies of FGF1 and FGFR1 were shown in Table 2. A significant difference was observed between NS-CL/P patients and control group regarding FGF1 rs34010 polymorphism in the codominant and dominant tested inheritance models. In the codominant model, the FGF1 rs34010 CA genotype with a remarkably increased frequency in controls compared to CL/P patients (69% vs. 39%) was associated with a reduced risk of NS-CL/P (OR = 0.29, 95%CI = 0.16–0.55, P = 0.001). Additionally, in the dominant model, the CA + AA genotype was more frequent in the control group than in the cases (75% vs. 52%) and was a protective factor against NS-CL/P (OR = 0.36, 95%CI = 0.19–0.69, P = 0.001). However, allele frequency of rs34010 variation was not significantly different between NSCL/P patients and the control group (OR = 0.71, 95%CI = 0.46–1.09, P = 0.097). With respect to FGFR1, rs13317 A>G variant, we did not find any disparity between genotype frequencies of the variation in patients and controls in codominant, dominant and recessive tested inheritance models. Besides, the allele frequency of rs13317 G variant in NS-CL/P patients was similar to those observed in the control group (19.5% and 17% in cases and controls, respectively) and was not associated to NS-CL/P (OR = 1.18, 95% CI = 0.69–2.03, P = 0.517).
[(Fig._3)TD$IG]
Fig. 3. Sequencing analysis for the FGF1 and FGFR1 polymorphisms: A1, A2 and A3 are representatives of the FGF1 rs34010 AA, AC and CC genotypes, respectively. B1, B2 and B3 represent the FGFR1 rs13317 AA, AG and GG genotypes, respectively.
Z. Rafiqdoost et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 731–736
734
Table 2 The genotype and allele frequencies of FGF1 and FGFR1 SNPs between patients with nonsyndromic cleft lip and/or cleft palate (NS-CL/P) and control subjects. Polymorphism FGF1, rs34010 C>A Codominant CC CA AA Dominant CC CA + AA Recessive CC + CA AA Alleles C A FGFR1, rs13317 A>G Codominant AA AG GG Dominant AA AG + GG Recessive AA + AG GG Alleles A G
CL/P Patients n (%)
Controls n (%)
Odd Ratio (95%CI)
P-value
48 (48.0) 39(39.0) 13 (13.0)
25 (25.0) 69 (69.0) 6 (6.0)
1.00 0.29 (0.16–0.55) 1.13 (0.383–3.33)
– 0.001 0.827
48 (48.0) 52 (52.0)
25 (25.0) 75 (75.0)
1.00 0.36 (0.19–0.69)
– 0.001
87 (87.0) 13 (13.0)
94 (94.0) 6 (6.0)
1.00 2.34 (0.78–7.27)
– 0.091
135 (67.5) 65 (32.5)
119 (59.5) 81 (40.5)
1.00 0.71 (0.46–1.09)
– 0.097
67 (67.0) 27 (27.0) 6 (6.0)
67 (67.0) 32 (32.0) 1 (1.0)
1.00 0.84 (0.46–1.56) 6.00 (0.70–51.2)
– 0.588 0.101
67 (67.0) 33 (33.0)
67 (67.0) 33 (33.0)
1.00 0.99 (0.53–1.88)
– 0.999
94 (94.0) 6 (6.0)
99 (99.0) 1 (1.0)
1.00 6.31 (0.73–141.9)
– 0.054
161 (80.5) 39 (19.5)
166 (83.0) 34 (17.0)
1.00 1.18 (0.69–2.03)
– 0.517
3.1. LD and haplotype and genotype combination analysis of FGF1 and FGFR1 polymorphisms LD was tested by calculating Lewontin’s Delta0 coefficient and the correlation coefficient r2 [27]. Pairwise LD between the SNPs in FGF1 (rs34010) and FGFR1 (rs13317) was calculated for the cases and controls. The LD analysis of the FGF1, rs34010 and FGFR1, rs13317 SNPs demonstrated incomplete LD for the two SNPs in controls and NS-CL/P patients (rs34010/rs13317, D0 = 0.101, r2 = 0.001). Table 3 demonstrates the frequency of each genotype combination in NS-CL/P patients and controls. Two genotype
combinations, rs34010CA/rs13317AA and rs34010CA/rs13317AG, were more prevalent in healthy controls compared to NS-CL/P patients and were associated with a reduced risk of NS-CL/P (OR = 0.357, 95%CI: 0.167–0.764, P = 0.008 for the rs34010CA/ rs13317AA; OR = 0.226, 95%CI: 0.082–0.621, P = 0.004 for the rs34010CA/rs13317AG), However, no significant differences in the frequencies of subjects carrying other genotype combinations were observed between patients and controls (P > 0.05). Moreover, the Table 4 shows haplotype association analyses for FGF rs34010 C/A and FGFR1 rs13317A/G in NS-CL/P patients and controls, but no association between haplotypes and risk of NS-CL/P was found (P > 0.05).
Table 3 Distribution of genotype combinations for the FGF1, rs34010 and FGFR1, rs13317 variants between patients with nonsyndromic cleft lip and/or cleft palate (NS-CL/P) and control subjects. Genotype combinations
CL/P patients n = 67 (%)
Control n = 74 (%)
Odds ratioa (95% CI)
P-value
rs34010/rs13317 CC/AA CC/AG CC/GG CA/AA CA/AG CA/GG AA/AA AA/AG AA/GG
29 16 3 29 8 2 9 3 1
17 8 0 47 21 1 3 3 0
1 (Reference) 1.185 (0.418–3.359) – 0.357 (0.167–0.764) 0.226 (0.082–0.621) 1.334 (0.105–16.99) 1.824 (0.428–7.769) 0.568 (0.102–3.170) –
– 0.750 – 0.008 0.004 0.824 0.416 0.519 –
a
(29.0) (16.0) (3.0) (29.0) (8.0) (2.0) (9.0) (3.0) (1.0)
(17.0) (8.0) (0) (47.0) (21.0) (1.0) (3.0) (3.0) (0)
Adjusted for Age and Sex
Table 4 Results from the Haplotype association analyses for FGF1, rs34010 and FGFR1, rs13317, in patients with nonsyndromic cleft lip and/or cleft palate (NS-CL/P) and control subjects. Haplotypea
CL/P patients (%)
Control (%)
OR (95% CI)
P-value
FGF1, rs34010/FGFR1, rs13317 A/A A/G C/A C/G
54 (0.274) 10.28(0.051) 106.28(0.531) 28.72(0.144)
65.28(0.326) 15.72(0.079) 101.72(0.509) 17.28(0.086)
0.777 0.635 1.096 1.773
0.249 0.270 0.648 0.073
a
All frequencies <0.03 were ignored in this analysis.
(0.506–1.194) (0.282–1.431) (0.740–1.622) (0.942–3.336)
Z. Rafiqdoost et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 731–736
4. Discussion NS-CL/P is a common birth defect, and the source of substantial morbidity and mortality worldwide [4]. Orofacial development is a precisely harmonized process of cell proliferation, differentiation, migration and apoptosis [7]. Craniofacial defects appear when the two halves of the craniofacies that form the hard palate and/or lip fail to fuse completely. Clefting is thought to be the result of a failure in correct FGF signaling, because FGFs are involved in at least three stages of development. The first is cranial neural crest (CNC) cell induction, which involves cells originating from the ectoderm overlying the dorsal ridges of the neural tube [12]. These cells migrate into the pharyngeal arches and populate the frontonasal, maxillary and mandibular primordia. These tissues are responsible for development of the majority of facial structures such as the jaw, lip and palate which their formation is directed particularly by FGF signaling [7,14]. In advancing development, FGF signaling is present in both the epithelia and mesenchyme and mediates the epithelial–mesenchymal interaction [28,29]. Epithelial–mesenchymal interaction is an important mechanism for initiation of organogenesis in the craniofacial area. Early orofacial epithelium expresses inductive signals to the underlying mesenchyme, which together undergo morphogenesis in response to the inducing signal and feeds back to the epithelium for further development [28]. Cleft palate in Fgf18/ mice has also suggested that FGF signaling plays a role in the epithelial–mesenchymal interactions that dictate fusion and maturation of the developing palate [14]. In the current study we investigated the impact of FGF1 rs34010 C/A and FGFR1 rs13317A/G polymorphisms on NS-CL/P risk. Our results demonstrated that the FGF1 rs34010 CA (in the codominant model) and CA + AA (in the dominant model) genotypes were associated with a reduced risk of NS-CL/P. The results indicated that individuals carrying the FGF1 rs34010 CA or CA + AA genotypes had a 0.29- and 0.36-fold, respectively, reduced risk of developing NS-CL/P compared to those carrying the CC genotype. Our findings highlight the protective role of FGF1 rs34010 C/A polymorphism against susceptibility to NS-CL/P in our population. In agreement with our findings, Nikopensius et al. [19] have found an association between FGF1 rs34010 C/A polymorphism and risk of NS-CL/P. They reported that the minor allele of the FGF1 rs34010 C/A polymorphism is associated with a 0.689-fold reduced risk of NS-CL/P in Northeastern European populations. Their study was the first report suggesting the implication of FGF1 in NS-CL/P susceptibility. On the other hand our study failed to find an association between FGFR1, rs13317 A/G polymorphism and risk of NS-CL/P. Our results corroborate the association data presented by Wan, W. et al. [30] in which no association between FGFR1 rs13317 variation and NS-CL/P risk was demonstrated. However, FGFR1, rs13317 A/G polymorphism was associated with the risk of some diseases such as ossification of the posterior longitudinal ligament [31], fracture non-union [32] and rotator cuff disease [33]. The FGF family consists of 22 members. FGF1 (or acidic FGF) and FGF2 (or basic FGF) are prototypical members of the FGF family [34]. Binding of FGFs to FGFRs results in dimerization of a receptor that activates the receptor tyrosine kinase domain by autophosphorylation [18]. FGFs and their cell surface receptors (FGFRs) make up a large and complex family of signaling molecules that play important roles in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion [35]. FGF-FGFR signaling is active during palatogenesis, and genetic FGF mutations have been shown to contribute to 5% of cases of NS-CL/P. In children with NSCL/P, mutations in FGFR1, FGFR2, FGFR3, and FGF8 have been
735
identified [6,28,36]. The SNP rs34010 is located in intron 2 of the FGF1 gene, a non-coding region of the FGF1 locus. Growing evidence has demonstrated that genetic variation in non-coding regions may affect transcription, because some portions of noncoding DNA bind to transcription factors that activate or repress gene expression. It has also been shown that transcriptional regulatory elements can be found near exon/intron boundaries, so that SNPs in these regions may affect gene splicing by introducing cryptic splicing sites, resulting in exon skipping. Therefore, the FGF1 intronic SNP, rs34010, may contribute to NS-CL/P susceptibility through altering the expression levels of the FGF1 gene [37]. In conclusion, our data highlights the protective role of FGF1 rs34010 C/A polymorphism against susceptibility to NS-CL/P in an Iranian population. Although recent years have witnessed substantial achievement in expanding the knowledge of genetic component contributing to NS-CL/P, the majority of genetic variants predisposing to nonsyndromic oral clefts are yet to be discovered. Our study is the first report suggesting the implication of FGF1 gene variation in NS-CL/P susceptibility in an Asian/Iranian population. In our study, the FGF1 variation deviated from HWE in the control group. Although there is no clear explanation for the deviation of HWE, it could be due to multiple reasons including the small sample size, genetic drift or consanguineous marriages, which are popular in this region of the country. In fact, the relatively small sample size of our study is one limitation of our study, and could be the main reason for lack of HWE in our population. Future research with larger samples from different ethnicities is required to validate our findings. Conflicting interests The authors declare that there is no conflict of interest to disclose. Acknowledgement This paper was funded from MSc thesis grant of ZR from the deputy for Research, Mashhad Azad University of Medical Sciences. References [1] B.M. Riley, M.A. Mansilla, J. Ma, S. Daack-Hirsch, B.S. Maher, L.M. Raffensperger, et al., Impaired FGF signaling contributes to cleft lip and palate, Proc. Natl. Acad. Sci. U. S. A. 104 (2007) 4512–4517. [2] L. Stuppia, M. Capogreco, G. Marzo, D. La Rovere, I. Antonucci, V. Gatta, et al., Genetics of syndromic and nonsyndromic cleft lip and palate, J. Craniofac. Surg. 22 (2011) 1722–1726. [3] F. Carinci, L. Scapoli, A. Palmieri, I. Zollino, F. Pezzetti, Human genetic factors in nonsyndromic cleft lip and palate: an update, Int. J. Pediatr. Otorhinolaryngol. 71 (2007) 1509–1519. [4] B.M. Riley, R.E. Schultz, M.E. Cooper, T. Goldstein-McHenry, S. Daack-Hirsch, K.T. Lee, et al., A genome-wide linkage scan for cleft lip and cleft palate identifies a novel locus on 8p 11–23, Am. J. Med. Genet. A 143A (2007) 846–852. [5] H. Rafighdoost, M. Hashemi, A. Narouei, E. Eskanadri-Nasab, G. Dashti-Khadivaki, M. Taheri, Association between CDH1 and MSX1 gene polymorphisms and the risk of nonsyndromic cleft lip and/or cleft palate in a southeast Iranian population, Cleft Palate Craniofac. J. 50 (2013) e98–e104. [6] P. Krejci, J. Prochazkova, V. Bryja, A. Kozubik, W.R. Wilcox, Molecular pathology of the fibroblast growth factor family, Hum. Mutat. 30 (2009) 1245–1255. [7] E. Pauws, P. Stanier, FGF signalling and SUMO modification: new players in the aetiology of cleft lip and/or palate, Trends Genet. 23 (2007) 631–640. [8] J. Albuisson, C. Pecheux, J.C. Carel, D. Lacombe, B. Leheup, P. Lapuzina, et al., Kallmann syndrome: 14 novel mutations in KAL1 and FGFR1 (KAL2), Hum. Mutat. 25 (2005) 98–99. [9] Y.R. Jin, X.H. Han, M.M. Taketo, J.K. Yoon, Wnt9b-dependent FGF signaling is crucial for outgrowth of the nasal and maxillary processes during upper jaw and lip development, Development 139 (2012) 1821–1830. [10] K. Fujiwara, T. Yamada, K. Mishima, H. Imura, T. Sugahara, Morphological and immunohistochemical studies on cleft palates induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin in mice, Congenit. Anom. (Kyoto) 48 (2008) 68–73. [11] X. Huang, S.L. Goudy, T. Ketova, Y. Litingtung, C. Chiang, Gli3-deficient mice exhibit cleft palate associated with abnormal tongue development, Dev. Dyn. 237 (2008) 3079–3087.
736
Z. Rafiqdoost et al. / International Journal of Pediatric Otorhinolaryngology 78 (2014) 731–736
[12] R. Rice, B. Spencer-Dene, E.C. Connor, A. Gritli-Linde, A.P. McMahon, C. Dickson, et al., Disruption of Fgf10/Fgfr2b-coordinated epithelial-mesenchymal interactions causes cleft palate, J. Clin. Invest. 113 (2004) 1692–1700. [13] R. Menezes, A. Letra, J. Ruff, J.M. Granjeiro, A.R. Vieira, Studies of genes in the FGF signaling pathway and oral clefts with or without dental anomalies, Am. J. Med. Genet. A 146A (2008) 1614–1617. [14] A.K. Snyder-Warwick, C.A. Perlyn, J. Pan, K. Yu, L. Zhang, D.M. Ornitz, Analysis of a gain-of-function FGFR2 Crouzon mutation provides evidence of loss of function activity in the etiology of cleft palate, Proc. Natl. Acad. Sci. U. S. A. 107 (2010) 2515–2520. [15] A. Mostowska, K.K. Hozyasz, P. Wojcicki, B. Biedziak, P. Paradowska, P.P. Jagodzinski, Association between genetic variants of reported candidate genes or regions and risk of cleft lip with or without cleft palate in the polish population, Birth Defects Res. A Clin. Mol. Teratol. 88 (2010) 538–545. [16] H. Wang, T. Zhang, T. Wu, J.B. Hetmanski, I. Ruczinski, H. Schwender, et al., The FGF and FGFR gene family and risk of cleft lip with or without cleft palate, Cleft Palate Craniofac. J. 50 (2013) 96–103. [17] T. Nikopensius, T. Jagomagi, K. Krjutskov, V. Tammekivi, M. Saag, I. Prane, et al., Genetic variants in COL2A1, COL11A2, and IRF6 contribute risk to nonsyndromic cleft palate, Birth Defects Res. A Clin. Mol. Teratol. 88 (2010) 748–756. [18] M. Zakrzewska, E. Marcinkowska, A. Wiedlocha, FGF-1: from biology through engineering to potential medical applications, Crit. Rev. Clin. Lab. Sci. 45 (2008) 91–135. [19] T. Nikopensius, I. Kempa, L. Ambrozaityte, T. Jagomagi, M. Saag, A. Matuleviciene, et al., Variation in FGF1, FOXE1, and TIMP2 genes is associated with nonsyndromic cleft lip with or without cleft palate, Birth Defects Res. A Clin. Mol. Teratol. 91 (2011) 218–225. [20] M. Hashemi, A.K. Moazeni-Roodi, A. Fazaeli, M. Sandoughi, G.R. Bardestani, D.M. Kordi-Tamandani, et al., Lack of association between paraoxonase-1 Q192R polymorphism and rheumatoid arthritis in southeast Iran, Genet. Mol. Res. 9 (2010) 333–339. [21] M. Hashemi, A. Moazeni-Roodi, A. Bahari, M. Taheri, A tetra-primer amplification refractory mutation system-polymerase chain reaction for the detection of rs8099917 IL28B genotype, Nucleosides Nucleotides Nucleic Acids 31 (2012) 55–60. [22] M. Hashemi, A.K. Moazeni-Roodi, A. Fazaeli, M. Sandoughi, M. Taheri, G.R. Bardestani, et al., The L55M polymorphism of paraoxonase-1 is a risk factor for rheumatoid arthritis, Genet. Mol. Res. 9 (2010) 1735–1741. [23] M. Hashemi, H. Hoseini, P. Yaghmaei, A. Moazeni-Roodi, A. Bahari, N. Hashemzehi, et al., Association of polymorphisms in glutamate–cysteine ligase catalytic subunit and microsomal triglyceride transfer protein genes with nonalcoholic fatty liver disease, DNA Cell Biol. 30 (2011) 569–575.
[24] M. Hashemi, E. Eskandari-Nasab, A. Fazaeli, A. Bahari, N.A. Hashemzehi, S. Shafieipour, et al., Association of genetic polymorphisms of glutathione-S-transferase genes (GSTT1, GSTM1, and GSTP1) and susceptibility to nonalcoholic fatty liver disease in Zahedan, Southeast Iran, DNA Cell Biol. 31 (2012) 672–677. [25] S.S. Hasani, M. Hashemi, E. Eskandari-Nasab, M. Naderi, M. Omrani, M. SheybaniNasab, A functional polymorphism in the miR-146a gene is associated with the risk of childhood acute lymphoblastic leukemia: a preliminary report, Tumour Biol. (2013). [26] X. Sole, E. Guino, J. Valls, R. Iniesta, V. Moreno, SNPStats: a web tool for the analysis of association studies, Bioinformatics 22 (2006) 1928–1929. [27] R.C. Lewontin, The detection of linkage disequilibrium in molecular sequence data, Genetics 140 (1995) 377–388. [28] X. Nie, K. Luukko, P. Kettunen, FGF signalling in craniofacial development and developmental disorders, Oral Dis. 12 (2006) 102–111. [29] P.T. Nguyen, T. Tsunematsu, S. Yanagisawa, Y. Kudo, M. Miyauchi, N. Kamata, et al., The FGFR1 inhibitor PD173074 induces mesenchymal-epithelial transition through the transcription factor AP-1, Br. J. Cancer 109 (2013) 2248–2258. [30] W.D. Wan, S.L. Yang, J.Y. Liu, Y.G. Cui, X.P. Zhou, F.F. Guo, et al., Correlation of the SNPs of FGFR1, FGF10, FGF18 with nonsyndromic cleft lip with or without palate in Chinese population, Beijing Da Xue Xue Bao 41 (2009) 409–413. [31] J.K. Jun, S.M. Kim, Association study of fibroblast growth factor 2 and fibroblast growth factor receptors gene polymorphism in Korean ossification of the posterior longitudinal ligament patients, J. Korean Neurosurg. Soc. 52 (2012) 7–13. [32] J.M. Guimaraes, I.C. Guimaraes, M.E. Duarte, T. Vieira, V.F. Vianna, M.B. Fernandes, et al., Polymorphisms in BMP4 and FGFR1 genes are associated with fracture nonunion, J. Orthop. Res. 31 (2013) 1971–1979. [33] G.D. Motta, M.V. Amaral, E. Rezende, R. Pitta, T.C. Dos Santos Vieira, M.E. Duarte, et al., Evidence of genetic variations associated with rotator cuff disease, J. Shoulder Elbow Surg. 23 (2013) 227–235. [34] S. Kang, S.Z. Li, N. Wang, R.M. Zhou, T. Wang, D.J. Wang, et al., Association between genetic polymorphisms in fibroblast growth factor (FGF)1 and FGF2 and risk of endometriosis and adenomyosis in Chinese women, Hum. Reprod. 25 (2010) 1806–1811. [35] R. Jiang, J.O. Bush, A.C. Lidral, Development of the upper lip: morphogenetic and molecular mechanisms, Dev. Dyn. 235 (2006) 1152–1166. [36] P. Carinci, E. Becchetti, T. Baroni, F. Carinci, F. Pezzetti, G. Stabellini, et al., Extracellular matrix and growth factors in the pathogenesis of some craniofacial malformations, Eur. J. Histochem. (51 Suppl. 1) (2007) 105–115. [37] T.E. Rohan, S.Q. Li, R. Hartwick, Kandel RA, p53 Alterations and protein accumulation in benign breast tissue and breast cancer risk: a cohort study, Cancer Epidemiol. Biomarkers Prev. 15 (2006) 1316–1323.