- Email: [email protected]
Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Digitaria sanguinalis L.) from China
YPEST-04011; No of Pages 6 Pesticide Biochemistry and Physiology xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest
Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Digitaria sanguinalis L.) from China Yu Mei, Chong Si, Mingjie Liu, Lihong Qiu, Mingqi Zheng ⁎ Department of Applied Chemistry, China Agricultural University, No. 2 of Yuan Ming Yuan Xilu, Haidian District, Beijing 100193, China
a r t i c l e
i n f o
Article history: Received 9 September 2016 Received in revised form 24 November 2016 Accepted 5 December 2016 Available online xxxx Keywords: Large crabgrass Nicosulfuron Acetolactate synthase Non-target-site based resistance
a b s t r a c t Large crabgrass is a major grass weed widely distributed across China. This weed infests maize fields and has evolved resistance to the acetolactate synthase (ALS)-inhibiting herbicide nicosulfuron due to continuous and intensive use. In this study, a total of 25 out of 26 large crabgrass populations collected from maize field demonstrated resistance to nicosulfuron. Amino acid modifications in ALS known to confer resistance to ALSinhibiting herbicides in other weeds, were not found in the 9 tested resistant populations. The P450 inhibitor malathion significantly reversed resistance to nicosulfuron in 3 tested populations, indicating one or more P450s may be involved. Nicosulfuron was metabolized more rapidly in one resistant large crabgrass population than in a susceptible biotype. This demonstrates that the metabolic resistance mechanisms involving one or more P450s may be responsible for large crabgrass resistance to nicosulfuron in this biotype. © 2016 Published by Elsevier Inc.
1. Introduction Agricultural weeds have always been the major cause of crop loss by competing with crop plants for nutrients, water, light and space. Herbicides are often considered to be the most effective way of controlling weeds. However, weed species can evolve resistance to herbicides under persistent and intensive herbicide selection. To date, 250 weed species in 65 countries have evolved resistance to most major herbicides across most modes of action [1]. Two types of mechanisms, target-site based resistance (TSR) and non-target-site based resistance (NTSR) mechanisms, are involved in resistance evolution. TSR is endowed by amino acid substitutions in the herbicide target protein that may change the activity or structure of target enzymes. These alterations can cause an increase in the expression or in the intrinsic activity of the herbicide target protein that compensates for the herbicide inhibitory action, or a decrease in the affinity of the herbicide for its target [2]. NTSR is conferred by any mechanisms that are not TSR, such as reduced herbicide dose reaching the target-site by decreasing herbicide penetration/translocation into plant or increasing rates of herbicide metabolism/sequestration [2,3]. One important NTSR is mediated by enhanced rates of herbicide metabolism (here in after referred to as metabolic resistance) often involving cytochrome P450 monooxygenase
⁎ Corresponding author. E-mail address: [email protected] (M. Zheng).
(thereafter referred to as P450), ABC transporters, glutathione S-transferase (GST), glycosyltransferase (GT) [4–7]. The herbicides that target acetolactate synthase (ALS), collectively named as ALS-inhibiting herbicides, can be grouped into sulfonylurea (SU), imidazolinone (IMI), triazolopyrimidine (TP), pyrimidinylthiobenzoate (PTB), sulfonylamino-carbonyl-triazolinone (SCT) according their chemical structures. The TSR mechanism for ALS-inhibiting herbicides is due to amino acid substitution in ALS enzyme. To date, twenty-eight amino acid substitutions (numbers of amino acid in parentheses) in ALS endowing ALS herbicides resistance have been identified at sites of Ala122 (3), Pro197 (13), Ala205 (2), Asp 376(1), Arg377 (1), Trp574 (3), Ser653 (3) and Gly654 (2) in weed species [1,3,8]. In addition, NTSR mechanisms were also found to endow resistance to ALS-inhibiting herbicides [7,9–10]. However, compared with TSR mechanisms, the NTSR are less investigated and remain poorly understood due to its complexity and diversity. Large crabgrass is one of the most problematic weeds of maize fields in China. Control of this species has relied on the ALSinhibiting herbicide nicosulfuron since the 1980s. Farmers in China have reported the efficacy of nicosulfuron on large crabgrass has reduced greatly recently. In order to sustain herbicide efficacy to achieve effective weed controlling, it is necessary not only to be able to quickly detect the presence of resistant plants in a field, but also to identify underlying resistance mechanisms. The objectives of this study were to (1) determine the resistance levels to nicosulfuron of different large crabgrass populations from China; (2) identify any amino acid mutations in ALS known to confer
http://dx.doi.org/10.1016/j.pestbp.2016.12.002 0048-3575/© 2016 Published by Elsevier Inc.
Please cite this article as: Y. Mei, et al., Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Di..., Pesticide Biochemistry and Physiology (2016), http://dx.doi.org/10.1016/j.pestbp.2016.12.002
2
Y. Mei et al. / Pesticide Biochemistry and Physiology xxx (2016) xxx–xxx
Table 1 Geographical origin of large crabgrass populations used in this study. Population
Location
Co-ordinate
BJ02 SD03 SD04 SD05 SD06 SD07 SD08 SD09 SD10 SD11 SD12 SD13 SD15 SD17 SD18 SD21 SX01 SX02 SX03 SX04 SX06 SX07 LN02 LN04 LN08 LN09 SXH01
Haidian, Beijing Liaocheng, Shandong Liaocheng, Shandong Taian, Shandong Taian, Shandong Jining, Shandong Jining, Shandong Taian, Shandong Linyi, Shandong Weifang, Shandong Weifang, Shandong Weifang, Shandong Qingdao, Shandong Yantai, Shandong Yantai, Shandong Yantai, Shandong Jinzhong, Shanxi Jinzhong, Shanxi Linfen, Shanxi Linfen, Shanxi Yuncheng, Shanxi Yuncheng, Shanxi Suizhong, Liaoning Jinzhou, Liaoning Yingkou, Liaoning Danian, Liaoning Xianyang, Shannxi
E116°17′14″, N40°02′00″ E116°25′47″, N36°54′45″ E115°53′14″, N36°27′05″ E116°35′57″, N36°11′73″ E116°47′08″, N35°52′40″ E116°20′33″, N35°24′09″ E116°57′12″, N35°36′07″ E116°35′57″, N36°11′73″ E118°30′36″, N34°58′08″ E119°20′35″, N36°03′30″ E119°31′37″, N36°18′18″ E119°30′31″, N36°18′33″ E120°17′05″, N36°51′39″ E121°02′28″, N37°28′45″ E121°02′28″, N37°28′45″ E121°02′27″, N37°28′45″ E112°44′52″, N37°37′48″ E112°44′52″, N37°37′48″ E111°17′42″, N35°49′18″ E111°14′29″, N35°48′03″ E110°49′19″, N35°06′54″ E110°44′44″, N35°11′29″ E119°45′41″, N40°03′19″ E121°06′26″, N41°04′37″ E122°22′58″, N40°20′43″ E121°50′36″, N39°51′25″ E108°25′35″, N34°29′28″
resistance to ALS herbicides; (3) investigate possible metabolic mechanisms underlying resistant large crabgrass. 2. Materials and methods 2.1. Plant materials Mature seed of the susceptible population (BJ02) was collected from a remote area of Haidian district in Beijing that had never been treated with herbicides. Seeds of suspected resistant (R) populations were harvested randomly from maize fields of Shandong (SD), Shanxi (SX), Liaoning (LN) and Shanxi (SHX) provinces during 2012–2014 in China (Table 1). Weed seeds were firstly immersed in distilled water for 1 h, and then germinated in Petri dishes for 48 h. Germinated seedlings were transplanted into 9-cm diameter plastic pots containing moist loam soil, and then kept in artificial climate chamber at 25 °C/20 °C (light/ dark), 14 h photoperiod with light intensity of 15,000 Lux. Large crabgrass seedlings were thinned down to 10 plants per pot before herbicide application.
Malathion at the rate of 840 g a.i. ha−1 has no visual effects on large crabgrass seedling growth, and was used to treat the plants 30 min prior to nicosulfuron application. Nicosulfuron (40 g a.i./L suspension concentrate, Beijing Zhong Bao Lv Nong Technology Co. Ltd)was diluted with distilled water containing 0.3% (v/v) Tween-80. Seedlings at stage of three-leaf were used for whole-plant response experiments. Nicosulfuron was applied at rates of 0.006, 0.03, 0.06, 0.6, 6, 60, 300 g a.i. ha−1 using a moving-boom cabinet sprayer delivering 600 L ha−1 water at a pressure of 0.4 MPa by a flat fan nozzle positioned 50 cm above the foliage. Plants were returned to artificial climate chamber after herbicide treatment. The aboveground shoots were harvested after 21 days and the fresh weights recorded. The experiment was conducted with three replicates per herbicide dosage and repeated once. 2.3. ALS activity assays in vitro The ALS extraction and activity assay were conducted according to the methods described by Yu et al. and Deng et al. [11–12]. Seedlings at 5-leaf stage was ground to fine powder in liquid nitrogen and homogenized in extraction buffer (2 mL/g tissue). The homogenate was filtered through two layers of miracloth and centrifuged at 27000g for 15 min at 4 °C. The supernatant were collected and an equal volume of saturated (NH4)2SO4 was added dropwise to precipitated ALS proteins. After centrifugation at 20000g for 30 min at 4 °C, the pellet was suspended in the extraction buffer and then desalted by passing through a Sephadex G-25 column previously equilibrated with elution buffer. The desalted enzyme extract was immediately used for ALS activity assays. The extraction buffer was 0.1 M potassium phosphate (pH 7.5) containing 0.5 mM MgCl2, 0.5 mM thiamine pyrophosphate (ThDP), 10 μμ flavin adenine dinucleotide (FAD), 1.0 mM phenylmethylsulfonyl fluoride (PMSF), 1.0 mM dithiothreitol (DTT), 10 mM sodium pyruvate, 0.5% soluble polyvinylpyrrolidone (PVP) and 10% (v/v) glycerol. The elution buffer contained 50 mM HEPES [N-(2-hydroxyethyl) piperazine-N′-(2-ethanesulphonic acid)], pH 7.5, 20 mM sodium pyruvate, 20 mM MgCl2, 2 mM ThDP, 10 μμ FAD, 1.0 μM DTT. The reaction mixtures contained 100 μL nicosulfuron of required concentration (final concentrations of 0, 1.0 × 10−2, 0.1, 1.0, 10, 1.0 × 102, 5.0 × 102 and 1.0 × 103 μM), 100 μL desalted enzyme extract, and incubated at 37 °C for 30 min. The reaction was stopped with 40 μL of 3 M H2SO4 and incubated at 60 °C for 15 min to convert acetolactate to acetoin. Then, 190 μL of 0.55% creatine solution and 190 μL of α-naphthol solution (5.5% in 5 M NaOH) were added and the mixture incubated at 60 °C for 15 min. ALS activity was determined colorimetrically (520 nm) with microplate photometer (Thermo Fisher) by measuring acetoin production. The assay was repeated two times with independent enzyme extracts. 2.4. Identification of ALS mutation endowing resistance to nicosulfuron
2.2. Whole-plant response to nicosulfuron with or without the cytochrome P450 inhibitor malathion Whole-plant dose response experiments were conducted to determine the GR50 (herbicide rate causing 50% growth reduction of plants) of S and R biotypes to nicosulfuron with or without malathion.
Four primer pairs (Table 2)were designed to amplify the ALS gene covering eight amino acid residues known to endow ALS resistance in other weed species. Genomic DNA was extracted from shoot tissue of four-leaf stage individual plant using DNA extraction kit® (Tian Gen biotechnology company Ltd.). The 25 μL polymerase chain reaction
Table 2 Information of primer pairs designed for the amplification of the ALS gene in large crabgrass. Primer
Sequence (5′–3′)
Amplicon size (bp)
Covering the putative ALS mutations
Annealing temperature (°C)
MT-F16 MT-R16 MT-F3 MT-R3 MT-F6 MT-R6 MT-F17 MT-R17
CGACGTCTTCGCCTACCC AGCCATCTGCTGTTGGATGT GTCATCGCCAACCACCTCT CGACTCACCAACAAGACGC CCCCAAGGACATCCAGCAG CCCATAGCCCCAAGACCAG GTTGGGCAGCACCAGATGT AAGCTACTTAAGATTACCATACCAGAGT
451
Ala122, Pro197
62.1
495
Pro197, Ala205
63.5
780
Asp376, Arg377,
63.5
750
Trp574, Ser653, Gly654
60.8
Please cite this article as: Y. Mei, et al., Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Di..., Pesticide Biochemistry and Physiology (2016), http://dx.doi.org/10.1016/j.pestbp.2016.12.002
Y. Mei et al. / Pesticide Biochemistry and Physiology xxx (2016) xxx–xxx
(PCR) mixture consisted of 100 ng of genomic DNA, 0.5 μL (25 μM) of each primer and 12.5 μL of 2 × Tag PCR Master Mix and 10.5 μL of ddH2O (Tian Gen biotechnology company Ltd.). PCR was run with the following programme: denaturation at 94 °C for 3 min, 34 cycles of 94 °C for 45 s, 63.5 °C (depend on the primer pairs) for 45 s and 72 °C for 45 s, followed finally by an extension step of 5 min at 72 °C. The PCR product was purified from agar gel with TIANgel Midi Purification Kit® (Tian Gen biotechnology company Ltd.) and sequenced from both ends by a commercial supplier (Invitrogen). The DNA fragments of R biotype were assembled and compared with that of S biotype to determine the potential mutation. Ten plants from each large crabgrass population were used for identification of resistance-endowing ALS mutations with four primer pairs. 2.5. Detection of residual nicosulfuron in R and S large crabgrass biotypes 2.5.1. Herbicide treatment Technical nicosulfuron (95%) was provided by Shandong Runfeng Chemistry Company. Stock solutions of 1.0 × 103 mg·L−1 were prepared by dissolving 0.00316 g in 3 mL acetonitrile, and were kept at dark at −20 °C. A total of 3 μg nicosulfuron (1.0 × 103 mg·L−1) was applied to single plant at the 3-leaf stage by micropipettes. A total of 300 plants of S or R large crabgrass populations were treated by nicosulfuron. At 1, 3, 5, 7 and 11 DAT, 60 plants of S or R biotypes, which were divided into three replicates, were selected randomly and used for nicosulfuron extraction. 2.5.2. Sample extraction and clean-up Samples were prepared according the methods of Liu et al. with modification [13]. Nicosulfuron on the surface of plant leaves was washed off with acetonitrile. Then, the pooled plants were ground to fine powder in liquid nitrogen and transferred into a 50 mL polyethylene centrifuge tube. Subsequently, 3 mL ultrapure water and 15 mL acetonitrile containing 2% formic acid were added in centrifuge tube. After shaking for 1 h at 150 rpm, 1 g sodium chloride (NaCl) was added and then centrifuged at 5000 rpm for 5 min. The supernatant was collected in heart-shaped bottle, evaporated at 40 °C, and dissolved in 1.5 mL acetonitrile. The extract was transferred to centrifuge tubes containing cleaning reagents (25 mg PSA and 50 mg GCB) and vibrated for 1 min. After centrifugation at 6000 rpm for 5 min, supernatant was filtered through 0.22 μm filter (Millipore Millex-HN Nylon, Billerica, MA, USA). The infiltration was transferred to a vial and stored at 4 °C before injection. 2.5.3. HPLC analysis A LC-20AT liquid chromatography system (Shimadzu Corporation, Japan), which equipped with a SIL-20A auto sampler and a SPD-M20A diode array detector (DAD), was used for analysis. Chromatographic
3
separation was conducted in isocratic mode using a C18 column (4.6 mm × 250 mm i. d.) at a flow rate of 1 mL/min. The mobile phase was composed of 60% acetonitrile and 40% ultrapure water (v/v) containing 0.2% formic acid. The compound was detected at 254 nm after injecting 10 μL aliquots. 2.5.4. Method validation Linearity, recovery, precision, limit of detection (LOD) and quantification (LOQ) were evaluated to ensure the quality of the analytical method. Linearity was determined by injecting nicosulfuron working standard solutions at concentration of 0.01, 0.05, 0.1, 0.2, 0.4 and 0.8 mg L−1 followed by linear regression analysis of the data. Precision was calculated as relative standard deviation (RSD) from recovery studies with standardspiked samples (n = 4) at levels of 1.0, 5.0 and 10 mg L−1. Both the spiked and unspiked samples were extracted, cleaned up and subjected to HPLC analysis. The instrumental LOD and LOQ values were estimated from signal-to-noise ratios of 3 and 10 respectively. 2.6. Statistical analyses Data obtained from nicosulfuron dose-response and in vitro ALS activity assay were converted into percentage of the control and subjected to the non-linear regression analysis. The GR50 values and herbicide concentration causing 50% inhibition of ALS activity (I50) were evaluated using the four-parameter log-logistic Eq. proposed by Seefeldt et al. [14]. h i y ¼ C þ ðD–C Þ= 1 þ ðx=I50 or GR50 Þb where C is the lower limit, D is the upper limit, b is the slope at the I50 or GR50. The resistance factor (RF) was calculated by the GR50 or I50 of the R population divided by that of the S population to estimate the resistance levels. 3. Results 3.1. Whole-plant response experiments to nicosulfuron The GR50 values obtained (Table 3) indicated that 25 out of 26 large crabgrass populations (all except LN04) from maize fields have evolved resistance to nicosulfuron. The SX01, LN02 and SD17 populations were the most resistant with 21.6, 20.1 and 16.0 fold resistance to nicosulfuron compared to the susceptible population, respectively. There were four populations from Shandong, three from Shanxi and one from Liaoning province that had high resistance levels (if the RF ≥ 10); six populations from Shandong, and one each from Liaoning and Shannxi that had medium resistance levels (if 4 ≤ RF ˂ 10); five
Table 3 GR50 values to nicosulfuron for the S and R large crabgrass populations. Population
Biotype
GR50a (g a.i./ha)
RFb
Population
Biotype
GR50 (g a.i./ha)
RF
BJ02 SX01 LN02 SD17 SX02 SD05 SD10 SD15 SX04 SD03 SD04 SD06 SD11 SD13
S R R R R R R R R R R R R R
0.35 ± 0.11 7.56 ± 1.26 7.02 ± 4.76 5.60 ± 3.64 5.34 ± 1.77 4.97 ± 2.65 4.51 ± 1.06 3.76 ± 0.00 3.59 ± 2.12 2.37 ± 0.00 2.21 ± 0.67 2.13 ± 0.74 2.08 ± 0.83 1.84 ± 1.39
1.0 21.6 20.1 16.0 15.3 14.2 12.9 10.7 10.3 6.8 6.3 6.6 5.9 5.3
SHX01 SD18 LN09 SX06 SX07 SD12 SD07 LN08 SD09 SD21 SX03 SD08 LN04
R R R R R R R R R R R R S
1.80 ± 0.24 1.73 ± 0.77 1.67 ± 0.77 1.31 ± 0.44 1.31 ± 0.45 1.18 ± 0.42 0.97 ± 0.66 0.92 ± 0.00 0.92 ± 0.02 0.91 ± 0.29 0.84 ± 0.43 0.73 ± 0.42 0.49 ± 0.031
5.1 4.9 4.8 3.7 3.7 3.4 2.8 2.8 2.8 2.6 2.4 2.1 1.4
a b
GR50: herbicide rate causing 50% growth reduction of plants. RF = GR50 value of R biotype / GR50 value of S biotype.
Please cite this article as: Y. Mei, et al., Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Di..., Pesticide Biochemistry and Physiology (2016), http://dx.doi.org/10.1016/j.pestbp.2016.12.002
4
Y. Mei et al. / Pesticide Biochemistry and Physiology xxx (2016) xxx–xxx
Table 4 Total activity and I50 values of S (BJ02) and R (LN02, SX02, SD10 and SHX01) large crabgrass populations to nicosulfuron. Resistance levels were indicated by the resistance factor (RF). Within a column, GR50 or I50 values with different letters are significantly different at P = 0.05 significant levels. Data were means of two experiments.
3.3. Identification of ALS mutation endowing resistance to nicosulfuron
populations from Shandong, three from Shanxi and one from Liaoning that had low resistance levels (2 ≤ RF ˂ 4) to nicosulfuron.
Plants of LN02, SX02, SD10 and SHX01 populations were selected for the identification of ALS gene mutation. In this study, four ALS gene fragments with sizes of 451, 495, 780 and 750 bp were amplified respectively from single genomic DNA using the various primer pairs. The four DNA sequences from the same ALS gene were assembled to one 1863 bp sequence. The 1863 bp identified region of ALS gene from different large crabgrass populations showed N90% homology with that of the documented ALS gene of Echinochloa crus-galli (LC006059.1), Echinochloa phyllopogon (AB636581.1), Setaria viridis (KF020518) and Sorghum halepense (KJ538785.1). The homology of the ALS genes extracted from the same population was N99%. There were no amino acid modifications identified at sites of Ala122, Pro197, Ala205, Asp376, Arg377, Trp574, Ser653 and Gly654 in all tested large crabgrass plants from 9 resistant populations (LN02, SX01, SX02, XS04, SD02, SD04, SD10, SD11 and SHX01).
3.2. In vitro ALS activity assays
3.4. Synergism of nicosulfuron with the P450 inhibitor malathion
In order to characterize the response of ALS to herbicides, four resistant populations (LN02, SX02, SD10 and SHX01) from Liaoning, Shanxi, Shandong and Shannxi provinces were selected for determination of in vitro ALS activity and I50. The results indicated that the total ALS activity and I50 values of the S (BJ02) and R (LN02, SX02, SD10 and SD11) showed no significant differences at P = 0.05 significant levels (Table 4).
The P450 inhibitor malathion had no visual effect on the growth of R and S plants when applied at 840 g a.i. ha−1. The results of whole-plant response experiments indicated the malathion can reverse greatly the resistance of three R large crabgrass populations (LN02, SD10 and SX02) (Fig. 1-b, c, d; Table 5). The synergism ratios (SR) for LN02, SD10 and SX02 were 10.6, 9.5 and 7.4, respectively. In contrast,
Population
BJ02 LN02 SX02 SD10 SHX01 a b
Biotype
S R R R R
I50 (mmol/L)
Total activity a
Total activity
RF
I50b
RF
3.68 ± 0.15a 4.72 ± 0.64a 3.42 ± 0.16a 3.29 ± 0.32a 3.97 ± 0.16a
1.00 1.28 0.93 0.89 1.08
1.01 ± 0.28a 1.01 ± 0.13a 0.89 ± 0.057a 1.06 ± 0.15a 1.05 ± 0.22a
1.00 1.00 0.89 1.05 1.04
RF = total activity or I50 values of R biotype / total activity or I50 values of S biotype. I50: herbicide concentration causing 50% inhibition of ALS activity.
Fig. 1. Dose-response curves of nicosulfuron with (▲) or without (●) P450 inhibitor malathion on large crabgrass of BJ02 (a), LN02 (b), SD10 (c) and SX02 (d) populations.
Please cite this article as: Y. Mei, et al., Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Di..., Pesticide Biochemistry and Physiology (2016), http://dx.doi.org/10.1016/j.pestbp.2016.12.002
Y. Mei et al. / Pesticide Biochemistry and Physiology xxx (2016) xxx–xxx Table 5 Synergism of P450 inhibitor malathion on S (BJ02) and R (LN02, SX02 and SD10) large crabgrass populations to nicosulfuron. Synergisms were indicated by the synergism ratio (SR). Populations BJ02 LN02 SX02 SD10 a b c
Herbicide Nicosulfuron + malathion Nicosulfuron Nicosulfuron + malathion Nicosulfuron Nicosulfuron + malathion Nicosulfuron Nicosulfuron + malathion Nicosulfuron
a
GR50b (g a.i./ha−1)
SRc
0.23 ± 0.09 0.35 ± 0.11 0.66 ± 0.27 7.02 ± 4.76 0.56 ± 0.29 5.34 ± 1.77 0.61 ± 0.20 4.51 ± 1.06
1.0 1.5 1.0 10.6 1.0 9.5 1.0 7.4
The rate of malathion is 840 g a.i. ha−1. GR50: herbicide rate causing 50% growth reduction of plants. SR = GR50 without malation / GR50 with malathion.
malathion only provided a slight increase in the susceptibility of the S (BJ02) population to nicosulfuron. The SR value of BJ02 was 1.5 (Fig. 1-a; Table 5). 3.5. Determination of residual nicosulfuron in large crabgrass plants 3.5.1. Optimizing extraction and purification Acetonitrile was employed as extraction solvent, as it is the most suitable solvent for extracting a wide range of polar pesticide residues and provides higher recoveries with minimum co-extractives from the sample matrix. Sodium chloride was used directly to partition the organic layer from aqueous layer with a higher salting-out effect. In this study, d-SPE (PSA and GCB) purification was effective against interference. 3.5.2. Validation of analysis methods The results in Fig. 2 show good chromatographic resolution, and the retention times of nicosulfuron from standard, recovery and extract samples were around 4 min, which indicated good method selectivity and specificity. The determination coefficient (R2) of linear curve was 0.999. The LOD of the analytical method was 0.06 ng at signal-to-noise ratio of 3, and the LOQ was 0.05 mg/kg large crabgrass. Recovery was
5
Table 6 The residual dosage of nicosulfuron in BJ02 (S) and SX02 (R) populations of large crabgrass at days of 1st, 3rd, 5th, 7th and 11th after nicosulfuron treatment. Within a row, residual nicosulfuron with different letters are significantly different at P = 0.05 significant levels. Data were means of three replicates. Days after nicosulfuron treatment
1 3 5 7 11
Residual nicosulfuron (μg) BJ02 (S)
SX02 (R)
45.38 ± 9.81a 35.84 ± 1.24a 28.83 ± 1.16a 24.86 ± 5.84a 19.73 ± 2.04a
43.57 ± 6.15a 19.78 ± 4.09b 16.62 ± 2.21b 16.94 ± 1.36a 15.74 ± 2.35a
87.43%, 86.85% and 89.96% with an RSD of 1.63%, 1.32% and 1.19% at addition level of 10, 50 and 100 μg respectively. 3.5.3. Determination of residual nicosulfuron in large crabgrass Nicosulfuron present in both S and R large crabgrass plants decreased with time (Table 6). However, nicosulfuron declined more rapidly in R (SX02) than in S (BJ02) biotype. The residual dosage in S was significantly higher than in R biotypes at the 3rd and 5th day after nicosulfuron application. In contrast, the nicosulfuron in S and R biotypes showed no obvious difference at the 1st, 7th and 11th day after treatment (Table 6). 4. Discussion Large crabgrass across China has evolved high resistance levels to nicosulfuron due to persistent and intensive application of the herbicide. In this study, almost all the tested large crabgrass populations have evolved resistance to nicosulfuron (Table 3). Zhang et al. reported (2013) that all 32 large crabgrass populations collected from maize fields in 6 provinces of North and Northeast of China have evolved different resistance levels to nicosulfuron [15]. In addition, ALSinhibiting-resistant large crabgrass was also discovered in other countries. For example, large crabgrass infesting maize, which displayed resistance to nicosulfuron and foramsulfuron, was discovered in 2015 in France [1]. Also large crabgrass infesting onions and vegetables evolved multiple resistance to imazethapyr (ALS herbicide) and fluazifop-P-
Fig. 2. Typical chromatograms of nicosulfuron from standard (a), recovery (b), extract samples of S (c) and R (d) large crabgrass populations.
Please cite this article as: Y. Mei, et al., Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Di..., Pesticide Biochemistry and Physiology (2016), http://dx.doi.org/10.1016/j.pestbp.2016.12.002
6
Y. Mei et al. / Pesticide Biochemistry and Physiology xxx (2016) xxx–xxx
butyl, haloxyfop-methyl (ACCase herbicide) in 1993 in South Australia [1]. In order to investigate possible TSR mechanisms underlying the R large crabgrass populations, four R large crabgrass (LN02, SX02, SD10 and SHX01) populations from different provinces were selected for identification of amino acid modifications and susceptibility of ALS enzyme. Although four R large crabgrass populations evolved median or high resistance levels to nicosulfuron, no ALS mutation conferring resistance to ALS herbicides in other weeds was found in these R large crabgrass populations. In addition, the total activity and susceptibility to nicosulfuron of ALS enzyme in S and four R populations displayed no significant differences (Table 4). These data indicated that resistance to nicosulfuron in the four populations was not caused by TSR mechanisms. In contrast, the P450 inhibitor (malathion) significantly decreased resistance levels of three R large crabgrass populations (LN02, SX02 and SD10) to nicosulfuron with synergism ratios of 10.6, 9.5 and 7.4 respectively (Fig. 1, Table 5). This indicates that one or more P450s may be involved in resistance to nicosulfuron in these populations. The P450 inhibitor malathion has long been used as an indicator of P450 involvement in metabolic resistance to ALS herbicides [16], and has been used for establishing metabolic resistance involving of P450s in several weeds such as Amaranthus hybridus [17], Lolium rigidum [18], Alopecurus myosurides [19], Bromus tectorum [20], Echinochloa phyllopogon [21–22], Descurainia Sophia [23]. In order to demonstrate metabolism of nicosulfuron in large crabgrass, the residual nicosulfuron present in plants of S (BJ02) and R (SX02) biotypes was determined after nicosulfuron treatment. The results indicated the nicosulfuron declined more rapidly in R than in S biotype (Table 6), which may be caused by the metabolic enzymes of P450s. Hence, we speculated the increased metabolism to nicosulfuron, which may mediate by one or more P450s, was responsible for resistance to nicosulfuron in the R (SX02) large crabgrass. It will be important to examine the other populations to determine how extensive this mechanism may be in R large crabgrass populations. As metabolites were not identified, there remains a lack of direct evidence for specific P450s involved in metabolic resistance in R large crabgrass. The identification of NTSR in large crabgrass is important because NTSR can confer an unpredictable resistance to herbicides with various modes of action, including herbicides not yet marketed [9]. The strategies of herbicide mixtures and rotations that could effectively manage the TSRmay have little or no effects on NTSR [7]. Acknowledgements The project was sponsored by China Special Fund for Agro-scientific Research in the Public Interest (201303031).
[2] C. Délye, Unravelling the genetic bases of non-target-site-based resistance (NTSR) to herbicides: a major challenge for weed science in the forthcoming decade, Pest Manag. Sci. 69 (2013) 176–187. [3] S.B. Powles, Q. Yu, Evolution in action: plants resistant to herbicide, Annu. Rev. Plant Biol. 61 (2010) 317–347. [4] B. Siminszky, Plant cytochrome P450-mediated herbicide metabolism, Phytochem. Rev. 5 (2006) 445–458. [5] J.S. Yuan, P.J. Tranel, C.N. Stewart, Non-target-site herbicide resistance: a family business, Trends Plant Sci. 12 (2007) 6–13. [6] Q. Yu, H. Han, G.R. Cawthray, S.F.F. Wang, S.B. Powles, Enhanced rates of herbicide metabolism in low herbicide-dose selected resistant Lolium rigidum, Plant Cell Environ. 36 (2013) 818–827. [7] Q. Yu, S.B. Powles, Metabolism-based herbicide resistance and cross-resistance in crop weeds: a threat to herbicide sustainability and global crop production, Plant Physiol. 166 (2014) 1106–1118. [8] J.T. Brosnan, J.J. Vargas, G.K. Breeden, L. Grier, R.A. Aponte, S. Tresch, M. Laforest, A new amino acid substitution (Ala-205-Phe) in acetolactate synthase (ALS) confers broad spectrum resistance to ALS-inhibiting herbicides, Planta 243 (2016) 149–159. [9] C. Petit, B. Duhieu, K. Boucansaud, C. D'elye, Complex genetic control of non-targetsite-based resistance to herbicides inhibiting acetylcoenzyme A carboxylase and acetolactate synthase in Alopecurus myosuroides Huds, Plant Sci. 178 (2010) 501–509. [10] L. Scarabela, F. Perninb, C. Délye, Occurrence, genetic control and evolution of nontarget-site basedresistance to herbicides inhibiting acetolactate synthase (ALS) in thedicot weed Papaver rhoeas, Plant Sci. 238 (2015) 158–169. [11] Q. Yu, H.P.M.M. Vila-Aiub, S.B. Powles, AHAS herbicide resistance endowing mutations: effect on AHAS functionality and plant growth, J. Exp. Bot. 61 (2010) 3925–3934. [12] W. Deng, Y. Cao, Q. Yang, M.J. Liu, Y. Mei, M.Q. Zheng, Different cross-resistance patterns to AHAS herbicides of two tribenuron-methyl resistant flixweed (Descurainia sophia L.) biotypes in China, Pestic. Biochem. Physiol. 112 (2014) 26–32. [13] K. Liu, Z.Y. Cao, X. Pan, Y.L. Yu, Using in situe proe water water concentrations to estimate the phytotoxicity of nicosulfuron in soils to corn (Zea mays L.), Environ. Toxicol. Chem. 31 (8) (2012) 1705–1711. [14] S.S. Seefeld, J.E. Jensen, E.P. Fuerst, Log-loistic analysis of herbicides dose-response relationships, Weed Technol. 9 (1995) 218–227. [15] H.J. Zhang, G.Q. Wang, X. Liu, Q.L. Bian, Resistance of Digitaria sanguinalis to nicosulfuron, Weed Sci. 31 (1) (2013) 34–36 (in Chinese). [16] J.T. Christopher, C. Preston, S.B. Powles, Malathion antagonizes metabolism- based chlorsulfuron resistance in Lolium rigidum, Pestic. Biochem. Physiol. 49 (1994) 172–182. [17] B.S. Manley, K.H. Hatzios, H.P. Wilson, Absorption, translocation and metabolism of chlorimuron and nicosulfuron in imidazolinone-resistant and susceptible smooth pigweed (Amaranthus hybridus), Weed Technol. 13 (1999) 759–764. [18] F.J. Tardif, S.B. Powles, Effect of malathion on resistance to soil-applied herbicides in a population of rigid ryegrass (Lolium rigidum), Weed Sci. 47 (1999) 258–261. [19] A. Letouz'e, J. Gasquez, Enhanced activity of several herbicide-degrading enzymes: a suggested mechanism responsible for multiple resistance in blackgrass (Alopecurus myosurides Hud.), Agronomie 23 (2003) 601–608. [20] K.W. Park, L. Fandrich, C.A. Mallory-Smith, Absorption, translocation, and metabolism of propoxycarbazone-sodium in ALS-inhibitor resistant Bromus tectorum biotypes, Pestic. Biochem. Physiol. 79 (2004) 18–24. [21] M.S. Yun, Y. Yogo, R. Miura, Y. Yamasue, A.J. Fischer, Cytochrome P-450 monooxygenase activity in herbicide-resistant and -susceptible late watergrass (Echinochloa phyllopogon), Pestic. Biochem. Physiol. 83 (2005) 107–114. [22] S. Iwakami, M. Endo, H. Saika, J. Okuno, N. Nakamura, M. Yokoyama, Cytochrome P450 CYP81A12 and CYP81A21 are associated with resistance to two acetolactate synthase inhibitors in Echinochloa phyllopogon, Plant Physiol. 165 (2014) 618–629. [23] Q. Yang, W. Deng, X.F. Li, Q. Yu, L.Y. Bai, M.Q. Zheng, Target-site and non-target-site based resistance to the herbicide tribenuronmethyl in flixweed (Descurainia sophia L.), BMC Genomics 17 (2016) 551.
References [1] I. Heap, The International Survey of Herbicide Resistant Weeds, http://www. weedscience.com02 – Sep - 2016.
Please cite this article as: Y. Mei, et al., Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Di..., Pesticide Biochemistry and Physiology (2016), http://dx.doi.org/10.1016/j.pestbp.2016.12.002
Contents lists available at ScienceDirect
Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest
Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Digitaria sanguinalis L.) from China Yu Mei, Chong Si, Mingjie Liu, Lihong Qiu, Mingqi Zheng ⁎ Department of Applied Chemistry, China Agricultural University, No. 2 of Yuan Ming Yuan Xilu, Haidian District, Beijing 100193, China
a r t i c l e
i n f o
Article history: Received 9 September 2016 Received in revised form 24 November 2016 Accepted 5 December 2016 Available online xxxx Keywords: Large crabgrass Nicosulfuron Acetolactate synthase Non-target-site based resistance
a b s t r a c t Large crabgrass is a major grass weed widely distributed across China. This weed infests maize fields and has evolved resistance to the acetolactate synthase (ALS)-inhibiting herbicide nicosulfuron due to continuous and intensive use. In this study, a total of 25 out of 26 large crabgrass populations collected from maize field demonstrated resistance to nicosulfuron. Amino acid modifications in ALS known to confer resistance to ALSinhibiting herbicides in other weeds, were not found in the 9 tested resistant populations. The P450 inhibitor malathion significantly reversed resistance to nicosulfuron in 3 tested populations, indicating one or more P450s may be involved. Nicosulfuron was metabolized more rapidly in one resistant large crabgrass population than in a susceptible biotype. This demonstrates that the metabolic resistance mechanisms involving one or more P450s may be responsible for large crabgrass resistance to nicosulfuron in this biotype. © 2016 Published by Elsevier Inc.
1. Introduction Agricultural weeds have always been the major cause of crop loss by competing with crop plants for nutrients, water, light and space. Herbicides are often considered to be the most effective way of controlling weeds. However, weed species can evolve resistance to herbicides under persistent and intensive herbicide selection. To date, 250 weed species in 65 countries have evolved resistance to most major herbicides across most modes of action [1]. Two types of mechanisms, target-site based resistance (TSR) and non-target-site based resistance (NTSR) mechanisms, are involved in resistance evolution. TSR is endowed by amino acid substitutions in the herbicide target protein that may change the activity or structure of target enzymes. These alterations can cause an increase in the expression or in the intrinsic activity of the herbicide target protein that compensates for the herbicide inhibitory action, or a decrease in the affinity of the herbicide for its target [2]. NTSR is conferred by any mechanisms that are not TSR, such as reduced herbicide dose reaching the target-site by decreasing herbicide penetration/translocation into plant or increasing rates of herbicide metabolism/sequestration [2,3]. One important NTSR is mediated by enhanced rates of herbicide metabolism (here in after referred to as metabolic resistance) often involving cytochrome P450 monooxygenase
⁎ Corresponding author. E-mail address: [email protected] (M. Zheng).
(thereafter referred to as P450), ABC transporters, glutathione S-transferase (GST), glycosyltransferase (GT) [4–7]. The herbicides that target acetolactate synthase (ALS), collectively named as ALS-inhibiting herbicides, can be grouped into sulfonylurea (SU), imidazolinone (IMI), triazolopyrimidine (TP), pyrimidinylthiobenzoate (PTB), sulfonylamino-carbonyl-triazolinone (SCT) according their chemical structures. The TSR mechanism for ALS-inhibiting herbicides is due to amino acid substitution in ALS enzyme. To date, twenty-eight amino acid substitutions (numbers of amino acid in parentheses) in ALS endowing ALS herbicides resistance have been identified at sites of Ala122 (3), Pro197 (13), Ala205 (2), Asp 376(1), Arg377 (1), Trp574 (3), Ser653 (3) and Gly654 (2) in weed species [1,3,8]. In addition, NTSR mechanisms were also found to endow resistance to ALS-inhibiting herbicides [7,9–10]. However, compared with TSR mechanisms, the NTSR are less investigated and remain poorly understood due to its complexity and diversity. Large crabgrass is one of the most problematic weeds of maize fields in China. Control of this species has relied on the ALSinhibiting herbicide nicosulfuron since the 1980s. Farmers in China have reported the efficacy of nicosulfuron on large crabgrass has reduced greatly recently. In order to sustain herbicide efficacy to achieve effective weed controlling, it is necessary not only to be able to quickly detect the presence of resistant plants in a field, but also to identify underlying resistance mechanisms. The objectives of this study were to (1) determine the resistance levels to nicosulfuron of different large crabgrass populations from China; (2) identify any amino acid mutations in ALS known to confer
http://dx.doi.org/10.1016/j.pestbp.2016.12.002 0048-3575/© 2016 Published by Elsevier Inc.
Please cite this article as: Y. Mei, et al., Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Di..., Pesticide Biochemistry and Physiology (2016), http://dx.doi.org/10.1016/j.pestbp.2016.12.002
2
Y. Mei et al. / Pesticide Biochemistry and Physiology xxx (2016) xxx–xxx
Table 1 Geographical origin of large crabgrass populations used in this study. Population
Location
Co-ordinate
BJ02 SD03 SD04 SD05 SD06 SD07 SD08 SD09 SD10 SD11 SD12 SD13 SD15 SD17 SD18 SD21 SX01 SX02 SX03 SX04 SX06 SX07 LN02 LN04 LN08 LN09 SXH01
Haidian, Beijing Liaocheng, Shandong Liaocheng, Shandong Taian, Shandong Taian, Shandong Jining, Shandong Jining, Shandong Taian, Shandong Linyi, Shandong Weifang, Shandong Weifang, Shandong Weifang, Shandong Qingdao, Shandong Yantai, Shandong Yantai, Shandong Yantai, Shandong Jinzhong, Shanxi Jinzhong, Shanxi Linfen, Shanxi Linfen, Shanxi Yuncheng, Shanxi Yuncheng, Shanxi Suizhong, Liaoning Jinzhou, Liaoning Yingkou, Liaoning Danian, Liaoning Xianyang, Shannxi
E116°17′14″, N40°02′00″ E116°25′47″, N36°54′45″ E115°53′14″, N36°27′05″ E116°35′57″, N36°11′73″ E116°47′08″, N35°52′40″ E116°20′33″, N35°24′09″ E116°57′12″, N35°36′07″ E116°35′57″, N36°11′73″ E118°30′36″, N34°58′08″ E119°20′35″, N36°03′30″ E119°31′37″, N36°18′18″ E119°30′31″, N36°18′33″ E120°17′05″, N36°51′39″ E121°02′28″, N37°28′45″ E121°02′28″, N37°28′45″ E121°02′27″, N37°28′45″ E112°44′52″, N37°37′48″ E112°44′52″, N37°37′48″ E111°17′42″, N35°49′18″ E111°14′29″, N35°48′03″ E110°49′19″, N35°06′54″ E110°44′44″, N35°11′29″ E119°45′41″, N40°03′19″ E121°06′26″, N41°04′37″ E122°22′58″, N40°20′43″ E121°50′36″, N39°51′25″ E108°25′35″, N34°29′28″
resistance to ALS herbicides; (3) investigate possible metabolic mechanisms underlying resistant large crabgrass. 2. Materials and methods 2.1. Plant materials Mature seed of the susceptible population (BJ02) was collected from a remote area of Haidian district in Beijing that had never been treated with herbicides. Seeds of suspected resistant (R) populations were harvested randomly from maize fields of Shandong (SD), Shanxi (SX), Liaoning (LN) and Shanxi (SHX) provinces during 2012–2014 in China (Table 1). Weed seeds were firstly immersed in distilled water for 1 h, and then germinated in Petri dishes for 48 h. Germinated seedlings were transplanted into 9-cm diameter plastic pots containing moist loam soil, and then kept in artificial climate chamber at 25 °C/20 °C (light/ dark), 14 h photoperiod with light intensity of 15,000 Lux. Large crabgrass seedlings were thinned down to 10 plants per pot before herbicide application.
Malathion at the rate of 840 g a.i. ha−1 has no visual effects on large crabgrass seedling growth, and was used to treat the plants 30 min prior to nicosulfuron application. Nicosulfuron (40 g a.i./L suspension concentrate, Beijing Zhong Bao Lv Nong Technology Co. Ltd)was diluted with distilled water containing 0.3% (v/v) Tween-80. Seedlings at stage of three-leaf were used for whole-plant response experiments. Nicosulfuron was applied at rates of 0.006, 0.03, 0.06, 0.6, 6, 60, 300 g a.i. ha−1 using a moving-boom cabinet sprayer delivering 600 L ha−1 water at a pressure of 0.4 MPa by a flat fan nozzle positioned 50 cm above the foliage. Plants were returned to artificial climate chamber after herbicide treatment. The aboveground shoots were harvested after 21 days and the fresh weights recorded. The experiment was conducted with three replicates per herbicide dosage and repeated once. 2.3. ALS activity assays in vitro The ALS extraction and activity assay were conducted according to the methods described by Yu et al. and Deng et al. [11–12]. Seedlings at 5-leaf stage was ground to fine powder in liquid nitrogen and homogenized in extraction buffer (2 mL/g tissue). The homogenate was filtered through two layers of miracloth and centrifuged at 27000g for 15 min at 4 °C. The supernatant were collected and an equal volume of saturated (NH4)2SO4 was added dropwise to precipitated ALS proteins. After centrifugation at 20000g for 30 min at 4 °C, the pellet was suspended in the extraction buffer and then desalted by passing through a Sephadex G-25 column previously equilibrated with elution buffer. The desalted enzyme extract was immediately used for ALS activity assays. The extraction buffer was 0.1 M potassium phosphate (pH 7.5) containing 0.5 mM MgCl2, 0.5 mM thiamine pyrophosphate (ThDP), 10 μμ flavin adenine dinucleotide (FAD), 1.0 mM phenylmethylsulfonyl fluoride (PMSF), 1.0 mM dithiothreitol (DTT), 10 mM sodium pyruvate, 0.5% soluble polyvinylpyrrolidone (PVP) and 10% (v/v) glycerol. The elution buffer contained 50 mM HEPES [N-(2-hydroxyethyl) piperazine-N′-(2-ethanesulphonic acid)], pH 7.5, 20 mM sodium pyruvate, 20 mM MgCl2, 2 mM ThDP, 10 μμ FAD, 1.0 μM DTT. The reaction mixtures contained 100 μL nicosulfuron of required concentration (final concentrations of 0, 1.0 × 10−2, 0.1, 1.0, 10, 1.0 × 102, 5.0 × 102 and 1.0 × 103 μM), 100 μL desalted enzyme extract, and incubated at 37 °C for 30 min. The reaction was stopped with 40 μL of 3 M H2SO4 and incubated at 60 °C for 15 min to convert acetolactate to acetoin. Then, 190 μL of 0.55% creatine solution and 190 μL of α-naphthol solution (5.5% in 5 M NaOH) were added and the mixture incubated at 60 °C for 15 min. ALS activity was determined colorimetrically (520 nm) with microplate photometer (Thermo Fisher) by measuring acetoin production. The assay was repeated two times with independent enzyme extracts. 2.4. Identification of ALS mutation endowing resistance to nicosulfuron
2.2. Whole-plant response to nicosulfuron with or without the cytochrome P450 inhibitor malathion Whole-plant dose response experiments were conducted to determine the GR50 (herbicide rate causing 50% growth reduction of plants) of S and R biotypes to nicosulfuron with or without malathion.
Four primer pairs (Table 2)were designed to amplify the ALS gene covering eight amino acid residues known to endow ALS resistance in other weed species. Genomic DNA was extracted from shoot tissue of four-leaf stage individual plant using DNA extraction kit® (Tian Gen biotechnology company Ltd.). The 25 μL polymerase chain reaction
Table 2 Information of primer pairs designed for the amplification of the ALS gene in large crabgrass. Primer
Sequence (5′–3′)
Amplicon size (bp)
Covering the putative ALS mutations
Annealing temperature (°C)
MT-F16 MT-R16 MT-F3 MT-R3 MT-F6 MT-R6 MT-F17 MT-R17
CGACGTCTTCGCCTACCC AGCCATCTGCTGTTGGATGT GTCATCGCCAACCACCTCT CGACTCACCAACAAGACGC CCCCAAGGACATCCAGCAG CCCATAGCCCCAAGACCAG GTTGGGCAGCACCAGATGT AAGCTACTTAAGATTACCATACCAGAGT
451
Ala122, Pro197
62.1
495
Pro197, Ala205
63.5
780
Asp376, Arg377,
63.5
750
Trp574, Ser653, Gly654
60.8
Please cite this article as: Y. Mei, et al., Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Di..., Pesticide Biochemistry and Physiology (2016), http://dx.doi.org/10.1016/j.pestbp.2016.12.002
Y. Mei et al. / Pesticide Biochemistry and Physiology xxx (2016) xxx–xxx
(PCR) mixture consisted of 100 ng of genomic DNA, 0.5 μL (25 μM) of each primer and 12.5 μL of 2 × Tag PCR Master Mix and 10.5 μL of ddH2O (Tian Gen biotechnology company Ltd.). PCR was run with the following programme: denaturation at 94 °C for 3 min, 34 cycles of 94 °C for 45 s, 63.5 °C (depend on the primer pairs) for 45 s and 72 °C for 45 s, followed finally by an extension step of 5 min at 72 °C. The PCR product was purified from agar gel with TIANgel Midi Purification Kit® (Tian Gen biotechnology company Ltd.) and sequenced from both ends by a commercial supplier (Invitrogen). The DNA fragments of R biotype were assembled and compared with that of S biotype to determine the potential mutation. Ten plants from each large crabgrass population were used for identification of resistance-endowing ALS mutations with four primer pairs. 2.5. Detection of residual nicosulfuron in R and S large crabgrass biotypes 2.5.1. Herbicide treatment Technical nicosulfuron (95%) was provided by Shandong Runfeng Chemistry Company. Stock solutions of 1.0 × 103 mg·L−1 were prepared by dissolving 0.00316 g in 3 mL acetonitrile, and were kept at dark at −20 °C. A total of 3 μg nicosulfuron (1.0 × 103 mg·L−1) was applied to single plant at the 3-leaf stage by micropipettes. A total of 300 plants of S or R large crabgrass populations were treated by nicosulfuron. At 1, 3, 5, 7 and 11 DAT, 60 plants of S or R biotypes, which were divided into three replicates, were selected randomly and used for nicosulfuron extraction. 2.5.2. Sample extraction and clean-up Samples were prepared according the methods of Liu et al. with modification [13]. Nicosulfuron on the surface of plant leaves was washed off with acetonitrile. Then, the pooled plants were ground to fine powder in liquid nitrogen and transferred into a 50 mL polyethylene centrifuge tube. Subsequently, 3 mL ultrapure water and 15 mL acetonitrile containing 2% formic acid were added in centrifuge tube. After shaking for 1 h at 150 rpm, 1 g sodium chloride (NaCl) was added and then centrifuged at 5000 rpm for 5 min. The supernatant was collected in heart-shaped bottle, evaporated at 40 °C, and dissolved in 1.5 mL acetonitrile. The extract was transferred to centrifuge tubes containing cleaning reagents (25 mg PSA and 50 mg GCB) and vibrated for 1 min. After centrifugation at 6000 rpm for 5 min, supernatant was filtered through 0.22 μm filter (Millipore Millex-HN Nylon, Billerica, MA, USA). The infiltration was transferred to a vial and stored at 4 °C before injection. 2.5.3. HPLC analysis A LC-20AT liquid chromatography system (Shimadzu Corporation, Japan), which equipped with a SIL-20A auto sampler and a SPD-M20A diode array detector (DAD), was used for analysis. Chromatographic
3
separation was conducted in isocratic mode using a C18 column (4.6 mm × 250 mm i. d.) at a flow rate of 1 mL/min. The mobile phase was composed of 60% acetonitrile and 40% ultrapure water (v/v) containing 0.2% formic acid. The compound was detected at 254 nm after injecting 10 μL aliquots. 2.5.4. Method validation Linearity, recovery, precision, limit of detection (LOD) and quantification (LOQ) were evaluated to ensure the quality of the analytical method. Linearity was determined by injecting nicosulfuron working standard solutions at concentration of 0.01, 0.05, 0.1, 0.2, 0.4 and 0.8 mg L−1 followed by linear regression analysis of the data. Precision was calculated as relative standard deviation (RSD) from recovery studies with standardspiked samples (n = 4) at levels of 1.0, 5.0 and 10 mg L−1. Both the spiked and unspiked samples were extracted, cleaned up and subjected to HPLC analysis. The instrumental LOD and LOQ values were estimated from signal-to-noise ratios of 3 and 10 respectively. 2.6. Statistical analyses Data obtained from nicosulfuron dose-response and in vitro ALS activity assay were converted into percentage of the control and subjected to the non-linear regression analysis. The GR50 values and herbicide concentration causing 50% inhibition of ALS activity (I50) were evaluated using the four-parameter log-logistic Eq. proposed by Seefeldt et al. [14]. h i y ¼ C þ ðD–C Þ= 1 þ ðx=I50 or GR50 Þb where C is the lower limit, D is the upper limit, b is the slope at the I50 or GR50. The resistance factor (RF) was calculated by the GR50 or I50 of the R population divided by that of the S population to estimate the resistance levels. 3. Results 3.1. Whole-plant response experiments to nicosulfuron The GR50 values obtained (Table 3) indicated that 25 out of 26 large crabgrass populations (all except LN04) from maize fields have evolved resistance to nicosulfuron. The SX01, LN02 and SD17 populations were the most resistant with 21.6, 20.1 and 16.0 fold resistance to nicosulfuron compared to the susceptible population, respectively. There were four populations from Shandong, three from Shanxi and one from Liaoning province that had high resistance levels (if the RF ≥ 10); six populations from Shandong, and one each from Liaoning and Shannxi that had medium resistance levels (if 4 ≤ RF ˂ 10); five
Table 3 GR50 values to nicosulfuron for the S and R large crabgrass populations. Population
Biotype
GR50a (g a.i./ha)
RFb
Population
Biotype
GR50 (g a.i./ha)
RF
BJ02 SX01 LN02 SD17 SX02 SD05 SD10 SD15 SX04 SD03 SD04 SD06 SD11 SD13
S R R R R R R R R R R R R R
0.35 ± 0.11 7.56 ± 1.26 7.02 ± 4.76 5.60 ± 3.64 5.34 ± 1.77 4.97 ± 2.65 4.51 ± 1.06 3.76 ± 0.00 3.59 ± 2.12 2.37 ± 0.00 2.21 ± 0.67 2.13 ± 0.74 2.08 ± 0.83 1.84 ± 1.39
1.0 21.6 20.1 16.0 15.3 14.2 12.9 10.7 10.3 6.8 6.3 6.6 5.9 5.3
SHX01 SD18 LN09 SX06 SX07 SD12 SD07 LN08 SD09 SD21 SX03 SD08 LN04
R R R R R R R R R R R R S
1.80 ± 0.24 1.73 ± 0.77 1.67 ± 0.77 1.31 ± 0.44 1.31 ± 0.45 1.18 ± 0.42 0.97 ± 0.66 0.92 ± 0.00 0.92 ± 0.02 0.91 ± 0.29 0.84 ± 0.43 0.73 ± 0.42 0.49 ± 0.031
5.1 4.9 4.8 3.7 3.7 3.4 2.8 2.8 2.8 2.6 2.4 2.1 1.4
a b
GR50: herbicide rate causing 50% growth reduction of plants. RF = GR50 value of R biotype / GR50 value of S biotype.
Please cite this article as: Y. Mei, et al., Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Di..., Pesticide Biochemistry and Physiology (2016), http://dx.doi.org/10.1016/j.pestbp.2016.12.002
4
Y. Mei et al. / Pesticide Biochemistry and Physiology xxx (2016) xxx–xxx
Table 4 Total activity and I50 values of S (BJ02) and R (LN02, SX02, SD10 and SHX01) large crabgrass populations to nicosulfuron. Resistance levels were indicated by the resistance factor (RF). Within a column, GR50 or I50 values with different letters are significantly different at P = 0.05 significant levels. Data were means of two experiments.
3.3. Identification of ALS mutation endowing resistance to nicosulfuron
populations from Shandong, three from Shanxi and one from Liaoning that had low resistance levels (2 ≤ RF ˂ 4) to nicosulfuron.
Plants of LN02, SX02, SD10 and SHX01 populations were selected for the identification of ALS gene mutation. In this study, four ALS gene fragments with sizes of 451, 495, 780 and 750 bp were amplified respectively from single genomic DNA using the various primer pairs. The four DNA sequences from the same ALS gene were assembled to one 1863 bp sequence. The 1863 bp identified region of ALS gene from different large crabgrass populations showed N90% homology with that of the documented ALS gene of Echinochloa crus-galli (LC006059.1), Echinochloa phyllopogon (AB636581.1), Setaria viridis (KF020518) and Sorghum halepense (KJ538785.1). The homology of the ALS genes extracted from the same population was N99%. There were no amino acid modifications identified at sites of Ala122, Pro197, Ala205, Asp376, Arg377, Trp574, Ser653 and Gly654 in all tested large crabgrass plants from 9 resistant populations (LN02, SX01, SX02, XS04, SD02, SD04, SD10, SD11 and SHX01).
3.2. In vitro ALS activity assays
3.4. Synergism of nicosulfuron with the P450 inhibitor malathion
In order to characterize the response of ALS to herbicides, four resistant populations (LN02, SX02, SD10 and SHX01) from Liaoning, Shanxi, Shandong and Shannxi provinces were selected for determination of in vitro ALS activity and I50. The results indicated that the total ALS activity and I50 values of the S (BJ02) and R (LN02, SX02, SD10 and SD11) showed no significant differences at P = 0.05 significant levels (Table 4).
The P450 inhibitor malathion had no visual effect on the growth of R and S plants when applied at 840 g a.i. ha−1. The results of whole-plant response experiments indicated the malathion can reverse greatly the resistance of three R large crabgrass populations (LN02, SD10 and SX02) (Fig. 1-b, c, d; Table 5). The synergism ratios (SR) for LN02, SD10 and SX02 were 10.6, 9.5 and 7.4, respectively. In contrast,
Population
BJ02 LN02 SX02 SD10 SHX01 a b
Biotype
S R R R R
I50 (mmol/L)
Total activity a
Total activity
RF
I50b
RF
3.68 ± 0.15a 4.72 ± 0.64a 3.42 ± 0.16a 3.29 ± 0.32a 3.97 ± 0.16a
1.00 1.28 0.93 0.89 1.08
1.01 ± 0.28a 1.01 ± 0.13a 0.89 ± 0.057a 1.06 ± 0.15a 1.05 ± 0.22a
1.00 1.00 0.89 1.05 1.04
RF = total activity or I50 values of R biotype / total activity or I50 values of S biotype. I50: herbicide concentration causing 50% inhibition of ALS activity.
Fig. 1. Dose-response curves of nicosulfuron with (▲) or without (●) P450 inhibitor malathion on large crabgrass of BJ02 (a), LN02 (b), SD10 (c) and SX02 (d) populations.
Please cite this article as: Y. Mei, et al., Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Di..., Pesticide Biochemistry and Physiology (2016), http://dx.doi.org/10.1016/j.pestbp.2016.12.002
Y. Mei et al. / Pesticide Biochemistry and Physiology xxx (2016) xxx–xxx Table 5 Synergism of P450 inhibitor malathion on S (BJ02) and R (LN02, SX02 and SD10) large crabgrass populations to nicosulfuron. Synergisms were indicated by the synergism ratio (SR). Populations BJ02 LN02 SX02 SD10 a b c
Herbicide Nicosulfuron + malathion Nicosulfuron Nicosulfuron + malathion Nicosulfuron Nicosulfuron + malathion Nicosulfuron Nicosulfuron + malathion Nicosulfuron
a
GR50b (g a.i./ha−1)
SRc
0.23 ± 0.09 0.35 ± 0.11 0.66 ± 0.27 7.02 ± 4.76 0.56 ± 0.29 5.34 ± 1.77 0.61 ± 0.20 4.51 ± 1.06
1.0 1.5 1.0 10.6 1.0 9.5 1.0 7.4
The rate of malathion is 840 g a.i. ha−1. GR50: herbicide rate causing 50% growth reduction of plants. SR = GR50 without malation / GR50 with malathion.
malathion only provided a slight increase in the susceptibility of the S (BJ02) population to nicosulfuron. The SR value of BJ02 was 1.5 (Fig. 1-a; Table 5). 3.5. Determination of residual nicosulfuron in large crabgrass plants 3.5.1. Optimizing extraction and purification Acetonitrile was employed as extraction solvent, as it is the most suitable solvent for extracting a wide range of polar pesticide residues and provides higher recoveries with minimum co-extractives from the sample matrix. Sodium chloride was used directly to partition the organic layer from aqueous layer with a higher salting-out effect. In this study, d-SPE (PSA and GCB) purification was effective against interference. 3.5.2. Validation of analysis methods The results in Fig. 2 show good chromatographic resolution, and the retention times of nicosulfuron from standard, recovery and extract samples were around 4 min, which indicated good method selectivity and specificity. The determination coefficient (R2) of linear curve was 0.999. The LOD of the analytical method was 0.06 ng at signal-to-noise ratio of 3, and the LOQ was 0.05 mg/kg large crabgrass. Recovery was
5
Table 6 The residual dosage of nicosulfuron in BJ02 (S) and SX02 (R) populations of large crabgrass at days of 1st, 3rd, 5th, 7th and 11th after nicosulfuron treatment. Within a row, residual nicosulfuron with different letters are significantly different at P = 0.05 significant levels. Data were means of three replicates. Days after nicosulfuron treatment
1 3 5 7 11
Residual nicosulfuron (μg) BJ02 (S)
SX02 (R)
45.38 ± 9.81a 35.84 ± 1.24a 28.83 ± 1.16a 24.86 ± 5.84a 19.73 ± 2.04a
43.57 ± 6.15a 19.78 ± 4.09b 16.62 ± 2.21b 16.94 ± 1.36a 15.74 ± 2.35a
87.43%, 86.85% and 89.96% with an RSD of 1.63%, 1.32% and 1.19% at addition level of 10, 50 and 100 μg respectively. 3.5.3. Determination of residual nicosulfuron in large crabgrass Nicosulfuron present in both S and R large crabgrass plants decreased with time (Table 6). However, nicosulfuron declined more rapidly in R (SX02) than in S (BJ02) biotype. The residual dosage in S was significantly higher than in R biotypes at the 3rd and 5th day after nicosulfuron application. In contrast, the nicosulfuron in S and R biotypes showed no obvious difference at the 1st, 7th and 11th day after treatment (Table 6). 4. Discussion Large crabgrass across China has evolved high resistance levels to nicosulfuron due to persistent and intensive application of the herbicide. In this study, almost all the tested large crabgrass populations have evolved resistance to nicosulfuron (Table 3). Zhang et al. reported (2013) that all 32 large crabgrass populations collected from maize fields in 6 provinces of North and Northeast of China have evolved different resistance levels to nicosulfuron [15]. In addition, ALSinhibiting-resistant large crabgrass was also discovered in other countries. For example, large crabgrass infesting maize, which displayed resistance to nicosulfuron and foramsulfuron, was discovered in 2015 in France [1]. Also large crabgrass infesting onions and vegetables evolved multiple resistance to imazethapyr (ALS herbicide) and fluazifop-P-
Fig. 2. Typical chromatograms of nicosulfuron from standard (a), recovery (b), extract samples of S (c) and R (d) large crabgrass populations.
Please cite this article as: Y. Mei, et al., Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Di..., Pesticide Biochemistry and Physiology (2016), http://dx.doi.org/10.1016/j.pestbp.2016.12.002
6
Y. Mei et al. / Pesticide Biochemistry and Physiology xxx (2016) xxx–xxx
butyl, haloxyfop-methyl (ACCase herbicide) in 1993 in South Australia [1]. In order to investigate possible TSR mechanisms underlying the R large crabgrass populations, four R large crabgrass (LN02, SX02, SD10 and SHX01) populations from different provinces were selected for identification of amino acid modifications and susceptibility of ALS enzyme. Although four R large crabgrass populations evolved median or high resistance levels to nicosulfuron, no ALS mutation conferring resistance to ALS herbicides in other weeds was found in these R large crabgrass populations. In addition, the total activity and susceptibility to nicosulfuron of ALS enzyme in S and four R populations displayed no significant differences (Table 4). These data indicated that resistance to nicosulfuron in the four populations was not caused by TSR mechanisms. In contrast, the P450 inhibitor (malathion) significantly decreased resistance levels of three R large crabgrass populations (LN02, SX02 and SD10) to nicosulfuron with synergism ratios of 10.6, 9.5 and 7.4 respectively (Fig. 1, Table 5). This indicates that one or more P450s may be involved in resistance to nicosulfuron in these populations. The P450 inhibitor malathion has long been used as an indicator of P450 involvement in metabolic resistance to ALS herbicides [16], and has been used for establishing metabolic resistance involving of P450s in several weeds such as Amaranthus hybridus [17], Lolium rigidum [18], Alopecurus myosurides [19], Bromus tectorum [20], Echinochloa phyllopogon [21–22], Descurainia Sophia [23]. In order to demonstrate metabolism of nicosulfuron in large crabgrass, the residual nicosulfuron present in plants of S (BJ02) and R (SX02) biotypes was determined after nicosulfuron treatment. The results indicated the nicosulfuron declined more rapidly in R than in S biotype (Table 6), which may be caused by the metabolic enzymes of P450s. Hence, we speculated the increased metabolism to nicosulfuron, which may mediate by one or more P450s, was responsible for resistance to nicosulfuron in the R (SX02) large crabgrass. It will be important to examine the other populations to determine how extensive this mechanism may be in R large crabgrass populations. As metabolites were not identified, there remains a lack of direct evidence for specific P450s involved in metabolic resistance in R large crabgrass. The identification of NTSR in large crabgrass is important because NTSR can confer an unpredictable resistance to herbicides with various modes of action, including herbicides not yet marketed [9]. The strategies of herbicide mixtures and rotations that could effectively manage the TSRmay have little or no effects on NTSR [7]. Acknowledgements The project was sponsored by China Special Fund for Agro-scientific Research in the Public Interest (201303031).
[2] C. Délye, Unravelling the genetic bases of non-target-site-based resistance (NTSR) to herbicides: a major challenge for weed science in the forthcoming decade, Pest Manag. Sci. 69 (2013) 176–187. [3] S.B. Powles, Q. Yu, Evolution in action: plants resistant to herbicide, Annu. Rev. Plant Biol. 61 (2010) 317–347. [4] B. Siminszky, Plant cytochrome P450-mediated herbicide metabolism, Phytochem. Rev. 5 (2006) 445–458. [5] J.S. Yuan, P.J. Tranel, C.N. Stewart, Non-target-site herbicide resistance: a family business, Trends Plant Sci. 12 (2007) 6–13. [6] Q. Yu, H. Han, G.R. Cawthray, S.F.F. Wang, S.B. Powles, Enhanced rates of herbicide metabolism in low herbicide-dose selected resistant Lolium rigidum, Plant Cell Environ. 36 (2013) 818–827. [7] Q. Yu, S.B. Powles, Metabolism-based herbicide resistance and cross-resistance in crop weeds: a threat to herbicide sustainability and global crop production, Plant Physiol. 166 (2014) 1106–1118. [8] J.T. Brosnan, J.J. Vargas, G.K. Breeden, L. Grier, R.A. Aponte, S. Tresch, M. Laforest, A new amino acid substitution (Ala-205-Phe) in acetolactate synthase (ALS) confers broad spectrum resistance to ALS-inhibiting herbicides, Planta 243 (2016) 149–159. [9] C. Petit, B. Duhieu, K. Boucansaud, C. D'elye, Complex genetic control of non-targetsite-based resistance to herbicides inhibiting acetylcoenzyme A carboxylase and acetolactate synthase in Alopecurus myosuroides Huds, Plant Sci. 178 (2010) 501–509. [10] L. Scarabela, F. Perninb, C. Délye, Occurrence, genetic control and evolution of nontarget-site basedresistance to herbicides inhibiting acetolactate synthase (ALS) in thedicot weed Papaver rhoeas, Plant Sci. 238 (2015) 158–169. [11] Q. Yu, H.P.M.M. Vila-Aiub, S.B. Powles, AHAS herbicide resistance endowing mutations: effect on AHAS functionality and plant growth, J. Exp. Bot. 61 (2010) 3925–3934. [12] W. Deng, Y. Cao, Q. Yang, M.J. Liu, Y. Mei, M.Q. Zheng, Different cross-resistance patterns to AHAS herbicides of two tribenuron-methyl resistant flixweed (Descurainia sophia L.) biotypes in China, Pestic. Biochem. Physiol. 112 (2014) 26–32. [13] K. Liu, Z.Y. Cao, X. Pan, Y.L. Yu, Using in situe proe water water concentrations to estimate the phytotoxicity of nicosulfuron in soils to corn (Zea mays L.), Environ. Toxicol. Chem. 31 (8) (2012) 1705–1711. [14] S.S. Seefeld, J.E. Jensen, E.P. Fuerst, Log-loistic analysis of herbicides dose-response relationships, Weed Technol. 9 (1995) 218–227. [15] H.J. Zhang, G.Q. Wang, X. Liu, Q.L. Bian, Resistance of Digitaria sanguinalis to nicosulfuron, Weed Sci. 31 (1) (2013) 34–36 (in Chinese). [16] J.T. Christopher, C. Preston, S.B. Powles, Malathion antagonizes metabolism- based chlorsulfuron resistance in Lolium rigidum, Pestic. Biochem. Physiol. 49 (1994) 172–182. [17] B.S. Manley, K.H. Hatzios, H.P. Wilson, Absorption, translocation and metabolism of chlorimuron and nicosulfuron in imidazolinone-resistant and susceptible smooth pigweed (Amaranthus hybridus), Weed Technol. 13 (1999) 759–764. [18] F.J. Tardif, S.B. Powles, Effect of malathion on resistance to soil-applied herbicides in a population of rigid ryegrass (Lolium rigidum), Weed Sci. 47 (1999) 258–261. [19] A. Letouz'e, J. Gasquez, Enhanced activity of several herbicide-degrading enzymes: a suggested mechanism responsible for multiple resistance in blackgrass (Alopecurus myosurides Hud.), Agronomie 23 (2003) 601–608. [20] K.W. Park, L. Fandrich, C.A. Mallory-Smith, Absorption, translocation, and metabolism of propoxycarbazone-sodium in ALS-inhibitor resistant Bromus tectorum biotypes, Pestic. Biochem. Physiol. 79 (2004) 18–24. [21] M.S. Yun, Y. Yogo, R. Miura, Y. Yamasue, A.J. Fischer, Cytochrome P-450 monooxygenase activity in herbicide-resistant and -susceptible late watergrass (Echinochloa phyllopogon), Pestic. Biochem. Physiol. 83 (2005) 107–114. [22] S. Iwakami, M. Endo, H. Saika, J. Okuno, N. Nakamura, M. Yokoyama, Cytochrome P450 CYP81A12 and CYP81A21 are associated with resistance to two acetolactate synthase inhibitors in Echinochloa phyllopogon, Plant Physiol. 165 (2014) 618–629. [23] Q. Yang, W. Deng, X.F. Li, Q. Yu, L.Y. Bai, M.Q. Zheng, Target-site and non-target-site based resistance to the herbicide tribenuronmethyl in flixweed (Descurainia sophia L.), BMC Genomics 17 (2016) 551.
References [1] I. Heap, The International Survey of Herbicide Resistant Weeds, http://www. weedscience.com02 – Sep - 2016.
Please cite this article as: Y. Mei, et al., Investigation of resistance levels and mechanisms to nicosulfuron conferred by non-target-site mechanisms in large crabgrass (Di..., Pesticide Biochemistry and Physiology (2016), http://dx.doi.org/10.1016/j.pestbp.2016.12.002