In vitro and in vivo protective effect of arginine against lipopolysaccharide induced inflammatory response in the intestine of juvenile Jian carp (Cyprinus carpio var. Jian)

Fish & Shellfish Immunology 42 (2015) 457e464

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

In vitro and in vivo protective effect of arginine against lipopolysaccharide induced inflammatory response in the intestine of juvenile Jian carp (Cyprinus carpio var. Jian) Jun Jiang a, b, c, Dan Shi a, b, Xiao-Qiu Zhou b, c, Yi Hu a, Lin Feng b, c, Yang Liu b, c, Wei-Dan Jiang b, c, Ye Zhao a, b, * a b c

College of Animal Science and Technology, Sichuan Agricultural University, Ya'an 625014, China Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, China Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Ya'an 625014, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 28 September 2014 Received in revised form 19 November 2014 Accepted 21 November 2014 Available online 27 November 2014

The present study was designed to assess the possible protective effects of arginine (Arg) against lipopolysaccharide (LPS) induced inflammatory response in juvenile Jian carp (Cyprinus carpio var. Jian) in vivo and in enterocytes in vitro. Firstly, inflammatory response was established by exposing enterocytes to different concentrations of LPS for 24 h. Secondly, the protective effects of Arg against subsequent LPS exposure were studied in enterocytes. Finally, we investigated whether dietary Arg supplementation could attenuate immune challenge induced by LPS in vivo. The result indicated that 10 mg/L LPS could induced inflammatory response in enterocytes. Cells exposed to LPS (10e30 mg/L) alone for 24 h resulted in a significant increase in lactate dehydrogenase release (LDH) (P < 0.05). The cell viability, protein content, alkaline phosphatase activity were decreased by LPS (P < 0.05). Moreover, LPS exposure significantly increased TNF-a, IL-1b, and IL-6 mRNA expression in vitro (P < 0.05). However, pre-treatment with Arg remarkably prevented the increase of TNF-a, IL-1b, and IL-6 by inhibiting the excessive activation of TLR4-Myd88 signaling pathway through down-regulating TLR4, Myd88, NFkB p65, and MAPK p38 mRNA expression (P < 0.05). Interestingly, the experiment in vivo showed that Arg pre-supplementation could attenuate immune challenge induced by LPS via TLR4Myd88 signaling pathway, and thus protect fish against LPS-induced inflammatory response. In conclusion, all of these results indicated pre-supplementation with Arg decreased LPS induced immune damage and regulated TLR4-Myd88 signaling pathway in juvenile Jian carp in vivo and in enterocytes in vitro. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Arginine Lipopolysaccharide Enterocytes Cyprinus carpio var. Jian TLR4-Myd88 signaling pathway

1. Introduction Arginine (Arg) is one of the essential amino acids for fishes. Sufficient Arg in the diets is indispensable to optimize the health status of fishes [1,2]. Fish growth is often related to the disease resistance [3], which could be reflected by survival [4]. Studies showed that dietary Arg deficiency reduced the survival of coho salmon (Oncorhynchus kisutch) [5] and European sea bass (Cirrhinus

* Corresponding author. College of Animal Science and Technology, Sichuan Agricultural University, Xinkang Road 46#, Ya'an, Sichuan Province 625014, PR China. Tel./fax: þ86 835 2886080. E-mail address: [email protected] (Y. Zhao). http://dx.doi.org/10.1016/j.fsi.2014.11.030 1050-4648/© 2014 Elsevier Ltd. All rights reserved.

mrigala) [6]. Fish disease resistance is associated with immune defense system, which includes innate and adaptive immunity. Buentello et al. demonstrated that dietary Arg supplementation enhanced the ability of channel catfish to survive exposure to Edwardsiella Ictaluri [2]. Pohlenz et al. reported Arg supplementation to culture media improves channel catfish macrophage phagocytosis and killing ability [7]. In mammals, dietary Arg supplementation was shown to alleviate a variety of infections and immune challenges [8,9,10]. These data suggested that Arg had a relationship with immunity. However, the potential mechanism has not been elucidated. Arg modulates immune functions through regulating several cytokines, such as interleukin-1b (IL-1b), IL-2, and tumor necrosis factor-a (TNF-a) in piglet [10]. However, the structure and form of the immune system is different between fish

458

J. Jiang et al. / Fish & Shellfish Immunology 42 (2015) 457e464

and mammals [11]. Whether Arg could improve disease resistance via regulating the cytokines in fish is unclear. Toll-like receptor 4 (TLR4) is an important member of pattern recognition receptors (PRRs) in the immune system by recognition of pathogen-associated molecular patterns (PAMPs), which are conserved molecules commonly shared by classes of pathogens [12,13]. Upon recognition, TLR4 transmits signals to nuclear factor kappa B (NF-kB) and mitogen-activated protein kinases (MAPK) through two signaling pathways. Namely, the myeloid differentiation primary response gene 88 (Myd88)-dependent pathway and the TIR-containing adapter inducing IFN-b (TRIF)-dependent pathway lead to changes in transcription of various effector proteins and inflammatory cytokines such as TNF-a, IL-1, IL-6, and IL-12 [14]. Su et al. reported TLR4 signaling pathway could be activated by both viral and bacterial infection in rare minnow Gobiocypris rarus [15]. In Atlantic salmon Salmo salar, bacterial lipopolysaccharide (LPS) induced significant up-regulation of IL-1b and IL-8 mRNA expression in head kidney leucocytes [16]. Recently, LPS has been used in studies of various aspects of induced immune responses in fish enterocytes [17,18]. Fish enterocytes are an important trigger of the intestinal immune system [18]. Mulder et al. reported that in vivo immersion exposure of the rainbow trout to Aeromonas salmonicida induces the expression of several cytokines in the intestine [19]. Komatsu et al. also reported that bacterial infection resulted in inflammatory responses in the intestine of trout Oncorhynchus mykiss [18]. These studies focused on bacteria induced inflammatory responses in the intestine of fish. However, to our knowledge, few studies examined how to efficiently protect the intestine against bacteria-induced immune damage. In the present experiment, we first investigated the effects of Arg on LPS-induced inflammatory responses in vivo and in vitro. And based on these effects, the potential mechanisms behind the Arg-regulated immune responses were investigated.

supplemented with 5% FBS, 0.02 mg transferrin/mL, 0.01 mg insulin/mL, and antibiotics (100 U/mL penicillin and 100 mg/mL streptomycin) at 26 ± 0.5  C under a Biochemical Incubator (Shanghai Boxun Industry & Commerce Co., Ltd., Shanghai, China). The cells were allowed to attach to plates for 72 h.

2. Materials and methods

2.3.1. Animal collection and acclimation conditions Juvenile Jian carp were obtained from Tong Wei fisheries (Sichuan, China) and acclimated for 4 weeks. The laboratory conditions were as follows: 24 ± 1  C, constant aeration, daily dechlorinated water change, natural photoperiod and feeding with a commercial food.

2.1. Chemicals LPS, Arg, insulin, collagenase, dispase, transferrin, benzyl penicillin, and streptomycin sulfate were purchased from Sigma (St. Louis, MO, USA). Hank's balanced salt solution (HBSS) and fetal bovine serum (FBS) were purchased from Hyclone (Logan, UT, USA). Arg-free DMEM was ordered from Beijing Tsing Skywing Bio. Tech. Co. Ltd. (Beijing, China). 3-(4, 5-dimethylthiazol-2-yl)-5-(3carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) were purchased from Promega Corporation (Madison, WI). 2.2. In vitro experiments 2.2.1. Primary enterocyte culture Cell isolation and culture were performed according to the methods of Jiang et al. (2009) [20] and Jiang et al. (2013) [21] with minor modifications. In brief, healthy carp with an average weight 48.5 ± 1.2 g were maintained for approximately 24 h without feeding before the experiment, and killed by decapitation. The intestines were rapidly removed from the carcass, opened and rinsed with HBSS containing antibiotics (100 U/mL penicillin and 100 mg/ mL streptomycin). Enterocytes were isolated by collagenase and dispase digestion. Cells were pooled and suspended in DMEM, and washed five times with DMEM to remove enzymes. Isolated enterocytes were seeded in 24-well culture plates (Falcon, Franklin Lake, NJ, USA) at the density of 2  103 cells/well that had been previously coated with collagen I (Sigma, St. Louis, MO, USA), as previously described by us [22]. The cells were cultured in DMEM

2.2.2. LPS induced inflammatory response in carp enterocytes The cells were incubated for 24 h in fresh medium containing 0, 5, 10, 20 and 30 mg/L LPS. At the end of the exposure, the MTS assay was performed. The cell lysates were collected to detect alkaline phosphatase (AKP) activity, protein content (PC), TNF-a, and IL-1b mRNA expression, the medium was collected to detect the content of lactate dehydrogenase (LDH). 2.2.3. Protective effect of Arg in LPS-induced inflammatory response in carp enterocytes To investigate the potential protective effect of Arg against a subsequent LPS exposure, enterocytes were pretreated with 0 (negative Ctrl group, group 1), 0 (group 2), 50 (group 3), 100 (group 4), 150 (group 5), 200 (group 6), 250 (group 7), 300 (group 8) mg/L of Arg for 72 h prior to 24 h treatment with 10 mg/L LPS in a 27  C incubator. The LPS exposure concentration was chosen because previous experiment showed that 10 mg/L LPS of medium could induce inflammatory response in carp enterocytes. Group 1 cells were incubated in Arg-free DMEM. Thus, there were seven groups (pre-treatment þ LPS exposure): Ctrl þ Ctrl, Ctrl þ LPS, 50 mg/L Arg þ LPS, 100 mg/L Arg þ LPS, 150 mg/L Arg þ LPS, 200 mg/L Arg þ LPS, 250 mg/L Arg þ LPS, 300 mg/L Arg þ LPS. At the end of the experiment, media were collected to analyze LDH release. Cell lysates were collected to detect TLR4, Myd88, NFkBp65, MAPKp38, TNF-a, IL-1b, IL-6, and IL-10 mRNA expression. 2.3. In vivo experiments

2.3.2. Protective effect of Arg in LPS-induced inflammatory response in carp The formulation of the basal diet was the same as in our previous study [1]. Briefly, it contained 340 g crude protein/kg diet. The basal diet was Arg unsupplemented control (Ctrl). Arg premix was added to the basal diet to provide 18.5 g Arg/kg diet, which was the required Arg concentration for optimal growth established by our previous study, and the amount of cellulose was reduced to compensate (Arg group). Procedures for diet preparation and storage were the same as those described by Ref. [23]. A total of 300 fish with an average initial weight of (10.53 ± 0.03 g) from the acclimatization aquarium were randomly assigned into 2 groups of 3 replicates each. The groups were fed either the Ctrl diet or the Arg diet for 63 days. The experimental conditions were the same as in our previous study [1]. At the end of the feeding trial, the fish in each aquarium were weighed and collected for LPS exposure. Fish from both the Ctrl and Arg groups were injected intraperitoneally with 100 mL of Escherichia coli LPS serotype 0111:B4 (3 mg of LPS kg1 of fish) diluted in sterile PBS for 48 h. The Ctrl/Ctrl treatment (fish from the Ctrl) was performed by injecting with 100 mL sterile PBS. Hence, there were 3 different pre-treatment/exposure groups, Ctrl/Ctrl, Ctrl/LPS and Arg/LPS, with 3 replicates per group and 12 fish per replicate (36

J. Jiang et al. / Fish & Shellfish Immunology 42 (2015) 457e464

459

Table 1 The primers and annealing temperature used for in real-time quantitative PCR. Name

Sequence (50 e30 )

Product size

Annealing temperature ( C)

GenBank ID

TNF-a-QF TNF-a-QR IL-1b-QF IL-1b-QR IL-6-QF IL-6-QR IL-10-QF IL-10-QR TLR4-QF TLR4-QR Myd88-QF Myd88-QR NF-kB p65-QF NF-kB p65-QR MAPK p38-QF MAPK p38-QR EF1а-QF EF1а-QR

TCAACAAGTCTCAGAACA GCACCTATTAAATGGATGG ACAGCCTCCTCTTCTTCAG CACCTTCTCCCAATCATCAAA TAGGTTAATGAGCAAGAGGA AGAGACTGTTGATACTGGAA GCATACAGAGAAATACAGAACT GTGACAGCCATAAGGACTA TGTCGCTTTGAGTTTGAAT TCCAGAATGATGATGATGATG AAGAGGATGGTGGTAGTCA GAGTGCGAACTTGGTCTG TATTCAGTGCGTGAAGAAG TATTAAAGGGGTTGTTCTGT ACCTCAATAATATCGTCAA TAAGTTCACAGTCTTCATT TCACCATTGACATTGCTCTC TGTTCTTGATGAAGTCTCTGT

112 bp

56

AJ311800

110 bp

56.5

AJ245635

115 bp

55.5

AY102633.1

102 bp

55

AB110780

77 bp

55

HM564033

75 bp

55.5

GU321987

77 bp

58

LN590704

159 bp

56

AB023481

93 bp

56

AF485331

fish for each group). At the end of trial, the fish intestines were frozen in liquid nitrogen and stored at 70  C for further analysis. 2.4. Analysis and measurement 2.4.1. Cell viability and differentiation assays Cell viability was quantified by CellTiter 96® AQueous One Solution cell proliferation assay kit (Promega). In brief, at the time of experimental termination, 40 mL of MTS working solution was added to each well. After incubation for 2 h at 27  C in a humidified atmosphere, the amount of formazan was estimated by optical density (OD) at 490 nm on a plate reader (Wellscan MK3, Labsystems, Finland). 2.4.2. PC, LDH and AKP activity measurement PC of enterocytes were measured using the method of Bradford with bovine serum albumin as the standard following [24]. AKP activity was assayed according to Krogdahl et al. [25]. LPS-induced cytotoxicity was quantified by measuring the amounts of LDH released into the culture medium from injured cells [26,27]. The amount of LDH released was measured using the method of Mulier et al. [28]. 2.4.3. Real-time quantitative PCR Total RNA isolation was conducted with TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions and 2 mL total RNA was used to synthesize cDNA using the PrimeScript® RT reagent Kit with gDNA Eraser (TaKaRa). Realtime quantitative PCR analysis of TLR4, Myd88, NF-kBp65, MAPKp38, TNF-a, IL-1b, IL-6, IL-10 and house-keeping gene (EF1а) was performed in a CFX96 Real-Time PCR Detection System (BioRad, Hercules, CA. USA). The gene-specific primers used in this study were listed in Table 1. The PCR mixture consisted of l mL the first-strand cDNA sample, 0.5 mL each of forward and reverse primers from 10 mM stocks, 3 mL RNase free dH2O, and 5 mL 2  Ssofast EvaGreen Supermix (Bio-Rad). Cycling condition were 98  C for 10 s, followed forty cycles of 98  C for 5 s, annealing at a different temperature (Table 1) for each gene for 10 s, and 72  C for 15 s. A melting curve analysis was generated following each realtime quantitative PCR assay to check and verify the specificity and purity of all PCR products. All cDNAs samples were quantified in triplicate. A standard curve was created from serial dilutions of one of the cDNA samples. A standard curve was drawn by plotting the natural log of the threshold cycle (CT) against the natural log of

the number of molecules. The CT was defined as the cycle at which a statistically significant increase in the magnitude of the signal generated by the PCR reaction was first detected. Standard curve of each gene was run in duplicate and three times for obtaining reliable amplification efficiency. The correlation coefficients (r2) of all standard curves were >0.99 and the amplification efficiency were between 90 and ~110%. Target gene mRNA concentration was normalized to the mRNA concentration of the reference gene EF1а. 2.5. Statistical analysis Data were analyzed by one-way analysis of variance (ANOVA) using SPSS 13.0 (SPSS Inc., Chicago, IL, USA). Duncan's multiplerange test was used to determine significant differences. A t-test was used for comparisons between two groups. Data are presented as means ± SEM. P < 0.05 was considered to be statistically significant. 3. Results 3.1. LPS-induced inflammatory response in carp enterocytes To assess the suitable concentration of LPS for the study, the primary cultured fish enterocytes were incubated with graded levels of LPS. The cell viability, PC, LDH and AKP were measured 24 h later. The results indicated that LDH release gradually increased with increasing levels of LPS, suggesting that the cell injury was induced by LPS (Table 2). In contrast, cell viability, as indicated by MTS OD, gradually decreased with increasing levels of LPS exposure (P < 0.05) (Table 2). PC was lower in 10, 20, and 30 mg/L LPS exposure group than other groups (P < 0.05) (Table 2). Table 2 Effect of different concentrations of LPS on LDH activity in media, MTS OD, protein content (PC) and AKP activity of carp enterocytes. The primary cultured carp enterocytes were stimulated with 0, 5, 10, 20 and 30 mg/L LPS for 24 h n ¼ 6, error bars indicate SEM. Values having different letters are significantly different (P < 0.05). LPS (mg/L)

LDH (U/g protein)

0 5 10 20 30

24.94 26.33 42.73 48.30 58.61

± ± ± ± ±

1.11a 0.51a 7.42b 2.23c 5.39d

MTS OD 0.1571 0.1514 0.1413 0.1361 0.1280

± ± ± ± ±

PC (mg protein/well) 0.0068c 0.0100c 0.0055b 0.0035b 0.0050a

442.47 441.67 414.67 406.81 399.27

± ± ± ± ±

6.76c 7.31bc 16.59ab 7.95a 16.70a

AKP (U/g protein) 1.77 1.63 1.49 1.34 1.29

± ± ± ± ±

0.07d 0.06c 0.13b 0.05a 0.05a

460

J. Jiang et al. / Fish & Shellfish Immunology 42 (2015) 457e464

LPS exposure significantly decreased the cellular AKP activity (Table 2). The effect of graded levels of LPS exposure on TNF-a, IL-1b and IL-6 mRNA expression in enterocytes are presented in Fig. 1.

Exposure of enterocytes to LPS at 10, 20, and 30 mg/L caused a significant elevation in expression of TNF-a, IL-1b and IL-6 compared to control (P < 0.05). 3.2. Effect of Arg on LPS-induced cytokine production in vitro

Relative TNF-α mRNA expression

A 4

d 3

c b

2

a

a

1

0

3.3. Effects of Arg on TLR4, Myd88, NF-kBp65 and MAPKp38 signaling pathways in LPS stimulated carp enterocytes

Control

5 mg/L

10 mg/L

20 mg/L

30 mg/L

LPS concentration

Relative IL-1β mRNA expr ession

B 4

d c

3

2

0

a

Control

Dietary Arg supplements administered for 63 days significantly increased the growth of carp compared with the Ctrl group (Fig. 2),

a

5 mg/L

10 mg/L

20 mg/L

30 mg/L

LPS concentration

Relative IL-6 mRNA expr ession

C

4

d

3

c b

2

a 1

0

Control

10 mg/L

Table 3 Effect of different concentrations of Arg on TNF-a, IL-1b, IL-6 and IL-10 mRNA expression in LPS-stimulated carp enterocytes. The cells were pretreated with different concentrations (0, 50, 100, 150, 200, 250, 300 mg/L) of Arg for 72 h prior to stimulation with 10 mg/L of LPS for 24 h n ¼ 6, error bars indicate SEM. Values having different letters are significantly different (P < 0.05). Groups

TNF-a

Ctrl þ Ctrl Ctrl þ LPS 50 mg/L Arg þ LPS 100 mg/L Arg þ LPS 150 mg/L Arg þ LPS 200 mg/L Arg þ LPS 250 mg/L Arg þ LPS 300 mg/L Arg þ LPS

1.00 2.17 1.77 1.47 1.22 1.18 0.91 1.01

± ± ± ± ± ± ± ±

IL-1b 0.10ab 0.27f 0.11e 0.13d 0.29c 0.33bc 0.15a 0.33ab

1.00 1.80 1.75 1.49 1.26 1.03 1.00 1.07

± ± ± ± ± ± ± ±

IL-6 0.11a 0.13d 0.26d 0.16c 0.28b 0.14a 0.23a 0.31a

1.00 1.89 1.74 1.55 1.05 0.95 1.01 0.93

IL-10 ± ± ± ± ± ± ± ±

0.09a 0.21d 0.06c 0.12b 0.24a 0.11a 0.24a 0.26a

1.00 1.70 1.96 2.29 2.49 2.52 2.86 2.65

± ± ± ± ± ± ± ±

0.10a 0.33b 0.36bc 0.42cd 0.47de 0.69de 0.38de 0.49de

Table 4 Effect of different concentrations of Arg on TLR4, Myd88, NF-kB p65, MAPK p38 mRNA expression in LPS-stimulated carp enterocytes. The cells were pretreated with different concentrations (0, 50, 100, 150, 200, 250, 300 mg/L) of Arg for 72 h prior to stimulation with 10 mg/L of LPS for 24 h n ¼ 6, error bars indicate SEM. Values having different letters are significantly different (P < 0.05).

a

5 mg/L

In order to investigate the possible mechanism by which Arg inhibited LPS-induced inflammatory response, the TLR4, Myd88, NF-kBp65, and MAPKp38 mRNA expression were detected by realtime quantitative PCR (Table 4). As shown, TLR4, Myd88, NF-kBp65 and MAPKp38 mRNA expression increased dramatically after 24 h of stimulation with LPS (P < 0.05) and Arg markedly inhibited LPSinduced TLR4, Myd88, NF-kBp65 and MAPKp38 mRNA expression (P < 0.05). 3.4. Protective effect of Arg against LPS-induced inflammatory responses in vivo

b

1

The TNF-a, IL-1b, IL-6 and IL-10 mRNA expression of enterocytes were measured by real-time quantitative PCR. Treatment of primary cultured fish enterocytes with LPS alone resulted in significant increases in TNF-a, IL-1b, IL-6, and IL-10 mRNA expression compared to Ctrl/Ctrl treatment (P < 0.05) (Table 3). However, pre-treatment with Arg completely prevent the increase of TNF-a and IL-6 mRNA expression induced by LPS (P < 0.05) (Table 3). Treatment with 100e300 mg/L Arg led to a statistically significant decrease in IL-1b mRNA expression when compared with Ctrl/LPS (P < 0.05) (Table 3). In contrast, the IL-10 mRNA expression was increased significantly at 100e300 mg/L Arg pre-treatment (P < 0.05) (Table 3).

20 mg/L

30 mg/L

LPS concentration Fig. 1. Effect of different concentrations of LPS on TNF-a, IL-1b and IL-6 mRNA expression of carp enterocytes. The primary cultured carp enterocytes were stimulated with 0, 5, 10, 20 and 30 mg/L LPS for 24 h n ¼ 6, error bars indicate SEM. Values having different letters are significantly different (P < 0.05).

Groups

TLR4

Ctrl þ Ctrl Ctrl þ LPS 50 mg/L Arg þ LPS 100 mg/L Arg þ LPS 150 mg/L Arg þ LPS 200 mg/L Arg þ LPS 250 mg/L Arg þ LPS 300 mg/L Arg þ LPS

1.00 1.74 1.96 1.68 1.52 1.26 1.12 0.90

NF-kB p65

Myd88 ± ± ± ± ± ± ± ±

0.27a 0.45d 0.30cd 0.32c 0.12c 0.41b 0.18ab 0.18a

1.00 2.48 2.37 2.20 1.78 1.25 1.13 1.10

± ± ± ± ± ± ± ±

0.22a 0.42e 0.23de 0.21d 0.22c 0.19b 0.15ab 0.33ab

1.00 1.96 2.01 1.96 1.64 1.39 1.29 1.25

± ± ± ± ± ± ± ±

0.20a 0.58d 0.18d 0.21d 0.24c 0.14b 0.28b 0.23b

MAPK p38 1.00 2.42 2.34 2.07 1.71 1.59 1.58 1.60

± ± ± ± ± ± ± ±

0.11a 0.40d 0.20d 0.23c 0.25b 0.18b 0.32b 0.29b

J. Jiang et al. / Fish & Shellfish Immunology 42 (2015) 457e464

60

Control Arg

*

# 40

461

The effects of Arg on TLR4, Myd88, NF-kBp65, and MAPKp38 mRNA expression in the intestine of fish following LPS exposure are presented in Fig. 4. The results indicated that compared with Ctrl/ Ctrl treatment, Ctrl/LPS caused a significant increase in TLR4, Myd88, NF-kBp65, and MAPKp38 mRNA expression in the intestine (P < 0.05). As expected, dietary Arg pre-supplementation significantly prevented the up-regulation of TLR4, Myd88, NF-kBp65, and MAPKp38 mRNA expression in intestine. 4. Discussion

20

Initial weight

Final weight

Weight gain

Fig. 2. Initial weight, final weight and weight gain of Jian carp (Cyprinus carpio var. Jian) fed diets containing different Arg levels for 63 days. *,#Mean values were significantly different between the control group and Arg group (P < 0.05).

which agreed with the previous study [1]. The effect of Arg on TNFa, IL-1b, IL-6, and IL-10 mRNA expression in intestine of juvenile Jian carp after LPS exposure are presented in Fig. 3. The result showed that the Ctrl/LPS treatment caused significant increase in TNF-a, IL-1b, and IL-6 mRNA expression of intestine when compared with the Ctrl/Ctrl (P < 0.05). However, pre-treatment with Arg prior LPS administration led to a significant lowering of TNF-a, IL-1b, and IL-6 mRNA expression (P < 0.05). Fish exposed to LPS showed an increase in IL-10 mRNA expression of intestine as compared to the Ctrl/Ctrl group (P < 0.05). Pre-treatment with Arg up-regulated the IL-10 mRNA expression (P < 0.05).

B

b

2.5 2.0 1.5

a a

1.0 0.5 0.0

Ctrl/Ctrl

Ctrl/LPS

Arg/LPS

Relative IL-6 mRNA expr ession

C

2.0

b

1.5

a

a

1.0

0.5

0.0

Ctrl/Ctrl

Ctrl/LPS

Arg/LPS

D

2.5

c

2.0

b

1.5

a 1.0 0.5 0.0

Relative IL-1β mRNA expr ession

Relative TNF-α mRNA expression

A

Ctrl/Ctrl

Ctrl/LPS

Arg/LPS

Relative IL-10 mRNA expr ession

0

LPS is a constituent of the outer membrane of Gram negative bacteria, which are part of resident intestinal flora, and can cause gastrointestinal injury. Cytokines, such as TNF-a, IL-1b, and IL-6 have a fundamental role in the regulation of the pro-inflammatory response in fish, playing an important role throughout the infection process [29]. In mammals, very low concentrations of LPS lead to the activation of pro-inflammatory cytokines (TNF-a, IL-1b) and are able to induce a septic shock [30,31]. In fish, higher concentrations of LPS are needed to obtain a similar induction of the cytokine abundance [29,32,33], resulting in a significantly toxicity in rainbow trout intestinal epithelial cell line [17]. In the present study, the exposure of carp enterocytes to LPS, especially at the highest concentration (10 mg/L), caused a general increase in IL-1b, TNF-a and IL-6 mRNA indicating a stimulatory action upon proinflammatory processes. MTS assay is based on the mitochondrial activity of the sperm and commonly used to validate the viability of metabolically active. Active cells produce more formazan than the resting cells, and the amount of formazan formed can be used as an estimate of the number of active mitochondria and hence the living cells in a sample [34,35]. A colorimetric assay using the dye MTS can rapidly quantify the cell viability of European eel (Anguilla anguilla L.) peripheral blood mononuclear cell [36,37]. Using this assay, the

2.0

c b

1.5

a 1.0

0.5

0.0

Ctrl/Ctrl

Ctrl/LPS

Arg/LPS

Fig. 3. The TNF-a, IL-1b, IL-6 and IL-10 mRNA expression in the intestine of juvenile Jian carp fed diets containing different Arg levels for 63 days, followed by exposure to 3 mg LPS/ kg of fish for 2 days. n ¼ 6, error bars indicate SEM. Values having different letters are significantly different (P < 0.05).

462

J. Jiang et al. / Fish & Shellfish Immunology 42 (2015) 457e464

B 2.5

c

2.0

b

1.5

a 1.0 0.5 0.0

Ctrl/Ctrl

Ctrl/LPS

Arg/LPS

Relative MyD88 mRNA expr ession

Relative TLR4 mRNA expr ession

A

2.0

b 1.5

a

a

1.0

0.5

0.0

Ctrl/Ctrl

Ctrl/LPS

Arg/LPS

Re lativ e MAPKp38 mRNA e xpre ssion

D 2.0

c 1.5

b a

1.0

0.5

0.0

Ctrl/Ctrl

Ctrl/LPS

Arg/LPS

Fig. 4. The TLR4, Myd88, NF-kB p38, MAPK p65 mRNA expression in intestine of juvenile Jian carp fed diets containing different Arg levels for 63 days, followed by exposure to 3 mg LPS/kg of fish for 2 days. n ¼ 6, error bars indicate SEM. Values having different letters are significantly different (P < 0.05).

present study showed that cell viability was depressed by LPS (10 mg/L) exposure. This result was in good agreement with a report on rat DRG cells [38]. We also assessed the LDH levels in the medium, a critical marker of cell toxicity [39,40]. The present results demonstrated that exposure to LPS (10 mg/L) alone significantly increased LDH levels in the medium, indicating severe enterocyte damage. AKP serves as an enterocyte differentiation marker and is considered to be involved in the absorption of nutrients [41]. In the present study, Exposure of enterocytes to 10 mg/L LPS was shown to cause a significant decrease in AKP activity compared with the Ctrl group. Thus, in order to induce inflammatory response in carp enterocytes, 10 mg/L LPS was used as the dose to cause inflammatory response to test the protective effects of Arg. In fish, protection of the digestive tract against pathogenic attack is critical for maintaining health since a large number of pathogenic microorganisms invade through its surface [18,42]. TNF-a and IL-1b are called primary cytokines due to their role in initiating an acute inflammatory response [43]. The present result clearly demonstrated that the expression of IL-1b, TNF-a and IL-6 gene were up-regulated in carp enterocytes in response to LPS exposure. Pre-treatment with Arg inhibited TNF-a, IL-1b and IL-6 mRNA expression in a dosedependent manner in LPS stimulated primary cultured fish enterocytes. To our knowledge, the current study is the first to demonstrate Arg could attenuate LPS-induced inflammatory responses in fish enterocytes. Similar results were observed in piglet that Arg stimulates proliferation and prevents endotoxin-induced death of IPEC-1 cells [43]. Liu et al. showed that dietary Arg supplementation could attenuate gut injury induced by LPS challenge through an antiinflammatory role in weaned pigs [44]. IL-10 cytokine is considered to have an anti-inflammatory role, potently inhibiting the capacity of cells to secrete inflammatory mediators, including TNF-a, IL-1b, and IL-6 [45,46]. In the current study, in addition to the finding that Arg decreased TNF-a, IL-6, and IL-1b levels, Arg may potentially up-

regulate IL-10 mRNA expression. Taken together, those results demonstrated that Arg could have potential protective role against LPS-induced inflammatory response. TLRs are transmembrane proteins containing an ectodomain composed of multiple leucine-rich region (LRR) motifs, a transmembrane region, and an intracellular Toll/interleukin-1 receptor (TIR) domain. The diversity of the LRR folding defines the TLR binding specificities and will orchestrate the appropriate innate and adaptive immune responses against the specific pathogen [47]. TLR4 is one type of pattern recognition receptors, which is critical for LPS recognition and cellular responses. Recently, sequencing and functional analysis of TLR4 in zebrafish and rare minnow have demonstrated conservation of TLR4 signaling pathways, involvement in innate immunity [15,48]. MacKenzie and Milston reported that teleost fish also display LPS responsiveness [49,50,51]. Su et al. demonstrated that TLR4 signaling pathway can be triggered by grass carp reovirus and Aeromonas hydrophila infection in rare minnow [15]. Thus, it is possible that piscine TLR4 gene was already implicated in LPS sensing. To clarify the cellular mechanisms that regulated the cytokine production after LPS exposure, we assessed the effects of Arg on TLR4, MAPKp38, and NF-kBp65 mRNA expression. The MAPKp38 and NF-kBp65 are the family members of MAPK and NF-kB respectively, and they are the main signaling molecules in TLR4-Myd88 signaling pathway of their family [52,53,54]. Over-activation of this signaling pathway would aggravate inflammatory reaction and then have negative effects on organism. The present results demonstrated that mRNA levels of TLR4, Myd88, MAPKp38, and NF-kBp65 were up-regulated in response to LPS. Arg pre-treatment prevented the increase in the TLR4, Myd88, MAPKp38, and NF-kBp65 mRNA expression. But how Arg interacts with TLR4 signaling pathway is unknown by now. Based on the beneficial effects of Arg against LPS-induced inflammatory response in the enterocytes, it was reasonable to

J. Jiang et al. / Fish & Shellfish Immunology 42 (2015) 457e464

463

References

Fig. 5. The potential action pathway of Arg against LPS induced inflammatory response in the intestine of juvenile Jian carp (Cyprinus carpio var. Jian).

hypothesize that Arg can protect fish against LPS-induced inflammatory response in vivo. The present study showed fish were intraperitoneally injected with 3 mg LPS/kg fish, which could induce inflammatory response. The TNF-a, IL-6, and IL-1b mRNA abundance in intestine were enhanced after LPS injection. Several studies have looked at the effects of LPS on the immune system in fish and have demonstrated a high potential for mediating proinflammatory cytokine mRNA abundance in vitro and in vivo [49,55,56]. It is well known that TLR4 is the mammal receptor for bacterial LPS-ligand [57]. Interestingly, Arg pre-supplementation could alleviate inflammatory response induced by LPS. Arg presupplementation decreased TLR4, Myd88, MAPKp38, and NFkBp65 mRNA expression. These results indicate that Arg may possess a protective effect on LPS-stimulated carp through TLR4Myd88 signaling pathway. This result was in agreement with this statement in vitro. Studies from piglet also indicated Arg supplementation alleviates immune challenge induced by Salmonella enterica serovar Cholerasuis bacterin potentially through TLR4Myd88 signaling pathway [10]. However, the mechanisms await further characterization. In conclusion, LPS exposure could induce inflammatory response, resulting in up-regulation TNF-a, IL-6, and IL-1b mRNA abundance in intestine and the enterocytes of fish. Dietary and medium pre-supplementation with Arg could alleviate LPSinduced immune damage in fish intestine and the enterocytes, respectively. The protective effects of Arg on LPS-induced inflammatory response are associated with decreasing the expression of proinflammatory by down-regulating TLR4, Myd88, NF-kBp65 and MAPKp38 mRNA abundance (Fig. 5).

Acknowledgments This study was financially supported by the Youth Foundation Program of the Education Department of Sichuan Province, China (14ZB0021) and Sichuan Province Science and Technology Support Program, China (2014FZ0026). The authors would like to express their sincere thanks to the personnel of these teams for their kind assistance.

[1] Chen G, Feng L, Kuang S, Liu Y, Jiang J, Hu K, et al. Effect of dietary arginine on growth, intestinal enzyme activities and gene expression in muscle, hepatopancreas and intestine of juvenile Jian carp (Cyprinus carpio var. Jian). Brit J Nutr 2012;108:195e207. [2] Buentello JA, Gatlin III DM. Effects of elevated dietary arginine on resistance of channel catfish to exposure to Edwardsiella ictaluri. J Aquat Anim Health 2001;13:194e201. [3] Lin M, Shiau S. Dietary L-ascorbic acid affects growth, nonspecific immune responses and disease resistance in juvenile grouper, Epinephelus malabaricus. Aquac 2005;244:215e21. [4] Sahoo PK, Meher PK, Mahapatra KD, Saha JN, Jana RK, Reddy PV. Immune responses in different fullsib families of Indian major carp, Labeo rohita, exhibiting differential resistance to Aeromonas hydrophila infection. Aquac 2004;238:115e25. [5] Tibaldi E, Tulli F, Lanari D. Arginine requirement and effect of different dietary arginine and lysine levels for fingerling sea bass (Dicentrarchus labrax). Aquac 1994;127:207e18. [6] Luzzana U, Hardy RW, Halver JE. Dietary arginine requirement of fingerling coho salmon (Oncorhynchus kisutch). Aquac 1998;163:137e50. [7] Pohlenz C, Buentello A, Mwangi W, Gatlin III DM. Arginine and glutamine supplementation to culture media improves the performance of various channel catfish immune cells. Fish Shellfish Immunol 2012;32:762e8. [8] Field CJ, Johnson I, Pratt VC. Glutamine and arginine: immunonutrients for improved health. Med Sci Sport Exerc 2000;32:S377e88. [9] Field CJ, Johnson IR, Schley PD. Nutrients and their role in host resistance to infection. J Leukoc Biol 2002;71:16e32. [10] Chen Y, Chen D, Tian G, He J, Mao X, Mao Q, et al. Dietary arginine supplementation alleviates immune challenge induced by Salmonella enterica serovar Choleraesuis bacterin potentially through the Toll-like receptor 4-myeloid differentiation factor 88 signalling pathway in weaned piglets. Br J Nutr 2012;108:1069e76. [11] Press CM, Evensen Ø. The morphology of the immune system in teleost fishes. Fish Shellfish Immunol 1999;9:309e18. [12] O'Neill LA, Golenbock D, Bowie AG. The history of Toll-like receptors-redefining innate immunity. Nat Rev Immunol 2013;13:453e60. [13] Miyake K. Innate immune sensing of pathogens and danger signals by cell surface Toll-like receptors. In: Seminars in immunology. Elsevier; 2007. p. 3e10. [14] Kawai T, Akira S. The roles of TLRs, RLRs and NLRs in pathogen recognition. Int Immunol 2009;21:317e37. [15] Su J, Yang C, Xiong F, Wang Y, Zhu Z. Toll-like receptor 4 signaling pathway can be triggered by grass carp reovirus and Aeromonas hydrophila infection in rare minnow Gobiocypris rarus. Fish Shellfish Immunol 2009;27:33e9. [16] Arnemo M, Kavaliauskis A, Gjøen T. Effects of TLR agonists and viral infection on cytokine and TLR expression in Atlantic salmon (Salmo salar). Dev Comp Immunol 2014;46:139e45. [17] Kawano A, Haiduk C, Schirmer K, Hanner R, Lee L, Dixon B, et al. Development of a rainbow trout intestinal epithelial cell line and its response to lipopolysaccharide. Aquac Nutr 2011;17:e241e52. [18] Komatsu K, Tsutsui S, Hino K, Araki K, Yoshiura Y, Yamamoto A, et al. Expression profiles of cytokines released in intestinal epithelial cells of the rainbow trout, Oncorhynchus mykiss, in response to bacterial infection. Dev Comp Immunol 2009;33:499e506. [19] Mulder IE, Wadsworth S, Secombes CJ. Cytokine expression in the intestine of rainbow trout (Oncorhynchus mykiss) during infection with Aeromonas salmonicida. Fish Shellfish Immunol 2007;23:747e59. [20] Jiang J, Zheng T, Zhou XQ, Liu Y, Feng L. Influence of glutamine and vitamin E on growth and antioxidant capacity of fish enterocytes. Aquacu Nutr 2009;15: 409e14. [21] Jiang W, Liu Y, Jiang J, Hu K, Li S, Feng L, et al. In vitro interceptive and reparative effects of myo-inositol against copper-induced oxidative damage and antioxidant system disturbance in primary cultured fish enterocytes. Aquat Toxicol 2013;132:100e10. [22] Jiang J. Effects of glutamine on the growth and metabolism of enterocytes in Jian carp (Cyprinus carpio var. Jian). Ya'an: Sichuan Agricultural University; 2005. [23] Shiau S, Su S. Juvenile tilapia (Oreochromis niloticus  Oreochromis aureus) requires dietary myo-inositol for maximal growth. Aquac 2005;243:273e7. [24] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248e54. [25] Krogdahl Å, Bakke McKellep AM, Baeverfjord G. Effects of graded levels of standard soybean meal on intestinal structure, mucosal enzyme activities, and pancreatic response in Atlantic salmon (Salmo salar L.). Aquac Nutr 2003;9: 361e71. [26] Ahn SK, Hong S, Park YM, Choi JY, Lee WT, Park KA, et al. Protective effects of agmatine on lipopolysaccharide-injured microglia and inducible nitric oxide synthase activity. Life Sci 2012;91:1345e50. [27] Tang S, Wu C, Wu S, Peng C, Perng W, Kang B, et al. Stanniocalcin-1 ameliorates lipopolysaccharide-induced pulmonary oxidative stress, inflammation, and apoptosis in mice. Free Radic Bio Med 2014;71:321e31.

464

J. Jiang et al. / Fish & Shellfish Immunology 42 (2015) 457e464

[28] Mulier B, Rahman I, Watchorn T, Donaldson K, MacNee W, Jeffery PK. Hydrogen peroxide-induced epithelial injury: the protective role of intracellular nonprotein thiols (NPSH). Eur Respir J 1998;11:384e91. [29] Jung HC, Eckmann L, Yang S, Panja A, Fierer J, Morzycka-Wroblewska E, et al. A distinct array of proinflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion. J Clin Invest 1995;95:55. [30] Leng W, Liu Y, Shi H, Li S, Zhu H, Pi D, et al. Aspartate alleviates liver injury and regulates mRNA expressions of TLR4 and NOD signaling-related genes in weaned pigs after lipopolysaccharide challenge. J Nutr Biochem 2014;25: 592e9. €cker C, Weylandt KH, Kahlke L, Wang J, Lobeck H, Tiegs G, et al. Omega[31] Schmo 3 fatty acids alleviate chemically induced acute hepatitis by suppression of cytokines. Hepatology 2007;45:864e9. [32] Roher N, Callol A, Planas JV, Goetz FW, MacKenzie SA. Endotoxin recognition in fish results in inflammatory cytokine secretion not gene expression. Innate Immun 2010. [33] Teles M, MacKenzie S, Boltana S, Callol A, Tort L. Gene expression and TNFalpha secretion profile in rainbow trout macrophages following exposures to copper and bacterial lipopolysaccharide. Fish Shellfish Immunol 2011;30: 340e6. [34] Aziz DM. Assessment of bovine sperm viability by MTT reduction assay. Anim Reprod Sci 2006;92:1e8. [35] Siddique RA, Atreja SK. Effect of L-Arginine and spermine-NONOate on motility, viability, membrane integrity and lipid peroxidation of Murrah buffalo (Bubalus bubalis) spermatozoa. Livest Sci 2013;153:147e53.  María Came rrez-Praena D, Pichardo S, Jos A, [36] Gutie an A. Toxicity and glutathione implication in the effects observed by exposure of the liver fish cell line PLHC-1 to pure cylindrospermopsin. Ecotoxicol Environ Saf 2011;74: 1567e72. [37] Pierrard M, Roland K, Kestemont P, Dieu M, Raes M, Silvestre F. Fish peripheral blood mononuclear cells preparation for future monitoring applications. Anal Biochem 2012;426:153e65. [38] Tse KH, Chow KBS, Leung WK, Wong YH, Wise H. Lipopolysaccharide differentially modulates expression of cytokines and cyclooxygenases in dorsal root ganglion cells via Toll-like receptor-4 dependent pathways. Neurosci 2014;267:241e51. € rster I, Schins RP. Cytotoxicity and oxida[39] Gerloff K, Albrecht C, Boots AW, Fo tive DNA damage by nanoparticles in human intestinal Caco-2 cells. Nanotoxicol 2009;3:355e64. [40] Koh JY, Choi DW. Quantitative determination of glutamate mediated cortical neuronal injury in cell culture by lactate dehydrogenase efflux assay. J Neurosci Methods 1987;20:83e90. [41] Villanueva J, Vanacore R, Goicoechea O, Amthauer R. Intestinal alkaline phosphatase of the fish Cyprinus carpio: regional distribution and membrane association. J Exp Zool 1997;279:347e55. [42] Ringø E, Løvmo L, Kristiansen M, Bakken Y, Salinas I, Myklebust R, et al. Lactic acid bacteria vs. pathogens in the gastrointestinal tract of fish: a review. Aquac Res 2010;41:451e67.

[43] Skotnicka B, Hassmann E. Proinflammatory and immunoregulatory cytokines in the middle ear effusions. Int J Pediatr Otorhinolaryngol 2008;72:13e7. [44] Liu Y, Huang J, Hou Y, Zhu H, Zhao S, Ding B, et al. Dietary arginine supplementation alleviates intestinal mucosal disruption induced by Escherichia coli lipopolysaccharide in weaned pigs. Brit J Nutr 2008;100:552e60. [45] Foey AD, Parry SL, Williams LM, Feldmann M, Foxwell BM, Brennan FM. Regulation of monocyte IL-10 synthesis by endogenous IL-1 and TNF-a: role of the p38 and p42/44 mitogen-activated protein kinases. J Immunol 1998;160: 920e8. [46] Fiorentino DF, Zlotnik A, Mosmann TR, Howard M, O'Garra A. IL-10 inhibits cytokine production by activated macrophages. J Immunol 1991;147: 3815e22. [47] Werling D, Jann OC, Offord V, Glass EJ, Coffey TJ. Variation matters: TLR structure and species-specific pathogen recognition. Trends Immunol 2009; 30:124e30. [48] Jault C, Pichon L, Chluba J. Toll-like receptor gene family and TIR-domain adapters in Danio rerio. Mol Immunol 2004;40:759e71. [49] MacKenzie S, Planas JV, Goetz FW. LPS-stimulated expression of a tumor necrosis factor-alpha mRNA in primary trout monocytes and in vitro differentiated macrophages. Dev Comp Immunol 2003;27:393e400. [50] MacKenzie S, Iliev D, Liarte C, Koskinen H, Planas JV, Goetz FW, et al. Transcriptional analysis of LPS-stimulated activation of trout (Oncorhynchus mykiss) monocyte/macrophage cells in primary culture treated with cortisol. Mol Immunol 2006;43:1340e8. [51] Milston RH, Vella AT, Crippen TL, Fitzpatrick MS, Leong JC, Schreck CB. In vitro detection of functional humoral immunocompetence in juvenile chinook salmon (Oncorhynchus tshawytscha) using flow cytometry. Fish Shellfish Immunol 2003;15:145e58. [52] Hsieh Y, Frink M, Thobe BM, Hsu J, Choudhry MA, Schwacha MG, et al. 17bEstradiol downregulates Kupffer cell TLR4-dependent p38 MAPK pathway and normalizes inflammatory cytokine production following trauma-hemorrhage. Mol Immunol 2007;44:2165e72. [53] Palmer CD, Mutch BE, Workman S, McDaid JP, Horwood NJ, Foxwell BM. Bmx tyrosine kinase regulates TLR4-induced IL-6 production in human macrophages independently of p38 MAPK and NFkB activity. Blood 2008;111: 1781e8. [54] Yang Y, Zhou H, Yang Y, Li W, Zhou M, Zeng Z, et al. Lipopolysaccharide (LPS) regulates TLR4 signal transduction in nasopharynx epithelial cell line 5-8F via NFkB and MAPKs signaling pathways. Mol Immunol 2007;44:984e92. [55] Darawiroj D, Kondo H, Hirono I, Aoki T. Immune-related gene expression profiling of yellowtail (Seriola quinqueradiata) kidney cells stimulated with ConA and LPS using microarray analysis. Fish Shellfish Immunol 2008;24:260e6. ~ a S, Tridico R, Teles M, Mackenzie S, Tort L. Lipopolysaccharides isolated [56] Boltan from Aeromonas salmonicida and Vibrio anguillarum show quantitative but not qualitative differences in inflammatory outcome in Sparus aurata (Gilthead seabream). Fish Shellfish Immunol 2014;39(2):475e82. [57] Kawai T, Akira S. Signaling to NF-kB by Toll-like receptors. Trends Mol Med 2007;13:460e9.