Involvement of CRH and hCG in the induction of aromatase by cortisol in human placental syncytiotrophoblasts

Placenta 35 (2014) 30e36

Contents lists available at ScienceDirect

Placenta journal homepage: www.elsevier.com/locate/placenta

Involvement of CRH and hCG in the induction of aromatase by cortisol in human placental syncytiotrophoblastsq W.S. Wang a, C. Liu a, W.J. Li b, P. Zhu c, J.N. Li a, K. Sun a, d, * a

School of Life Sciences, Fudan University, Shanghai 200433, PR China Maternity and Infant Health Hospital of Changning District, Shanghai 200051, PR China c Department of Obstetrics and Gynecology, No. 401 Hospital, Qingdao 266100, PR China d Center of Reproductive Medicine, Renji Hospital, School of Medicine, Shanghai Jiaotong University, Shanghai 200135, PR China b

a r t i c l e i n f o

a b s t r a c t

Article history: Accepted 29 October 2013

Introduction: Increased estrogen production in placenta towards the end of gestation plays a pivotal role in the onset of human labor. Estrogen transforms myometrium from a quiescent to a contractile status. Glucocorticoids have been shown to induce estrogen production through the transcription factor specificity protein 1 (Sp1)-mediated induction of aromatase transcription upon elevation of cyclic adenosine mono-phosphate (cAMP) level in human placental syncytiotrophoblasts. However, it is unclear how glucocorticoids activate cAMP pathway thereby inducing aromatase expression in human placental syncytiotrophoblasts. Material and methods: We investigated this issue in cultured primary human placental syncytiotrophoblasts prepared from placentas collected at term without labor. Results: We demonstrated that cortisol (0.01e1 mM) dose-dependently increased corticotropin-releasing hormone (CRH) and human chorionic gonadotropin (hCG) a/b subunit expression and their production in the syncytiotrophoblasts. The induction of intracellular cAMP level, Sp1 expression, Sp1 enrichment at the aromatase promoter as well as aromatase expression by cortisol could be partially attenuated by either hCG antibody (1:100) or CRH receptor antagonist a-helical-CRH (1 mM), and further attenuated by combination of hCG antibody and a-helical-CRH. Conclusions: Cortisol increases aromatase expression via induction of CRH and hCG production and subsequent elevation of cAMP level and enrichment of Sp1 at the aromatase promoter in human placental syncytiotrophoblasts. These findings may account for the parallel increases of cortisol and estrogen production prior to the onset of parturition. Ó 2013 Elsevier Ltd. All rights reserved.

Keywords: Cortisol CRH hCG Aromatase Placenta Estrogen

1. Introduction It is well known that the rise in estrogen level towards the end of gestation plays a pivotal role in the onset of parturition in a number of mammalian species including humans, and this surge of estrogen transforms the myometrium from a quiescent to a contractile state via the induction of contraction-associated proteins (CAPs) such as connexin 43, oxytocin receptor and prostaglandin receptors etc [1,2]. In most mammalian species, the rise in estrogen is accompanied by a decline of progesterone, a dominant hormone which

q This work was supported by Natural Science Foundation of China (81330018, 81270704), and National Key Basic Research Program of China (2011CB944403). * Corresponding author. Center of Reproductive Medicine, Renji Hospital, School of Medicine, Shanghai Jiaotong University, 845 Lingshan Road, Pudong New District, Shanghai 200135, PR China. Tel./fax: þ86 21 20284517. E-mail address: [email protected] (K. Sun). 0143-4004/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.placenta.2013.10.018

keeps the myometrium quiescent prior to the onset of labor [1,3]. Glucocorticoids derived from the fetal adrenal glands are believed to be responsible for the reciprocal changes in estrogen and progesterone levels towards the end of gestation thereby priming the myometrium towards a contractile state. This action of glucocorticoids is accomplished by the induction of P450 c17 hydoxylase, encoded by CYP17 gene, converting progesterone to C19-steroids, which serves as substrates for aromatase in estrogen synthesis. However, the synthesis of estrogen from progesterone in human placenta is disabled by the absence of P450 c17 hydoxylase. To circumvent this limitation, human placenta relies on the aromatization of C19-steroids, dehydroepiandrosterone (DHEA) and its sulfate derived from the adrenal glands by aromatase for estrogen synthesis thereby bypassing the step catalyzed by P450 c17 hydoxylase [4]. We have demonstrated that cortisol stimulates the production of estrogen via induction of aromatase expression in human placental syncytiotrophoblasts following the enrichment of

W.S. Wang et al. / Placenta 35 (2014) 30e36

the specificity protein 1 (Sp1) at the aromatase promoter upon activation of the cAMP pathway [5]. Glucocorticoids are well known to operate via the intracellular glucocorticoid receptor to execute their transcriptional activities [6]. It remains largely unknown how glucocorticoids could activate the cAMP signaling pathway in the induction of aromatase in human placental syncytiotrophoblasts. Among hormones secreted by human placental syncytiotrophoblast that operate via the cAMP signaling pathway, corticotropin releasing hormone (CRH) and human chorionic gonadotropin (hCG) are most noteworthy. CRH, a classical hypothalamic hormone, has been found to be synthesized locally in placental syncytiotrophoblast and is believed to play a functional role in human parturition [7,8]. The G-protein-coupled CRH receptors classically activate adenylyl cyclase [9e11], although alternative signaling pathways are also proposed [12,13]. Like CRH, hCG is another abundant hormone secreted by placental syncytiotrophoblasts activating the cAMP signaling pathway through a G protein-coupled receptor shared with the pituitary luteinizing hormone (LH) [14,15]. We and others have demonstrated that glucocorticoids increase both CRH and hCG expression and production in human placental syncytiotrophoblasts [16,17]. Thus it is conceivable to speculate that glucocorticoids may activate the cAMP pathway via CRH and hCG thereby enhancing the enrichment of Sp1 at the aromatase promoter and increasing aromatase expression. Here we tested this hypothesis in cultured primary human placental syncytiotrophoblasts. 2. Materials and methods 2.1. Preparation and culture of human placental trophoblasts Human placentas were obtained from uncomplicated term (38e40 weeks) pregnancies after elective cesarean section without labor following a protocol approved by the Ethics Committee of School of Life Sciences of Fudan University. Placental cytotrophoblast cells were prepared using a modified method of Kliman [18] as described previously [19]. In brief, aliquots of villous tissue were removed randomly from the maternal side of the placenta. The tissue were minced after washing with normal saline and digested with 0.125% trypsin (Sigma Chemical Co., St. Louis, MO) and 0.03% DNase I (Sigma) in Dulbecco Modified Eagle medium (DMEM; Gibco, Grand Island, NY). The dispersed placental cells were purified using a 5e65% Percoll (GE Healthcare Bio-Sciences, Uppsala, Sweden) gradient at step increments of 5%. The cytotrophoblasts between densities of 1.049 g/ml and 1.062 g/ ml were collected and plated at 1.5  106 cells/well in 6 well plate for culture at 37  C in 5% CO2-95% air in DMEM containing 10% Fetal calf serum (FCS, HyClone) and 1% antibiotics (Gibco) to allow maximal syncytialization in vitro for three days. 2.2. Treatment of the syncytiotrophoblasts Three days after plating, the cells were treated in serum-free medium. To examine the time course effect of cortisol on CRH, hCG a/b subunit, Sp1 and aromatase mRNA levels, the cells were treated with cortisol (1 mM, Sigma) for 3, 6, 12 and 24 h, and medium was collected for the measurement of CRH and hCG secretion at 6, 12 and 24 h. The cells were also treated with 0.01, 0.1 and 1 mM cortisol for 12 h to test the dose-dependent effect. To determine if hCG and CRH are involved in the effect of cortisol, the cells were treated with cortisol (1 mM) in the presence and absence of non-selective CRH receptor antagonist a-helical-CRH (a-h-CRH) (1 mM, Tocris Bioscience, Minneapolis, MN) or hCG antibody (1:100, Sigma) or combination of a-h-CRH and hCG antibody for 24 h for the examination of aromatase and Sp1 mRNA and protein levels as well as the binding of Sp1 to aromatase promoter, and for 12 h for the examination of intracellular cAMP level. In all experiments, the antibody to hCG was added 15 min prior to cortisol treatment. For control, equal amount of preimmune serum was added instead of hCG antibody. The concentrations of a-h-CRH and hCG antibody were chosen according to literature report [17,20] and our pilot study. 2.3. Extraction of RNA and analysis with qRT-PCR Messenger RNA of the extracted total cellular RNA from the above trophoblasts was reverse-transcribed to cDNA using PrimeScriptÒ RT Master Mix Perfect Real Time kit (TaKaRa, Dalian, China), and cDNA was used for the measurement of CRH, hCG a/b subunit, aromatase and Sp1 mRNA levels with qRT-PCR using power SYBRÒ Premix Ex TaqÔ (TaKaRa). The absolute mRNA levels in each sample were calculated according to a standard curve set up using serial dilutions of known amounts of specific templates against corresponding cycle threshold (Ct) values. For sampling error control, qRT-PCR for housekeeping gene b-actin was performed on each

31

sample. The ratio of the target gene over b-actin in each sample was obtained to normalize the expression of the target gene. The primer sequences for amplifying human Actb, CYP19, Sp1, CRH, hCG a and b subunit mRNA are illustrated in Table 1. 2.4. Extraction of protein and analysis with Western blotting Total cellular protein was extracted from the above treated trophoblasts using ice-cold radioimmunoprecipitation assay (RIPA) lysis buffer (Active Motif, Carlsbad, CA) containing protease inhibitor cocktail (Merck, Millipore). Protein levels of aromatase and Sp1 were examined following a standard Western blotting protocol. Briefly, 35 mg protein of each sample were electrophoresed in 8% SDSpolyacrylamide gel and transferred to the nitrocellulose membrane. After blocking with 5% non-fat milk, the membrane was incubated with aromatase antibody (Santa Cruz, 1:500) or Sp1 antibody (Santa Cruz, 1:1000) overnight. After washing, the membrane was incubated with appropriate secondary antibody conjugated with horseradish peroxidase (Sigma) for 1 h. The enhanced chemiluminescent detection system (Millipore) was used to detect the bands with peroxidase activity. To control sampling error, the same blot was also probed for GAPDH (CMC scientific, shanghai, 1:10000) as internal control. 2.5. Measurement of hCG and CRH secretion The syncytiotrophoblasts were treated with cortisol (1 mM) in serum-free DMEM. Culture medium was collected at 6, 12 and 24 h. The level of hCG b subunit in the medium was measured with a chemiluminescent microparticle immunoassay (CMIA) kit (Abbott Laboratories, Abbott Park, IL), and the CRH level in the medium was assayed using an enzyme immunoassay assay kit (Phoenix Pharmaceuticals, Inc., Belmont, CA) following a protocol provided by the manufacturer. 2.6. Intracellular cAMP assay The intracellular cAMP level in the presence of phosphodiesterase inhibitor 3isobutyl-1-methyl xanthine (IBMX) (500 mM, Sigma) in the syncytiotrophoblasts was measured using an ELISA kit (R&D Systems, Minneapolis, MN) after treatment with cortisol (1 mM) for 12 h in the presence and absence of non-selective CRH antagonist a-helical-CRH (1 mM) or hCG antibody (1:100) or a combination of a-hCRH and hCG antibody. This time point was chosen according to our pilot study. After treatment, the cells were washed three times with ice-cold PBS (1 ml) and lysed in Cell Lysis BufferÔ (200 ml, R&D Systems) and subjected to three freezeethaw cycles in the presence of IBMX. Lysates were assayed for the cAMP level following the manufacturer’s protocol. 2.7. Chromatin immunoprecipitation (ChIP) assay The binding of Sp1 to aromatase promoter after treatment with cortisol (1 mM) for 24 h in the presence and absence of non-selective CRH antagonist a-helical-CRH (1 mM) or hCG antibody (1:100) or a combination of a-h-CRH and hCG antibody was examined with ChIP assay. After treatment, the placental syncytiotrophoblasts were fixed with 1% formaldehyde to cross-link the protein on chromatin DNA, which was terminated with 1 M glycine. After washing with ice-cold PBS, the cells were scraped off and lysed with 1% sodium dodecyl sulfate lysis buffer supplemented with protease inhibitor cocktail on ice. The lysed cells were sonicated to shear the chromatin DNA to an optimal size around 500 bp. After precleaning with protein A agarose/ Salmon Sperm DNA (Millipore), sheared chromatin DNA was immunoprecipitated with 4 mg of antibodies against Sp1 (Santa Cruz). Non-immune IgG served as

Table 1 Primer sequences used for PCR. Genes Actb Forward Reverse CYP19 Forward Reverse Sp1 Forward Reverse CRH Forward Reverse hCGa Forward Reverse hCGb Forward Reverse

Primer sequences (50 e30 )

Genbank accession PCR product no. size (bp)

GGGAAATCGTGCGTGACATTAAG NM_001101 TGTGTTGGCGTACAGGTCTTTG

275

TGGCTACCCAGTGAAAAAGG CCATGGCGATGTACTTTCCT

NM_000103

182

GTTTCCTTGGGGCAGACCAG TCCTTCCTCTCCACCTGCTG

NM_138473

288

GCCTCCCATCTCCCTGGAT TGTGAGCTTGCTGTGCTAACTG

NM_000756

88

ACATTGTCGGTGTTTCTGC GGACCTTAGTGGAGTGGG

NM_000735

162

CGGGACATGGGCATCCAA GCGCACATCGCGGTAGTT

NM_000737

202

W.S. Wang et al. / Placenta 35 (2014) 30e36

B

3. Results

3.2. Effect of CRH receptor antagonist and hCG antibody on cortisolinduced aromatase and Sp1 expression in human placental syncytiotrophoblasts Although neutralization of hCG with its antibody (1:100) or blockade of CRH receptors with non-selective antagonist a-h-CRH (1 mM) did not affect basal levels of aromatase and Sp1 mRNA and protein, the combination of hCG antibody and a-h-CRH significantly reduced basal levels of aromatase (Fig. 2A, B) and Sp1 (Fig. 3A, B) mRNA and protein, suggesting that the maintenance of the basal expression of aromatase and Sp1 might require the joint effects of hCG and CRH. The induction of aromatase (Fig. 2A, B) and Sp1 (Fig. 3A, B) mRNA and protein by cortisol treatment (1 mM, 24 h) could be partially attenuated by either hCG antibody or a-h-CRH, and further attenuated by combined treatment with hCG antibody and a-hCRH. This data suggests that both CRH and hCG are involved in the induction of aromatase and Sp1 expression by cortisol in human placental syncytiotrophoblasts.

2

3h

**

*

6h

12 h

24 h

** *

1.5

***

*

*

1 0.5

Aromatase 1.4

Sp1

CRH

**

1.0 0.8 0.6 *

0.4 0.2 0

C

6h

12h

Ctr F

*

8 6 4 2

*

0

24h

hCGβ

hCGα 10

Ctr F

1.2

6h

12h

CRH hCGα hCGβ

2.5 Fold change of mRNA level (ratio to β-actin )

Consistent with the previous study [5], treatment of the syncytiotrophoblasts with cortisol (1 mM) significantly increased aromatase and Sp1 mRNA levels at the incubation time of 24 h but not at the incubation time points prior to 24 h (Fig. 1A). A significant increase in CRH mRNA level was detected at the incubation time of 6 and 12 h but not 3 and 24 h, while significant increases in hCG a and b subunit mRNA levels were detected at the incubation time of 12 and 24 h but not 3 and 6 h (Fig. 1A). Enzyme immunoassay and chemiluminescent microparticle immunoassay showed increased production of CRH and hCG b subunit in the culture medium upon treatment with cortisol (1 mM) for 12 and 24 h but not for 6 h (Fig. 1B). Like the dosedependent induction of aromatase and Sp1 mRNA by cortisol [5], the induction of CRH, hCG a and b subunit mRNA by cortisol (0.01, 0.1, 1 mM, 12 h) was also concentration-dependent (Fig. 1C). This data suggests that the changes in aromatase and Sp1 expression might be a subsequential hormonal effect in response to increased CRH and hCG production following cortisol treatment of the syncytiotrophoblasts.

0h ***

0

All data are reported as mean  SEM. The number of each experiment indicates repeated experiments using placentas from different pregnancies. One way ANOVA test followed by the Student-Newman-Keuls test was used to analyze the data. Significance was set at P < 0.05.

3.1. Time course and dose-dependent effect of cortisol on aromatase/Sp1/hCG subunit/CRH mRNA levels and hCG/CRH production in human placental syncytiotrophoblasts

2.5

CRH concentration (ng/mL)

2.8. Statistical analysis

A Fold change of mRNA level (ratio to β-actin )

negative control. The immunoprecipitate was then incubated with Magna ChIPÔ Protein A agarose Magnetic Beads (Millipore) and pulled down on magnetic stand. After washing, reverse cross-linking was performed in 5 M NaCl at 65 C overnight. Contaminating RNA was cleaned with RNase A and protein was digested with proteinase K. Finally, the sheared DNA recovered was extracted for further qRT-PCR analysis. The sequences of the primers spanning the Sp1 binding region used for PCR are 50 -ATGTAGAGGTGCTTTAGGCCTC-30 (forward) and 50 -CTGTCCAGATTCTTCTTCCTCT-30 (reverse). The same amount of sheared DNA without antibody precipitation was also processed for reverse cross-linking and served as input control. For qRT-PCR, the absolute DNA levels in each sample were calculated according to a standard curve set up using serial dilutions of known amounts of specific templates against corresponding cycle threshold (Ct) values. The ratio of DNA precipitated by Sp1 antibody over input control was obtained. Some of the samples obtained from qRT-PCR that was terminated around 30 cycles were also electrophoresed in 1% agarose gel.

hCG β subunit concentration (IU/l)

32

2

24h

** ** *

1.5 **

**

*

***

**

1 0.5 0 0

0.01 0.1 Cortisol(μM)

1

Fig. 1. Time course and dose-dependent effects of cortisol (F) on aromatase/Sp1/hCG subunit/CRH mRNA levels and hCG/CRH production in human placental syncytiotrophoblasts. A, Time course effect of cortisol (1 mM) on the mRNA levels of aromatase/ Sp1/hCG subunit/CRH, n ¼ 6; B, Time course effect of cortisol (1 mM) on hCG/CRH production by placental syncytiotrophoblasts, n ¼ 5; C, Concentration-dependent effect of cortisol (0.01, 0.1, 1 mM, 12 h) on the mRNA levels of hCG subunit and CRH, n ¼ 5. * P < 0.05, **P < 0.01, ***P < 0.001 vs. 0 h or control (Ctr) or 0 mM.

3.3. Effect of CRH receptor antagonist and hCG antibody on cortisolinduced intracellular cAMP change and Sp1 binding to aromatase promoter in human placental syncytiotrophoblasts Combined treatment with hCG antibody and a-h-CRH caused a non-significant but marginal reduction in cAMP level (Q ¼ 3.517 vs Q ¼ 3.770（P < 0.05）). Treatment of syncytiotrophoblasts with cortisol (1 mM, 12 h) significantly increased intracellular cAMP level, which was partially attenuated by either hCG antibody (1:100)or ah-CRH (1 mM), and further attenuated by combined treatment with hCG antibody and a-h-CRH (Fig. 4A). ChIP assay revealed that hCG antibody (1:100) or a-h-CRH (1 mM) alone did not affect the basal enrichment of Sp1 at the aromatase promoter, but partially attenuated the enrichment of Sp1 at the aromatase promoter by cortisol (1 mM, 24 h). Furthermore, both basal and cortisol-enhanced enrichment of Sp1 at the aromatase promoter was significantly attenuated by combined treatment with hCG antibody and a-hCRH (Fig. 4B). These data suggest that there is basal activation of cAMP pathway and Sp1 binding to aromatase promoter under the combined effects of hCG and CRH, which is further increased by cortisol treatment.

W.S. Wang et al. / Placenta 35 (2014) 30e36

2.5 ***

Aromatase mRNA level (ratio to β-actin )

2.0

### ^^

1.5 *

1.0

###

0.5 0 r Ct

B

### $

F

r Ct

b RH RH RH H Ab F + A -CR -h- C h-C -h-C h α- + α + α- b + α F Ab F+ A RH H -C R h H C α CR hRH -h- α- b + Ab h-C + α b + A b + α- F A F+ F A F

Aromatase

58kD

GAPDH 0.6

34kD

DHEA and estradiol concentrations increase towards term [23], and lower DHEA and estradiol levels are reported in post-term patients who are non-responsive to induction of labor [24,25] suggesting their myometrium has not been primed and that production of estrogen is critical. As well as confirming the induction of hCG and CRH expression and production by glucocorticoids in the syncytiotrophoblasts [16,17], here we have demonstrated that hCG and CRH not only maintain the basal expression of aromatase but also account for the cortisol-induced expression of aromatase. These results suggest that the basal and cortisol-induced aromatase expression require the participation of multiple factors such as hCG and CRH secreted

A

***

*** ### ^

### $

5 4

*

###

3 2 1

0.5

0 ### ^

0.4

r Ct

### $

0.3 *

0.2

###

B

0.1 0 r Ct

F

Fig. 2. Effect of CRH receptor antagonist and hCG antibody on cortisol-induced aromatase expression in human placental syncytiotrophoblasts. A, CRH receptor antagonist a-h-CRH (1 mM) or hCG antibody (Ab, 1:100) has no effect on the basal level of aromatase mRNA but partially attenuated the increase of aromatase mRNA level by cortisol (F, 1 mM, 24 h). Combination of a-h-CRH and hCG antibody reduced both basal and cortisol-induced aromatase mRNA level. n ¼ 5; B, CRH receptor antagonist a-hCRH (1 mM) or hCG antibody (Ab, 1:100) has no effect on the basal level of aromatase protein but partially attenuated the increase of aromatase protein level by cortisol (F, 1 mM, 24 h). Combination of a-h-CRH and hCG antibody reduced both basal and cortisol-induced aromatase protein level. n ¼ 6. Top panel of Fig. 2B is the representative Western blot. *P < 0.05, ***P < 0.001 vs. control (Ctr); ###P < 0.001 vs. F; ^P < 0.05, ^ P < 0.01 vs. Ab; $P < 0.05 vs. a-h-CRH.

4. Discussion In most mammalian species, estrogen synthesized by the placenta has a key role in priming the myometrium for labor by inducing expression of contraction associated proteins. The crucial role of estrogen in parturition in primates is clearly demonstrated by the studies showing that continuous infusion of androstenedione into pregnant rhesus monkeys at 0.8 of term pregnancy caused premature delivery [21], an effect that could be prevented by infusion of the aromatase inhibitor 4-hydroxyandrostenedione [22]. In higher primates including humans the production of placental estrogen depends on the aromatization of DHEA derived from the adrenal glands by placental aromatase. In humans both

b RH RH RH H Ab F + A -CR -h- C h-C -h-C h α- + α + α b + α F Ab A F+ RH H -C R h H C α CR hRH -h- α- b + Ab h-C + α b + A r b + α- F A F+ Ct F A F

F

Sp1

106kD

GAPDH 0.6

H H H H Ab +Ab -CR h- CR -CR h-CR h F -h α +α +α +α F Ab Ab + F

34kD ***

0.5 Sp1 protein level (ratio to GAPDH )

Aromatase protein level (ratio to GAPDH )

7 6

Sp1 mRNA level (ratio to β-actin )

A

33

## ^^

0.4 0.3

## $

*

###

0.2 0.1 0

r Ct

F

H H H Ab +Ab CRH - CR -CR h-CR h F -h- -h α α +α +α b+ F A Ab F+

Fig. 3. Effect of CRH receptor antagonist and hCG antibody on cortisol-induced Sp1 expression in human placental syncytiotrophoblasts. A, CRH receptor antagonist a-hCRH (1 mM) or hCG antibody (Ab, 1:100) has no effect on the basal level of Sp1 mRNA but partially attenuated the increase of Sp1 mRNA level by cortisol (F, 1 mM, 24 h). Combination of a-h-CRH and hCG antibody reduced both basal and cortisol-induced Sp1 mRNA level. n ¼ 5; B, CRH receptor antagonist a-h-CRH (1 mM) or hCG antibody (Ab, 1:100) has no effect on the basal level of Sp1 protein but partially attenuated the increase of Sp1 protein level by cortisol (F, 1 mM, 24 h). Combination of a-h-CRH and hCG antibody reduced both basal and cortisol-induced Sp1 protein level induced by cortisol. n ¼ 6. Top panel of Fig. 2B is the representative Western blot. *P < 0.05, *** P < 0.001 vs. control (Ctr); ##P < 0.01, ###P < 0.001 vs. F; ^P < 0.05, ^P < 0.01 vs. Ab; $ P < 0.05 vs. a-h-CRH.

34

W.S. Wang et al. / Placenta 35 (2014) 30e36

18

A

***

16 cAMP concentration (pmol/mL)

## $

## ^

14 12

###

10 8 6 4 2 0

r Ct

B

F

Ab

H Ab RH CR RH RH -C -h-C h F + α-h-C α-hα +α b+ F+ Ab F+ A

5’ primers

-305

Ctr

F

Ab

Sp1 T.S.S

3’ primers

RH H -h-C R Ab -C + α F+ α-h F

r Ct F

Sp1 IgG

IgG

Input

Input ***

2.5 2

# ^^

## $$

1.5 1 0.5 0

RH RH -C -C α-h h - + + α Ab Ab F+

Sp1

r Ct

F

H RH b Ab F+A -CR h- C h α- + α F

Sp1 on Aromatase promoter (ratio to Input)

Sp1 on Aromatase promoter (ratio to Input)

+1

-120 Sp1

2.5 **

2 1.5 1

**

##

0.5 0

r Ct

F RH CRH h-C -h α- b + α + Ab F+ A

Fig. 4. Effect of CRH receptor antagonist and hCG antibody on cortisol-induced intracellular cAMP level and Sp1 binding to aromatase promoter in human placental syncytiotrophoblasts. A, Treatment of syncytiotrophoblasts with cortisol (F, 1 mM, 12 h) significantly increased the intracellular cAMP level, which was partially attenuated by either hCG antibody (Ab,1:100)or a-h-CRH (1 mM), and further blocked by the combined treatment with hCG antibody and a-h-CRH, n ¼ 7; B, Bottom left: ChIP assay revealed that either hCG antibody (Ab, 1:100) or a-h-CRH (1 mM) alone could partly attenuate the increased enrichment of Sp1 at the aromatase promoter by cortisol (1 mM, 24 h) but not the basal enrichment of Sp1. Bottom right: Both basal and enhanced enrichment of Sp1 at the aromatase promoter by cortisol (1 mM, 24 h) were significantly attenuated by combined treatment with hCG antibody and a-h-CRH. Top panels of each bar graphs (data derived from qRT-PCR) are representative gel images. The diagram on the top panel illustrates Sp1 binding sites in aromatase promoter and primers used for qRT-PCR in ChIP assay. n ¼ 3e4. T.S.S: Transcription start site. **P < 0.01, ***P < 0.001 vs. control (Ctr); #P < 0.05, ##P < 0.01, ### P < 0.001 vs. F; ^P < 0.05, ^P < 0.01 vs. Ab; $P < 0.05, $$P < 0.01 vs. a-h-CRH.

by the placental syncytiotrophoblasts. This notion is supported by the demonstration of further reduced levels of cAMP and Sp1, the second messenger and transcription factor underlying both basal and cortisol-induced transcription of aromatase [5,26], by combined antagonism of hCG and CRH. However we do not know how activation of the cAMP pathway increases Sp1 transcriptional activity at the current stage although phosphorylation of Sp1 has been controversially suggested [27,28]. It has been demonstrated that the production of CRH increases exponentially toward the end of human gestation, which is believed to play a pivotal role in human parturition [29e31].

The finding of involvement of CRH in cortisol-induced aromatase expression in this study lends further support for a pro-laboring role of CRH. Similar to CRH, hCG is also secreted abundantly by human placental syncytiotrophoblasts in pregnancy with its concentration reaching maximal in maternal plasma at 8e10th weeks of gestation, then decreasing slowly to a relatively stable level after 18e20th weeks of gestation [32]. In addition to the effects of maintaining pregnancy by stimulating progesterone synthesis [33], hCG was also found to stimulate the fetal adrenal glands to produce DHEAS for the synthesis of estrogen in the placenta [34]. The level of hCG in cervicovaginal secretions was used as a predictor of

W.S. Wang et al. / Placenta 35 (2014) 30e36

Precis

Cortisol CRH

35

hCG cAMP activate

PKA

Sp1 Aromatase Fig. 5. Scheme illustrating the proposed regulation of human placental aromatase expression by cortisol. Cortisol induces CRH and hCG expression and production, which increases intracellular cAMP level and activates PKA, subsequently upregulates Sp1 expression and Sp1 enrichment at the aromatase promoter thereby inducing aromatase expression in human placental syncytiotrophoblasts.

preterm delivery [35,36]. These findings indicate complicated roles of hCG at different stages of human pregnancy. The present study demonstrated that hCG accounts in part for the basal and cortisolinduced aromatase expression, which is in keeping with an earlier study showing that hCG induces aromatase expression and activity in human choriocarcinoma cells [37]. These findings suggest that hCG may switch to pro-parturition effect in late gestation. The stimulating effect of cortisol on placental estrogen production coincides with the findings of an ability of inducing labor by glucocorticoids administered either intramuscularly or intraamniotically in humans [38,39]. However there are some inconsistent reports failing to observe labor-inducing effect of maternal intramuscular administration of synthetic glucocorticoids such as dexamethasone and betamethasone in the preterm period to induce fetal lung maturation in the literature [40]. These arguments may have neglected the facts that these synthetic glucocorticoids, unlike the endogenous cortisol, can readily pass the placenta barrier without being metabolized by placenta 11bhydroxysteroid dehydrogenase 2 (11b-HSD2), resulting in the inactivation of fetal hypothalamusepituitaryeadrenal axis and diminished placental estrogen formation due to reduced production of DHEA from the fetal adrenal glands [41]. This may compromise the labor-inducing effects of systemic administration of synthetic glucocorticoids, especially in cases where the myometrium is not yet fully primed by estrogen. Thus we believe that endogenous cortisol, unlike the synthetic glucocorticoids, may play a more significant role in human parturition with less negative feedback on DHEA production. 5. Conclusions We presented evidence in this study that cortisol increases intracellular cAMP level and Sp1 enrichment at the aromatase promoter thereby inducing aromatase expression indirectly via CRH and hCG in human placental syncytiotrophoblasts (Fig. 5). These findings may account for the parallel increases of cortisol and estrogen production prior to the onset of labor [42,43]. Disclosure The authors have nothing to disclose.

Cortisol induces CRH and hCG production and subsequent activation of cAMP pathway which leads to increased aromatase expression in human placental syncytiotrophoblasts suggesting a role for cortisol in human parturition. Appendix A. Supplementary data Supplementary data related to this article can be found online at http://dx.doi.org/10.1016/j.placenta.2013.10.018. References [1] Mesiano S. Roles of estrogen and progesterone in human parturition. Front Horm Res 2001;27:86e104. [2] Challis JR, Lye SJ. Parturition. Oxf Rev Reprod Biol 1986;8:61e129. [3] Thorburn GD, Challis JR, Currie WB. Control of parturition in domestic animals. Biol Reprod 1977;16(1):18e27. [4] Siiteri PK, MacDonald PC. Placental estrogen biosynthesis during human pregnancy. J Clin Endocrinol Metab 1966;26(7):751e61. [5] Wang W, Li J, Ge Y, Li W, Shu Q, Guan H, et al. Cortisol induces aromatase expression in human placental syncytiotrophoblasts through the cAMP/Sp1 pathway. Endocrinology 2012;153(4):2012e22. [6] Rhen T, Cidlowski JA. Antiinflammatory action of glucocorticoidsenew mechanisms for old drugs. N Engl J Med 2005;353(16):1711e23. [7] Shibasaki T, Odagiri E, Shizume K, Ling N. Corticotropin-releasing factor-like activity in human placental extracts. J Clin Endocrinol Metab 1982;55(2): 384e6. [8] Smith R. Parturition. N Engl J Med 2007;356(3):271e83. [9] Chen R, Lewis KA, Perrin MH, Vale WW. Expression cloning of a human corticotropin-releasing-factor receptor. Proc Natl Acad Sci U S A 1993;90(19): 8967e71. [10] Perrin M, Donaldson C, Chen R, Blount A, Berggren T, Bilezikjian L, et al. Identification of a second corticotropin-releasing factor receptor gene and characterization of a cDNA expressed in heart. Proc Natl Acad Sci U S A 1995;92(7):2969e73. [11] Ross PC, Kostas CM, Ramabhadran TV. A variant of the human corticotropinreleasing factor (CRF) receptor: cloning, expression and pharmacology. Biochem Biophys Res Commun 1994;205(3):1836e42. [12] Hillhouse EW, Grammatopoulos DK. The molecular mechanisms underlying the regulation of the biological activity of corticotropin-releasing hormone receptors: implications for physiology and pathophysiology. Endocr Rev 2006;27(3):260e86. [13] Grammatopoulos DK, Chrousos GP. Functional characteristics of CRH receptors and potential clinical applications of CRH-receptor antagonists. Trends Endocrinology Metabolism TEM 2002;13(10):436e44. [14] Lapthorn AJ, Harris DC, Littlejohn A, Lustbader JW, Canfield RE, Machin KJ, et al. Crystal structure of human chorionic gonadotropin. Nature 1994;369(6480):455e61. [15] Bahl OP. Human chorionic gonadotropin, its receptor and mechanism of action. Fed Proc 1977;36(8):2119e27. [16] Robinson BG, Emanuel RL, Frim DM, Majzoub JA. Glucocorticoid stimulates expression of corticotropin-releasing hormone gene in human placenta. Proc Natl Acad Sci U S A 1988;85(14):5244e8. [17] Ni XT, Duan T, Yang Z, Guo CM, Li JN, Sun K. Role of human chorionic gonadotropin in maintaining 11beta-hydroxysteroid dehydrogenase type 2 expression in human placental syncytiotrophoblasts. Placenta 2009;30(12): 1023e8. [18] Kliman HJ, Nestler JE, Sermasi E, Sanger JM, Strauss 3rd JF. Purification, characterization, and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology 1986;118(4):1567e82. [19] Sun K, Yang K, Challis JR. Differential regulation of 11 beta-hydroxysteroid dehydrogenase type 1 and 2 by nitric oxide in cultured human placental trophoblast and chorionic cell preparation. Endocrinology 1997;138(11): 4912e20. [20] Zoumakis E, Margioris AN, Stournaras C, Dermitzaki E, Angelakis E, Makrigiannakis A, et al. Corticotrophin-releasing hormone (CRH) interacts with inflammatory prostaglandins and interleukins and affects the decidualization of human endometrial stroma. Mol Hum Reprod 2000;6(4):344e51. [21] Mecenas CA, Giussani DA, Owiny JR, Jenkins SL, Wu WX, Honnebier BO, et al. Production of premature delivery in pregnant rhesus monkeys by androstenedione infusion. Nat Med 1996;2(4):443e8. [22] Nathanielsz PW, Jenkins SL, Tame JD, Winter JA, Guller S, Giussani DA. Local paracrine effects of estradiol are central to parturition in the rhesus monkey. Nat Med 1998;4(4):456e9. [23] Buster JE, Chang RJ, Preston DL, Elashoff RM, Cousins LM, Abraham GE, et al. Interrelationships of circulating maternal steroid concentrations in third trimester pregnancies. II. C18 and C19 steroids: estradiol, estriol, dehydroepiandrosterone, dehydroepiandrosterone sulfate, delta 5-androstenediol,

36

[24]

[25]

[26]

[27] [28] [29]

[30]

[31]

[32]

W.S. Wang et al. / Placenta 35 (2014) 30e36 delta 4-androstenedione, testosterone, and dihydrotestosterone. J Clin Endocrinol Metab 1979;48(1):139e42. Doganay M, Erdemoglu E, Avsar AF, Aksakal OS. Maternal serum levels of dehydroepiandrosterone sulfate and labor induction in postterm pregnancies. Int J Gynaecol Obstet 2004;85(3):245e9. Torricelli M, Novembri R, Voltolini C, Conti N, Biliotti G, Piccolini E, et al. Biochemical and biophysical predictors of the response to the induction of labor in nulliparous postterm pregnancy. Am J Obstet Gynecol 204(1):39 e1e6. Kamat A, Alcorn JL, Kunczt C, Mendelson CR. Characterization of the regulatory regions of the human aromatase (P450arom) gene involved in placentaspecific expression. Mol Endocrinol 1998;12(11):1764e77. Tan NY, Khachigian LM. Sp1 phosphorylation and its regulation of gene transcription. Mol Cell Biol 2009;29(10):2483e8. Chu S, Ferro TJ. Sp1: regulation of gene expression by phosphorylation. Gene 2005;348:1e11. Smith R, Mesiano S, Chan EC, Brown S, Jaffe RB. Corticotropin-releasing hormone directly and preferentially stimulates dehydroepiandrosterone sulfate secretion by human fetal adrenal cortical cells. J Clin Endocrinol Metab 1998;83(8):2916e20. Sirianni R, Rehman KS, Carr BR, Parker Jr CR, Rainey WE. Corticotropinreleasing hormone directly stimulates cortisol and the cortisol biosynthetic pathway in human fetal adrenal cells. J Clin Endocrinol Metab 2005;90(1): 279e85. Jones SA, Challis JR. Local stimulation of prostaglandin production by corticotropin-releasing hormone in human fetal membranes and placenta. Biochem Biophys Res Commun 1989;159(1):192e9. Jameson JL, Hollenberg AN. Regulation of chorionic gonadotropin gene expression. Endocr Rev 1993;14(2):203e21.

[33] Kurtzman JT, Wilson H, Rao CV. A proposed role for hCG in clinical obstetrics. Semin Reprod Med 2001;19(1):63e8. [34] Seron-Ferre M, Lawrence CC, Jaffe RB. Role of hCG in regulation of the fetal zone of the human fetal adrenal gland. J Clin Endocrinol Metab 1978;46(5): 834e7. [35] Sanchez-Ramos L, Mentel C, Bertholf R, Kaunitz AM, Delke I, Loge C. Human chorionic gonadotropin in cervicovaginal secretions as a predictor of preterm delivery. Int J Gynaecol Obstet 2003;83(2):151e7. [36] Rengaraj G, Guleria K, Suneja A, Gambhir JK. Human chorionic gonadotropin in cervicovaginal secretions as a predictor of preterm birth. Gynecol Obstet Invest 2009;67(3):202e7. [37] Kanno H, Kitawaki J, Maeda K, Kim T, Noguchi T, Yamamoto T, et al. Regulation of aromatase in human choriocarcinoma cells. Nihon Sanka Fujinka Gakkai Zasshi 1994;46(5):449e56. [38] Mati JK, Horrobin DF, Bramley PS. Induction of labour in sheep and in humans by single doses of corticosteroids. Br Med J 1973;2(5859):149e51. [39] Craft I, Brummer V, Horwell D, Morgan H. Betamethazone induction of labour. Proc R Soc Med 1976;69(11):827e8. [40] Yeshaya A, Orvieto R, Ben-Shem E, Dekel A, Peleg D, Dicker D, et al. Uterine activity after betamethasone administration for the enhancement of fetal lung maturation. Eur J Obstet Gynecol Reprod Biol 1996;67(2):139e41. [41] Ogueh O, Jones J, Mitchell H, Alaghband-Zadeh J, Johnson MR. Effect of antenatal dexamethasone therapy on maternal plasma human chorionic gonadotrophin, oestradiol and progesterone. Hum Reprod 1999;14(2):303e6. [42] Levitz M, Young BK. Estrogens in pregnancy. Vitam Horm 1977;35:109e47. [43] Carr BR, Parker Jr CR, Madden JD, MacDonald PC, Porter JC. Maternal plasma adrenocorticotropin and cortisol relationships throughout human pregnancy. Am J Obstet Gynecol 1981;139(4):416e22.