Involvement of oxidative stress in 4-vinylcyclohexene-induced toxicity in Drosophila melanogaster

Free Radical Biology and Medicine 71 (2014) 99–108

Contents lists available at ScienceDirect

Free Radical Biology and Medicine journal homepage: www.elsevier.com/locate/freeradbiomed

Original Contribution

Involvement of oxidative stress in 4-vinylcyclohexene-induced toxicity in Drosophila melanogaster Amos Olalekan Abolaji a,b,n, Jean Paul Kamdem b,c, Thiago Henrique Lugokenski b,d, Thallita Kalar Nascimento b, Emily Pansera Waczuk b, Ebenezer Olatunde Farombi a, Élgion Lúcio da Silva Loreto e, João Batista Teixeira Rocha b,n a Drug Metabolism and Molecular Toxicology Research Laboratories, Department of Biochemistry, Faculty of Basic Medical Sciences, College of Medicine, University of Ibadan, Ibadan, Nigeria b Departamento de Bioquimica e Biologia Molecular, Bioquímica Toxicológica, Centro de Ciências Naturais e Exatas, Universidade Federal de Santa Maria, Santa Maria, Rio Grande do Sul 97105-900, Brazil c Departamento de Bioquímica, Instituto de Ciências Básica da Saúde, Universidade Federal do Rio Grande do Sul, Porto Alegre, RS CEP 90035-003, Brazil d Universidade Federal do Pampa - UNIPAMPA - Campus Caçapava do Sul - RS - Brazil e Laboratório de Biologia Molecular – LabDros, Universidade Federal de Santa Maria, Santa Maria, Brazil, Rio Grande do Sul 97105-900, Brazil

art ic l e i nf o Article history: Received 14 January 2014 Received in revised form 6 March 2014 Accepted 11 March 2014 Available online 26 March 2014 Keywords: 4-Vinylcyclohexene Oxidative stress mRNA gene expression RT-PCR Antioxidants δ-ALA-D Neurotoxicity

Abstract: 4-Vinylcyclohexene (VCH) is a dimer of 1,3-butadiene produced as a by-product of pesticides, plastic, rubber, flame retardants, and tire production. Although, several studies have reported the ovotoxicity of VCH, information on a possible involvement of oxidative stress in the toxicity of this occupational chemical is scarce. Hence, this study was carried out to investigate further possible mechanisms of toxicity of VCH with a specific emphasis on oxidative stress using a Drosophila melanogaster model. D. melanogaster (both genders) of 1 to 3 days old were exposed to different concentrations of VCH (10 mM–1 mM) in the diet for 5 days. Subsequently, the survival and negative geotaxis assays and the quantification of reactive oxygen species (ROS) generation were determined. In addition, we evaluated RT-PCR expressions of selected oxidative stress and antioxidant mRNA genes (HSP27, 70, and 83, SOD, Nrf-2, MAPK2, and catalase). Furthermore, catalase, glutathione-Stransferase (GST), delta aminolevulinic acid dehydratase (δ-ALA-D), and acetylcholinesterase (AChE) activities were determined. VCH exposure impaired negative geotaxic behavior and induced the mRNA of SOD, Nrf-2, and MAPK2 genes expressions. There were increases in catalase and ROS production, as well as inhibitions of GST, δ-ALA-D, and AChE activities (Po0.05). Our results suggest that the VCH mechanism of toxicity is associated with oxidative damage, as evidenced by the alteration in the oxidative stress-antioxidant balance, and possible neurotoxic consequences due to decreased AChE activity, and impairments in negative geotaxic behavior. Thus, we conclude that D. melanogaster is a useful model for investigating the toxicity of VCH exposure, and here, we have provided further insights on the mechanism of VCH-induced toxicity. & 2014 Elsevier Inc. All rights reserved.

Introduction

Abbreviations: VCH, 4-vinylcyclohexene; VCM1, 4-vinylcyclohexene 1,2-epoxide; VCM2, 4-vinylcyclohexene 7,8-epoxide; VCD, 4-vinylcyclohexene diepoxide; RT PCR, reverse transcription polymerase chain reaction; DTNB, 1-chloro-2,4-dinitrobenzene, 5,50 -dithiobis (2-nitro-benzoic acid); DCFH-DA, 20 ,70 -dichlorofluorescein diacetate; mRNA, messenger RNA; ROS, reactive oxygen species; HSP, heat shock protein; SOD, superoxide dismutase; Nrf-2, nuclear factor erythroid 2-related factor 2; MAPK2, mitogen-activated protein kinase 2; δ-ALA-D, delta aminolevulinic acid dehydratase; AChE, acetylcholinesterase; mEH, microsomal epoxide hydrolase; GST, glutathione-S-transferase. n Corresponding author at: Universidade Federal de Santa Maria, Departamento de Bioquimica e Biologia Molecular, Bioquímica Toxicológica, Centro de Ciências Naturais e Exatas, Campus Universitário, Av roraima 1000, 97105-900 Santa Maria, Rio Grande do Sul, Brazil. Fax: þ 55 55 8104 0207. E-mail addresses: [email protected], [email protected] (A. Olalekan Abolaji), [email protected], [email protected] (J.B. Teixeira Rocha). http://dx.doi.org/10.1016/j.freeradbiomed.2014.03.014 0891-5849/& 2014 Elsevier Inc. All rights reserved.

The occupational chemical 4-vinylcyclohexene (VCH) is a dimer of 1,3-butadiene that is produced as a by-product of pesticides, plastic, rubber, flame retardants, and tire production. It is used commercially as a reactive diluent for diepoxides and epoxy resins [1]. Indeed, humans are exposed to VCH through oral intake, inhalation, and dermal contact [2,3]. The VCH became a public health concern due to its ovotoxic effect. It causes the destruction of the primordial and small primary follicles in animal models [4–7]. Of particular importance, chemicals that destroy the primordial follicles are of toxicological concern to women because their exposure can cause premature ovarian failure (i.e., early menopause) [8]. The liver is the major bioactivation site of VCH through hepatic cytochrome P450 (CYP) 2A and 2B to the monoepoxides (4-vinylcyclohexene 1,2-epoxide, VCM1, and 4-vinylcyclohexene 7,8-epoxide, VCM2), and subsequently to the diepoxide (4-vinylcyclohexene

100

A. Olalekan Abolaji et al. / Free Radical Biology and Medicine 71 (2014) 99–108

Materials and methods Chemicals All chemicals were of analytical grade. 4-Vinylcyclohexene (99%), 1-chloro-2,4-dinitrobenzene, 5,50 -dithiobis(2-nitro-benzoic acid) (DTNB), acetylthiocholine iodide, 20 ,70 -dichlorofluorescein diacetate (DCFH-DA), and sodium dodecyl sulfate (SDS) were purchased from Sigma Aldrich (St. Louis, MO). Drosophila melanogaster stock and culture

Scheme 1. The mechanism of VCH metabolism in the liver (1 A) and the ovary (1B). In the liver, CYP 2 A converts VCH to the monoepoxides. This is followed by the conversion of these monoepoxides to VCD by CYP 2B. The liver and the ovary have in common the diepoxide (VCD) metabolite, which is subsequently converted to the inactive form by mEH. GST can also conjugate GSH with VCD to form VCD-SG adduct through another metabolic process. VCD-SG adduct could transfer VCD to free protein thiols, thereby deactivating native function of chemically altered protein. VCH, 4-vinylcyclohexene; VCM1, 4-vinylcyclohexene 1,2-epoxide; VCM2, 4-vinylcyclohexene 7,8-epoxide; VCD, 4-vinylcyclohexene diepoxide; mEH, microsomal epoxide hydrolase; GST, glutathione-S-transferase.

diepoxide, VCD), the ovotoxic metabolite (Scheme 1A). When these circulating epoxides reach the ovary, they cause destruction of the follicles [9,10]. Additionally, the ovary can bioactivate VCH directly to VCD by the action of CYP 2E1 [11]. This is followed by its metabolism by the microsomal epoxide hydrolase (mEH) to an inactive form [12,13] (Scheme 1B). Another metabolic pathway involves the π glutathione-S-transferase (π-GST) conjugation of the VCD to GSH [14]. Despite evidence on the mechanism of toxicity of VCH, there is a dearth of information on a possible involvement of oxidative stress in the toxicity of this occupational chemical. Oxidative stress is thought to be involved in a wide range of diseases [15,16], and is characterized by an imbalance between prooxidants and antioxidants [17]. This ratio could be altered in VCH toxicity by depletion of glutathione (GSH) and/or formation of reactive species in the reaction of cytochrome P450 metabolic processes. Potentially, biomolecules can have their functional roles altered by oxidative modification due to oxidative stress. This in turn can compromise normal female physiological functions, leading to reproductive diseases, such as spontaneous abortion and unexplained infertility [18]. Thus, the investigation of the possible role of oxidative stress in VCH-induced toxicity is of high importance, as this would help in further understanding of its mechanism of toxicity. Considering the importance of oxidative stress in the pathogenesis of various diseases and the paucity of information on the possible involvement of oxidative stress in the mechanism of VCHinduced toxicity, the present study was designed to investigate the effects of VCH exposure in Drosophila melanogaster. Particularly, we assessed the role of selected mRNA genes expressions (HSP27, HSP70, HSP83, MAPK2, catalase, SOD, and Nrf-2) and antioxidant defense systems as molecular endpoints of VCH toxicity. In addition, the survival and climbing behavior of flies were evaluated following VCH exposure. D. melanogaster was chosen in our study because it raises few ethical concerns and it is approved as an alternative model of vertebrate usage by the European Centre for the Validation of Alternative Methods (ECVAM) [19,20]. The results obtained here validated fruit flies as a model for studying the toxicity of VCH and indicated that oxidative stress is involved in the toxicity of this widespread compound found in human occupational and domestic environments.

D. melanogaster (Harwich strain) was obtained from the National Species Stock Center (Bowling Green, OH, USA). The flies were maintained and reared on cornmeal medium containing 1% w/v brewer's yeast, 2% w/v sucrose, 1% w/v powdered milk, 1% w/v agar, and 0.08% v/w nipagin at constant temperature and humidity (2371 1C; 60% relative humidity, respectively) under 12 h dark/light cycle conditions. All the experiments were carried out with the same D. melanogaster strain. VCH exposure and survival rate analyses D. melanogaster (both genders) of 1 to 3 days old were divided into six groups of 30 flies each: 2 sets of controls (with and without ethanol final concentration of 2.5%) and VCH (10 mM, 100 mM, 1 mM, and 10 mM) prepared in 98% ethanol. However, only the ethanol control data are depicted in the results because there was no statistical significant difference between the two controls in all the parameters assessed. In order to determine the concentrations of VCH and the duration of exposure to be used in the experiment, a 28-day survival assay was carried out. The survival assay consisted of three independent experiments with each containing three replicates of each of the concentrations of VCH indicated above, in vials containing 30 flies each. The diet mixed with VCH was changed once a week. The 28-day survival rate was determined across the VCH concentrations, by recording the number of live and dead flies daily. At the end of the 28 days, the data were analyzed and plotted as percentage of live flies. Based on these data, we selected three concentrations of VCH (10 mM, 100 mM, and 1 mM) since there was no previous studies involving VCH exposure in the flies. These concentrations were selected because the survival rates were comparable among the VCH-exposed, control, and ethanol-exposed flies after 5 days of exposure (Fig. 1A). Furthermore, the range of concentrations used was expected to cover low to high levels of exposure. Fifty flies/ vial were exposed to three replicates of each of these selected concentrations and control for 5 days. The 5-day survival assay was also determined as described above. Negative geotaxis Locomotor performance of VCH-treated and control flies was investigated using the negative geotaxis assay [21]. Ten VCHtreated and control flies were immobilized under mild ice anaesthesia placed separately in labeled vertical glass columns (length, 15 cm; diameter, 1.5 cm). After the recovery from ice exposure (about 20 min), the flies were gently tapped to the bottom of the column, and the number of flies that climbed up to the 6 cm mark of the column in 6 s as well as those that remained below this mark after this time were recorded. The scores represent the mean of the number of flies at the top (ntop) expressed as a percentage of the total number of flies (ntot). This procedure was repeated three times at 1-min interval.

A. Olalekan Abolaji et al. / Free Radical Biology and Medicine 71 (2014) 99–108

101

were designed using Primer3 program version 0.4.0 (http:// frodo.wi.mit.edu/primer3/) and custom made by Invitrogen. Following quantification, the total RNA was treated with DNase I (Invitrogen), and cDNA was synthesized with M-MLV reverse transcriptase enzyme and random primers using the manufacturer's protocol (Invitrogen). Quantitative real-time polymerase chain reaction was performed in 20 mL reaction volumes containing 1 mL RT product (cDNAs) as template, 1X PCR buffer, 25 mM dNTPs, 0.2 mM of each primer (Table I), 1.5–2.5 mM MgCl2, 0.1X SYBR Green I (molecular probes), and 1 U Taq DNA polymerase (Invitrogen) [22,23]. The thermal cycle was carried out using a StepOne Plus real-time PCR system (Applied Biosystems, NY) according to the following protocol: activation of the Taq DNA polymerase at 95 1C for 5 min, followed by 40 cycles of 15 s at 95 1C, 15 s at 60 1C, and 25 s at 72 1C. Threshold and baselines were manually determined using the StepOne Software v2.0 (Applied Biosystems, NY). SYBR fluorescence was analyzed by StepOne software version 2.0 (Applied Biosystems, NY), and the CT (cycle threshold) value for each sample was calculated and recorded ΔΔ using 2- CT [24]. For each well, we analyzed in quadruplicate, and obtained the ΔCT value by subtracting the tubulin and GPDH CT value from the CT value of the gene of interest. The tubulin and GPDH genes are the endogenous reference genes with no alteration in response to VCH treatment. Preparation of sample for biochemical assays

Fig. 1. 4-Vinylcyclohexene exposure caused reduction in survival rate of D. melanogaster after 28 days exposure. (A) Survival curve analysis and (B) survival (%) of 30 flies (both gender) after 28 days of exposure of D. melanogaster to 10 mM, 100 mM, 1 mM, and 10 mM 4- vinylcyclohexene. Data are presented as mean þSEM of three independent biological replicates carried out in duplicates. Survival analysis was carried out in three independent experiments. nP o 0.05 vs control.

Table 1 Sequences of qPCR primers. Primer Sequence HSP27 LEFT HSP27 RIGHT HSP83 LEFT HSP83 RIGHT HSP70 LEFT HSP70 RIGHT SOD LEFT SOD RIGHT Catalase LEFT Catalase RIGHT Nrf-2 LEFT Nrf-2 RIGHT MPK2 LEFT MAPK2 RIGHT GPDH LEFT GPDH RIGHT Tubulin LEFT Tubulin RIGHT

50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50

AAAGATGGCTTCCAGGTGTG 30 CCCTTGGGCAGGGTATACTT 30 CAAATCCCTGACCAACGACT 30 CGCACGTACAGCTTGATGTT 30 CGGAGTCTCCATTCSGGTGT 30 GCTGACGTTCAGGATTCCAT 30 GGAGTCGGTGATGTTGACCT 30 GTTCGGTGACAACACCAATG 30 ACCAGGGCATCAAGAATCTG 30 AACTTCTTGGCCTGCTCGTA 30 CCAACTTCCTCAAGGAGCAG 30 CGGCGACAAATATCATCCTT 30 GGCCACATAGCCTGTCATCT 30 ACCAGATACTCCGTGGCTTG 30 ATGGAGATGATTCGCTTCGT 30 GCTCCTCAATGGTTTTTCCA 30 ACCAATGCAAGAAAGCCTTG 30 ATCCCCAACAACGTGAAGAC 30

RNA isolation and mRNA analysis by quantitative real-time RT-PCR About 2 mg of total RNA was isolated from 25 flies per VCHtreated groups and control using Trizol reagent (Invitrogen) according to the manufacturer's protocol. The primer sequences used for this study were SOD, catalase, Nrf-2, MAPK2, and heat shock proteins (HSP) 27, 70, and 83 (Table 1). The gene-specific primer sequences were based on published sequences in GenBank Overview (http://www.ncbi.nlm.nih.gov/genbank/). The primers

For the determination of biochemical assays, 50 flies (of both gender) were exposed to final concentrations of VCH (10 mM, 100 mM, and 1 mM) and controls (with and without ethanol) in media for 5 days as described above. At the end of the treatment period, flies were anaesthetized in ice, weighed, and homogenized in 0.1 M phosphate buffer, pH 7.0 (ratio of 1 mg:10 mL), and centrifuged at 4000 g for 10 min at 4 1C in a Biofuge Sorvall Fresco centrifuge (Kendro Laboratory Products, Germany). Subsequently, the supernatant was separated from the pellet into labeled Eppendorf tubes, and used for the determination of the activities of acetylcholinesterase (AChE), glutathione-S-transferase (GST), catalase (CAT), and total thiol content. All the assays were carried out in duplicates for each of the three replicates of VCH concentrations in three independent experiments. Assessment of DCFH oxidation The supernatant obtained above was used to determine 20 ,70 dichlorofluorescein (DCFH) oxidation as a general index of oxidative stress [25]. The reaction mixture was made up of 150 mL of 0.1 M potassium phosphate buffer (pH 7.4), 40 mL of distilled water, 5 mL of DCFH-DA (200 mM, final concentration 5 mM), and 5 mL of the sample (1:10 dilution). The fluorescence emission of DCF resulting from DCFH oxidation was monitored in duplicates for each of the three replicate concentrations, in three independent experiments of VCH for 10 min (30 s intervals) at 488 and 525 nm, excitation and emission wavelengths, respectively, using a SpectraMax plate reader (Molecular Devices, USA). The rate of DCF formation was expressed in percentage of ethanol-treated control group. Total thiol determination Total thiol content was estimated by the method of Ellman [26]. The reaction mixture was made up of 170 mL of 0.1 M potassium phosphate buffer (pH 7.4), 20 mL of sample, and 10 mL of 10 mM DTNB. This was followed by 30 min incubation at room temperature, and the absorbance was measured at 412 nm. A standard

102

A. Olalekan Abolaji et al. / Free Radical Biology and Medicine 71 (2014) 99–108

curve was plotted for each measurement using GSH as standard (expressed as mmol/mg protein).

Protein determination Protein determination was carried out as described by Lowry et al. [31], using bovine serum albumin (BSA) as a standard.

Determination of glutathione-S-transferase activity Glutathione-S-transferase (GST; EC 2.5.1.18), activity was assayed according to the procedure of Habig and Jakoby [27] using 1-chloro2,4-dinitrobenzene (CDNB) as substrate. The assay reaction mixture was made up of 270 mL of a solution containing (20 mL of 0.25 M potassium phosphate buffer, pH 7.0, with 2.5 mM EDTA, 10.5 mL of distilled water, and 500 mL of 0.1 M GSH at 25 1C), 20 mL of sample (1:5 dilution), and 10 mL of 25 mM CDNB. The reaction was monitored for 5 min (10 s intervals) at 340 nm in a SpectraMax plate reader (Molecular Devices) and the data were expressed as millimole per minute per milligram protein using the molar extinction coefficient (ε) of 9.6 mM-1 cm-1 for CDNB conjugate.

Determination of catalase activity Catalase (CAT; EC 1.11.1.6) activity was determined according to the method of Aebi [28] by monitoring the clearance of H2O2 at 240 nm at 25 1C in a reaction medium containing 1800 mL of 50 mM phosphate buffer (pH 7.0), 180 mL of 300 mM H2O2, and 20 mL of sample (1:50 dilution). The reaction was monitored for 2 min (10 s intervals), at 240 nm using a UV-visible spectrophotometer (Shimadzu, Japan) (expressed as mmol of H2O2 consumed/min/mg protein).

Determination of acetylcholinesterase activity

Statistical analysis The results are expressed as mean þSEM (standard error of mean). Statistical analysis was performed using a one-way analysis of variance (ANOVA) followed by Tukey's post hoc test. The results were considered statistically significant for P o0.05.

Results 4-Vinylcyclohexene caused reduction in survival rate of D. melanogaster after 28 days of exposure To select the concentrations of VCH to be used in the main experiment, we exposed flies to different concentrations of VCH (10 mM–10 mM) for 28 days to determine the survival rate. As shown in Figs. 1A and B, 28 days exposure of flies to VCH caused significant reductions of survival rates when compared with the control (Po0.05, Fig. 1B). The reduction was most pronounced in the 10 mM group, whereas those in the 100 mM and 1 mM groups were similar. Hence 10 mM, 100 mM, and 1 mM were used in the main experiment. In addition, 5 days exposure duration was used because the survival rates on Day 5 were not significantly different from control in the 10 mM, 100 mM, and 1 mM VCH concentrations (Figs. 1A and 2A). Furthermore, after 5 days exposure to these concentrations of VCH, the macroscopic morphology (weights and

Acetylcholinesterase activity was carried out according to the method of Ellman et al. [29]. The system consisted of 135 mL of distilled water, 20 mL of 100 mM potassium phosphate buffer (pH 7.4), 20 mL of 10 mM DTNB, 5 mL of sample, and 20 mL of 8 mM acetylthiocholine as initiator. The reaction was monitored for 5 min (15 s intervals) at 412 nm using a Spectra Max plate reader (Molecular Devices, USA). The data were calculated against blank and sample blank and the results were corrected with the protein content.

Determination of delta aminolevulinic acid dehydratase (δ-ALA-D) activity The δ-ALA-D activity was assayed using a modified method of Sassa [30], by measuring the rate of porphobilinogen formation. Eighty flies/vial were exposed in triplicates to each of the 10 mM, 100 mM, and 1 mM concentrations of VCH and control as described above for 5 days. The flies were anaesthetized with ice, weighed, and homogenized in 5 mM Tris-HCl buffer, pH 8.5 (1 g of flies to 3 mL of buffer). The homogenate was centrifuged at 4000 rpm for 10 min at 4 1C to yield a supernatant fraction that was used for the enzyme assay. The reaction mixture made up of 10 mL of 0.5 M Tris-glycine (pH 8.5), 7 mL distilled water, 25 mL sample, and 8 mL of 31.25 mM 5-aminolevulinic acid hydrochloride was incubated at 37 1C for 3 h. Subsequently, 100 mL of 10% TCA containing 20 mM CuSO4 was added to each reaction mixture, and centrifuged at 5000 rpm for 10 min. After this, 100 mL from each of the supernatants obtained was added to 100 mL of Erlich reagent and incubated for 30 min at room temperature. The absorbance was measured at 555 nm in a SpectraMax plate reader (Molecular Devices, USA) and the data were expressed as percentage of the ethanol-treated control. The assay was carried out in duplicates of three independent experiments

Fig. 2. 4-Vinylcyclohexene exposure in D. melanogaster did not affect survival rate, but decreased negative geotaxis after 5 days of exposure. (A) Survival (%) of 50 flies (both gender) and (B) climbing rate (%) after 5 days exposure of D. melanogaster to 10 mM, 100 mM, and 1 mM 4- vinylcyclohexene. Data are presented as meanþ SEM of three independent biological replicates carried out in duplicates. Each assay was carried out in three independent experiments. nPo 0.05 vs control.

A. Olalekan Abolaji et al. / Free Radical Biology and Medicine 71 (2014) 99–108

103

Fig. 3. Expressions of HSP 27, HSP 70, and HSP 83 mRNA genes expressions after treatment of D. melanogaster with VCH for 5 days. (A) HSP 27, (B) HSP 70, and (C) HSP 83 relative mRNA expressions after exposure of D. melanogaster to 10 mM, 100 mM, and 1 mM 4- vinylcyclohexene. Data are presented as mean 7SEM of three independent biological replicates carried out in quadruplicates. nPo 0.05 vs control.

sizes) of the flies did not change (data not shown). The total content of protein and the MTT reducing capacity of flies homogenates were not modified by VCH exposure (10 mM, 100 mM, and 1 mM; data not shown). These results indicated that during this period of exposure, no significant cell death occurred. 4-Vinylcyclohexene exposure to D. melanogaster did not affect survival rate, but decreased negative geotaxis after 5 days of exposure At the end of the 5 days treatment, there was no significant change in the survival of flies after VCH exposure (Fig. 2A). However, we observed significant reductions (Po 0.05) in the climbing rate in the 100 mM and 1 mM VCH concentrations compared with the control (Fig. 2B). Expression of HSP27, HSP70, and HSP83 mRNA genes after treatment of D. melanogaster with VCH for 5 days. Next, we examined whether VCH could modify the expressions of mRNA heat shock protein genes because they are involved in cellular protection against oxidative stress [32]. Furthermore, previous studies have demonstrated that they can be useful markers of exposure to prooxidant levels of chemicals [33,34]. As shown in Fig. 3, VCH did not significantly affect the expressions

Fig. 4. Inductions of SOD, Nrf-2, and MAPK2 gene expressions levels after 5 days of 4-vinylcyclohexene exposure in D. melanogaster. Relative mRNA levels of (A) SOD, (B) CAT, (C) Nrf-2, and (D) MAPK2 after exposure of D. melanogaster to 10 mM, 100 mM, and 1 mM 4-vinylcyclohexene. Data are presented as mean þSEM of three independent biological replicates carried out in quadruplicates. nP o 0.05 vs control.

of HSP27 (Fig. 3A), HSP70 (Fig. 3B), and HSP83 (Fig. 3C) mRNA genes when compared with the control (P 40.05). SOD, CAT, Nrf-2, and MAPK2 mRNA gene expression levels after 5 days of 4-VCH exposure to D. melanogaster In order to further understand the role of VCH in the cellular response, we determined the levels of mRNA genes of SOD and catalase because they are endogenous enzymatic antioxidants. We also evaluated Nrf-2 and MAPK2 mRNA gene expressions since they can be induced in response to increased ROS [35,36].

104

A. Olalekan Abolaji et al. / Free Radical Biology and Medicine 71 (2014) 99–108

Interestingly, the four genes displayed similar expression patterns across the concentrations. As depicted in Fig. 4, only 100 mM VCH concentration caused significant increase in the expressions of SOD (Fig. 4A), Nrf-2 (Fig. 4C), and MAPK2 (Fig. 4D) mRNA genes compared with the control (Po 0.05). However, VCH at all the concentrations tested did not alter catalase mRNA gene expression (Fig. 4B) compared with the control (P 40.05).

ROS levels increased in D. melanogaster exposed to VCH

Fig. 5. ROS production in D. melanogaster exposed to 10 mM, 100 mM, and 1 mM 4- vinylcyclohexene for 5 days. Data are presented as mean 7 SEM of three independent biological replicates carried out in duplicates. Each assay was carried out in three independent experiments. nPo 0.05 vs control.

VCH (10 and 100 mM) caused significant increases in DCF fluorescence in the flies when compared with control in the flies (P o0.05, Fig. 5). There was an increase in DCF fluorescence in the homogenates of flies treated with 1 mM VCH in comparison to the control; however, it was not statistically significant (P 40.05, Fig. 5).

Changes in total thiols and antioxidant enzyme activities after 5 days of exposure of D. melanogaster to VCH Due to the increase in the levels of ROS production following VCH treatment, we decided to evaluate selected antioxidants such as GST, total thiols, and catalase. VCH at concentrations of 10 mM and 1 mM caused a significant (Po0.05) decrease in GST activity in the flies, when compared with the control (Fig. 6A). The levels of total thiols in all the VCH-exposed flies were not significantly different when compared with the ethanol control (P40.05, Fig. 6B). Catalase activity was significantly enhanced in flies exposed to 100 mM and 1 mM VCH concentrations compared with the control (P o0.05, Fig. 6C), while no change was noted at 10 mM VCH (P 40.05).

Fig. 6. Changes in antioxidant enzymes activities after 5 days of oral exposure of D. melanogaster to 4-vinylcyclohexene. (A) GST activity, (B) total thiols levels and CAT activity after exposure of flies to 10 mM, 100 mM, and 1 mM 4- vinylcyclohexene. Data are presented as mean þSEM of three independent biological replicates carried out in duplicates. Each assay was carried out in three independent experiments. nPo 0.05 vs control.

Fig. 7. δ-ALA-D and acetylcholinesterase activity after 5 days of exposure of 4-vinylcyclohexene in D. melanogaster. (A) δ-ALA-D and (B) acetylcholinesterase levels after exposure of flies to 10 mM, 100 mM, and 1 mM 4- vinylcyclohexene. Data are presented as mean þSEM of three independent biological replicates carried out in duplicate. nP o 0.05 vs control.

A. Olalekan Abolaji et al. / Free Radical Biology and Medicine 71 (2014) 99–108

Five days of exposure to VCH in D. melanogaster was accompanied by inhibitions of δ-ALA-D and AChE activities The activities of δ-ALA-D, which is involved in heme synthesis and is a potential marker of oxidative stress [37], and AChE were investigated after exposure of flies to VCH for 5 days. VCH at concentration of 100 mM significantly inhibited δ-ALA-D activity in relation to the control (P o0.05, Fig. 7A). Similarly, AChE activity was significantly depleted in flies exposed to 100 mM and 1 mM VCH concentrations when compared with the control group (P o0.05, Fig. 7B).

Discussion Exposures to industrial environmental toxicants have been reported to cause oxidative stress and changes in gene expressions in experimental models [23,38,39]. In the present study, 4-vinylcyclohexene, an ovotoxic and carcinogenic agent [40], was used for the first time to investigate whether its exposure was accompanied by oxidative stress using D. melanogaster as a model. Indeed, about 75% of human disease-causing genes have functional homology in D. melanogaster, and therefore, it is being used as a model in toxicological studies [41–43]. Our data demonstrated that 5 days exposure of VCH to D. melanogaster caused inductions of SOD, Nrf-2, and MAPK2 mRNA gene expressions, increased ROS production, altered the levels of antioxidant enzymes, and inhibited δ-ALA-D and AChE activities. Although there were no studies involving exposure of VCH in flies, the concentrations investigated here covered a wide range of concentrations (2 to 3 orders of magnitude). Consequently, the wide range of exposure used here may have some overlapping or equivalence with the previous doses of VCH used in rodents. Indeed, in the literature, doses ranging from 50 to 5000 mg/kg have been used in rats and mice (normally administered by gavage) for different durations in toxicological and carcinogenic studies [1,5,9,44]. In this study, VCH caused increased production of reactive oxygen/nitrogen species (ROS/RNS) after 5 days of exposure in the flies. ROS such as superoxide (O2 –), hydrogen peroxide (H2O2), and hydroxyl radical (HO  ) are constantly being generated in all aerobic organisms [45]. Particularly, the O2 – generated by the mitochondria is dismutated to H2O2 by superoxide dismutase (SOD). The H2O2, in turn, can react with Fe2 þ via Fenton reaction, to produce HO  , a strong reactive oxidant [45]. Cellular antioxidants protect the cells by neutralizing ROS [46,47]. Although ROS plays a central role in a variety of biological processes, such as intracellular signaling [48], elevated intracellular buildup of ROS concentrations, as a result of exposure to environmental toxicants, can induce oxidative damage in cellular macromolecules such as nucleic acids, proteins, lipids, and carbohydrates [45,49]. The results obtained here demonstrated an increase in ROS production caused by VCH, indicating that VCH exposure in the flies induced oxidative stress, as a result of the imbalance between ROS production and the cellular antioxidant defense capacity [50]. Due to the VCH-induced accumulation of ROS, we determined the levels of mRNA of nuclear factor erythroid 2-related factor 2 (Nrf-2) and mitogen-activated protein kinase 2 (MAPK2) genes. In cellular defense, Nrf-2 is a redox-sensitive transcription factor that plays a central role against a vast variety of exogenous and endogenous electrophilic damaging substances, including those formed during oxidative stress. Nrf-2 is a master switch that upregulates the expression of several oxidative stress response proteins [51]. The role of Nrf-2-induced protection of the ovary against VCD exposure has been demonstrated in mice. In this case, Nrf-2 null mice exposed to VCD exhibited an age-dependent decline in fertility following 30 weeks of age, and prevent the

105

basal and inducible expressions of microsomal epoxide hydrolase (mEH), an important enzyme involved in the detoxification of VCD, thereby increasing oxidative stress in cells which was worsened by VCD exposure [52]. Here, VCH caused the induction of Nrf-2 mRNA gene expression after 5 days of exposure in the flies. In the absence of oxidative stress, Nrf-2 activity is repressed by kelch-like erythroid-derived cap-n-collar (CNC) homology (ECH)-associated protein 1 (keap1), which is a sensor of oxidative stress. Nrf-2 activation therefore, as observed in this study, could be due to the oxidative or covalent modification of key sensor cysteine residues in Keap1 by ROS [53]. In this case, the interaction of Keap1 with Nrf-2 is disrupted, leading to the liberation of Nrf-2 from Keap1, and its eventual migration to the nucleus, where it binds to the antioxidant response elements (ARE) to induce the transcription of target genes [54,55], such as SOD and MAPK2 as indicated in this study. In addition, we investigated the mRNA level of MAPK2, since MAPKs are involved in the activation of Nrf-2. MAPKs are apoptotic signaling regulatory proteins that are induced in response to ROS [56]. They are activated by upstream phosphorylations via MAPK kinases (MAPKKs) [57]. After their activation, MAPKs regulate gene expression through the phosphorylation of downstream transcription factors such as activator protein-1 (AP-1) which interacts with regulatory DNA sequences known as AP-1 sites [58]. The elevated level of MAPK2 mRNA gene expression as reported in this study further supports the fact that VCH induced oxidative stress in the flies. Indeed, daily repeated dosing of rats with VCD has been shown to selectively induce the activation of MAPKs in small preantral ovarian follicles [59]. In order to further understand the mechanism of toxicity of VCH, we determined the mRNA levels of selected heat shock proteins, catalase, and SOD genes. Heat shock response is induced in a protective way through a nonspecific mechanism of toxicity that involves alteration of cellular functions and generation of abnormal proteins [60]. Under such conditions, heat shock protein induction is often related to early cellular reversible toxicity [61]. In the present study, VCH exposure in flies failed to induce HSP27, HSP70, and HSP83 as well as catalase mRNA gene expressions after 5 days of exposure. One explanation for this could be that these genes were not affected at the transcriptional level, but possibly at the posttranslational level. Here, we did not determine the levels of proteins expressed by the mRNA of these genes, which is a limitation of this study; however, the increased activity of catalase enzyme suggests posttranslational modification of this specific antioxidant enzyme. Similarly, there is the possibility that these heat shock proteins might be modified following translation of their mRNA, particularly because they can be induced in response to oxidative stress [32]. On the other hand, the up-regulation of the SOD mRNA gene noted in this study could be a compensatory response to VCD-induced oxidative insult due to increased production of ROS, a phenomenon observed in other situations associated with oxidative stress [62]. Further, we sought to find out whether VCH affects the activities of antioxidant enzymes catalase and GST, as well as total thiol level. During the metabolism of environmental toxicants, SOD is an important line of defense against oxidative stress. In the current study, we did not investigate the activity of SOD because we could not obtain reliable results for SOD in fly homogenate supernatants (data not shown). However, the overexpression of the mRNA of SOD gene as reported in this study might have caused an increase in the activity of the SOD in response to ROS overproduction in the flies. However, since the mRNA level of a given protein may not necessarily mirror its functional activity, the interpretation of this requires caution (see, for instance, the absence of change in catalase mRNA and the increase in enzyme activity observed in this study).

106

A. Olalekan Abolaji et al. / Free Radical Biology and Medicine 71 (2014) 99–108

Further, following the conversion of O2  to H2O2, catalase and glutathione peroxidase metabolize H2O2 to water and molecular oxygen. The unaltered mRNA level of the catalase gene suggests that the observed increase in its activity is not likely due to altered transcription. Similar reports of altered catalase activity without corresponding alteration in mRNA expression have been reported in the literature. For instance, in the lungs of newborn rats under hyperoxia conditions, increase in catalase activity was ascribed to an increase in mRNA stabilization rather than increase in transcription [63]. Additionally, in the small intestine of diabetic rats, an increase in catalase activity without a change in its mRNA level was attributed to lack of regulation at the transcriptional level [64]. Thus, the increased activity of catalase can be associated with posttranslational modifications in response to oxidative stress [65] as indicated above. GSTs are classified as a family of phase II detoxification enzymes that catalyze the conjugation of glutathione to the electrophilic centers of exogenous and endogenous electrophiles [66,67]. Indeed, GSTs also function in the regulations of an array of cellular processes involved in the intrinsic ability of cell survival to oxidative stress and genotoxic agents. Here, we observed reduction in total GST activity, suggesting that the phase II detoxification system was not activated under our experimental conditions. However, since GST has different isoforms, perhaps, some specific isoforms could be increased, while others decrease, which eventually resulted in a net reduction in total GST activity. The VCD-induced reduction in total GST activity, therefore, might imply impaired capacity of the flies to completely detoxify VCH. This may be the reason for the mortality recorded in our study after the 28 days of exposure to VCH. In this case, once the phase I detoxification system converts VCH to reactive species, a decrease in the activity of GST may lead to their accumulation. In the ovary, through a CYP2E1 metabolizing system, VCH is converted directly to VCD, which is then detoxified by microsomal epoxide hydrolase [12,13,68] (Scheme 1). GST can also conjugate GSH with VCD; however, VCD-SG adduct cannot be regarded as an inactive product of VCD detoxification processes. Indeed, the vinyl epoxide moiety of VCD-SG adduct could transfer VCD to other thiol-containing proteins, thereby inactivating the native function of chemically altered protein (see, for instance, the inhibition of ALA-D noted in this study). Our data are in agreement with a report of decreased activity of GST after long-term exposure of rats to VCH [69], and this might be one of the mechanisms responsible for the ovotoxic effect of VCH. Further, early up-regulation of GST may occur after VCD insult. For instance, previous studies revealed that in cultured mouse ovaries, the mRNA encoding the GST isoforms mu (GSTm) and pi (GSTp) were enhanced following VCD exposure [68]. Similarly, GSTp mRNA and protein increased in response to VCD in cultured rat ovaries after 4-8 days of exposure [70]. Thus, these studies suggest that VCD-induced increases in GST isoforms promote the conjugation of GSH with VCD and therefore help to protect the ovary from apoptosis through a process of adaptive response. In these states, GSTp [71] and GSTm [72] act as negative regulators of apoptosis in the ovary by binding to c-Jun N-terminal kinases (JNKs) and apoptosis signal-regulating kinase 1 (ASK1), respectively. During conditions of stress as observed here, these complexes dissociate to release JNK and ASK1 [70,73]. ASK1, a mitogen-activated protein kinase kinase kinase (MAPKKK), then activates JNK and p38 MAPK signaling pathways. Consequently, proapoptotic JNK increases, leading to ovotoxicity [70]. Therefore, repeated exposure to VCD could eventually overwhelm the inductions of GST isoforms, and thereby results in reduced detoxification capacity of GST at the onset of toxicity [68]. This may be the reason for the observed decrease in the activity of GST as reported in our study. Despite the reduction in GST activity, VCH did not disrupt the total thiols redox circuit in the flies. This is similar to the study of Devine et al. [74] in which GSH levels were not changed in the ovaries of immature rats exposed once or daily to VCD (0.57 mmol/kg, ip) for 15 days.

Scheme 2. The active site of δ-aminolevulinate dehydratase (δ-ALA-D) indicating three thiol groups of cysteine that coordinate Zn (II) ions (modified from [37]).

Due to the reported ovotoxic effect of VCH, and the hypothalamuspituitary-ovarian axis connection, we further investigated selected neurotoxic markers in flies such as the negative geotaxis and AChE activity. Of note, the flies exhibited impaired climbing behavior and reduced activity of AChE after 5 days of treatment. AChE is an essential enzyme in the nervous system of insects in which the cholinergic transmission of impulses is involved. It terminates nerve impulses by catalyzing the hydrolysis of acetylcholine, which is an excitatory neurotransmitter at synapses in the insect nervous system [75,76]. Consequently, a change in AChE activity could compromise the normal motor activity of the flies, which was detected here by the impairments in negative geotaxic behavior. Thus, inhibition of AChE results in the accumulation of acetylcholine causing overstimulation of the acetylcholine receptors [76]. Of particular importance, the reported ovotoxicity of VCH may be associated with impairment of neurological functions [77], but a link between neurotoxicity and ovotoxicity must be better characterized. Our study also indicated that VCH (100 mM) inhibited δaminolevulinate dehydratase. To confirm whether the VCH-induced inhibitions of δ-ALA-D and AChE were related to cell death, we carried out the MTT (3-[4,5–dimethylthiazol–2–yl]-2,5 diphenyl tetrazolium bromide) assay (data not shown). Based on the results of the MTT assay, it seems that the decreases in the activities of AChE and δ-ALAD were not related to cell death. The δ-ALA-D is a metalloenzyme containing 3 thiol groups in its active site that coordinates Zn(II) ions (Scheme 2). It catalyzes the asymmetric condensation of two aminolevulinic acid (δ-ALA) molecules, to yield porphobilinogen, a heme precursor [78]. The spatial proximity of these thiol groups makes the enzyme particularly sensitive to oxidation [79,80]. This implies that agents such as epoxides, which have high reactivity toward nucleophilic centers, such as thiol groups, can inhibit δ-ALA-D [37,79,80]. Thus, VCH-induced inhibition of δ-ALA-D can be due to the interaction between the epoxide metabolites of VCH and the thiol groups of δALA-D. Alternatively, the adduct VCD-SG could also exchange VCD with the free thiol groups of the enzyme resulting in free GSH and oxidized enzyme. This inhibition might impair heme biosynthesis [22], and consequently lead to the accumulation of δ-ALA. Indeed, δ-ALA possesses prooxidant activity, and it can disrupt aerobic metabolic processes [79–82]. This implies that VCH-induced accumulation of δ-ALA, due to the inhibition of δ-ALA-D, might exacerbate the oxidative stress reported in this study [81]. In conclusion, we evidenced the involvement of oxidative stress in VCH-induced toxicity, which was associated with alteration in the oxidative stress-antioxidant balance in flies. Moreover, VCH-induced neurotoxicity was evidenced by AChE inhibition and negative geotaxic behavioral impairments. Taken together, our results offer new perspectives on the mechanism of VCH toxicity using D. melanogaster as a model. Future studies should be focused on the direct toxicity studies of VCH metabolites, VCM, and VCD in flies.

Conflict of interest The authors declare that there is no conflict of interest associated with this study.

A. Olalekan Abolaji et al. / Free Radical Biology and Medicine 71 (2014) 99–108

Acknowledgments A.A.O. thanks TWAS-CNPq for financial support. A.A.O. is a beneficiary of the TWAS-CNPq 2012 Postdoctoral Fellowship. This study was supported by CNPq, CAPES, FAPERGS, FAPERGS-PRONEX, FAPERGS-PRONEX-CNPq, VITAE Fundation, Rede Brasileira de Neurociências (IBNET-FINEP), FINEP-CTINFRA, INCT-CNPq for Excitotoxicity and Neuroprotection and CNPQ-Institute for Excitotoxicity and Neuroprotection. References [1] Huff, J. Carcinogenicity bioassays of bisphenol A, 4-vinylcyclohexene diepoxide, and 4- vinycyclohexene. Toxicol. Sci. 64(2):282–283; 2001. [2] Bevan, C.; Stadler, J. C.; Elliott, G. S.; Frame, S. R.; Baldwin, J. K.; Leung, H. W.; Moran, E.; Panepinto, A. S. Subchronic toxicity of 4-vinylcyclohexene in rats and mice by inhalation exposure. Fundam. Appl. Toxicol. 32:1–10; 1996. [3] Bhattacharya, P.; Keating, A. Impact of environmental exposures on ovarian function and role of xenobiotic metabolism during ovotoxicity. Toxicol. Appl. Pharmacol. 261:227–235; 2012. [4] Smith, B. J.; Mattison, D. R.; Sipes, I. G. The role of epoxidation in 4vinylcyclohexene-induced ovarian toxicity. Toxicol. Appl. Pharmacol. 105: 372–381; 1990. [5] Hooser, S. B.; Douds, D. P.; DeMerell, D. G.; Hoyer, P. B.; Sipes, I. G. Long-term ovarian and gonadotropin changes in mice exposed to 4-vinylcyclohexene. Reprod. Toxicol. 8:315–323; 1994. [6] Mayer, L. P.; Pearsall, N. A.; Christian, P. J.; Devine, P. J.; Payne, C. M.; McCuskey, M. K.; Marion, S. L.; Sipes, I. G.; Hoyer, P. B. Long-term effects of ovarian follicular depletion in rats by 4-vinylcyclohexene diepoxide. Reprod. Toxicol. 16:775–781; 2002. [7] Bhattacharya, P.; Keating, A. F. Ovarian metabolism of xenobiotics. Exp. Biol. Med. 236(7):765–771; 2011. [8] Kappeler, C. J.; Hoyer, P. B. 4-Vinylcyclohexene diepoxide: a model chemical for ovotoxicity. Syst. Biol. Reprod. Med. 58(1):57–62; 2012. [9] Doerr, J. K.; Hooser, S. B.; Smith, B. J.; Sipes, I. G. Ovarian toxicity of 4vinylcyclohexene and related olefins in B6C3F1 mice: role of diepoxides. Chem. Res. Toxicol. 8:963–969; 1995. [10] Doerr-Stevens, J. K.; Liu, J.; Stevens, G. J.; Kraner, J. C.; Fontaine, S.; Halpert, M.; Sipes, J. R. Induction of cytochrome P450 enzymes after repeated exposure to 4-vinylcyclohexene in B6C3F1 mice. Drug Metab. Dispos. 27:281–287; 1999. [11] Rajapaksa, K. S.; Sipes, I. G.; Hoyer, P. B. Involvement of microsomal epoxide hydrolase enzyme in ovotoxicity caused by 7,12-dimethylbenz[a]anthracene. Toxicol. Sci. 96:327–334; 2007. [12] Cannad, E. A.; Dyer, C. A.; Christian, P. J.; Sipes, I. G.; Hoyer, P. B. Expression and activity of microsomal epoxide hydrolase in follicles isolated from mouse ovaries. Toxicol. Sci. 68(1):24–31; 2002. [13] Chiappe, C.; De Rubertis, A.; De Carlo, M.; Amato, G.; Gervasi, P. G. Stereochemical aspects in the 4-vinylcyclohexene biotransformation with rat liver microsomes and purified p450s monoepoxides and diols. Chem. Res. Toxicol. 14(5):492–499; 2001. [14] Rajapaksa, K. S. The role of ovarian metabolism in 4-vinylcyclohexene metabolites and 7, 12-dimethylbenz[a]anthracene-induced ovotoxicity in mice. Department of Physiology, University of Arizona. Dissertation, 2007. [15] Saeidnia, S.; Abdollahi, M. Toxicological and pharmacological concerns on oxidative stress and related diseases. Toxicol. Appl. Pharmacol. 273(3): 442–455; 2013. [16] Bullon, P.; Newman, H. N.; Battino, M. Obesity, diabetes mellitus, atherosclerosis and chronic periodontitis: a shared pathology via oxidative stress and mitochondrial dysfunction? Periodontology 2000(64):1; 2014139-153 2000 (64); 2014. [17] Saeidnia, S. Anti-oxidative trypanocidal drugs, myth or reality. Daru 21(1):21; 2013. [18] Rizzo, A.; Roscino, M. T.; Binetti, F.; Sciorsci, R. L. Roles of reactive oxygen species in female reproduction. Reprod. Domest. Anim. 47(2):344–352; 2012. [19] Festing, M. F. W.; Baumans, V.; Combes, D. R.; Halder, M.; Hendriksen, F. M.; Howard, B. R.; Lovell, D. P.; Moore, G. J.; Overend, P.; Wilson, M. S. Reducing the use of laboratory animals in biomedical research: problems and possible solutions. Altern. Lab. Anim 26:283–301; 1998. [20] Singh, M. P.; Reddy, M. M. K.; Mathur, N.; Saxena, D. K.; Kar, C. D. Induction of hsp70, hsp60, hsp83 and hsp26 and oxidative stress markers in benzene, toluene and xylene exposed Drosophila melanogaster: role of ROS generation. Toxicol. Appl. Pharmacol. 235:226–243; 2009. [21] Feany, M. B.; Bender, W. W. A Drosophila model of Parkinson's disease. Nature 404:394–398; 2000. [22] Golombieski, R. M.; Graichen, D. A. S.; Pivetta, L. A.; Nogueira, C. W.; Loreto, E. L. S.; Rocha, J. B. T. Diphenyl diselenide [(PhSe)2] inhibits Drosophila melanogaster δ-aminolevulinate dehydratase (δ-ALA-D) gene transcription and enzyme activity. Comp. Biochem. Physiol. C 147:198–204; 2008. [23] Sudati, J. H.; Vieira, F. A.; Pavin, S. S.; Dias, G. R. M.; Seeger, R. L.; Golombieski, R.; Athayde, M. L.; Soares, F. A.; Rocha, J. B. T.; Barbosa, N. V. Valeriana officinalis attenuates the rotenone-induced toxicity in Drosophila melanogaster. Neurotoxicology 37:118–126; 2013.

107

[24] Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 5 4 (402-408):2001; 2001. [25] Perez-Severiano, F.; Santamaria, A.; Pedraza-Chaverri, J.; Medina-Campos, O. N.; Rios, C.; Segovia, J. Increased formation of reactive oxygen species, but no changes in glutathione peroxidase activity, in striata of mice transgenic for the Huntington's disease mutation. Neurochem. Res. 29(4):729–733; 2004. [26] Ellman, G. L. Tissue sulfhydryl groups. Arch. Biochem. Biophys. 82:70–77; 1959. [27] Habig, W. H.; Jakoby, W. B. Assays for differentiation of glutathione-Stransferases. Methods Enzymol. 77:398–405; 1981. [28] Aebi, H. Catalase in vitro. Methods Enzymol. 105:121–126; 1984. [29] Ellman, G. L.; Courtney, K. D.; Andres Jr V.; Feathers-Stone, R. M. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7:88–95; 1961. [30] Sassa, S. Delta-aminolevulinic acid dehydratase assay. Enzyme 28(2-3):133–145; 1982. [31] Lowry, O. H.; Rosebrough, N. J.; Farr, A. L.; Randall, R. J. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193(1):265–275; 1951. [32] Velichko, A. K.; Markova, E. N.; Petrova, N. V.; Razin, S. V.; Kantidze, O. L. Mechanisms of heat shock response in mammals. Cell Mol. Life Sci. 70 (22):4229–4241; 2013. [33] Jaattela, M.; Wissing, D.; kokholm, K.; Kalunki, T.; Egeblad, M. Hsp70 has been reported to protect against apoptosis in the face of activated caspase-3 activity in an overexpressing WHEI-S cell line. EMBO J. 17:6124–6134; 1998. [34] Golombieski, R. M.; Graichen, D. A. S.; Rocha, J. B. T.; Valente, V. L.; Loreto, E. L. Over-activation of the Drosophila melanogaster hsp83 gene by selenium intoxication. Genet. Mol. Biol. 31:128–135; 2008. [35] Son, Y.; Kim, S; Chung, H. T.; Pae, H. O. Reactive oxygen species in the activation of MAP kinases. Methods Enzymol. 528:27–48; 2013. [36] Niture, S. K.; Khatri, R.; Jaiswal, A. K. Regulation of Nrf2-an update. Free Radic. Biol. Med. 66:36–44; 2014. [37] Rocha, J. B. T.; Rogerio, A. S.; Garcia, S. C.; Gravina, F. S.; Nogueira, C. W. Aminolevulinate dehydratase (δ-ALA-D) as marker protein of intoxication with metals and other pro-oxidant situations. Toxicol. Res 1:85; 2012. [38] Fonnum, F.; Mariussen, E. Mechanisms involved in the neurotoxic effects of environmental toxicants such as polychlorinated biphenyls and brominated flame retardants. J. Neurochem. 111(6):1327–1347; 2009. [39] Kim, H. L.; Seo, Y. R. Molecular and genomic approach for understanding the gene-environment interaction between Nrf2 deficiency and carcinogenic nickel-induced DNA damage. Oncol. Rep. 28(6):1959–1967; 2012. [40] International Agency for Research on Cancer. 4-Vinylcyclohexene. In: IARC monographs on the evaluation of carcinogenic risks to humans: some industrial chemicals, volume 60. Lyon, France: IARC: 347–359; 1994. [41] Rand, M. D. Drosophotoxicology: the growing potential for Drosophila in neurotoxicology. Neurotoxicol. Teratol. 32:74–83; 2010. [42] Abolaji, A. O.; Kamdem, J. P.; Farombi, E. O.; Rocha, J. B. T. Drosophila melanogaster as a promising model organism in toxicological studies. Arch. Bas. App. Med 1:33–38; 2013. [43] Paula, M. T.; Zemolin, A. P.; Vargas, A. P.; Golombieski, R. M.; Loreto E.L.S.; Saidelles, A.P.; Picoloto, R.S.; Flores, E.M.M.; Pereira, A.B., Rocha, J.B.T.;. Merritt, T.J.S; Franco J. L.; Posser, T.Effects of Hg(II) exposure on MAPK phosphorylation and antioxidant system in D. melanogaster. Environ. Toxicol. 2012. 10.1002/tox. [44] N. T. P. Toxicology and carcinogenesis studies of 4-vinylcyclohexene (CAS No. 100-40-3) in F344/N rats and B6C3F1 mice (gavage studies). Natl. Toxicol. Program Tech. Rep. Ser 303:1–190; 1986. [45] Farina, M.; Avila, D. S.; Rocha, J. B. T.; Aschner, M. Metals, oxidative stress and neurodegeneration: a focus on iron, manganese and mercury. Neurochem. Int. 62:575–594; 2013. [46] Hatem, E.; Veronique, B.; Michele, D.; Gilles, L.; Peggy, B.; Meng-Er, H.; Jean, L.; Stephane, C. Glutathione is essential to preserve nuclear function and cell survival under oxidative stress. Free Radic. Biol. Med. 67:103–114; 2014. [47] Shenton, D.; Smirnova, J. B.; Selley, J. N.; Carroll, K.; Hubbard, S. J.; Pavitt, G. D.; Ashe, M. P.; Grant, C. M. Global translational responses to oxidative stress impact upon multiple levels of protein synthesis. J. Biol. Chem. 281:29011–29021; 2006. [48] Mascarenhas, C.; Edwards-Ingram, L. C.; Zeef, L.; Shenton, D.; Ashe, M. P.; Grant, C. M. Gcn4 is required for the response to peroxide stress in the yeast Saccharomyces cerevisiae. Mol. Biol. Cell 19:2995–3007; 2008. [49] Klaunig, J. E.; Kamendulis, L. M.; Hocevar, B. A. Oxidative stress and oxidative damage in carcinogenesis. Toxicol. Pathol. 38:96–109; 2010. [50] Murphy, M. P. How mitochondria produce reactive oxygen species. Biochem. J. 417:1; 2009. [51] Naa, H.; Surh, Y. Oncogenic potential of Nrf2 and its principal target protein heme oxygenase-1. Free Radic. Biol. Med. 67:353–365; 2014. [52] Hu, X.; Roberts, J. R.; Apopa, P. L.; Kan, Y. W.; Ma, Q. Accelerated ovarian failure induced by 4-vinylcyclohexene diepoxide in Nrf2 Null Mice. Mol. Cell. Biol. 26:940–954; 2006. [53] Zhang, D. D.; Hannink, M. Distinct cysteine residues in Keap1 are required for Keap1-dependent ubiquitination of Nrf2 and for stabilization of Nrf2 by chemopreventive agents and oxidative stress. Mol. Cell. Biol. 23:8137–8151; 2003. [54] Jyrkkanen, H. K.; Kuosmanen, S.; Heinaniemi, M.; Laitinen, H.; Kansanen, E.; Mella-Aho, E.; Leinonen, H.; Yla-Herttuala, S.; Levonen, A. L. Novel insights into the regulation of antioxidant-response-element-mediated gene expression by electrophiles: induction of the transcriptional repressor BACH1 by Nrf2. Biochem. J. 440:167–174; 2011.

108

A. Olalekan Abolaji et al. / Free Radical Biology and Medicine 71 (2014) 99–108

[55] Maher, J.; Yamamoto, M. The rise of antioxidant signalling—the evolution and hormetic actions of Nrf2. Toxicol. Appl. Pharmacol. 244(1):4–15; 2010. [56] Breton-Romero, R.; de Orduna, C. G.; Francisco, N.; Sanchez-Gomez, J.; de Alvaro, C.; Porras, A.; Rodriguez-Pascual, F.; Laranjinha, J.; Radi, R.; Lamas, S. Activation of p38 MAPK by oxidative stress underlying epirubicin-induced vascular endothelial cell injury. Free Radic. Biol. Med. 52:1093–1100; 2012. [57] Whitmarsh, A. J.; Davis, R. J. Transcription factor AP-1 regulation by mitogenactivated protein kinase signal transduction pathways. J. Mol. Med. 74: 589–607; 1996. [58] Angel, P.; Imagawa, M.; Chiu, R.; Stein, B.; Imbra, R. J.; Rahmsdorf, H. J.; Jonat, C.; Herrlich, P.; Karin, M. Phorbol ester-inducible genes contain a common cis elementrecognized by a TPA-modulated trans-acting factor. Cell 49:729–739; 1987. [59] Hu, X.; Christian, P.; Sipes, I. G.; Hoyer, P. B. Expression and redistribution of cellular Bad, Bax, and Bcl-X(L) protein is associated with VCD-induced ovotoxicity in rats. Biol. Reprod. 65:1489–1495; 2001. [60] Hightower, L. E. Heat shock, stress proteins, chaperones, and proteotoxicity. Cell 66:191–197; 1991. [61] Goering, P. L.; Fisher, B. R.; Kish, C. L. Stress protein synthesis induced in rat liver by cadmium precedes hepatotoxicity. Toxicol. Appl. Pharmacol. 22(139148):1993; 1993. [62] Sharma, S.; Dewald, O.; Adrogue, J.; Salazar, R. L.; Razeghi, P.; Crapo, J. D.; Bowler, R. P.; Entman, M. L.; Taegtmeyer, H. Induction of antioxidant gene expression in a mouse model of ischemic cardiomyopathy is dependent on reactive oxygen species. Free Radic. Biol. Med. 40; 2006. (2223-2223). [63] Clerch, L. B.; Massaro, D. Oxidation–reduction sensitive binding of lung proteins to rat catalase mRNA. J. Biol. Chem. 267:2585–2853; 1992. [64] Bhor, V. M.; Raghuram, N.; Sivakami, S. Oxidative damage and altered antioxidant enzyme activities in the small intestine of streptozotocininduced diabetic rats. Int. J. Biochem. Cell Biol. 36:89–97; 2004. [65] Cao, C.; Leng, Y.; Kufe, D. Catalase activity is regulated by c-Abl and Arg in the oxidative stress response. J. Biol. Chem. 278:29667–29675; 2003. [66] Hayes, J. D.; Flanagan, J. U.; Jowsey, I. R. Glutathione transferases. Annu. Rev. Pharmacol. Toxicol. 45:51–88; 2005. [67] Coles, B. F.; Chen, G.; Kadlubar, F. F.; Radominska-Pandya, A. Inter-individual variation and organ-specific patterns of glutathione S-transferase alpha, mu, and pi expression in gastrointestinal tract mucosa of normal individuals. Arch. Biochem. Biophys. 403:270–276; 2002. [68] Keating, A. F.; Rajapaksa, K. S.; Sipes, I. G.; Hoyer, P. B. Effect of CYP2E1 gene deletion in mice on expression of microsomal epoxide hydrolase in response to VCD exposure. Toxicol. Sci. 105(2):351–359; 2008.

[69] Rajapaksa, K. S.; Cannady, E. A.; Sipes, I. G.; Hoyer, P. B. Involvement of CYP 2E1 enzyme in ovotoxicity caused by 4-vinylcyclohexene and its metabolites. Toxicol. Appl. Pharmacol. 221:215–221; 2007. [70] Keating, A. F.; Sen, N.; Sipes, I. G.; Hoyer, P. B. Dual protective role for glutathione S-transferase class pi against VCD-induced ovotoxicity in the rat ovary. Toxicol. Appl. Pharmacol. 247:71–75; 2010. [71] Yu, S. T.; Chen, T. M.; Chern, J. W.; Tseng, S. Y.; Chen, Y. H. Downregulation of GSTπ expression by tryptanthrin contributing to sensitization of doxorubicinresistant MCF-7 cells through c-jun NH2-terminal kinase mediated apoptosis. Anti-cancer Drugs 20:382–388; 2009. [72] Cho, S. G.; Lyy, Y. H.; Park, H. S.; Ryoo, K.; Kang, K. W.; Park, J.; Eom, S. J.; Kim, M. J.; Chang, T. S.; Choi, S. Y.; Shim, J.; Kim, Y.; Dong, M. S.; Lee, M. J.; Kim, S. G.; Ichijo, H.; Choi, E. J.. Glutathione S-transferase mu modulates the stressactivated signals by suppressing apoptosis signal-regulating kinase 1. J. Biol. Chem. 276:12749–12755; 2001. [73] Bhattacharya, P.; Madden, J. A.; Sen, N.; Hoyer, P. B.; Keating, A. F. Glutathione S-transferase class mu regulation of apoptosis signal-regulating kinase 1 protein during VCD-induced ovotoxicity in neonatal rat ovaries. Toxicol. Appl. Pharmacol. 267:49–56; 2013. [74] Devine, P. J.; Sipes, I. G.; Hoyer, P. B. Effect of 4-vinylcyclohexene diepoxide dosing in rats on GSH levels in liver and ovaries. Toxicol. Sci. 62(2):315–320; 2001. [75] Gepner, J. I.; Hall, L. M.; Sattelle, D. B. Insect acetylcholine receptors as a site of insecticide action. Nature 276:188–190; 1978. [76] Charpentier, A.; Fournie, D. Levels of total acetylcholinesterase in Drosophila melanogaster in relation to insecticide resistance. Pestic. Biochem. Phys 70:100–107; 2001. [77] Haas, J. R.; Christian, P. J.; Hoyer, P. B. Effects of impending ovarian failure induced by 4-vinylcyclohexene diepoxide on fertility in C57BL/6 female mice. Comp. Med 57:443–449; 2007. [78] Jaffe, E. K. Porphobilinogen synthase, the first source of heme's asymmetry. J. Bioenerg. Biomembr. 27(169-179):1995; 1995. [79] Nogueira, C. W.; Zeni, G; Rocha, J. B. T. Organoselenium and organotellurium compounds: toxicology and pharmacology. Chem. Rev. 104(12):6255–6286; 2004. [80] Saraiva, R. A.; Bueno, D. C.; Nogara, P. A.; Rocha, J. B. Molecular docking studies of disubstituted diaryl diselenides as mammalian δ-aminolevulinic acid dehydratase enzyme inhibitors. J. Toxicol. Environ. Health A 75(16-17): 1012–1022; 2012. [81] Bechara, E. J. H.; Medeiros, M. H. G.; Monteiro, H. P.; Hermes-Lima, M.; Pereira, B.; Demasi, M.; Costa, C. A.; Adballa, D. S. P.; Onuki, J.; Wendel, C. M. A.; Masci, P. D. A free radical hypothesis of lead poisoning and inborn porphyrias associated with 5-aminolevulinic acid overload. Quim. Nova 16:385–392; 1993.